P53 Gene Mutations in Colorectal Tumors from Patients with Familial Polyposis Coli1

(CANCER RESEARCH 51, 2874-2878. June I. 1991] p53 Gene Mutations in Colorectal Tumors from Patients with Familial Polyposis Coli1

Senji Shirasawa, Kazunori Urabe, Yuchio Yanagawa, Koji Toshitani, Takeo Iwama, and Takehiko Sasa/ukr Department of Genetics, Medical Institute of Bioregulation, Kyushu L'niversity, 3-1-1 \iaidashi, Higashi-ku, h'ukuoka 812 [S. S.. K. U., Y. Y.t K. T., T. SJ, and The Research Center for Polyposis and Intestinal Disease, Tokyo Medical and Dental L'niversity, Yushima, Hunkyo-ku, Tokyo Ili Â¡T././, Japan

ABSTRACT of chromosome 17p, since mutation of the remaining p53 gene was a frequent occurrence (17,18). The p5i gene has been elucidated as a tumor suppressor gene, and p53 was first identified as a cellular protein present in com Â¡nactivationofthis gene caused by deletion or point mutations may play plex with the SV40 early-region encoded T-antigen protein (19, a crucial role in the development of human malignancies. In colorectal carcinomas with an allelic deletion of the p53 gene, the remaining pSi 20). Although the p53 gene was originally considered to be an oncogene, several recent reports have indicated that the wild- gene was mutated with considerable frequency. It is most difficult to detect point mutations or small deletions of the gene because the muta type gene product actually functions as a tumor suppressor gene tions occur in diverse regions, although four hot spots have been observed (21, 22). Its mutations are clustered in four hot spots which |J. M. Nigro et al.. Nature (Lond.), 342:705-708,1989|. The polymerase coincide exactly with the most highly conserved regions of the chain reaction and denaturing gradient gel electrophoresis facilitate de gene among species (17). However, several mutations were tection of mutations in the hot spots of thep53 gene. Using these methods, found in different regions; therefore it is not easy to detect the we detected mutations in three adenomatous polyps and one carcinoma point mutations or small deletions of this gene. To search for from familial polyposis coli patients and three carcinomas of sporadic the mutations in this gene, we established the combined method cases. The DNA sequence analysis confirmed mutations of the p53 gene in 2 adenomas (13 base-pair deletions in one and a point mutation in the of PCR and denaturing gradient gel electrophoresis (23). PCR products about 300-500 base pairs long, differing by single other) and 1 carcinoma (point mutation) from familial polyposis coli base-pair substitutions or small deletions, were clearly separated patients. These results suggest that the p53 gene mutations may be involved in the formation not only of carcinomas but also of adenomas in the denaturing gel. Using these methods, we examined the which occur in familial polyposis coli patients. p53 gene mutations in colorectal tumors from patients with FPC. INTRODUCTION MATERIALS AND METHODS Familial polyposis coli is a single autosomal dominant dis order characterized by the onset of numerous colorectal ade Materials. We analyzed 75 primary colorectal tumor specimens from nomas early in life and progression to adenocarcinoma in 36 Japanese patients with FPC and 15 with NPCC. There were 45 adenomas from 34 patients with FPC, 15 carcinomas from 14 patients almost 100% of untreated patients. In general, adenomatous with FPC, and 15 carcinomas from 15 patients with NPCC. In addition polyps in the colon and rectum are thought to progress to adenocarcinoma not only in FPC' but also in cases of NPCC. to primary tumors, 3 kinds of carcinomas from 3 independent patients with FPC transplanted into nude mice were also examined. Correspond Therefore, FPC provides an excellent model for molecular ing normal colonie mucosae were obtained from each patient. All of analysis of oncogenesis, in which the accumulation of genetic these specimens were obtained at the time of surgery and were snap alterations of both DNA and chromosomes in a single cell is frozen in liquid nitrogen. involved. In colorectal carcinomas, genetic alterations include DNA Preparation. High-molecular-weight DNA was isolated from the activation of the K-ras gene (1-3), and allelic losses of surgical tumor specimens and/or their transplants into nude mice and chromosomes 5q, 14, 17p, 18q, and 22 (3-6) and deregulated the corresponding normal mucosae by the method of SDS-proteinase expression of the c-myc and c-fos genes are observed (7, 8). K and phenol/chloroform treatment (24). Allelic losses have been regarded as evidence that the affected RNA Preparation. RNA was extracted by the phenol/SDS method regions contain a tumor suppressor gene or genes (9, 10). The from 3 kinds of tumors transplanted into nude mice and separated from DNA by selective participation using LiCl, as described by Ausbcl et gene responsible for FPC (FPC gene) was localized on chro al. (25). mosome 5q by linkage studies (11, 12), and frequent allelic loss p53 cDNA Synthesis, Amplification, and Sequence. First-strand of chromosome 5q indicated that the FPC gene might be a cDNA was generated from 10 ^g of total RNA with p53-specific tumor suppressor gene. Recently, Fearon et al. (13) reported oligonucleotide primer P; (50 pmol) in the presence of reverse tran- that the target of allelic deletion of chromosome 18q was the scriptase at 42Â°Cfor 60 min in a 20-^1 reaction (26). The consecutive DCCgene which encodes a protein with a significant homology amplification of the p53 cDNA was performed by PCR, as described to the neural cell adhesion molecule. Allelic deletions of chro (27), using Tag polymerase instead of a Klenow fragment. The reaction mosome 17p are often found in human tumors, including those was performed in a total volume of 50 n\ with 10 /il of the cDNA of the breast (14), lung (15), and bladder (16). Recent evidence solution described above; primers P: and Pi at 100 pmol each in 42 suggests that \hep53 gene was likely to be the target of deletions niM K.C1;10 mM Tris, pH 8.3; 2.5 mivi MgCl2; 0.01% gelatin; dATP, dCTP, dGTP. and dTTP at 0.2 mMeach: and 2 units of Taq polymerase for 33 cycles of 95Â°Cdenaturation (1 min), 55Â°Cannealing (30 s), and Received 9/25/90: accepted 3/14/91. The costs of publication of this article were defrayed in part by the payment 72Â°Cextension (2 min) in a programmable heat block (DNA thermal of page charges. This article must therefore be hereby marked advertisement in cycler). The PCR products contained codons 122-393 of p53 cDNA. accordance with 18 U.S.C. Section 1734 solely to indicate this fact. The primers used for the reaction were P;, 5'TTTGGTACCCT- ' This work was supported by Cancer Research Grant-in-Aid 01015079 from the Ministry of Education. Science and Culture. Japan, and by a grant-in-aid GTCAGTGGGGAACAAG3', and P,, 5'GCCAAGCTTGTGACT- from the Fukuoka Cancer Society. TGCACGTACTC3'. Primers P2 and P, had extraneous nucleotides 2To whom requests for reprints should be addressed. comprising Kpn\ and Hind\\\ sites, respectively, at their 5' ends to 3The abbreviations used are: FPC, familial polyposis coli; NPCC. nonpolyposis colorectal cancer: PCR. polymerase chain reaction: SDS, sodium dodecyl facilitate cloning. The PCR products were digested with Kpn\ and sulfate: cDNA, complementary DNA. HindlU, fractionated by electrophoresis, and ligated to Kpn\- and 2874

///Â«(/Ill-digested Bluescript vectors (Stratagene). DNA sequence analy 1ÃŒ2345e78910I 11 sis was performed according to the dideoxy chain termination method (28). (667) P2 DNA Amplification. Total genomic DNA (0.1 Mg)was used in four separate 50-Ml PCR reactions for 30 cycles (96Â°Cfor 1 min, 60Â°Cfor 30 s, 72Â°Cfor 1 min) to generate fragments corresponding to exons 5 and 6 and intron 5 (primer set 2), exon 7 and intron 7 (primer set 3), exons 8 and 9 and intron 8 (primer set 4), and exons 5, 6. and 7 and intronsS and 6 (primer set 5) (primer set 2: P5,5TTCCTGCAGTACTC- CCCTGC3', and P6, S'AGTCTCAGACCAGACCTCAGGCGGCS'; set 3: P,o, 5'TCTCCTAGGTTGGCTCTG3', and P,,, | 333 ) P12 5'CACGGATCCCAAAGCTGTTCCGTCCCA3';set 4: P,â€ž5'TTCG- Fig. 1. Structure and amplified region of the p53 cDNA and gene. Boxed GATCCTGAGTAGTGGTAATCTA3', and P,2, 5'CCAAAGCTT- numbers, exons: regions between the vertical dotted lines in p53-cDNA are coding exons. Number above the box, number of the amino acid. Arrows, primers and AGTACCTGAAGGGTG3'; set 5: P5 and P9, 5'AGTGGATCCTG- their directions from 5' to 3': bold underlines, PCR products generated by primer ACCTGGAGTCTTCC3'). All primers except P,3 were located on the set 1 (P2 and P,). set 2 (P5 and P6), set 3 (P,0 and P,,), set 4 (P,, and PÂ¡2).and exon-intron junction. Primer P13 was located in exon 8. In the PCR set 5 (P5 and P9). Numbers in parentheses, nucleotide length (base pairs) of PCR reactions, primer sets 2, 3, and 4 generated 402-, 535-, and 333-base products. pair fragments, respectively. The PCR product generated by primer set 5. primers P5 and Pc, which had extraneous nucleotides comprising scribed in "Materials and Methods." In the transplanted tumor Pstl and BamHl sites, respectively, at their 5' ends, were cloned into from KUPL40, we found one nucleotide change, when a com the Bluescript vector and sequenced as described for p53 cDNA. parison was made with p53 cDNA sequence (30). A transition Dot Blot Hybridization. Oligonucleotide probes specific for normal from A to G had occurred within codon 215 (ACT to GGT), and mutated sequences at codon 215 of the p53 gene were 5'TTTCGACATAGTGTGGTG3' and 5'TTTCGACATGGTGTG- the result being a change of the encoded amino acid from serine GTG3', respectively (Fig. 2). The probes were end-labeled with [7-12P] to glycine. We also examined two other transplanted tumors ATP in the presence of T4 polynucleotide kinase. Amplified DNA without an allelic loss of chromosome 17 but found no muta fragments (3 /jl) generated by primer set 2 were dot blotted onto nylon tions. To determine whether the sequence change was derived membrane (Hybond N+) and hybridized with radiolabeled oligomer from a somatic mutation and whether the same mutation oc probes. The filters were prehybridized for 4 h at 54Â°Cin solution A curred in the primary carcinoma and other tumors from FPC (3.0 M tetramethylammonium chloride-50 mM Tris-HCl, pH 8.0-2 mM and NPCC, PCR was used to amplify a 402-base pair segment EDTA-0.1% SDS-5 x Denhardt's solution-100 Mg/ml denatured her ring sperm DNA) and hybridized for 12 h at 54Â°Cinthe same solution surrounding the presumptive mutation from total genomic with 10 pmol 32Pend-labeled probe. These filters were washed twice in DNA (0.1 fig) of 78 tumors, including 3 tumors transplanted 0.75 M NaCl-0.05 M NaH2PO4-5 m\i EDTA and 0.1% SDS at room into nude mice and 51 corresponding normal colonie mucosae temperature for 10 min and in solution A without Denhardt's solution by primer set 2 (Fig. 1). As shown in Fig. 2, the DNA of the and herring sperm DNA, once for 10 min at room temperature and tumor transplanted into nude mice from KUPL40 hybridized twice for 10 min at 58Â°C,and exposed to Kodak XAR5 film at -80Â°C only with the mutated probe, and the DNA of the primary using an intensifying screen for 30 min. carcinoma from KUPL40 hybridized with both the mutated Restriction Fragment Length Polymorphism Analysis. Genomic DNA and the normal probes because of contamination of the normal (8 Mg)from 75 tumors and corresponding normal tissues was digested mucosa. On the other hand, normal colonie mucosae from with Manli and hybridized with p53 cDNA as a probe, as described by KUPL40 and other specimens hybridized only with a normal Masharani et al. (29). Electrophoresis, transfer, and hybridization were probe. These observations suggest that the mutation at codon performed as described (6). 215 occurred only in the carcinoma from KUPL40 at the Denaturing Gradient Gel Electrophoresis. The polyacrylamide con somatic level. centration (120 mg/ml; acrylamide:bisacrylamide, 30:1) and the buffer concentration (89 mM Tris-borate-89 mM boric acid-2 mM EDTA) were p53 Gene Mutations in an Adenoma from a Patient with FPC. uniform throughout the gels containing a linear gradient of formamide The amplified region with primer set 2 where there was a between 25% (v/v) and 60% (v/v) in the same direction as the electric mutation in the carcinoma from KUPL40 contained exons 5 field of a two-chamber gradient maker (23). Electrophoresis was per and 6. This region is one of the hot spots where mutations of formed at a constant field of 6 V/cm for 12 h at 60Â°Cin the air the p53 gene were frequently detected (17). To screen for other incubator. mutations in the amplified region with primer set 2, the 402- base pair PCR products from 78 tumors were digested with RESULTS several restriction enzymes that recognize four base pairs. When PCR products were cleaved with Hhal and separated by poly Analysis oÃ¬p53Gene Mutations by PCR and DNA Sequencing acrylamide gel electrophoresis, adenoma from KUPL31 in the Remaining AlÃele.We reported that the loss of heterozy- (KUPL31A) exhibited an abnormal band, in comparison with gosity on chromosome 17 in carcinomas from patients with other specimens (data not shown). The PCR product generated FPC or NPCC occurred at rates of 31 and 27%, respectively from KUPL31A by primer set 5 was then cloned as described (6). To determine whether the remaining alÃelein carcinoma in "Materials and Methods." We sequenced 4 independent from FPC had mutations in the p53 gene, we analyzed a clones and found 13-base pair deletions in exon 5 from codon carcinoma from KUPL40, one of the FPC patients. The carci 152 (CCG) to codon 156 (CGC) in 2 clones of 4, and the other noma showed an alÃeleloss for D17S5, on the short arm of clones were identical with the normal sequence from nonneo chromosome 17 where the p53 gene was mapped, and the plastic cells (Fig. 3). Restriction fragment length polymorphism related tumors transplanted into nude mice were used for analysis with the p53 cDNA probe revealed that KUPL31A examination. Although primary tumors contain nonneoplastic had allelic deletions in the p53 gene. The analysis was per cells, tumors transplanted into nude mice carried none of these formed using tissues from 75 primary tumors, and the results cells. The p53 cDNA generated by primer set 1, including are summarized in Table 1. There were 5 carcinomas from FPC codons 122-393 (Fig. 1), were cloned and sequenced as de- patients with allelic deletions of the p53 gene. The carcinoma 2875

Probe Fig. 2. Demonstration of p53 gene muta tion in carcinoma from FPC patient KUPL40 by dot blot hybridization. Pn and Pm, oligo- (a) Pn nucleotides specific for normal and mutated sequences, respectively. Bold underlines, se quences corresponding to codon 215. PCR products generated with primer set 2 were hybridized with Pn (a) and Pm (b). Left to (b) righi. KUPL40N, A2, A3, C, C*. KUPL31N, Pm P, C, and KUCO15N. C. KUPL, patients with FPC; KUCO. patients with NPCC. N, normal Pn : 5TTTCGACATAGTGTGGTG3' colonie mucosa; A, colorectal adenoma; C. colorectal carcinoma: C*. carcinoma trans Pm : 5TTTCGACATGGTGTGGTG3' planted into nude mice.

allelic deletion of the p53 gene from FPC, a carcinoma trans GATC GATC planted into nude mice from KUPL40 (KUPL40C*), and KUPL31A, were applied in the gradient gel at 60Â°Cfor 12 h. -- r After electrophoresis, the gels were stained with ethidium bro mide. KUPL40C* and KLJPL31A with mutations in this region exhibited abnormal bands, but the others exhibited only a normal band. To confirm that these abnormal bands derived from neoplastic cells, PCR products from the corresponding normal colonie mucosae were also applied to the gradient gel (Fig. 4, a and b). KUPL40C* exhibited only the abnormal band, the position of which was lower than the normal band on the gel. On the other hand, KUPL31A exhibited two bands, one of which was abnormal with a higher position in the gel. In the case of other carcinomas, no abnormal band appeared. To confirm that these other carcinomas contained no mutation in the amplified region, we chose 5 of them and examined them by direct sequencing (31) to determine whether they had mu l tations in the amplified region. Single-stranded DNA generated by an asymmetric PCR using primers P< (0.5 pmol) and P6 (50 pmol), in which genomic DNA (1 ^g) was used in a 50-nl PCR reaction for 30 cycles (96Â°Cfor 1 min, 60Â°Cfor 30s, and 72Â°C for l min), was sequenced using [7-"P]ATP end-labeled primer P5 as a sequencing primer. Thus by using direct sequencing, we obtained no evidence of mutations in these 5 cases, but we did KUPL31N KUPL31A find mutations in KUPL40C* and KUPL31A. And to deter Fig. 3. Sequence of p53 gene in normal colonie mucosa (left) and adenoma mine whether the presence of nonneoplastic cells in tumor (right) from FPC patient KUPL31. The PCR products generated by primer set 5 were digested with Pst\ and BamHl and ligated to Pstl- and SamHI-digested specimens makes it difficult to observe mutations by this Bluescript SK vector. DNA sequence analysis was performed according to the method, we examined mutation p53 with varying mixtures of dideoxy chain termination method. The sequences marked by a vertical line were lost in adenoma from KUPL3I. For an explanation of tumor abbreviations, see the DNA from normal cells and neoplastic cells (Fig. 4a). Fig. legend to Fig. 2. 4a shows four bands consisting of normal homoduplex, mutant homoduplex, and two different heteroduplex DNA fragments Table 1 Loss of heteroiygosity for the p53 gene in colorectal tumors (32). The mutation in KUPL40 carcinoma is an A to G change, The number of cases in which the normal tissues were found to be heterozygous causing the domain to melt at a higher temperature, and there for p53 cDNA is shown as a denominator. The number of informative cases in fore leads to a lower position in the gel. Two bands higher than which the loss of heterozygosity was seen in colorectal tumors is shown as a numerator. the normal band in the gel are different heteroduplexes, each Loss of heterozygosity containing a single base mismatch. While we could detect the mutation in Fig. 4, Lane 7, in which the DNA ratio between FPC Adenoma 3/22(14)Â° normal colon mucosa and carcinoma transplanted into nude Carcinoma 5/9 (56) mice is 5:1, we could barely detect the mutation in Fig. 4, Lanes 2 and 3, in which the DNA ratios are 10:1 and 50:1, respectively. NPCC carcinoma 3/7(43) " Numbers in parentheses, percentage. Therefore, while some admixture with normal cells would not interfere with our ability to detect mutations, the level of sensitivity achieved with this technique remains to be defined. from KUPL40 (KUPL40C) showed an alÃeleloss with D17S5, Screening for Mutations by the Combined Methods of PCR and the p53 cDNA probe was a noninformative case. and Denaturing Gradient Gel Electrophoresis. The PCR prod Mutations Detected by Denaturing Gradient Gel Electropho- ucts generated by primer sets 2, 3, and 4 (Fig. 1) covered the resis. To screen for subtle alterations in the p53 gene, which four hot spots (17). When the 402-base pair PCR product could not be detected by restriction endonuclease mapping, we generated by primer set 2 from 45 adenomas, 15 carcinomas used the method of denaturing gradient gel electrophoresis (23). from FPC, and 15 carcinomas from NPCC was applied in the The 402-base pair PCR products, including 5 carcinomas with denaturing gel with those from the corresponding normal co- 2876

(a) KUPL40 (b) KUPL31 (c) KUCO15 Fig. 4. Denaturing gradient gel electropho- NA NC resis of the 402-base pair PCR products of the p53 gene in various colonie tissues from FPC patients, a. KUPL40; h. KUPL31: and c, NPCC patient KUCO15. The PCR products were electrophoresed on a 25-60% formamide gradient gel and stained with ethidium bro mide. ,V,C, ('*. and.4. normal colonie mucosa, colon carcinoma, carcinoma transplanted into nude mice, and adenomatous polyp, respec tively. Lanes 1-3. varying mixtures of normal and mutant p53 neoplastic cells from KUPL40. Total genomic DNAs (0.1 Mg).with ratios between normal colon mucosa and car cinoma from transplanted into nude mice of 5:1, 10:1, and 50:1, respectively, were ampli fied, and the PCR products were electropho resed. Arrows, normal band. For an explana tion of tumor abbreviations, see legend to Fig. 2.

Table 2 Mutations in the p53 gene in colorectal tumors detected by denaturing shown in Table 2, we found p53 gene mutations in 3 adenomas gradient gel electrophoresis and one adenocarcinoma from FPC patients and in 3 adeno- in Mutations in of exon 5 or 6 exon 7 or carcinomas from patients with NPCC. We observed that all but TumorFPCAdenomaKUPL31AKUPL36A5KUPL50ACarcinomaKUPL40CNPCCKUC01KUCO13KUC015No.17palÃeles"11NI'1M11Mutations7+* or intron 5 intron 2 of these tumors with mutations had allelic losses of chromo some 17p. The results support the notion that the p53 gene is (13-base pair deletion)'+ a recessive tumor suppressor gene, based on the theory that (24'Ser-^Cys)++ inactivations of the genes on both alÃelesis a hallmark of recessive tumor suppressor gene (10). However, there were (2"Ser^Gly)+++ several cases of allelic losses in the p53 gene in which we observed no mutation in the remainder of the p53 gene. The rate of loss of heterozygosity on the p53 gene was 14% (3 of 22) in colorectal adenomas and 56% (5 of 9) in carcinomas from FPC patients and 43% (3 of 7) in carcinomas from NPCC "The number of 17p alÃeleswas determined by restriction fragment length cases. We found no mutation in 5 carcinomas with an allelic polymorphism analysis, using D17S5 or p53 cDNA as a probe. loss of thep53 gene from FPC. Factors worthy of consideration Mutations were detected by denaturing gradient gel electrophoresis. +, exist ence of mutations. include: (a) mutations capable of affecting the transcription of ' Information in parentheses, mutation in the p53 gene, by sequencing. p53 mRNA, its stability, or its translational capacity (17) exist **NI. noninformative case. For explanation of tumor designations, see legend outside the regions examined; (b) we did not detect these to Fig. 2. because they existed within the regions in primers; (c) we could not detect mutations by denaturing gradient gel electrophoresis, Ionic mucosa, abnormal bands were observed in two adenomas according to the theory that fragments carrying substitutions (KUPL31A, 50A) and one carcinoma (KUPL40C) from FPC in domains melting at a higher temperature reach final gel and three carcinomas (KUCO1, KUCO13, KUCO15) from positions indistinguishable from the wild type (23); (d) contam NPCC (Fig. 4). When the 535-base pair PCR products gener inations of nonneoplastic cells made it difficult to detect mu ated by primer set 3 were analyzed by the same method, one tations, because these contaminations resulted in abnormal adenoma from KUPL36 exhibited the abnormal band. The bands of low intensity in the case of some admixture with PCR product generated by primer set 5 from this adenoma was normal cells (Fig. 4); and (e) only an alÃeleloss in the p53 gene cloned and sequenced. A transversion from C to G was noted may lead to progressive disorder of controlling growth. Once at codon 241 (TCC to TGC), resulting in a change in the one of the p53 genes is deleted, progression to malignancy may encoded amino acid from serine to cysteine. In the 333-base occur in cells from FPC patients with inactivation of the FPC pair PCR products generated with primer set 4, we found no major gene on chromosome 5q (11, 12). This hypothesis could abnormal bands in 75 tumors. Using the method with primer explain previous observations that loss of heterozygosity on sets 2, 3, and 4, we detected mutations in three adenomatous chromosome 17p and that of chromosome 5q did not occur polyps and one carcinoma from FPC patients and three carci simultaneously in tumors from FPC, although losses on both nomas from NPCC. Our observations are summarized in Table chromosomes 5 and 17 were frequently observed in the case of 2. NPCC (6). We found mutations in 3 adenomas of 45 cases of FPC. Two DISCUSSION (KUPL31A, 36A) of the 3 cases had allelic deletion in thep5J gene, and the other (KUPL50A) was not an informative case. Previous studies have demonstrated that mutations in the Polyps from KUPL31 were about 0.5 cm in diameter, the p53 gene occurred in sporadic colorectal carcinomas from pa pathology being a tubular adenoma. Polyps from KUPL36 were tients with NPCC. We attempted to determine whether muta 0.2-1.0 cm in diameter, and the pathology was tubular and tions in the p53 gene also occur in tumors from FPC patients tubulovillous adenoma. These results show that genetic changes and in what stage of tumorigenesis the mutations occur. As in the p53 gene occur in benign adenomas. In view of the 2877

Downloaded from cancerres.aacrjournals.org on September 23, 2021. © 1991 American Association for Cancer Research. pS3 MUTATIONS IN FPC multistep theory of carcinogenesis, it is probable that adenomas tissues from patients with familial polyposis coli. Cancer Res., 48: 4855- 4861, 1988. will have undergone several gene or chromosomal mutations 9. Knudson, A. G. Mutations and cancer: statistical study of retinoblastoma. before revealing the fully malignant state. Mutations of the p53 Proc. Nati. Acad. Sci. USA, 68: 820-823, 1971. 10. Knudson, A. G. Hereditary cancers: clues to mechanism of carcinogenesis. gene may play an important role in forming adenomas or in Br. J. Cancer, 59: 661-666. 1989. the progression from adenoma to adenocarcinoma. The p53 11. Bodmer, W. F., Bailey, C. J., Bodmer. J., Bussey, H. J. R., Ellis, A., Gorman, protein has been well conserved during evolution, and regions P., Lucibello, F. C., Murday, V. A., Rider, S. H., Scambler. P., Sheer, D., Solomon, E., and Spurr. N. K. Localization of the gene for familial adenom of the p53 gene with mutations coincided well with the most atous polyposis on chromosome 5. Nature (Lond.), 328: 614-616, 1987. highly conserved region of the gene (33). 12. Leppert, M., Dobbs, M., Scambler, P., O'Connell, P.. Nakamura, Y., Stauf- These results suggest that p53 may play an important role in fer, D.. Woodward, S., Burt. R., Hughes. J., Gardner, E., Lathrop, M., Wasmuth. J., Lalouel, J. M.. and White, R. The gene for familial polyposis tumorigenesis both in adenomas and in carcinomas from FPC coli maps to the long arm of chromosome 5. Science (Washington DC), 238: patients as well as in sporadic cases. In cases of colorectal 1411-1413, 1987. 13. Fearon, E. R., Cho, K. R., Nigro, J. M., Kern, S. E., Simons, J. W., Ruppert, tumorigenesis in FPC, several genetic alterations may be in J. M., Hamilton, S. R., Preisinger, A. C., Thomas, G., Kinzler. K. W., and volved, in addition to the mutated FPC gene, including activa Vogelstein, B. Identification of a chromosome 18q gene that is altered in tion of ras genes (1-3), mutations in the p53 gene, etc., and colorectal cancers. Science (Washington DC). 247: 49-56, 1990. 14. Mackay, J., Steel, C. M., Elder, P. A., Forrest, A. P. M., and Evans, H. J. some of these genetic changes may interact with one another. AlÃelelosson short arm of chromosome 17 in breast cancer. Lancet, 2:1384- Denaturing gradient gel electrophoresis has been used to 1385, 1988. 15. Yokota, J., Wada, M., Shimosato, Y.. Terada, M., and Sugimura, T. Loss of detect mutations and polymorphisms in genes (23, 34). As for heterozygosity on chromosomes 3. 13. and 17 in small-cell carcinoma and the combined method of PCR and denaturing gradient gel on chromosome 3 in adenocarcinoma of the lung. Proc. Nati. Acad. Sci. electrophoresis, an oligomer with a G-C clamp was found to be USA, 84: 9252-9256. 1987. 16. Tsai, Y. C, Nichols, P. W.. Hiti, A. L., Williams, Z., Skinner, D. G., and effective in separating the different fragments (34). We used Jones, P. A. Allelic loss of chromosomes 9, 11, and 17 in human bladder simple oligomers without G-C clamps and separated the abnor cancer. Cancer Res., 50:44-47, 1990. mal fragments from normal ones, although the level of sensitiv 17. Nigro, J. M., Baker, S. J.. Preisinger, A. C.. Jessup, J. M., Hosteller, R., Cleary, K., Binger, S. H., Davidson. N.. Baylin, S., Devilee, P., Glover, T., ity achieved with this technique remains to be defined. Further Collins, F. S., Weston, A., Modali. R., Harris, C. C, and Vogelstein, B. investigations of the G-C clamp method will be required to Mutations in the p53 gene occur in diverse human tumour types. Nature estimate the true frequency of mutations. PCR combined with (Lond.), 342: 705-708, 1989. 18. Baker, S. J., Fearon, E. R., Nigro, J. M.. Hamilton. S. R.. Preisinger, A. C., denaturing gradient gel electrophoresis may be one of the easiest Jessup, J. M., van Tuinen, P., Ledbetter, D. H., Barker, B. F., Nakamura, methods, without the use of radioisotopes, of screening for Y., White, R., and Vogelstein, B. Chromosome 17 deletions and p53 gene mutations in colorectal carcinomas. Science (Washington DC), 244: 217- mutations in identified as well as presumptive tumor suppressor 221, 1989. genes. 19. Lane, D. P.. and Crawford, L. V. T-antigen is bound to host protein in SV- 40-transformed cells. Nature (Lond.), 27Â«:261-263. 1979. 20. Linzer, D. I. H., and Levine, A. J. Characterization of a 54K dalton cellular ACKNOWLEDGMENTS SV40 tumor antigen present in SV40 transformed cells and uninfected embryonal carcinoma cells. Cell, 17: 43-52, 1979. We thank Professors F. Nakayama, K. Sugimachi, and M. Fujishima 21. Finlay, C. A., Hinds. P. W., and Levine, A. J. The p53 proto-oncogene can act asa suppressor of transformation. Cell, 57: 1083-1093, 1989. at Kyushu University and associated surgeons for providing the tissue 22. Eliyahu. D., Michalovitz, D.. Eliayahu, S.. Pinhasi-Kimhi, O., and Oren, M. specimens. We are very grateful to Drs. M. Oren and Y. Nakamura for Wild-type p53 can inhibit oncogene-mediated focus formation. Proc. Nati. providing plasmid clones. We also thank Drs. Y. Nishimura and A. Acad. Sci. USA, 86: 8763-8767, 1989. Kimura for critical comments and encouragement. M. Ohara kindly 23. Fischer, S. G., and Lerman, L. S. DNA fragments differing by single base- pair substitutions are separated in denaturing gradient gels: correspondence read the manuscript. with melting theory. Proc. Nati. Acad. Sci. USA, 80: 1579-1583, 1983. 24. Copeland, N. G., Zelenetz, A. D., and Cooper, G. H. Transformation by subgenomic fragments of Rous sarcoma virus DNA. Cell, 79:863-870,1980. REFERENCES 25. Ausbel, F. M., Brent, R., Kingston, R. E., Moore, D. D., Seidman, J. G., Smith, J. A., and Struhl, K. Current Protocols in Molecular Biology. New 1. Bos, J. L., Fearon, E. R.. Hamilton. S. R., Verlaan-de Vreis, M., van Boom. York: Greene Publishing Associates and Wiley Interscience, 1987. J. H., van der Eb, A. J., and Vogelstein, B. Prevalence of ras gene mutations 26. Chelly, J., Kaplan. J. C., Maire, P., Gautron, S.. and Kahn, A. Transcription in human colorectal cancers. Nature (Lond.), 327: 293-297, 1987. of the dystrophin gene in human muscle and non-muscle tissues. Nature 2. Forrester, K., Almoguera. C.. Han, K., Grizzle, W. E.. and Perucho, M. (Lond.). 333: 858-860, 1988. Detection of high incidence of K-ras oncogenes during human colon tumor 27. Saiki, R. K., Scharf, S., Faloona, F., Muliis, K. B., Horn, G. T., Erlich, H. igenesis. Nature (Lond.). 327: 298-303, 1987. A., and Arnheim, N. Enzymatic amplifications of rf-globin genomic sequences 3. Vogelstein, B., Fearon. E. R., Hamilton, S. R.. Kern, S. E., Preisinger, A. and restriction site analysis for diagnosis of sickle cell anemia. Science C., Leppert. M., Nakamura. Y., White, R.. Smits, A. M. M., and BÃ¶s,J. L. (Washington DC), 230: 1350-1354, 1985. Genetic alterations during colorectal-tumor development. N. Engl. J. Med., 28. Sanger, F., Nicklen. S., and Coulson. A. R. DNA sequencing with chain- 319: 525-532, 1988. terminating inhibitors. Proc. Nati. Acad. Sci. USA, 74: 5463-5467. 1977. 4. Vogelstein, B., Fearon, E. R., Kern, S. E.. Hamilton. S. R., Preisinger. A. 29. Masharani, U.. Wolf, D., and Frossard, P. M. BaÃ±iland Sca\ RFLPs at the C, Nakamura. Y., and White, R. Allelotype of colorectal carcinomas. Science human p53 gene locus. Nucleic Acids Res., 16: 7757, 1988. (Washington DC). 244: 207-211. 1989. 30. Buchman, V. L., Chumakov, P. M., Ninkina, N. N., Samarina. O. P., and 5. Delattre, P.. Olschwang. S., Law, D. J., Melot, T.. Remvikos. Y., Salmon. Georgiev. G. P. A variation in the structure of the protein-coding region of R. J., Sastre, X., Validire, P., Feinberg, A. P., and Thomas. G. Multiple the human p53 gene. Gene (Amst.), 70: 245-252. 1988. genetic alterations distinguish distal from proximal colorectal cancer. Lancet, 31. Gyllensten. U. B., and Erlich. H. A. Generation of single-stranded DNA by 2:353-356, 1989. the polymerase chain reaction and its application to direct sequencing of the 6. Sasaki, M., Okamoto, M., Sato, C.. Sugio. K., Soejima, J.. Iwama, T.. HLA-DQA locus. Proc. Nati. Acad. Sci. USA. 85: 7652-7656, 1988. Ikeuchi. T.. Tonomura, A.. Miyaki, M., and Sasazuki, T. Loss of constitu 32. Myers. R. M., Sheffield. V. C., and Cox, D. R. Mutation detection by PCR, tional heterozygosity in colorectal tumors from patients with familial poly- GC-clamps. and denaturing gradient gel electrophoresis. In: H. A. Erlich posis coli and those with nonpolyposis colorectal carcinoma. Cancer Res., (ed.), PCR Technology, pp. 71-78. New York: Stockton Press, 1989. 49:4402-4406. 1989. 33. Jenkins. J. R., and Sturzbecher, H. W. The p53 oncogene. In: E. P. Reddy, 7. Erisman, M. D., Scott, J. K., and Astrin, S. M. Evidence that the familial A. M. Skalka. and T. Curran (eds.). The Oncogene Handbook, pp. 403-423. adenomatous polyposis gene is involved in a subset of colon cancers with a Amsterdam: Elsevier Science Publishers, 1988. complementable defect in c-myc regulation. Proc. Nati. Acad. Sci. USA. 86: 34. Sheffield, V. C., Cox, D. R., Lerman. L. S., and Myers, R. M. Attachment 4264-4268, 1989. of a 40-base-pair G + C-rich sequence (GC-clamp) to genomic DNA frag 8. Sugio, K., Kurata. S., Sasaki, M.. Soejima. J.. and Sasazuki. T. Differential ments by the polymerase chain reaction results in improved detection of expression of c-myc gene and c-fos gene in premalignant and malignant single-base changes. Proc. Nati. Acad. Sci. USA. Â«6:232-236, 1989.

2878

Senji Shirasawa, Kazunori Urabe, Yuchio Yanagawa, et al.

Cancer Res 1991;51:2874-2878.

Updated version Access the most recent version of this article at: http://cancerres.aacrjournals.org/content/51/11/2874

E-mail alerts Sign up to receive free email-alerts related to this article or journal.

Reprints and To order reprints of this article or to subscribe to the journal, contact the AACR Publications Subscriptions Department at [email protected].

Permissions To request permission to re-use all or part of this article, use this link http://cancerres.aacrjournals.org/content/51/11/2874. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC) Rightslink site.