Efficient Genome Engineering by Targeted Homologous

Total Page:16

File Type:pdf, Size:1020Kb

Load more

ARTICLE Received 14 Oct 2013 | Accepted 2 Dec 2013 | Published 13 Jan 2014 | Updated 20 Feb 2015 DOI: 10.1038/ncomms4045 Efficient genome engineering by targeted homologous recombination in mouse embryos using transcription activator-like effector nucleases Daniel Sommer1, Annika E. Peters1, Tristan Wirtz1,w, Maren Mai1, Justus Ackermann2, Yasser Thabet1, Ju¨rgen Schmidt3, Heike Weighardt4, F. Thomas Wunderlich2, Joachim Degen5, Joachim L. Schultze1 & Marc Beyer1 Generation of mouse models by introducing transgenes using homologous recombination is critical for understanding fundamental biology and pathology of human diseases. Here we investigate whether artificial transcription activator-like effector nucleases (TALENs)— powerful tools that induce DNA double-strand breaks at specific genomic locations—can be combined with a targeting vector to induce homologous recombination for the introduction of a transgene in embryonic stem cells and fertilized murine oocytes. We describe the gen- eration of a conditional mouse model using TALENs, which introduce double-strand breaks at the genomic locus of the special AT-rich sequence-binding protein-1 in combination with a large 14.4 kb targeting template vector. We report successful germline transmission of this allele and demonstrate its recombination in primary cells in the presence of Cre-recombinase. These results suggest that TALEN-assisted induction of DNA double-strand breaks can facilitate homologous recombination of complex targeting constructs directly in oocytes. 1 Genomics and Immunoregulation, LIMES Institute, University of Bonn, Carl-Troll-Strasse 31, D-53115 Bonn, Germany. 2 Max Planck Institute for Neurological Research and Institute for Genetics, University of Cologne, Gleuelerstrasse 50, D-50931 Cologne, Germany. 3 Department of Experimental Therapy, University Hospital Bonn, Sigmund-Freud-Strasse 25, D-53105 Bonn, Germany. 4 Immunology and Environment, LIMES Institute, University of Bonn, Carl-Troll-Strasse 31, D-53115 Bonn, Germany. 5 Genomic Resource Centre, LIMES Institute, University of Bonn, Carl-Troll-Strasse 31, D-53115 Bonn, Germany. w Present address: Immune Regulation and Cancer, Max-Delbru¨ck-Center for Molecular Medicine, D-13092 Berlin, Germany. Correspondence and requests for materials should be addressed to M.B. (email: [email protected]). NATURE COMMUNICATIONS | 5:3045 | DOI: 10.1038/ncomms4045 | www.nature.com/naturecommunications 1 & 2014 Macmillan Publishers Limited. All rights reserved. ARTICLE NATURE COMMUNICATIONS | DOI: 10.1038/ncomms4045 urrent research in life sciences relies heavily on sophisti- reporter activity under the endogenous regulatory elements cated genetic mouse models allowing cell- and tissue- normally driving SATB1 expression. The targeting vector is Cspecific expression or knockout of conditionally targeted optimized for TALEN-based strategies and can be readily adapted alleles utilizing Cre-recombinase technology. A major bottleneck to other genes within the mouse genome. In addition, we apply an of current technology is the necessity to introduce transgenes improved methodology to screen for TALEN-mediated nuclease by homologous recombination in ES cells, often a labour- activity utilizing an in vitro approach based on an in vitro intensive, error-prone and time-consuming process. Therefore, transcription and translation system10. Taken together, we large consortia have been established to effectively address these show successful homologous recombination at the Satb1 locus issues1. directly in fertilized oocytes, thereby demonstrating that injection Over the last 2 years, site-specific gene targeting to incorporate of TALEN mRNA together with complex targeting constructs locus-specific DNA double-strand breaks using transcription into oocytes facilitates the generation of conditionally targeted activator-like effector nucleases (TALENs) has been introduced2,3. animals. This technology has been successfully applied in several animal models including mouse, rat, zebrafish and Caenorhabditis Results elegans4–8. Gene targeting via non-homologous end-joining Generation of a targeting vector for the murine Satb1 locus. (NHEJ) has also been suggested to generate combined reporter To test whether homology-directed repair of a specific genomic and knockout alleles9. Combination of TALEN-based gene locus is possible in vivo in mouse embryos, we generated a tar- targeting with insertion of a few base pairs or transgenes using geting construct for the murine Satb1 locus with 1.8 kb 50 and small ssDNA oligonucleotides or donor vectors with longer 4.9 kb 30 homology arms. This construct contained exon 2 com- homologous arms was initially reported for zebrafish10,11 and prising the start codon for Satb1 within a FLEX switch19, allowing later extended to other animal models including mouse12,13.The for a Cre-recombinase mediated exchange of exon 2 with an mouse remains the most widely used animal model in the study artificial exon 2 encoding for the endogenous 50 untranslated of human biology and diseases. Since tissue-specific gene region (UTR) and the start codon fused to eGFP. Within the modification is highly desirable, we investigate whether this new targeting construct, eGFP was directly followed by the 30 UTR of technology can be translated to conditional targeting of a genomic Satb1 to enable the regulation of the reporter gene by endogenous allele of higher vertebrates such as the mouse using large targeting miRNAs previously reported to fine-tune Satb1 expression constructs. To our knowledge, a mouse line harbouring a (Supplementary Fig. 1)18,20. Assessment of recombination effi- conditionally targeted allele has not previously been created by cacy revealed a 100% success rate in prokaryotes expressing combined injection of TALENs with a targeting construct into Cre-recombinase (Supplementary Fig. 2). eGFP expression was mouse embryos, allowing for homologous recombination at a tested in the human embryonic kidney cell line 293 T and the specific site in the mouse genome. murine fibroblast cell line NIH3T3. Co-transfection of a Here we induce a conditional allele at the gene locus of the eukaryotic expression vector containing the FLEX switch special AT-rich sequence-binding protein-1 (Satb1), a factor together with a Cre-recombinase containing plasmid led to known to recruit chromatin-remodelling enzymes that is robust eGFP fluorescence (Fig. 1a–c and Supplementary Fig. 3), required for normal thymic T-cell development14, TH1/TH2 while no fluorescence was detected following transfection of polarization15,16, and reprogramming of gene expression17 HEK293T cells with the FLEX construct alone (Fig. 1a–c and 18 specifically suppressed in Treg cells . This allele simultaneously Supplementary Fig. 3). These results suggested that the targeting combines loss of endogenous Satb1 expression with eGFP construct was fully functional in vivo. Neo/Kana UTR SATB13 eGFP 2 ′ loxP lox2272′ loxP lox2272 SATB1 CDS pTriExSATB1 flex Eukaryotic 23FRT FRT promoter Cre-recombinase loxP 2′ eGFPSATB13′ UTR Neo/Kana 2 lox2272 SATB1 CDS pTriExSATB1 flex-eGFP Eukaryotic FRT FRT 3 promoter w/o Cre + Cre 40 * 30 20 SSC SSC 1.7% 25.3% cells (%) 10 eGFP-positive 0 eGFP eGFP w/o Cre + Cre Figure 1 | Functionality of the eGFP-expressing modified FLEX switch within the conditional targeting construct for the murine Satb1 locus. (a) Schematic of the FLEX switch contained in the conditional targeting construct for the murine Satb1 locus transferred to an eukaryotic expression vector before and after Cre-recombinase induced recombination. (b,c) In vivo recombination of the FLEX switch in HEK293T cells 24 h after transfection. eGFP expression was determined by flow cytometry in control (w/o Cre) or Cre-recombinase co-transfected cells ( þ Cre). (b) Exemplary dot plots of a single experiment. (c) Quantification of eGFP expression (n ¼ 3). Mean and s.e.m. *Po0.05 (Student’s t-test). 2 NATURE COMMUNICATIONS | 5:3045 | DOI: 10.1038/ncomms4045 | www.nature.com/naturecommunications & 2014 Macmillan Publishers Limited. All rights reserved. NATURE COMMUNICATIONS | DOI: 10.1038/ncomms4045 ARTICLE Generation of a TALEN pair for the murine Satb1 locus.To together, these data demonstrate successful generation of a target the murine Satb1 locus we designed and synthesized highly TALEN pair directed at a sequence just upstream of exon 2 active TALENs that bind to an intronic region of the murine inducing small deletions at its target site. Satb1 locus contained within the FLEX switch (Fig. 2a). We used As this TALEN pair is directed against an intronic region at an in vitro assay system based on in vitro transcription and the Satb1 locus also contained in the targeting construct translation of the TALENs to exclude TALEN pairs with low (Supplementary Fig. 1), we modified the Satb1-targeting con- efficiencies in inducing DNA double-strand breaks before asses- struct to include three point mutations at the binding site of each sing their activity in vivo10. We showed TALEN protein activity TALEN to prevent TALEN-induced modification of the targeting against a PCR product of the targeted locus and demonstrated construct and subsequently of the targeted Satb1 allele. high rates of DNA double-strand break induction (Fig. 2b). We then used this TALEN pair for the classical T7 in vivo assay TALEN-assisted homologous recombination in ES cells. Recent analysing TALEN activity in NIH3T3 cells (Fig. 2c,d). Taken in vivo work in zebrafish and mice has demonstrated that small TALEN1 N term FokI AGACCTCCACCCACTGATAACGTCTTCTTTTCCAGTTCTGGCAGGTGATCTGT
Recommended publications
  • P1 Bacteriophage and Tol System Mutants

    P1 Bacteriophage and Tol System Mutants

    P1 BACTERIOPHAGE AND TOL SYSTEM MUTANTS Cari L. Smerk A Thesis Submitted to the Graduate College of Bowling Green State University in partial fulfillment of the requirements for the degree of MASTER OF SCIENCE August 2007 Committee: Ray A. Larsen, Advisor Tami C. Steveson Paul A. Moore Lee A. Meserve ii ABSTRACT Dr. Ray A. Larsen, Advisor The integrity of the outer membrane of Gram negative bacteria is dependent upon proteins of the Tol system, which transduce cytoplasmic-membrane derived energy to as yet unidentified outer membrane targets (Vianney et al., 1996). Mutations affecting the Tol system of Escherichia coli render the cells resistant to a bacteriophage called P1 by blocking the phage maturation process in some way. This does not involve outer membrane interactions, as a mutant in the energy transucer (TolA) retained wild type levels of phage sensitivity. Conversely, mutations affecting the energy harvesting complex component, TolQ, were resistant to lysis by bacteriophage P1. Further characterization of specific Tol system mutants suggested that phage maturation was not coupled to energy transduction, nor to infection of the cells by the phage. Quantification of the number of phage produced by strains lacking this protein also suggests that the maturation of P1 phage requires conditions influenced by TolQ. This study aims to identify the role that the TolQ protein plays in the phage maturation process. Strains of cells were inoculated with bacteriophage P1 and the resulting production by the phage of viable progeny were determined using one step growth curves (Ellis and Delbruck, 1938). Strains that were lacking the TolQ protein rendered P1 unable to produce the characteristic burst of progeny phage after a single generation of phage.
  • Scalable Recombinase-Based Gene Expression Cascades

    Scalable Recombinase-Based Gene Expression Cascades

    bioRxiv preprint doi: https://doi.org/10.1101/2020.06.20.161430; this version posted June 20, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Title: Scalable recombinase-based gene expression cascades One Sentence Summary: Recombinase-based gene circuits enable scalable and sequential gene modulation. Authors: Tackhoon Kim1,2, Benjamin Weinberg3, Wilson Wong3, Timothy K. Lu1,* Affiliations: 1 Research Lab of Electronics, Massachusetts Institute of Technology, Cambridge, Massachusetts, USA. 2 Chemical Kinomics Research Center, Korea Institute of Science and Technology, 5 Hwarangro 14-gil, Seongbuk-gu, Seoul 02792, Republic of Korea 3 Department of Biomedical Engineering and Biological Design Center, Boston University, Boston, Massachusetts, USA. *Correspondence to: [email protected] (T.K.L) Abstract: Temporal modulation of multiple genes underlies sophisticated biological phenomena. However, there are few scalable and generalizable gene circuit architectures for the programming of sequential genetic perturbations. We describe a modular recombinase-based gene circuit architecture, comprising tandem gene perturbation cassettes (GPCs), that enables the sequential expression of multiple genes in a defined temporal order by alternating treatment with just two orthogonal ligands. We used tandem GPCs to sequentially express single-guide RNAs to encode transcriptional cascades and trigger the sequential accumulation of mutations. We built an all-in- one gene circuit that sequentially edits genomic loci, synchronizes cells at a specific stage within bioRxiv preprint doi: https://doi.org/10.1101/2020.06.20.161430; this version posted June 20, 2020.
  • Identification and Analysis of Recombineering Functions from Gram-Negative and Gram-Positive Bacteria and Their Phages

    Identification and Analysis of Recombineering Functions from Gram-Negative and Gram-Positive Bacteria and Their Phages

    Identification and analysis of recombineering functions from Gram-negative and Gram-positive bacteria and their phages Simanti Datta, Nina Costantino, Xiaomei Zhou, and Donald L. Court† Gene Regulation and Chromosome Biology Laboratory, Center for Cancer Research, National Cancer Institute at Frederick, Frederick, MD 21702 Edited by Sankar Adhya, National Institutes of Health, Bethesda, MD, and approved December 12, 2007 (received for review September 25, 2007) We report the identification and functional analysis of nine genes but linear DNA recombination studies with RecET have used ␭ from Gram-positive and Gram-negative bacteria and their phages Gam to inhibit nucleases (4). that are similar to lambda (␭) bet or Escherichia coli recT. Beta and For recombineering, either a dsDNA PCR product (1, 4, RecT are single-strand DNA annealing proteins, referred to here as 15–17) or an oligonucleotide (oligo) (18–21) carrying short recombinases. Each of the nine other genes when expressed in E. (Ϸ50-bp) segments homologous to the target sequences can be coli carries out oligonucleotide-mediated recombination. To our used. These linear DNA substrates are precisely recombined in knowledge, this is the first study showing single-strand recombi- vivo by the phage proteins to target DNA on any replicon. When nase activity from diverse bacteria. Similar to bet and recT, most of linear dsDNA is used for recombination, both the exonuclease these other recombinases were found to be associated with pu- and single-strand annealing protein are required. For optimal tative exonuclease genes. Beta and RecT in conjunction with their recombination, RecBCD should be inactivated, either by muta- cognate exonucleases carry out recombination of linear double- tion or by ␭ Gam (1, 15, 22).
  • Cre/Lox-Mediated Chromosomal Integration of Biosynthetic Gene Clusters for Heterologous Expression in Aspergillus Nidulans

    Cre/Lox-Mediated Chromosomal Integration of Biosynthetic Gene Clusters for Heterologous Expression in Aspergillus Nidulans

    bioRxiv preprint doi: https://doi.org/10.1101/2021.08.20.457072; this version posted August 20, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. Cre/lox-mediated chromosomal integration of biosynthetic gene clusters for heterologous expression in Aspergillus nidulans Indra Roux1, Yit-Heng Chooi1 1 School of Molecular Sciences, University of Western Australia, Perth, WA 6009, Australia. Correspondence to: [email protected] Abstract Building strains for stable long-term heterologous expression of large biosynthetic pathways in filamentous fungi is limited by the low transformation efficiency or genetic stability of current methods. Here, we developed a system for targeted chromosomal integration of large biosynthetic gene clusters in Aspergillus nidulans based on site-specific recombinase mediated cassette exchange. We built A. nidulans strains harbouring a chromosomal landing pad for Cre/lox-mediated recombination and demonstrated efficient targeted integration of a 21.5 kb heterologous region in a single step. We further evaluated the integration at two loci by analysing the expression of a fluorescent reporter and the production of a heterologous polyketide. We compared chromosomal expression at those landing loci to episomal AMA1- based expression, which also shed light on uncharacterised aspects of episomal expression in filamentous fungi.
  • Coupling Recombinase-Mediated Cassette Exchange with Somatic Hypermutation for Antibody Affinity Maturation in CHO Cells

    Coupling Recombinase-Mediated Cassette Exchange with Somatic Hypermutation for Antibody Affinity Maturation in CHO Cells

    ARTICLE Coupling Recombinase-Mediated Cassette Exchange With Somatic Hypermutation for Antibody Affinity Maturation in CHO Cells Chuan Chen,1,2 Nan Li,1,2 Yun Zhao,1 Haiying Hang1 1 Key Laboratory for Protein and Peptide Pharmaceuticals, National Laboratory of Biomacromolecules, Institute of Biophysics, Chinese Academy of Sciences, Beijing 100101, China; telephone: þ86-10-64888473; fax: þ86-10-64888473; e-mail: [email protected] 2 University of Chinese Academy of Sciences, Beijing, China Introduction ABSTRACT: Heterologous expression of activation-induced cytidine deaminase (AID) can induce somatic hypermutation Technologies such as phage (de Bruin et al., 1999; Huse et al., 1992; (SHM) for genes of interest in various cells, and several research Smith, 1985; Winter et al., 1994), yeast (Boder and Wittrup, 1997; groups (including ours) have successfully improved antibody affinity in mammalian or chicken cells using AID-induced SHM. These Feldhaus et al., 2003), and bacterial displays (Francisco and affinity maturation systems are time-consuming and inefficient. In Georgiou, 1994; Mazor et al., 2009; Qiu et al., 2010) have been used this study, we developed an antibody affinity maturation platform in for antibody affinity maturation in vitro. In recent years, Chinese hamster ovary (CHO) cells by coupling recombinase- mammalian cell surface display has also been developed (Akamatsu mediated cassette exchange (RMCE) with SHM. Stable CHO cell et al., 2007; Higuchi et al., 1997; Ho et al., 2006; Wolkowicz et al., clones containing a single copy puromycin resistance gene (PuroR) expression cassette flanked by recombination target sequences (FRT 2005); it has advantages in protein folding, post-translational and loxP) being able to highly express a gene of interest placed in the modification, and code usage (Ho et al., 2006).
  • Elucidating Recombination Mediator Function Using Biophysical Tools

    Elucidating Recombination Mediator Function Using Biophysical Tools

    biology Review Elucidating Recombination Mediator Function Using Biophysical Tools Camille Henry 1,* and Sarah S. Henrikus 2,* 1 Department of Biochemistry, University of Wisconsin-Madison, Madison, WI 53706, USA 2 Macromolecular Machines Laboratory, The Francis Crick Institute, London NW1 1AT, UK * Correspondence: [email protected] (C.H.); [email protected] (S.S.H.); Tel.: +1-608-472-3019 (C.H.) Simple Summary: This review recapitulates the initial knowledge acquired with genetics and bio- chemical experiments on Recombination mediator proteins in different domains of life. We further address how recent in vivo and in vitro biophysical tools were critical to deepen the understanding of RMPs molecular mechanisms in DNA and replication repair, and unveiled unexpected features. For instance, in bacteria, genetic and biochemical studies suggest a close proximity and coordination of action of the RecF, RecR and RecO proteins in order to ensure their RMP function, which is to over- come the single-strand binding protein (SSB) and facilitate the loading of the recombinase RecA onto ssDNA. In contrary to this expectation, using single-molecule fluorescent imaging in living cells, we showed recently that RecO and RecF do not colocalize and moreover harbor different spatiotemporal behavior relative to the replication machinery, suggesting distinct functions. Finally, we address how new biophysics tools could be used to answer outstanding questions about RMP function. Abstract: The recombination mediator proteins (RMPs) are ubiquitous and play a crucial role in genome stability. RMPs facilitate the loading of recombinases like RecA onto single-stranded (ss) DNA coated by single-strand binding proteins like SSB. Despite sharing a common function, RMPs are the products of a convergent evolution and differ in (1) structure, (2) interaction partners and (3) Citation: Henry, C.; Henrikus, S.S.
  • The RAG Recombinase: Beyond Breaking. Chloé Lescale, Ludovic Deriano

    The RAG Recombinase: Beyond Breaking. Chloé Lescale, Ludovic Deriano

    The RAG recombinase: Beyond breaking. Chloé Lescale, Ludovic Deriano To cite this version: Chloé Lescale, Ludovic Deriano. The RAG recombinase: Beyond breaking.. Mechanisms of Ageing and Development, Elsevier, 2016, 10.1016/j.mad.2016.11.003. pasteur-01416603 HAL Id: pasteur-01416603 https://hal-pasteur.archives-ouvertes.fr/pasteur-01416603 Submitted on 21 Feb 2017 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. Distributed under a Creative Commons Attribution - NonCommercial - NoDerivatives| 4.0 International License The RAG recombinase: Beyond breaking Chlo´eLescale, Ludovic Deriano To cite this version: Chlo´eLescale, Ludovic Deriano. The RAG recombinase: Beyond breaking. Mechanisms of Ageing and Development, Elsevier, 2016, <10.1016/j.mad.2016.11.003>. <pasteur-01416603> HAL Id: pasteur-01416603 https://hal-pasteur.archives-ouvertes.fr/pasteur-01416603 Submitted on 15 Dec 2016 HAL is a multi-disciplinary open access L'archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destin´eeau d´ep^otet `ala diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publi´esou non, lished or not. The documents may come from ´emanant des ´etablissements d'enseignement et de teaching and research institutions in France or recherche fran¸caisou ´etrangers,des laboratoires abroad, or from public or private research centers.
  • Recent Advances in Gene Mutagenesis by Site-Directed Recombination

    Recent Advances in Gene Mutagenesis by Site-Directed Recombination

    Recent advances in gene mutagenesis by site-directed recombination. J D Marth J Clin Invest. 1996;97(9):1999-2002. https://doi.org/10.1172/JCI118634. Perspective Find the latest version: https://jci.me/118634/pdf Perspectives Series: Molecular Medicine in Genetically Engineered Animals Recent Advances in Gene Mutagenesis by Site-directed Recombination Jamey D. Marth Howard Hughes Medical Institute, Department of Medicine and Division of Cellular and Molecular Medicine, University of California San Diego, La Jolla, California 92093 Transgenic experimentation yields insights that could not be lack of cell or tissue development may result from ES cell perceived otherwise among populations of mammalian organ- clonal variation, use of multiple ES clones and complementa- isms (reviewed in references 1 and 2). However, information tion by gene transfer allow for controlled studies. Some con- gained may, on occasion, be somewhat limited should germ- siderations remain the inability to direct genetic variation to line gene dysfunction be deleterious in embryonic develop- multiple, experimentally defined cell lineages and the poten- ment, thereby precluding analyses in various somatic compart- tially unique nature of each chimeric mouse generated. ments of the adult organism. The production of chimeric mice Since inception, gene transfer experimentation has been bearing genetic mutations specifically in various somatic cells generally limited to irreversible modifications of chromosomal allows the study of gene function in physiologic contexts that DNA. Isolation of cells having undergone site-specific ex- would otherwise be unavailable or lethal. One elegant cell change or deletion of DNA sequence has only recently been type-restricted chimeric approach has been the use of the developed using novel screening strategies for often low fre- RAG 2-null embryos as recipients in gene-targeted embryonic quency events.
  • Mechanism of Homologous Recombination: Mediators and Helicases Take on Regulatory Functions

    Mechanism of Homologous Recombination: Mediators and Helicases Take on Regulatory Functions

    REVIEWS Mechanism of homologous recombination: mediators and helicases take on regulatory functions Patrick Sung* and Hannah Klein‡ Abstract | Homologous recombination (HR) is an important mechanism for the repair of damaged chromosomes, for preventing the demise of damaged replication forks, and for several other aspects of chromosome maintenance. As such, HR is indispensable for genome integrity, but it must be regulated to avoid deleterious events. Mutations in the tumour- suppressor protein BRCA2, which has a mediator function in HR, lead to cancer formation. DNA helicases, such as Bloom’s syndrome protein (BLM), regulate HR at several levels, in attenuating unwanted HR events and in determining the outcome of HR. Defects in BLM are also associated with the cancer phenotype. The past several years have witnessed dramatic advances in our understanding of the mechanism and regulation of HR. Homologous recombination (HR) occurs in all life homologous chromosomes and generates chromosome- Meiosis I The successful completion of forms. HR studies were initially the domain of a few arm crossovers. These crossovers are essential for proper meiosis requires two cell aficionados who had a desire to understand how genetic chromosome segregation at the first meiotic division2,4. divisions. Meiosis I refers to the information is transferred and exchanged between Mitotic HR differs from meiotic HR in that few events are first division in which the pairs chromosomes. The isolation and characterization of associated with crossover and indeed, crossover formation of homologous chromosomes 1 DNA helicases are segregated into the two relevant mutants in Escherichia coli , and later in the is actively suppressed by specialized (see daughter cells.
  • The Cre Recombinase Gene Y

    The Cre Recombinase Gene Y

    Proc. Natl. Acad. Sci. USA Vol. 93, pp. 3932-3936, April 1996 Neurobiology Targeted DNA recombination in vivo using an adenovirus carrying the cre recombinase gene Y. WANG*, L. A. KRUSHEL*t, AND G. M. EDELMAN*t *Department of Neurobiology, The Scripps Research Institute, 10666 North Torrey Pines Road, La Jolla, CA 92037; and tThe Neurosciences Institute, 10640 John Jay Hopkins Road, San Diego, CA 92121 Contributed by G. M. Edelman, December 26, 1995 ABSTRACT Conditional gene expression and gene dele- sequences, each of which is 34 bp in length (7, 8). The tion are important experimental approaches for examining intramolecular recombination of two loxP sites (oriented ei- the functions of particular gene products in development and ther head-to-head or head-to-tail) results in an inversion or disease. The cre-loxP system from bacteriophage P1 has been deletion of the intervening DNA sequences, and an intermo- used in transgenic animals to induce site-specific DNA re- lecular recombination causes integration or reciprocal trans- combination leading to gene activation or deletion. To regulate location at the loxP site. The cre-loxP system has been tested the recombination in a spatiotemporally controlled manner, in various eukaryotic organisms and shown to function effi- we constructed a recombinant adenoviral vector, Adv/cre, that ciently in mammalian cells (9-13). It has been used in trans- contained the cre recombinase gene under regulation of the genic animals to achieve conditional gene activation or dele- herpes simplex virus thymidine kinase promoter. The efficacy tion (knockout) of targeted genes in specific tissues (5, 6, 14).
  • Requirements for Catalysis in Cre Recombinase

    Requirements for Catalysis in Cre Recombinase

    University of Pennsylvania ScholarlyCommons Publicly Accessible Penn Dissertations Summer 2010 Requirements for Catalysis in Cre Recombinase Bryan P S Gibb Biochemistry and Molecular Biophysics, [email protected] Follow this and additional works at: https://repository.upenn.edu/edissertations Part of the Biochemistry, Biophysics, and Structural Biology Commons Recommended Citation Gibb, Bryan P S, "Requirements for Catalysis in Cre Recombinase" (2010). Publicly Accessible Penn Dissertations. 427. https://repository.upenn.edu/edissertations/427 This paper is posted at ScholarlyCommons. https://repository.upenn.edu/edissertations/427 For more information, please contact [email protected]. Requirements for Catalysis in Cre Recombinase Abstract Cre recombinase, a member of the tyrosine recombinase (YR) family of site-specific ecombinasesr catalyzes DNA rearrangements using phosphoryl transfer chemistry that is identical to that used by the type IB topoisomerases (TopIBs). In this dissertation, the requirements for YR catalysis and the relationship between the YRs and the TopIBs are explored. I have analyzed the in vivo and in vitro recombination activities of all possible substitutions of the seven active site residues in Cre recombinase. To facilitate the interpretation mutant activities, I also determined the structure of a vanadate transition state mimic for the Cre-loxP reaction that allows for a comparison with similar structures from the related TopIBs. The results demonstrate that active site residues shared by the TopIBs are most sensitive to substitution. Two of the conserved active site residues in YRs have no equivalent in TopIBs. I have concluded that Glu176 and His289 in Cre evolved to have functional roles in site-specific ecombination,r that are unnecessary for relaxation by TopIB.
  • Overview of Gene Targeting by Homologous Recombination 4.29.10

    Overview of Gene Targeting by Homologous Recombination 4.29.10

    Overview of Gene Targeting by Homologous UNIT 4.29 Recombination The analysis of mutant organisms and cell tion of the mutation present in the targeting lines has been important in determining the construct into the target gene. Once identified, function of specific proteins. Until recently, mutant ES cell clones can be microinjected into mutants were produced by mutagenesis fol- a normal blastocyst in order to produce a lowed by selection for a particular phenotypic chimeric mouse. Because many ES cell lines change. Recent technological advances in gene retain the ability to differentiate into every cell targeting by homologous recombination in type present in the mouse, the chimera can have mammalian systems enable the production of tissues, including the germ line, with contribu- mutants in any desired gene (Mansour, 1990; tion from both the normal blastocyst and the Robertson, 1991; Zimmer, 1992). This technol- mutant ES cells. Breeding germ-line chimeras ogy can be used to produce mutant mouse yields animals that are heterozygous for the strains and mutant cell lines. Because most mutation introduced into the ES cell, and that mammalian cells are diploid, they contain two can be interbred to produce homozygous mu- copies, or alleles, of each gene encoded on an tant mice. autosomal (nonsex) chromosome. In most Homologous recombination can also be cases, both alleles must be inactivated to pro- used to produce homozygous mutant cell lines. duce a discernible phenotypic change in a mu- Previously, inactivation of both alleles of a gene tant. The conversion from heterozygosity to required two rounds of homologous recombi- homozygosity is accomplished by breeding in nation and selection (te Riele et al., 1990; Cruz the case of mouse strains and by direct selection et al., 1991; Mortensen et al., 1991).