ARTICLE Received 14 Oct 2013 | Accepted 2 Dec 2013 | Published 13 Jan 2014 | Updated 20 Feb 2015 DOI: 10.1038/ncomms4045 Efficient genome engineering by targeted homologous recombination in mouse embryos using transcription activator-like effector nucleases Daniel Sommer1, Annika E. Peters1, Tristan Wirtz1,w, Maren Mai1, Justus Ackermann2, Yasser Thabet1, Ju¨rgen Schmidt3, Heike Weighardt4, F. Thomas Wunderlich2, Joachim Degen5, Joachim L. Schultze1 & Marc Beyer1 Generation of mouse models by introducing transgenes using homologous recombination is critical for understanding fundamental biology and pathology of human diseases. Here we investigate whether artificial transcription activator-like effector nucleases (TALENs)— powerful tools that induce DNA double-strand breaks at specific genomic locations—can be combined with a targeting vector to induce homologous recombination for the introduction of a transgene in embryonic stem cells and fertilized murine oocytes. We describe the gen- eration of a conditional mouse model using TALENs, which introduce double-strand breaks at the genomic locus of the special AT-rich sequence-binding protein-1 in combination with a large 14.4 kb targeting template vector. We report successful germline transmission of this allele and demonstrate its recombination in primary cells in the presence of Cre-recombinase. These results suggest that TALEN-assisted induction of DNA double-strand breaks can facilitate homologous recombination of complex targeting constructs directly in oocytes. 1 Genomics and Immunoregulation, LIMES Institute, University of Bonn, Carl-Troll-Strasse 31, D-53115 Bonn, Germany. 2 Max Planck Institute for Neurological Research and Institute for Genetics, University of Cologne, Gleuelerstrasse 50, D-50931 Cologne, Germany. 3 Department of Experimental Therapy, University Hospital Bonn, Sigmund-Freud-Strasse 25, D-53105 Bonn, Germany. 4 Immunology and Environment, LIMES Institute, University of Bonn, Carl-Troll-Strasse 31, D-53115 Bonn, Germany. 5 Genomic Resource Centre, LIMES Institute, University of Bonn, Carl-Troll-Strasse 31, D-53115 Bonn, Germany. w Present address: Immune Regulation and Cancer, Max-Delbru¨ck-Center for Molecular Medicine, D-13092 Berlin, Germany. Correspondence and requests for materials should be addressed to M.B. (email: [email protected]). NATURE COMMUNICATIONS | 5:3045 | DOI: 10.1038/ncomms4045 | www.nature.com/naturecommunications 1 & 2014 Macmillan Publishers Limited. All rights reserved. ARTICLE NATURE COMMUNICATIONS | DOI: 10.1038/ncomms4045 urrent research in life sciences relies heavily on sophisti- reporter activity under the endogenous regulatory elements cated genetic mouse models allowing cell- and tissue- normally driving SATB1 expression. The targeting vector is Cspecific expression or knockout of conditionally targeted optimized for TALEN-based strategies and can be readily adapted alleles utilizing Cre-recombinase technology. A major bottleneck to other genes within the mouse genome. In addition, we apply an of current technology is the necessity to introduce transgenes improved methodology to screen for TALEN-mediated nuclease by homologous recombination in ES cells, often a labour- activity utilizing an in vitro approach based on an in vitro intensive, error-prone and time-consuming process. Therefore, transcription and translation system10. Taken together, we large consortia have been established to effectively address these show successful homologous recombination at the Satb1 locus issues1. directly in fertilized oocytes, thereby demonstrating that injection Over the last 2 years, site-specific gene targeting to incorporate of TALEN mRNA together with complex targeting constructs locus-specific DNA double-strand breaks using transcription into oocytes facilitates the generation of conditionally targeted activator-like effector nucleases (TALENs) has been introduced2,3. animals. This technology has been successfully applied in several animal models including mouse, rat, zebrafish and Caenorhabditis Results elegans4–8. Gene targeting via non-homologous end-joining Generation of a targeting vector for the murine Satb1 locus. (NHEJ) has also been suggested to generate combined reporter To test whether homology-directed repair of a specific genomic and knockout alleles9. Combination of TALEN-based gene locus is possible in vivo in mouse embryos, we generated a tar- targeting with insertion of a few base pairs or transgenes using geting construct for the murine Satb1 locus with 1.8 kb 50 and small ssDNA oligonucleotides or donor vectors with longer 4.9 kb 30 homology arms. This construct contained exon 2 com- homologous arms was initially reported for zebrafish10,11 and prising the start codon for Satb1 within a FLEX switch19, allowing later extended to other animal models including mouse12,13.The for a Cre-recombinase mediated exchange of exon 2 with an mouse remains the most widely used animal model in the study artificial exon 2 encoding for the endogenous 50 untranslated of human biology and diseases. Since tissue-specific gene region (UTR) and the start codon fused to eGFP. Within the modification is highly desirable, we investigate whether this new targeting construct, eGFP was directly followed by the 30 UTR of technology can be translated to conditional targeting of a genomic Satb1 to enable the regulation of the reporter gene by endogenous allele of higher vertebrates such as the mouse using large targeting miRNAs previously reported to fine-tune Satb1 expression constructs. To our knowledge, a mouse line harbouring a (Supplementary Fig. 1)18,20. Assessment of recombination effi- conditionally targeted allele has not previously been created by cacy revealed a 100% success rate in prokaryotes expressing combined injection of TALENs with a targeting construct into Cre-recombinase (Supplementary Fig. 2). eGFP expression was mouse embryos, allowing for homologous recombination at a tested in the human embryonic kidney cell line 293 T and the specific site in the mouse genome. murine fibroblast cell line NIH3T3. Co-transfection of a Here we induce a conditional allele at the gene locus of the eukaryotic expression vector containing the FLEX switch special AT-rich sequence-binding protein-1 (Satb1), a factor together with a Cre-recombinase containing plasmid led to known to recruit chromatin-remodelling enzymes that is robust eGFP fluorescence (Fig. 1a–c and Supplementary Fig. 3), required for normal thymic T-cell development14, TH1/TH2 while no fluorescence was detected following transfection of polarization15,16, and reprogramming of gene expression17 HEK293T cells with the FLEX construct alone (Fig. 1a–c and 18 specifically suppressed in Treg cells . This allele simultaneously Supplementary Fig. 3). These results suggested that the targeting combines loss of endogenous Satb1 expression with eGFP construct was fully functional in vivo. Neo/Kana UTR SATB13 eGFP 2 ′ loxP lox2272′ loxP lox2272 SATB1 CDS pTriExSATB1 flex Eukaryotic 23FRT FRT promoter Cre-recombinase loxP 2′ eGFPSATB13′ UTR Neo/Kana 2 lox2272 SATB1 CDS pTriExSATB1 flex-eGFP Eukaryotic FRT FRT 3 promoter w/o Cre + Cre 40 * 30 20 SSC SSC 1.7% 25.3% cells (%) 10 eGFP-positive 0 eGFP eGFP w/o Cre + Cre Figure 1 | Functionality of the eGFP-expressing modified FLEX switch within the conditional targeting construct for the murine Satb1 locus. (a) Schematic of the FLEX switch contained in the conditional targeting construct for the murine Satb1 locus transferred to an eukaryotic expression vector before and after Cre-recombinase induced recombination. (b,c) In vivo recombination of the FLEX switch in HEK293T cells 24 h after transfection. eGFP expression was determined by flow cytometry in control (w/o Cre) or Cre-recombinase co-transfected cells ( þ Cre). (b) Exemplary dot plots of a single experiment. (c) Quantification of eGFP expression (n ¼ 3). Mean and s.e.m. *Po0.05 (Student’s t-test). 2 NATURE COMMUNICATIONS | 5:3045 | DOI: 10.1038/ncomms4045 | www.nature.com/naturecommunications & 2014 Macmillan Publishers Limited. All rights reserved. NATURE COMMUNICATIONS | DOI: 10.1038/ncomms4045 ARTICLE Generation of a TALEN pair for the murine Satb1 locus.To together, these data demonstrate successful generation of a target the murine Satb1 locus we designed and synthesized highly TALEN pair directed at a sequence just upstream of exon 2 active TALENs that bind to an intronic region of the murine inducing small deletions at its target site. Satb1 locus contained within the FLEX switch (Fig. 2a). We used As this TALEN pair is directed against an intronic region at an in vitro assay system based on in vitro transcription and the Satb1 locus also contained in the targeting construct translation of the TALENs to exclude TALEN pairs with low (Supplementary Fig. 1), we modified the Satb1-targeting con- efficiencies in inducing DNA double-strand breaks before asses- struct to include three point mutations at the binding site of each sing their activity in vivo10. We showed TALEN protein activity TALEN to prevent TALEN-induced modification of the targeting against a PCR product of the targeted locus and demonstrated construct and subsequently of the targeted Satb1 allele. high rates of DNA double-strand break induction (Fig. 2b). We then used this TALEN pair for the classical T7 in vivo assay TALEN-assisted homologous recombination in ES cells. Recent analysing TALEN activity in NIH3T3 cells (Fig. 2c,d). Taken in vivo work in zebrafish and mice has demonstrated that small TALEN1 N term FokI AGACCTCCACCCACTGATAACGTCTTCTTTTCCAGTTCTGGCAGGTGATCTGT