Expression Profiling Reveals Unique Pathways Associated with Differential Severity of Lyme Arthritis

This information is current as Hillary Crandall, Diane M. Dunn, Ying Ma, R. Mark of September 25, 2021. Wooten, James F. Zachary, John H. Weis, Robert B. Weiss and Janis J. Weis J Immunol 2006; 177:7930-7942; ; doi: 10.4049/jimmunol.177.11.7930

http://www.jimmunol.org/content/177/11/7930 Downloaded from

Supplementary http://www.jimmunol.org/content/suppl/2006/11/16/177.11.7930.DC1 Material http://www.jimmunol.org/ References This article cites 58 articles, 29 of which you can access for free at: http://www.jimmunol.org/content/177/11/7930.full#ref-list-1

Why The JI? Submit online.

• Rapid Reviews! 30 days* from submission to initial decision by guest on September 25, 2021 • No Triage! Every submission reviewed by practicing scientists

• Fast Publication! 4 weeks from acceptance to publication

*average

Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts

The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2006 by The American Association of Immunologists All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology

Gene Expression Profiling Reveals Unique Pathways Associated with Differential Severity of Lyme Arthritis1

Hillary Crandall,* Diane M. Dunn,† Ying Ma,* R. Mark Wooten,‡ James F. Zachary,§ John H. Weis,* Robert B. Weiss,† and Janis J. Weis2*

The murine model of Lyme disease provides a unique opportunity to study the localized host response to similar stimulus, Borrelia burgdorferi, in the joints of mice destined to develop severe arthritis (C3H) or mild disease (C57BL/6). Pathways associated with the response to infection and the development of Lyme arthritis were identified by global patterns using oligo- microarrays. A robust induction of IFN-responsive was observed in severely arthritic C3H mice at 1 wk of infection, which was absent from mildly arthritic C57BL/6 mice. In contrast, infected C57BL/6 mice displayed a novel expression profile characterized by genes involved in epidermal differentiation and wound repair, which were decreased in the joints of C3H mice. These expression patterns were associated with disease state rather than inherent differences between C3H and C57BL/6 Downloaded from mice, because C57BL/6-IL-10؊/؊ mice infected with B. burgdorferi develop more severe arthritis than C57BL/6 mice and displayed an early gene expression profile similar to C3H mice. Gene expression profiles at 2 and 4 wk postinfection revealed a common response of all strains that was likely to be important for the host defense to B. burgdorferi and mediated by NF-␬B-dependent signaling. The gene expression profiles identified in this study add to the current understanding of the host response to B. burgdorferi and identify two novel pathways that may be involved in regulating the severity of Lyme arthritis. The Journal of Immunology, 2006, 177: 7930–7942. http://www.jimmunol.org/

yme disease is a multisystem disorder caused by infection develop mild to moderate disease (8, 9). Although this difference with the tick-borne spirochete Borrelia burgdorferi (1). is not dependent on MHC alleles, it has been linked to quantitative L Signs of infection include a bull’s-eye rash at the site of trait loci (QTL)3 on 1, 4, 5, 11, and 12 (10, 11). the tick bite, termed erythema migrans, followed by dissemination Interestingly, infected C3H and C57BL/6 mice harbor similar of bacteria to various tissues resulting in neurological abnormali- numbers of bacteria in joint tissues, indicating that differences in ties, myocarditis, and arthritis (2). Lyme arthritis occurs in ϳ60% arthritis severity are not due to differences in host defense, but of individuals not treated with antibiotics at the time of the tick rather reflect different abilities to regulate the localized inflamma- by guest on September 25, 2021 bite, is associated with the presence of B. burgdorferi in joint tis- tory response (9). B. burgdorferi lipoprotein interaction with TLR2 sue, and resolves with successful antibiotic treatment (3, 4). A results in the production of proinflammatory cytokines and che- small percentage of individuals with subacute arthritis progress to mokines, several of which have been implicated in modulating the a chronic treatment-resistant arthritis that is no longer associated development of arthritis (12–15). Furthermore, C57BL/6 mice with bacteria in joint tissue and is postulated to be autoimmune- lacking the potent anti-inflammatory cytokine IL-10 (C57BL/6 IL- mediated (5, 6). 10Ϫ/Ϫ) develop more severe arthritis than wild-type C57BL/6 Infection-associated Lyme arthritis has been studied in the mice while more effectively controlling bacterial growth (16–18). mouse, where arthritis develops 3–4 wk following intradermal in- The mouse model of Lyme arthritis provides a unique opportu- oculation and is histopathologically similar to Lyme arthritis in nity to study contrasting responses to similar bacterial stimuli in humans (7, 8). The severity of arthritis is genetically regulated, mice developing severe or mild arthritis (8, 9, 19). Localized re- with C3H mice developing severe arthritis whereas C57BL/6 mice sponses to B. burgdorferi were assessed by global gene expression analysis in whole joint tissue from C3H, C57BL/6, and C57BL/ 6-IL-10Ϫ/Ϫ mice during the progression of disease development. *Department of Pathology, and †Department of Human Genetics, University of Utah, This analysis revealed the activation of two unexpected and diver- Salt Lake City, Utah 84112; ‡Department of Medical Microbiology and Immunology, gent pathways in response to infection in mice destined to develop § Medical University of Ohio, Toledo, Ohio 43614; and Department of Pathobiology, arthritis of different severities, and suggested that an early com- University of Illinois at Urbana-Champaign, Urbana, Illinois 61802 mitment to a gene expression phenotype in infected joint tissue Received for publication June 13, 2006. Accepted for publication September 12, 2006. could determine the severity of subsequent Lyme arthritis. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance Materials and Methods with 18 U.S.C. Section 1734 solely to indicate this fact. Mice 1 This work was supported by National Institutes of Health Grants (AI-32223 to J.J.W. and J.F.Z.; AR-43521 to J.J.W.; AI-24158 to J.H.W.; and HL-072903 to Female C3H/HeNCr (C3H) and C57BL/6NCr (C57BL/6) mice were ob- R.B.W.), National Institutes of Health/National Institute of Diabetes and Digestive tained from the National Cancer Institute, whereas female B6.129P2-IL- and Kidney Diseases Training Grant (DK07115 to H.C.), the American Heart Asso- 10tm1Cgn/J (C57BL/6-IL-10Ϫ/Ϫ) mice on the closely related C57BL/6J ciation (Grant 0335148N to R.M.W.), and by funds from Associated Regional Uni- mouse were obtained from The Jackson Laboratory. Mice were housed in versity Pathologists. 2 Address correspondence and reprint requests to Dr. Janis J. Weis, Department of Pathology, University of Utah School of Medicine, 15 North Medical Drive East, 3 Abbreviations used in this paper: QTL, quantitative trait loci; SAM, significance Room 2100, Salt Lake City, Utah 84112-5650. E-mail address: janis.weis@path. analysis of microarray; F, forward; R, reverse; KO, knockout; NC, not changed; utah.edu MMP, matrix metalloproteinase; TIMP, tissue inhibitor of MMP.

Copyright © 2006 by The American Association of Immunologists, Inc. 0022-1767/06/$02.00 The Journal of Immunology 7931 the Animal Resource Center at the University of Utah Health Science Cen- ter according to the guidelines of the National Institutes of Health for the care and use of laboratory animals. B. burgdorferi culture and infection Mice were infected by intradermal injection at 6 wk of age with 2 ϫ 103 B. burgdorferi clone N40 (provided by S. Barthold, University of Califor- nia, Davis, CA) that had been cultured for 4 days in Barbour-Stoenner- Kelly II medium containing 6% rabbit serum (Sigma-Aldrich). Assessment of infection status and arthritis severity Infection of mice was confirmed by culture of spirochetes from bladders, production of B. burgdorferi-specific Abs, and detection of B. burgdorferi recA in ear tissues by quantitative PCR (7, 20). Ankle swelling was used as a relative indicator of arthritis development in the actual tissue collected for microarray analysis and was determined from measurements made of the rear ankle joints with a metric caliper. Increases in ankle measurement were similar to those in previous studies, where complete histological as- sessment of arthritis severity was performed (9, 16). Isolation of RNA Downloaded from Total RNA was isolated from tissues and cells using acid guanidine ex- traction (21). Skin was removed from the rear ankles, and tissue extending ϳ5 mm in each direction was collected from infected and control mice at the indicated times. Joint tissues were flash frozen and homogenized in cold acid guanidine using an Ultra-Turrax disperser (IKA Works), and RNA was separated by cesium chloride cushion centrifugation. RNA was recovered by ethanol precipitation and applied to a RNeasy kit (Qiagen). http://www.jimmunol.org/ Gene expression analysis Equal amounts of total RNA from the more swollen ankle of five individual mice of each genotype from each time point were pooled into a single sample that was prepared for Affymetrix array hybridization according to the manufacturer’s instructions (Affymetrix) (22). cDNA was synthesized from 8 ␮g of total RNA and biotin-labeled using the One-Cycle Target Labeling Kit (Affymetrix). Each sample was hybridized to triplicate GeneChip arrays; either GeneChip Mouse Expression Array 430A (C3H/ HeN) or GeneChip Mouse Genome 430 2.0 Array (C57BL/6 and C57BL/6 IL-10Ϫ/Ϫ) (Affymetrix) depending on availability, and then stained and by guest on September 25, 2021 washed in the Affymetrix Fluidics Station 450 with program EukGE- WS2v4. Arrays were scanned with either the GeneArray 2500 Scanner (C3H/HeN) or GeneChip Scanner 3000 (C57BL/6 and C57BL/6 IL-10Ϫ/Ϫ) laser confocal slide scanner. Data from all GeneChips were preprocessed using the affy and gcRMA (Robust Multiarray Average) packages in R (23–25). Statistical analysis was performed using significance analysis of microarrays (SAM), and data were filtered based on a significant p value ( p Ͻ 0.05 as determined by SAM) (26). Transcripts with changes meeting significant p values were filtered based on fold change, and those with a FIGURE 1. Gene expression profiles as they relate to arthritis develop- change of 2-fold or greater were considered differentially expressed, ment. A, Ankle swelling was determined for each infected and uninfected whereas other transcripts were considered not changed (NC). The function mouse as tissues were collected for expression analysis, as described in of gene products was primarily determined with the National Cancer Materials and Methods. B, RT-PCR with primers for Borrelia 16S rRNA Institute/Center for Information Technology microarray database (NCI/ CIT mAdb, ͳhttp://www.cit.nih.gov/home.aspʹ) and with was performed on the individual RNA samples used for microarray to annotations according to Mouse Genome Informatics (27). In some cases, estimate relative levels of B. burgdorferi in tissues. Values for C3H and gene function was inferred based on the function of orthologous genes C57BL/6 mice were not significantly different at 1 and 2 wk of infection, and/or phenotype of other gene family members as determined from public whereas the difference at 4 wk was significant (p Ͻ 0.05, Student’s t test). databases such as Ensembl and Mouse Genome Informatics (27, 28). Mi- Differences between C57BL/6 and IL-10Ϫ/Ϫ mice were significant at 2 and croarray data from this manuscript may be accessed at the GEO database 4 wk of infection. C, Lines representative of gene expression reflect the ͗ ͘ http://www.ncbi.nlm.nih.gov/geo/ under accession no. GSE6055. average fold change of five genes selected from the IFN-responsive profile (Igtp, Iigp2, Iigp1, Tgtp, and Ifi1) and the epidermal differentiation profile Real-time quantitative RT-PCR (D)(Flg, Krt2–1, Hrnr, Sprr1b, and Lor. RT-RCR on 5 ␮g of total RNA was performed using random primers and M-MLV (Invitrogen Life Technologies). Quantitative PCR was performed using LightCycler SYBRPlus MasterMix on the Light- Cycler (Roche Applied Science). The oligonucleotide primers used to detect ␤-actin were bactin.F (forward) (5Ј-GTAACAATGCCATGTTCAAT-3Ј) and GTCAC-3Ј) and iigp1.R (5Ј-TACCTCCACCACCCCAGTTTTAGC-3Ј); Il1b bactin.R (reverse) (5Ј-CTCCATCGTGGGCCGCTCTAG-3Ј); Cxcl13 were were il1b.F (5Ј-TCCCAAGCAATACCCAAAGAGAA-3Ј) and il1b.R (5Ј-TG cxcl13.F (5Ј--3Ј) and cxcl13.R (5Ј--3Ј); Elovl4 were elovl4.F (5Ј-TACTA GGGAAGGCATTAGAAACAGTC-3Ј); Irf7 were irf7.F (5Ј-TGTGACCCTC TGGGCTGACTGCGTTCG-3Ј) and elovl4.R (5Ј-GACTGCTTCGGCTC AACACCCTAATACC-3Ј) and irf7.R (5Ј-CAATAGCCAGTCTCCAAACA ATTGTATGTC-3Ј); Flg were flg.F (5Ј-CAATGAAGACTGGGAGGCA GCAC-3Ј); Mmp3 were mmp3.F (5Ј-TTGTGTGCTCATCCTACCCATTG- AGC-3Ј) and flg.R (5Ј-TGACTGGAGATGGTTTGGAGTGG-3Ј); Hrnr 3Ј) and mmp3.R (5Ј-TTCCTCCATTTTGGCGAACC-3Ј); and Stat1 were were hrnr.F (5Ј-GCAACAAGATGCCTAAACTCCTGG-3Ј) and hrnr.R stat1.F (5Ј-CGTGGGAACGGAAGCATTTG-3Ј) and stat1.R (5Ј-ACGAGA (5Ј-GCTGGTGACTGTGATTTTTCTGC-3Ј); Igtp were igtp.F (5Ј-TAGAGC CATCATAGGCAGCGTG-3Ј). Primers for B. burgdorferi 16S rRNA were AGACCCACAGAGTTCAGG-3Ј) and igtp.R (5Ј-CAGCAGTCATAGATTT 5ЈGGTCAAGACTGACGCTGAGTCA and 5ЈGGCGGTCCACTTAACACG AGACCACGG-3Ј); Iigp1 were iigp1.F (5Ј-GTAGTGTGCTCAATGTTGCT TTAG, as described previously (29). 7932 NOVEL PATHWAYS IN B. burgdorferi INFECTION

Table I. Number of unique gene transcripts changed Ͼ2-fold in the joints of C3H, C57BL/6, and C57BL/6 IL-10Ϫ/Ϫ mice at 1, 2, and 4 wk postinfectiona

Arthritis Borreila no. Phenotypeb in Jointc 1wk 2wk 4wk

C3H/HeN Severe High 1156 2401 1695 2647 1456 2222 C57BL/6 Mild High 1119 26 1594 223 1340 221 IL-10 KO Intermediate Low 1419 1231 11332 2769 11423 2870

a Gene expression in ankle joint tissue at 1, 2, and 4 wk postinfection was compared to uninfected ankle joint tissue. Affymetrix probe sets identifying the same gene transcript were counted as a single gene transcript. b As described in Ref. 16 and Fig 1A. c As described in Ref. 16 and Fig 1B.

Design of microarray experiment changed by Ͼ2-fold that were common to C3H and C57BL/6 mice at 1 wk of infection (Figs. 2, 3A). Tissue from infected C57BL/6- Gene expression profiling using Affymetrix GeneChip microarrays was Ϫ/Ϫ performed during the development of arthritis of differing severities in IL-10 mice revealed 419 gene transcripts increased at 1 wk of C3H, C57BL/6, and C57BL/6-IL-10Ϫ/Ϫ mice infected with B. burgdorferi. infection and displayed clear overlap with those increased in C3H Expression profiles in joint tissues were determined at 1, 2, and 4 wk of mice (Fig. 3A). At 2 wk postinfection, significant recruitment of infection, and compared with mock-infected mice, age matched with the leukocytes to joint tissues is evident by histological analysis (7, 9), Downloaded from 1-wk time point. Previous studies indicated that by 1 wk of infection, B. burgdorferi had spread to the joint tissue, but that inflammatory cell infil- which was supported by the increase in a large number of genes in trate was not yet detectable, thus providing an opportunity to capture the all three strains of mice associated with host defense and inflam- early response of endogenous cells of the joint tissue to invading bacteria matory cell infiltrate (Fig. 3B). The 4-wk postinfection time point (4, 7). By 2 wk of infection, bacterial number was at its greatest and there represents the peak of arthritis as well as full development of the was robust inflammatory cell infiltrate, whereas the 4-wk time point was designed to coincide with the peak of arthritis development in C3H mice adaptive immune response, consistent with the identification of a http://www.jimmunol.org/ (4, 7). Expression profiles were performed on C57BL/6-IL-10Ϫ/Ϫ mice, group of genes induced only at this late time point. The number of which develop more severe arthritis than C57BL/6 mice, to help iden- genes changed at 4 wk was less than at 2 wk in both C3H and tify changes in gene expression that are common to the development of C57BL/6 mice, possibly reflecting resolution of infection and inflam- arthritis (16). matory response (Table I and Fig. 3C). In contrast, C57BL/6 IL- Because technical and biological variation were expected, RNA was Ϫ/Ϫ isolated from the joint tissue of five mice at each time point and pooled 10 mice displayed an exaggerated and uncontrolled response to before microarray analysis, which was performed in triplicate (30). Results infection, with the number of genes changed Ͼ2-fold still increasing were confirmed for selected transcripts by quantitative RT-PCR with the at the 4-wk time point. This is consistent with the potent ability of individual samples used to generate the pool, as well as confirmation IL-10 to regulate acute inflammatory processes (Table I) (32). of selected transcripts from individual animals infected in a second experiment. by guest on September 25, 2021 B. burgdorferi infection induces an early proinflammatory Results response in arthritis-susceptible C3H mice Overview of gene expression profiles At 1 wk of infection, C3H mice displayed a robust induction of genes indicative of a strong proinflammatory response by endog- B. burgdorferi infection of C3H, C57BL/6, and C57BL/6-IL- Ϫ Ϫ enous cells. In particular, the most highly increased genes were 10 / mice was followed over time, with measurements of rear those known to be inducible by type I (IFN-␣ and IFN-␤) and/or ankle swelling taken as an approximation of the progression of type II (IFN-␥) IFN (Table II). In fact, 36% (56 of 156) of the arthritis in the actual joint tissues pooled for microarray analysis genes induced Ͼ2-fold in C3H mice were clearly annotated as IFN (Fig. 1A). Although ankle measurements provide a limited assess- responsive, and 67 of the 100 most highly induced genes were ment of arthritis, the results reported in Fig 1A are similar to those either IFN responsive or could be linked to the induction and reg- in our previous report that included histological assessment of ar- 4 Ϫ Ϫ ulation of IFN responses (Fig. 2 and Supplement 1) (27). Addi- thritis development in C57BL/6-IL-10 / mice (16). To gain an tional genes increased in C3H mice could be indirectly linked to approximation of B. burgdorferi levels in the individual ankle tis- IFN by their role in regulation and development of the immune sues collected for microarray analysis, we performed RT-PCR us- response, such as Parp14, Bst2, and Nfil3 (Table II). The genes of ing primers for the flaB gene and for 16S rRNA of Borrelia (29, the C3H profile were highly induced, up to 120-fold compared 31). Results were similar with the two primer sets and are shown with uninfected joint tissue. It is difficult to assign responsibility for the more sensitive 16S rRNA (Fig. 1B). Similar levels of 16S for this robust IFN response because changes were not detected in rRNA were present in ankle tissues from C3H and C57BL/6 mice either type I or type II IFN transcripts in C3H or C57BL/6 mice at at 1 and 2 wk of infection, whereas at 4 wk of infection 16S rRNA any time, and most of the genes listed in Table II can be induced levels were greater in C57BL/6 than C3H joint tissues. 16S rRNA by either type I or type II IFN (including the highly induced Iigp1, was not detected in samples from uninfected mice, and levels of Gbp1, and Tap1 (27, 33)). The increased transcript levels for the 16S rRNA were much lower at all time points in C57BL/6-IL- Ϫ Ϫ signaling molecules Stat1, Irf1, Irf7, and Irf8 also did not provide 10 / mice than in either wild type, consistent with previous re- strong evidence for the selective presence of type I or type II IFN ports using quantitative PCR detection of DNA in tissues (16). (Table II) (33). Affymetrix GeneChip array analysis revealed alterations in ex- In striking contrast, none of the IFN-inducible gene transcripts pression of discrete subsets of genes in RNA collected from the was increased Ͼ2-fold at 1 wk postinfection in the ankle joints of joint tissue of infected mice. At 1 wk of infection, transcripts from C57BL/6 mice (Table II and Fig. 2). Although some IFN-inducible 156 genes were increased by Ͼ2-fold in C3H mice, whereas in transcripts were increased by 2 wk postinfection, the magnitude of C57BL/6 mice 119 transcripts were increased; this result is based on the 22,000 unique transcripts included on GeneChip 430A of the mouse (Table I). Interestingly, there were only three transcripts 4 The on-line version of this article contains supplemental material. The Journal of Immunology 7933

of the Ͼ100 genes increased at 1 wk postinfection, some up to 40-fold, only two genes were shared with C3H mice, serum amy- loidA3(Saa3) and the chemokine Ccl12 (Fig. 2). In C57BL/6 mice, a large number (55%; 65 of 119) of transcripts increased Ͼ2-fold, and 75 of the 100 most highly induced transcripts at 1 wk postinfection were involved in epidermal differentiation, cell ad- hesion, and cell-cell interaction or wound repair (Table III and Supplement 2) (27, 34). Increased expression of genes involved in FIGURE 2. Distinct gene expression profiles at 1 wk postinfection in epidermal development was surprising because all skin was re- C3H/HeN and C57BL/6 mice. Of the 100 most highly increased transcripts moved from the joint tissue before collection, and expression was in C3H mice, 67 were related to the IFN response, whereas 75 of the 100 most increased transcripts in C57BL/6 mice were related to epidermal dif- low in joint tissue collected from uninfected C57BL/6 mice. The ferentiation and wound repair. Only 2 of the 100 most highly increased increased expression of genes involved in wound repair, such as transcripts were shared in the two mouse strains, Saa3 and Ccl12. Krt-2a, and cell-cell interactions, such as Ly6d and Dsp, could be suggestive of a response to disseminating bacteria (35, 36). change was generally much less than that seen in C3H mice, sug- Of note, most of the 119 genes which increased Ͼ2-fold at 1 wk gesting that ankle tissues of C57BL/6 mice have a temporally de- postinfection in the joints of C57BL/6 mice were decreased in layed and diminished IFN response to B. burgdorferi infection C3H mice, and comprised a subset of the 401 genes decreased by (Table II, Fig. 1C, and Supplement 2). The association with ar- Ͼ2-fold in C3H mice (Figs. 1D and 3A, Table III, and Supple- thritis was further strengthened by findings with C57BL/6-IL- ments 1and 2). Seventy-six of the genes with reduced expression Downloaded from Ϫ Ϫ 10Ϫ/Ϫ mice, which displayed robust induction of many of the IFN- in C3H mice were also reduced in C57BL/6 IL-10 / mice (Table responsive genes characteristic of the expression profile found III, Fig. 3A), suggesting that regulation of this response could be with severely arthritic C3H mice (Table II, Fig. 3A, and Supple- related to the inflammatory status of the tissue. Differential expres- ment 3). Although the IFN-induced profile was delayed in IL- sion of this epidermal differentiation/wound repair profile was 10Ϫ/Ϫ mice, the levels of IFN-inducible genes remained elevated most evident at 1 wk postinfection; however, elevation in C57BL/6 Ϫ Ϫ throughout the course of infection rather than returning to baseline mice and reduction in C3H and C57BL/6-IL-10 / mice was http://www.jimmunol.org/ as seen with C3H mice (Table II and Fig. 1C) (17, 32). These maintained at 2 and 4 wk postinfection with B. burgdorferi (Fig. findings suggest that early production of IFN in the environment of 1D). Interestingly, not all genes induced during epidermal differ- the C3H mouse joint is associated with inflammatory events of entiation were altered during B. burgdorferi infection, including arthritis development and that its absence from C57BL/6 mice is Ivl, Ppl, and Sprr2f (Table III) (27). protective. RT-PCR was used to assess the transcriptional pattern for se- The expression levels of several highly changed transcripts in- lected epidermal differentiation/wound repair gene transcripts from cluding Iigp1 and Igtp and the signaling molecules Stat1 and Irf7 Table III, including Flg, Hrnr, and Elovl4. Changes observed by were assessed in individual mice using quantitative RT-PCR (Fig. microarray analysis in pooled samples were reproducibly present by guest on September 25, 2021 4A–D). The trends of expression observed by microarray analysis in the joints of five individual mice comprising the pools for each were confirmed by RT-PCR for all genes tested, and selected ex- time point (Fig. 4, E–G) and in tissues from a second infection pression patterns were confirmed with samples from a second in- experiment (data not shown). These data demonstrate that the in- fection experiment. This result provides important documentation creased expression of the epidermal transcripts in C57BL/6 mice that the microarray analysis reflected the contribution of individual and reduced expression in C3H and IL-10Ϫ/Ϫ mice was a feature mice rather than the dominant expression of an aberrant sample in of the response to B. burgdorferi infection that correlated with the the pool and indicate that the robust induction of IFN-responsive severity of arthritis. genes in joint tissue is a universal feature of the early response of Great care was taken in the removal of skin from the ankle joints C3H mice to B. burgdorferi infection that is absent in the early used in this study, and histological assessment of many rear ankle response of C57BL/6 mice. tissues prepared in the same manner as for microarray has not revealed differences in the inclusion of skin tissue in the joints of A novel group of genes is selectively increased in infected any mouse genotype. To determine whether altered expression of C57BL/6 mice the epidermal profile was a generalized response to infection of the Joint tissue from C57BL/6 mice displayed elevation of an entirely skin or whether it was a response unique to the joint tissue, RT- different set of genes than C3H mice at 1 wk postinfection. In fact, PCR was performed on RNA prepared from the ears of infected

FIGURE 3. The number of transcripts changed Ͼ2-fold in the joint tissue of C3H/HeN, C57BL/6, and C57BL/6 IL-10Ϫ/Ϫ mice at 1 wk (A),2wk(B), and4wk(C) postinfection. The number of nonredundant transcripts with significant p values and changes Ͼ2-fold were detected by microarray analysis as described in Materials and Methods, with arrows indicating induction or reduction relative to joint tissue from uninfected mice. Transcripts with changed values that were shared among strains are placed within the appropriate common areas of the Venn diagrams. 7934

Table II. Expression levels of selected IFN-responsive gene transcripts increased at 1 wk postinfection in joints tissue of C3H micea

1wk 2wk 4wk Gene Probe Set ID Gene Title Symbol C57BL/6 C3H/HeN IL-10 KO C57BL/6 C3H/HeN IL-10 KO C57BL/6 C3H/HeN IL-10 KO

IFN-inducible genes 1417141_at IFN-␥-induced GTPase Igtp NC 128 NC 7.1 16 49 NC 3.6 49 1417793_at IFN-inducible GTPase 2 Iigp2 NC 123 2.4 4.8 12 35 NC 2.6 38 1419042_at IFN-inducible GTPase 1 Iigp1 NC 113 2.5 12 16 62 2.4 5.3 86 1449009_at T cell-specific GTPase Tgtp NC 42 2.5 7.5 14 72 2.1 5.3 77 1438676_at activation 2 like Mpa21 NC 36 NC 4.1 3.6 31 NC NC 36 1418825_at IFN-inducible 1 Ifi1 NC 35 NC 3.6 3.3 32 NC NC 34 1419714_at CD274 Ag Cd274 NC 33 NC 5.3 5.1 53 NC NC 57 1416016_at Transporter 1, ATP-binding cassette, subfamily B Tap1 NC 15 2.0 6.4 5.8 34 2.1 2.6 35 (MDR/TAP) 1418240_at Guanylate nucleotide-binding protein 2 Gbp2 NC 12 2.8 12 4.1 72 2.6 2.1 71 1450696_at Proteosome (prosome, macropain) subunit, ␤ Psmb9 NC 11 NC 6.5 7.9 40 2.4 3.6 45 type 9 (large multifunctional protease 2) 1453196_a_at 2Ј–5Ј oligoadenylate synthetase-like 2 Oasl2 NC 4.4 4.2 2.8 NC 29 NC NC 33 Signaling molecules

1450034_at Signal transducer and activator of transcription 1 Stat1 NC 23 2.1 3.0 5.2 24 NC NC 39 IN PATHWAYS NOVEL 1448436_a_at IFN regulatory factor 1 Irf1 NC 4.5 NC 2.7 2.5 15 NC NC 16 1417244_a_at IFN regulatory factor 7 Irf7 NC 4.0 2.1 2.2 NC 18 NC NC 16 1416714_at IFN regulatory factor 8 Irf8 NC 3.8 NC 4.9 4.0 15 2.5 NC 15 1418131_at SAM domain and HD domain, 1 Samhd1 NC 4.7 NC 4.0 6.0 24 NC 2.5 21 1418265_s_at IFN regulatory factor 2 Irf2 NC NC NC NC NC NC NC NC 2.1 Other 1451564_at Poly(ADP-ribose) polymerase family, member 14 Parp14 NC 7.3 NC 2.9 3.2 15 NC NC 16 1429947_a_at Z-DNA-binding protein 1 Zbp1 NC 5.3 NC 4.9 3.4 40 NC 2.1 47 1438855_x_at TNF, ␣-induced protein 2 Tnfaip2 NC 4.5 NC NC 2.0 5.1 NC NC 6.2 1424921_at Bone marrow stromal cell Ag 2 Bst2 NC 3.8 NC 2.7 2.1 11 NC NC 13

a Gene expression in ankle joint tissue at 1, 2, and 4 wk postinfection was compared to uninfected ankle joint tissue. Numbers indicate fold change. Changes Ͻ2-fold are designated “NC.” burgdorferi B.

INFECTION

Downloaded from from Downloaded http://www.jimmunol.org/ by guest on September 25, 2021 25, September on guest by The Journal of Immunology 7935

FIGURE 4. Quantification of selected gene transcripts in the joints of individual mice. Expres- sion level of IFN-related transcripts Iigp1 (A), Igtp (B), Stat1 (C), and Irf7 (D); epidermal differenti- ation-related transcripts Flg (E), Hrnr (F), and Elovl4 (G); transcripts associated with the host de- fense Cxcl13 (H) and Il1b (I); and a transcript as- sociated with chondrocyte activation Mmp3 (J) were determined using quantitative RT-PCR. Fold Downloaded from change was determined based on the difference between the five individual mice used to generate pooled samples and the average of uninfected con- trols. In all cases, trends observed by microarray were confirmed by RT-PCR analysis. http://www.jimmunol.org/ by guest on September 25, 2021

and uninfected mice. Transcript levels for filaggrin were not mice displayed a less robust induction of Cxcl13 (Table IV). In changed in ear tissue from infected C3H or C57BL/6 mice, sug- fact, Cxcl13 was the only chemokine with greater induction in gesting that this differential response to infection was specific for C57BL/6 mice than in C57BL/6 IL-10Ϫ/Ϫ mice, an interesting the ankle tissue (data not shown). finding in light of the clinical association between Cxcl13 expres- sion and spirochete load in neuroborreliosis (38) and the reduced B. burgdorferi infection results in expression of genes involved presence of B. burgdorferi in the joints of IL-10Ϫ/Ϫ mice (Fig. 1B). in host defense Expression profiles for many of the chemokines were confirmed by In addition to the very distinct gene expression profiles seen early RT-PCR in individual mice, with the unique profile for Cxcl13 during infection that correlate with arthritis severity, all three shown in Fig. 4H. strains of mice shared a common response to B. burgdorferi that Genes whose expression is associated with host defense were also was evident at 2 and 4 wk postinfection (Fig. 3, B and C). The increased at 2 wk of infection, including additional markers for neu- recruitment of PMNs is a hallmark of Lyme arthritis (8, 15), and trophils and , Mpo, Cd14, Tlrs, Fc receptors, and argi- by 2 wk of infection modest increases (5-fold) in the PMN-recruit- nase. Complement component C1qa, C1qb, C1qg, C1r, C2, and C3 ing chemokines Cxcl1, Cxcl2, and Cxcl5 were seen in both C3H transcripts were modestly increased in the joints of both C3H and and C57BL/6 mice as well as increased levels of PMN gene prod- C57BL/6 mice, further suggesting the presence of activated mac- ucts such as Mpo, Ncf1, and Ncf4 (Table IV and Supplements 1–3). rophages (Table IV). Transcripts for markers of APCs and Ag- Additionally, increased transcription of several mononuclear cell- processing machinery, including the MHC, Cd1, Tap1/2, and recruiting chemokines, such as Ccl2, Ccl3, Ccl7, and Ccl12, was proteosome subunits indicated the presence of an active ac- observed (37). The IFN-responsive T cell-recruiting chemokine quired host defense in joint tissues at 2 and 4 wk of infection, Cxcl9 was increased in both C3H and C57BL/6 mice over the as did the increased expression of Ig genes (Table IV) (27). course of infection, whereas Cxcl10 was also highly induced in Borrelia and its lipoproteins are known to activate NF-␬B and joints of C57BL/6 and C57BL/6-IL-10Ϫ/Ϫ mice (Table IV) (37). induce the production of many cytokines including IL-6, IL-1␤, Additional T cell-recruiting chemokines were increased during in- TNF-␣, and IL-12 in vitro (39, 40). Surprisingly, IL-1␤ was the fection in both C3H and C57BL/6 mice, including Cxcl16, Ccl2, only hallmark inflammatory cytokine to be increased in either C3H and Ccl7, (37). Transcript levels for the B cell chemokine Cxcl13 or C57BL/6 ankle tissue (Table IV and Fig. 4I). In contrast, tran- were dramatically increased in the joints of both C57BL/6 and scripts for many cytokines were robustly induced at 2 and 4 wk of C3H mice by 2 wk infection, whereas joints of C57BL/6-IL-10Ϫ/Ϫ infection in the IL-10Ϫ/Ϫ mice (including IL-1b, IFN-␥, IL-6, IL-7, 7936

Table III. Expression levels of selected epidermal differentiation/wound repair-associated gene transcripts increased at 1 wk postinfection in joint tissue of C57BL/6 micea

1wk 2wk 4wk Gene Ϫ Ϫ Ϫ Ϫ Ϫ Ϫ Probe Set ID Gene Title Symbol C57BL/6 C3H/HeN IL10 / C57BL/6 C3H/HeN IL10 / C57BL/6 C3H/HeN IL10 /

Structural molecules 1427268_at Filaggrin Flg 47 Ϫ12 Ϫ23 24 Ϫ7.2 NC 66 Ϫ16 Ϫ17 1422481_at Keratin complex 2, basic, gene 1 Krt2-1 38 Ϫ124 Ϫ41 16 Ϫ3.7 NC 67 Ϫ131 Ϫ23 1451613_at Hornerin Hmr 36 Ϫ8.6 Ϫ18 31 Ϫ5.7 Ϫ5.3 90 Ϫ10 Ϫ17 1427154_at Keratin complex 2, basic, gene 17 Krt2-17 24 Ϫ86 Ϫ6.8 17 Ϫ6.7 NC 40 Ϫ90 Ϫ6.8 1422672_at Small proline-rich protein 1B Sprr1b 20 Ϫ7.0 Ϫ13 14 Ϫ5.9 Ϫ2.1 74 Ϫ8.9 Ϫ13 1420183_at Loricrin Lor 8.5 Ϫ18 Ϫ2.7 5.6 Ϫ5.0 NC 10 Ϫ24 Ϫ6.3 1422667_at Keratin complex 1, acidic, gene 15 Krt1-15 6.7 NC NC 3.7 NC NC 5.9 Ϫ2.1 NC 1422222_at Involucrin Iv1 NC NC NC NC NC NC NC NC NC 1460732_a_at Periplakin Pp1 NC NC NC NC NC NC NC NC NC 1449833_at Small proline-rich protein 2F Sprr2f NC NC NC NC NC NC NC NC NC Cell adhesion/cell-cell interactions 1416930_at Lymphocyte Ag 6 complex, locus D Ly6d 15 Ϫ7.8 Ϫ3.1 8.5 Ϫ6.5 NC 25 Ϫ9.2 Ϫ2.9 1435493_at Desmoplakin Dsp 15 Ϫ7.3 Ϫ5.3 8.4 Ϫ4.5 NC 24 Ϫ9.4 Ϫ5.0 1435191_at Corneodesmosin Cdsn 14 Ϫ4.9 Ϫ5.0 7.0 Ϫ3.3 NC 24 Ϫ5.9 Ϫ7.5 1418799_a_at Procollagen, type XVII, alpha 1 Col17a1 7.3 Ϫ3.6 Ϫ2.0 3.4 Ϫ3.2 NC 7.0 Ϫ4.9 Ϫ3.5 Wound response related 1421752_a_at Serine (or cysteine) proteinase inhibitor, Serpinb5 11 Ϫ4.4 Ϫ4.1 7.1 Ϫ2.2 NC 23 Ϫ3.4 Ϫ3.6 IN PATHWAYS NOVEL clade B, member 5 1421092_at Serine (or cysteine) proteinase inhibitor, Serpina12 4.7 Ϫ3.1 Ϫ4.8 3.1 Ϫ2.7 NC 10 Ϫ3.4 Ϫ5.5 clade A (␣-1 Antiproteinase, antitrypsin), member 12 1422784_at Keratin complex 2, basic, gene 6a Krt2-6a 3.7 Ϫ2.2 NC 3.9 Ϫ2.1 6.6 8.2 Ϫ2.2 NC Other 1450633_at Calmodulin 4 Calm4 29 Ϫ86 Ϫ10 16 Ϫ7.7 NC 49 Ϫ134 Ϫ13 1424306_at Elongation of very long chain fatty acids Elov14 14 Ϫ4.5 NC 7.0 Ϫ4.1 NC 15 Ϫ5.7 Ϫ3.0 (FEN1/Elo2, SUR4/Elo3, yeast)-like 4 1450645_at Metallothionein 4 Mt4 20 Ϫ22 Ϫ12 6.5 Ϫ4.4 NC 36 Ϫ30 Ϫ9.0 .burgdorferi B. a Gene expression in ankle joint tissue at 1, 2, and 4 wk postinfection was compared to uninfected ankle joint tissue. Numbers indicate fold change. Numbers preceded by a “_” are reduced compared to uninfected ankle joint tissue. Changes Ͻ2-fold are designated “NC.”

INFECTION

Downloaded from from Downloaded http://www.jimmunol.org/ by guest on September 25, 2021 25, September on guest by h ora fImmunology of Journal The Table IV. Expression levels of genes involved in the immune response that are changed Ͼ2-fold a

1wk 2wk 4wk Gene Ϫ Ϫ Ϫ Ϫ Ϫ Ϫ Probe Set ID Gene Title Symbol C57BL/6 C3H/HeN IL10 / C57BL/6 C3H/HeN IL10 / C57BL/6 C3H/HeN IL10 /

Chemokines 1420380_at Chemokine (C-C motif) ligand 2 Ccl2 NC NC 2.1 22 6.7 42 3.7 2.8 66 1419561_at Chemokine (C-C motif) ligand 3 Ccl3 NC NC NC 14 NC 7.5 2.4 NC 11 1417266_at Chemokine (C-C motif) ligand 6 Ccl6 NC NC NC 2.9 NC 7.0 NC NC 5.2 1421228_at Chemokine (C-C motif) ligand 7 Ccl7 NC NC NC 13 11 28 3.4 4.6 49 1419684_at Chemokine (C-C motif) ligand 8 Ccl8 NC 2.9 NC 7.6 15 48 4.9 9.7 84 1417936_at Chemokine (C-C motif) ligand 9 Ccl9 NC NC NC 4.0 3.3 3.4 2.0 NC 3.0 1419282_at Chemokine (C-C motif) ligand 12 Ccl12 2.5 2.6 NC 41 2.0 17 3.5 NC 32 1419209_at Chemokine (C-X-C motif) ligand 1 Cxcl1 NC NC 3.4 5.9 5.6 34 3.4 5.7 79 1449984_at Chemokine (C-X-C motif) ligand 2 Cxcl2 NC NC 2.2 5.7 NC 17 NC NC 20 1419728_at Chemokine (C-X-C motif) ligand 5 Cxcl5 NC NC NC NC 6.7 13 NC 5.6 27 1418480_at Chemokine (C-X-C motif) ligand 7 Cxcl7 NC NC 2.4 NC NC NC NC NC NC 1418652_at Chemokine (C-X-C motif) ligand 9 Cxcl9 NC 17 3.1 60 10 596 12 3.6 811 1418930_at Chemokine (C-X-C motif) ligand 10 Cxcl10 NC 2.6 2.7 11 NC 141 2.3 NC 189 1448823_at Chemokine (C-X-C motif) ligand 12 Cxcl12 NC Ϫ2.0 NC NC NC 2.1 NC 2.2 2.6 1417851_at Chemokine (C-X-C motif) ligand 13 Cxcl13 2.3 NC NC 401 37 7.8 121 45 20 1418457_at Chemokine (C-X-C motif) ligand 14 Cxcl14 NC NC NC NC 5.4 NC NC 2.8 NC 1449195_s_at Chemokine (C-X-C motif) ligand 16 Cxcl16 NC NC NC 6.4 7.9 15 4.3 3.3 22 1415803_at Chemokine (C-X3-C motif) ligand 1 Cx3cl1 NC NC NC NC NC NC NC NC 3.0 Chemokine receptors 1419609_at Chemokine (C-C motif) receptor 1 Ccr1 NC NC NC 2.5 NC 3.1 NC NC 2.4 1421187_at Chemokine (C-C motif) receptor 2 Ccr2 NC NC 2.4 4.0 NC 8.8 2.1 NC 18 Cytokines 1425947_at IFN-␥ Ifng NC NC NC NC NC 16 NC NC 22 1450330_at IL-10 Il10 NC NC NC 2.2 NC 6.2 NC NC 6.4 1418219_at IL-15 Il15 NC NC NC NC NC 2.8 NC NC 3.4 1449399_a_at IL-1␤ Il1b NC NC NC 4.0 3.1 13 2.9 2.5 42 1421370_a_at IL-1 family, member 5 (␦) Il1f5 2.6 NC NC NC NC NC 6.5 Ϫ2.1 NC 1451798_at IL-1 receptor antagonist Il1m NC NC NC 9.4 NC 14 3.0 NC 22 1421034_a_at IL-4 receptor, ␣ Il4ra NC NC NC NC 3.3 4.8 NC NC 5.5 1450297_at IL-6 Il6 NC NC NC NC NC 13 NC NC 72 1436861_at IL-7 Il7 NC NC NC NC NC NC NC NC 2.1 1419135_at Lymphotoxin B Ltb NC NC NC NC NC 4.3 NC NC 4.2 1418345_at TNF (ligand) superfamily, member 13 Tnfsf13 NC NC NC NC NC NC NC 2.1 2.3 1460255_at TNF (ligand) superfamily, member 13b Tnfsf13b NC NC NC 4.3 NC 6.6 3.2 NC 10 Innate immune response 1419549_at Arginase 1, liver complement component 1, Arg1 2.1 Ϫ4.2 NC 63 NC 47 16 Ϫ2.8 32 q subcomponent, ␣ 1417381_at Polypeptide complement component 1, C1qa NC NC NC 2.9 2.3 4.8 2.3 2.9 5.2 q subcomponent, ␤ 1417063_at Polypeptide complement component 1, C1qb NC NC NC 4.2 3.3 6.7 2.9 3.5 7.7 q subcomponent, ␥ 1449401_at Polypeptide C1qg NC NC NC 3.2 3.1 5.5 2.6 2.6 5.9 1417009_at Complement component 1, r subcomponent C1r NC NC NC NC 2.6 6.8 NC 2.5 7.6 1416051_at Complement component 2 (within H-2S) C2 NC NC NC NC 2.2 6.2 NC NC 8.8 1423954_at Complement component 3 C3 NC NC NC 3.4 3.9 10 2.5 2.1 11 1460334_at Drebrin-like Dbn1 NC NC NC NC NC 3.5 NC NC 3.8 1425548_a_at Leukocyte specific transcript 1 Lst1 NC NC NC 7.4 16 16 2.5 4.5 12 7937

(Table continues)

Downloaded from from Downloaded http://www.jimmunol.org/ by guest on September 25, 2021 25, September on guest by 7938

Table IV. (Continued)

1wk 2wk 4wk Gene Ϫ Ϫ Ϫ Ϫ Ϫ Ϫ Probe Set ID Gene Title Symbol C57BL/6 C3H/HeN IL10 / C57BL/6 C3H/HeN IL10 / C57BL/6 C3H/HeN IL10 /

1455346_at Mannan-binding lectin serine protease 1 Masp1 NC NC NC NC NC Ϫ3.7 NC NC Ϫ4.6 1415960_at Myeloperoxidase Mpo NC NC 4.3 Ϫ2.2 NC 6.2 Ϫ2.0 NC NC 1425609_at Neutrophil cytosolic factor 1 Ncf1 NC NC NC 4.8 NC 9.6 NC NC 12 1448561_at Neutrophil cytosolic factor 2 Ncf2 NC NC NC 4.3 3.5 5.8 NC NC 5.1 1418465_at Neutrophil cytosolic factor 4 Ncf4 NC NC NC 6.7 7.6 6.7 3.2 3.2 6.4 1452279_at Properdin factor, complement Pfc NC NC NC 6.5 7.0 11 NC 2.7 6.3 1416625_at Serine (or cysteine) proteinase inhibitor, clade G, member 1 Serping1 NC NC NC NC NC NC NC NC 2.1 Adaptive immune response 1449289_a_at ␤-2-microglobulin B2m NC NC NC 2.7 3.9 4.6 NC 2.8 4.9 1449130_at CD1d1 Ag Cd1d1 NC 2.0 NC NC NC NC NC NC NC 1417597_at CD28 Ag Cd28 NC NC NC NC NC 2.9 NC NC 2.6 1426324_at Histocompatibility 2, D region locus 1 H2-D1 NC 2.2 NC 2.5 2.3 7.8 NC NC 8.7 1427746_x_at Histocompatibility 2, K1, K region H2-K1 NC 2.1 2.5 3.7 6.1 15 2.1 2.9 17 1425385_a_at Ig H chain 1a (serum IgG2a) Igh-1a NC NC NC NC NC 2.4 4.8 NC 130 1451632_a_at Ig H chain 1a (serum IgG2a) Igh-1a NC NC NC NC NC NC NC 17 NC 1425247_a_at Ig H chain 4 (serum IgG1) Igh-4 NC NC NC NC NC 2.0 NC 5.7 5.0 1425324_x_at Ig H chain 4 (serum IgG1) Igh-4 NC NC NC NC NC NC NC 9.0 2.9 1427756_x_at Ig H chain 4 (serum IgG1) Igh-4 NC NC NC NC NC NC NC 7.0 2.8 1424305_at Ig joining chain Igj NC NC NC NC NC NC 32 6.0 28 1425519_a_at Ia-associated invariant chain Ii NC NC NC 3.6 2.7 10 2.8 NC 13 1422962_a_at Proteosome (prosome, macropain) subunit, ␤ type 8 (large Psmb8 NC 7.4 2.2 6.0 9.4 43 2.6 4.5 46 multifunctional protease 7) 1450696_at Proteosome (prosome, macropain) subunit ␤ type 9 (large Psmb9 NC 11 NC 6.5 7.9 40 2.4 3.6 45 multifunctional protease 2) 1417056_at Proteasome (prosome, macropain) 28 subunit, ␣ Psme1 NC 2.2 NC NC 2.6 5.0 NC NC 4.2

1416016_at Transporter 1, ATP-binding cassette, subfamily B (MDR/ Tap1 NC 15 2.0 6.4 5.8 34 2.1 2.6 35 IN PATHWAYS NOVEL TAP) 1453913_a_at Transporter 2, ATP-binding cassette, subfamily B (MDR/ Tap2 NC 4.0 NC 2.3 NC 12 NC NC 12 TAP) Cell surface receptors 1417268_at CD14 Ag Cd14 NC NC NC 6.4 5.7 4.9 3.2 3.8 5.1 1460251_at Fas (TNF receptor superfamily member) Fas NC NC NC NC NC 2.4 NC NC 3.0 1418340_at Fc receptor, IgE, high-affinity I, ␥ polypeptide Fcer1g NC NC NC 5.4 6.0 9.5 2.5 3.3 8.4 1417876_at Fc receptor, IgG, high-affinity I Fcgr1 NC NC 2.2 14 8.0 48 3.3 3.0 51 1451941_a_at Fc receptor, IgG, low-affinity IIb Fcgr2b NC Ϫ3.0 NC 4.4 2.4 7.3 2.1 2.6 9.2 1448620_at Fc receptor, IgG, low-affinity III Fcgr3 NC NC NC 4.9 5.7 6.9 2.7 3.2 7.4

1422903_at Lymphocyte Ag 86 Ly86/MD-1 NC NC NC 6.3 8.7 11 3.8 4.1 12 burgdorferi B. 1449874_at Lymphocyte Ag 96 Ly96/MD-2 NC NC NC NC NC 3.5 NC NC 4.3 1449184_at Peptidoglycan recognition protein 1 Pglyrp1 NC NC NC NC NC 3.2 NC NC NC 1417860_a_at Spondin 2, extracellular matrix protein Spon2 NC NC NC NC NC NC NC 2.1 4.7 1449049_at TLR1 Tlr1 NC NC NC 13 NC 20 3.4 NC 23 1419132_at TLR2 Tlr2 NC NC NC 6.1 4.3 7.4 3.4 3.2 13 1422781_at TLR3 Tlr3 NC NC NC NC NC 2.7 NC NC 4.6 INFECTION 1418163_at TLR4 Tlr4 NC NC NC NC NC 2.1 NC NC 2.6 1421352_at TLR6 Tlr6 NC NC NC 2.1 NC 2.8 NC NC 3.7 1449473_s_at TNF receptor superfamily, member 5 Tnfrsf5 NC NC NC 2.1 2.4 6.1 NC NC 10

(Table continues)

Downloaded from from Downloaded http://www.jimmunol.org/ by guest on September 25, 2021 25, September on guest by The Journal of Immunology 7939

IL15, and TNF family members), indicating that B. burgdorferi does induce these cytokines in the joint but that in the presence of

Ϫ / IL-10 their levels are quite low (Table IV and Supplement 3). In fact, RT-PCR, which is much more sensitive than microarray anal- ysis, did reveal the presence of extremely low levels of transcripts for IL-6, TNF, IFN-␤, and IFN-␥ in the joint tissues of infected

4wk C3H and C57BL/6 mice, with levels below detection in uninfected tissues (data not shown). These results may explain the failure to detect significant changes by microarray. Taken together, they sug- gest that whereas the contribution of proinflammatory cytokines appears to be tightly controlled in wild-type mice, it is not a dom- C57BL/6 C3H/HeN IL10 inant feature of the localized response to infection in joint tissue. Interestingly, RT-PCR analysis of spleen samples from infected Ϫ / mice also revealed very low levels of these proinflammatory cy- Ϫ 2.3 NC NC NC tokines and of the IFN-inducible genes Igtp and Iipt (data not shown).

B. burgdorferi infection activates chondrocytes and triggers 2wk

reactive responses in C3H mice Downloaded from The most severe manifestation of arthritis in C3H mice includes evidence of reactive processes such as the formation of foci of new

C57BL/6 C3H/HeN IL10 chondrocytes and new bone formation at 4 wk of infection (4, 9). Microarray revealed modest increases in gene products associated

Ϫ / with chondrocytes from the joints of 4 wk postinfection C3H

mice, including several collagen genes, such as Ctsk and Dspg3 http://www.jimmunol.org/ (Table V). Quantification of Col1␣2 by RT-PCR demonstrated a range of expression, and in this case only a portion of the individ- ual samples (3 of 5) showed increased expression of this gene late 1wk in disease. Future studies will be required to determine whether associations between gene induction and clinical markers of dis- ease can be made. Interesting, many of these genes associated with end-stage arthritis are also induced in rodent models of rheumatoid C57BL/6 C3H/HeN IL10 arthritis (41). In agreement with findings reported by others (42, 43), tran- by guest on September 25, 2021 scripts for Mmp3, Mmp9, Mmp13, and Mmp23, as well as tissue inhibitor of matrix metalloproteinase 1 (Timp1) were induced in Gene Symbol the joints of C3H mice, whereas transcripts for Mmp3, Mmp8, and Timp1 were increased in C57BL/6-IL-10Ϫ/Ϫ mice (Table V). Mmp3 expression was also increased in joints of C57BL/6 mice, but to a lesser extent than in C3H or C57BL/6-IL-10Ϫ/Ϫ mice. Expression profiles of several of the metalloproteinases were con- firmed by RT-PCR with individual mice, with results for Mmp3 shown in Fig. 4J.

Discussion The murine model of Lyme disease initially developed by Barthold et al. (8) has provided a unique opportunity to study the localized response to a similar infectious challenge in tissues that will ulti-

Gene Title mately develop distinct severities of arthritis (9, 19). The response to invading bacteria at 1 wk of infection precedes the influx of inflammatory cells and revealed a dramatic difference in the local- ized response. Although C3H mice displayed a robust response dominated by IFN-inducible transcripts, these transcripts were ab- sent at 1 wk from infected C57BL/6 mice (Table II and Figs. 1 and 2). Instead, the C57BL/6 mouse displayed an increase in an en- tirely distinct and unexpected group of genes previously associated with epidermal differentiation and wound repair (Table III). The C57BL/6-IL-10Ϫ/Ϫ mouse shared expression profiles with the C3H mouse, implicating the IFN response in arthritis development rather than in a strain-specific response to infection, and suggesting that suppression of the IFN response in C57BL/6 mice was crucial

Probe Set ID to suppression of arthritis (Figs. 1 and 3). 1422133_at1417976_at Sialophorin1424923_at1449361_at Adenosine deaminase Serine (or cysteine) proteinase T-box inhibitor, 21 clade A, member 3G Serpina3g NC 6.6 2.1 Ada 8.4 Spn 2.1 NC Tbx21/Tbet NC 119 NC NC NC NC NC NC NC NC NC NC 2.1 114 4.2 NC NC NC 4.2 3.6 NC 2.7 NC 2.5 NC NC NC 4.0 4.6 2.4 1423048_a_at1419272_at Toll-interacting protein1417856_at1418110_a_at Myeloid differentiation primary1422932_a_at response Avian Inositol gene reticuloendotheliosis polyphosphate-5-phosphatase 88 viral D (v-rel) Vav oncogene-related 1 B1422013_at oncogene1420804_s_at1420330_at Relb C-type C-type lectin lectin domain1425951_a_at domain family family 4, 4, member1419627_s_at member a2 C-type d C-type lectin lectin domain1421366_at Myd88 domain family family C-type 4, 4, lectin member member1419693_at domain e n family 4, member C-type NC n lectin domain family Collectin 5, subfamily member member Inpp5d a NC 12 NC Tollip NC Clec4a2 NC Clec4d NC Clec4e Clec4n NC NC Clec4n NC NC NC NC Clec5a NC Vav1 NC NC NC NC NC NC NC NC NC Colec12 NC NC NC 3.4 3.3 NC NC NC 3.2 NC NC NC 4.5 NC NC 15 NC 3.6 NC NC 13 NC NC NC NC NC 3.7 NC 14 5.5 NC NC NC 16 NC NC 2.1 NC NC NC 2.2 7.4 12 4.7 3.8 79 NC NC 12 4.9 NC 65 NC 2.4 4.2 7.0 8.0 NC NC 2.1 4.2 NC 4.6 2.0 4.3 5.9 8.4 NC 2.8 NC 2.0 2.2 5.2 9.5 86 NC 66 16 NC 10 5.7 6.3 Gene expression in ankle joint tissue at 1, 2, and 4 wk postinfection was compared to uninfected ankle joint tissue. Numbers indicate fold change. Numbers preceded by a “_” are reduced compared to uninfected ankle joint tissue. Changes Immune development Signaling molecules Cell-cell interactions/lectins

a A second surprising feature of the early C3H profile was the Table IV. ( Continued ) Ͻ 2-fold are designated “NC.” down-regulation of a large number of genes, many of which were 7940 NOVEL PATHWAYS IN B. burgdorferi INFECTION

Table V. Expression levels of gene transcripts indicative of reactive processes and/or activation of chondrocytes by B. burgdorferia

2wk 4wk Gene Probe Set ID Gene Title Symbol C57BL/6 C3H/HeN IL10Ϫ/Ϫ C57BL/6 C3H/HeN IL10Ϫ/Ϫ

MMPs and TIMPs 1416136_at MMP 2 Mmp2 NC NC NC NC 3.3 NC 1418945_at MMP 3 Mmp3 7.7 18 34 5.3 13 45 1449366_at MMP 8 Mmp8 NC NC 4.9 NC NC 2.1 1448291_at MMP 9 Mmp9 NC 3.9 NC NC NC NC 1417256_at MMP 13 Mmp13 NC 10 NC NC 13 3.0 1417282_at MMP 23 Mmp23 NC 2.4 NC NC 2.6 NC 1460227_at TIMP 1 Timp1 NC 10 4.0 NC 5.8 3.8 Chondrocyte related 1423606_at Periostin, osteoblast-specific factor Postn NC 6.3 NC NC 6.0 NC 1418365_at Cathepsin H Ctsh 2.5 6.2 5.7 2.1 3.7 5.9 1450652_at Cathepsin K Ctsk NC 2.7 NC NC 3.8 NC 1421114_a_at Dermatan sulphate proteoglycan 3 Dspg3 NC 2.8 NC NC 3.7 NC 1423607_at Lumican Lum NC 3.7 NC NC 6.6 NC 1423110_at Procollagen, type I, ␣ 2 Col1a2 NC 2.1 NC NC 2.3 NC 1427884_at Procollagen, type III, ␣ 1 Col3a1 NC 8.8 NC NC 7.9 NC 1450625_at Procollagen, type V, ␣ 2 Col5a2 NC 3.7 NC NC 4.6 NC Downloaded from

a Gene expression in ankle joint tissue at 2 and 4 wk postinfection was compared to uninfected ankle joint tissue. Numbers indicate fold change. Changes Ͻ2-fold are designated “NC.”

in the same group of epidermal genes that were increased in differentiation genes and the development of both localized and

C57BL/6 mice. More striking was the fact that expression of these systemic inflammatory lesions including psoriasis and psoriatic ar- http://www.jimmunol.org/ Ϫ Ϫ genes was also reduced in C57BL/6-IL-10 / mice, similar to thritis (54). Because B. burgdorferi achieve high levels in the skin C3H mice, and again arguing that regulation of expression of the of infected mice, it is also possible that dissemination through the epidermal profile was related to the development of inflammatory skin promotes increased trafficking of cells that are not normally arthritis, not due to strain-specific differences between C3H and present in the joint tissue, and that this trafficking influences the C57BL/6 mice (Table III and Figs. 1 and 3). Expression of several overall inflammatory status of the joint (55, 56). Finally, in rheu- of the epidermal profile genes, including filaggrin, loricrin, and matoid arthritis, citrullinated such as filaggrin have been cytokeratins, can be down-regulated by endogenous peptide ligands identified as targets for autoantibody; however, it is only the cit- for nicotinic acetylcholine receptors, providing precedent for reduced rullinated species that are recognized by rheumatoid arthritis se- by guest on September 25, 2021 expression following signaling pathway activation (44). rum, and unmodified filaggrin is actually not expressed in joint It cannot be determined from our results which IFN is respon- tissue (57). sible for the intense induction of this group of transcripts in C3H The 2-wk profile revealed unexpected similarities in genes in- mice, or even the possible role of another pleotropic cytokine such creased in C3H and C57BL/6 mice (Table IV and Fig. 3). Numer- ␣ ␥ as TNF- (45). Studies with mice lacking IFN- indicate that it is ous chemokines were induced in both wild-type strains of mice, not required for arthritis development (46); however, it is possible without correlation with the greater inflammatory cell infiltrate that there are compensatory pathways acting in the gene ablation seen in C3H mice (8, 15). In contrast, the robust production of model. Based on the known inflammatory potential of B. burgdor- NF-␬B-dependent inflammatory cytokines seen with cultured cells feri, the production of either type I IFN or IFN-␥ by the milieu of in vitro and during infection of animals and patients was absent the joint tissue could certainly occur by 1 wk of infection (17, 47, from localized response in joint tissues of C3H and C57BL/6 mice 48). Alternatively, the early presence the -specific (2, 12, 48). The lack of differentially regulated genes downstream transcript Oasl2 (Table II) in C3H mice may be highly relevant of the TLR2, MyD88, and NF-␬B-driven response to B. burgdor- due to the importance of dendritic cells as a sources of type I IFN feri was unexpected and suggests that activation of this pathway (49, 50). In clinical trials, treatment with type I IFN has resulted in transient arthritis in patients with multiple sclerosis and hepatitis C occurs independently from the development and regulation of ␬ infection, providing precedent for involvement of IFN in inflam- Lyme arthritis. The possibility that the NF- B pathway is a better matory arthritis development (51, 52). Additional experiments will indicator of the host response to infection rather than a determinant be required to identify the cellular source and identity of the cy- of arthritis severity is consistent with the heightened expression of Ϫ/Ϫ tokine responsible for the IFN-inducible profile. cytokines and more effective host defense in IL-10 mice (Fig. Additional experiments will also be required to detail the inter- 1B and Table IV). These findings should also be interpreted in light play between the epidermal profile and inflammatory responses. of previous studies with TLR2-deficient mice: these mice harbor Several published reports provide some insight as to a connection high levels of spirochetes in tissues and develop severe arthritis between altered epidermal gene expression profiles in the joints of even though isolated cells are defective in production of cytokines B. burgdorferi-infected mice and regulation of the inflammatory in response to B. burgdorferi (58). The lack of differential expres- response. Normal differentiation of the epidermis during develop- sion of the NF-␬B-dependent cytokines in B. burgdorferi-infected ment requires the I␬B kinase IKK1 (53), a key component of the C3H and C57BL/6 mice is consistent with the observed develop- Ϫ Ϫ classical and alternative NF-␬B-signaling pathways, implicating ment of Lyme arthritis in TLR2 / C3H. The possible implication IKK1 as a common link between regulation of epidermal differ- of type I IFN in arthritic responses is also consistent with Lyme entiation genes and inflammation. Additionally, mice with a kera- arthritis development in the TLR2Ϫ/Ϫ mouse, because type I IFN tinocyte-specific deletion of the inflammation-associated transcrip- is not a target of TLR2 signaling and its production should proceed tion factor AP-1 displayed altered expression of epidermal normally in the absence of TLR2 (50, 58, 59). The Journal of Immunology 7941

Global gene expression analysis led to the identification of pre- 12. Wooten, R. M., and J. J. Weis. 2001. Host-pathogen interactions promoting in- viously unrecognized differences in expression profiles in the flammatory Lyme arthritis: use of mouse models for dissection of disease pro- cesses. Curr. Opin. Microbiol. 4: 274–279. joints of C3H and C57BL/6 mice in response to the same stimulus: 13. Hirschfeld, M., C. J. Kirschning, R. Schwandner, H. Wesche, J. H. Weis, invading B. burgdorferi. This justifies our strategy of assessing R. M. Wooten, and J. J. Weis. 1999. Cutting edge: inflammatory signaling by Borrelia burgdorferi lipoproteins is mediated by Toll-like receptor 2. J. Immunol. expression in the complex joint tissue and provides new insight 163: 2382–2386. into the development of this inflammatory pathology. The differ- 14. Aliprantis, A. O., R. B. Yang, M. R. Mark, S. Suggett, B. Devaux, J. D. Radolf, ences in gene expression between the arthritis-susceptible (C3H G. R. Klimpel, P. Godowski, and A. Zychlinsky. 1999. Cell activation and ap- Ϫ/Ϫ optosis by bacterial lipoproteins through Toll-like receptor-2. Science 285: and IL-10 ) and arthritis-resistant (C57BL/6) strains was evi- 736–739. dent by 1 wk of infection, suggesting that a very early discrimi- 15. Brown, C. R., V. A. Blaho, and C. M. Loiacono. 2003. Susceptibility to exper- nating event occurs in each strain that determines the outcome of imental Lyme arthritis correlates with KC and monocyte chemoattractant pro- tein-1 production in joints and requires neutrophil recruitment via CXCR2. J. Im- infection. One interpretation of these results is that in the presence munol. 171: 893–901. of high levels of chemokines, the IFN response of C3H mice pro- 16. Brown, J. P., J. F. Zachary, C. Teuscher, J. J. Weis, and R. M. Wooten. 1999. Dual role of interleukin-10 in murine Lyme disease: regulation of arthritis se- motes leukocytic infiltration resulting in inflammation and arthri- verity and host defense. Infect. Immun. 67: 5142–5150. tis; whereas in C57BL/6 mice, some aspect of the epidermal/ 17. Ganapamo, F., V. A. Dennis, and M. T. Philipp. 2000. Early induction of ␥ wound profile prevents leukocytic infiltration and inflammation, interferon and interleukin-10 production in draining lymph nodes from mice in- fected with Borrelia burgdorferi. Infect. Immun. 68: 7162–7165. thus limiting arthritis. These early initial events determine the out- 18. Ganapamo, F., V. A. Dennis, and M. T. Philipp. 2001. CD19ϩ cells produce come of arthritis severity even in the presence of similarly high IFN-␥ in mice infected with Borrelia burgdorferi. Eur. J. Immunol. 31: levels of bacteria, chemokine production, and proinflammatory cy- 3460–3468. 19. Brown, C. R., and S. L. Reiner. 1998. Clearance of Borrelia burgdorferi may not tokine production. be required for resistance to experimental Lyme arthritis. Infect. Immun. 66: Downloaded from Future investigations will be directed toward a mechanistic under- 2065–2071. standing of the involvement of these novel pathways in regulation of 20. Morrison, T. B., Y. Ma, J. H. Weis, and J. J. Weis. 1999. Rapid and sensitive quantification of Borrelia burgdorferi-infected mouse tissues by continuous flu- the development of Lyme arthritis. Additionally, experiments de- orescent monitoring of PCR. J. Clin. Microbiol. 37: 987–992. signed to assess the participation of QTL regulating the severity of 21. Chirgwin, J. M., A. E. Przybyla, R. J. MacDonald, and W. J. Rutter. 1979. Isolation of biologically active ribonucleic acid from sources enriched in ribo- murine Lyme arthritis in control of these distinct responses may nuclease. Biochemistry 18: 5294–5299. provide further insight into the genetic and biochemical regulation 22. GeneChip Expression Analysis Technical Manual. 2005. Affymetrix Incorpo- http://www.jimmunol.org/ of arthritis development (10, 11). rated, Santa Clara. 23. Bolstad, B. M., R. A. Irizarry, M. Astrand, and T. P. Speed. 2003. A comparison of normalization methods for high density oligonucleotide array data based on Acknowledgments variance and bias. Bioinformatics 19: 185–193. 24. Irizarry, R. A., B. M. Bolstad, F. Collin, L. M. Cope, B. Hobbs, and T. P. Speed. We acknowledge the helpful comments of Liming Yang from the National 2003. Summaries of Affymetrix GeneChip probe level data. Nucleic Acids Res. Institutes of Health, and Joseph Holden, Lorise Gharing, Scott Rogers, and 31: e15. all the members of the Weis laboratory at the University of Utah. 25. Gautier, L., L. Cope, B. M. Bolstad, and R. A. Irizarry. 2004. affy: analysis of Affymetrix GeneChip data at the probe level. Bioinformatics 20: 307–315. 26. Tusher, V. G., R. Tibshirani, and G. Chu. 2001. Significance analysis of microar- Disclosures rays applied to the ionizing radiation response. Proc. Natl. Acad. Sci. USA 98: 5116–5121. by guest on September 25, 2021 The authors have no financial conflict of interest. 27. Eppig, J. T., C. J. Bult, J. A. Kadin, J. E. Richardson, J. A. Blake, A. Anagnostopoulos, R. M. Baldarelli, M. Baya, J. S. Beal, S. M. Bello, et al. 2005. The Mouse Genome Database (MGD): from genes to mice: a community References resource for mouse biology. Nucleic Acids Res. 33: D471–D475. 1. Burgdorfer, W., A. G. Barbour, S. F. Hayes, J. L. Benach, E. Grunwaldt, and 28. Hubbard, T., D. Andrews, M. Caccamo, G. Cameron, Y. Chen, M. Clamp, J. P. Davis. 1982. Lyme disease: a tick-borne spirochetosis? Science 216: L. Clarke, G. Coates, T. Cox, F. Cunningham, et al. 2005. Ensembl 2005. Nucleic 1317–1319. Acids Res. 33: D447–D453. 2. Steere, A. C., J. Coburn, and L. Glickstein. 2004. The emergence of Lyme dis- 29. Ornstein, K., and A. G. Barbour. 2006. A reverse transcriptase-polymerase chain ease. J. Clin. Invest. 113: 1093–1101. reaction assay of Borrelia burgdorferi 16S rRNA for highly sensitive quantifi- 3. Nocton, J. J., F. Dressler, B. J. Rutledge, P. N. Rys, D. H. Persing, and cation of pathogen load in a vector. Vector Borne Zoonotic Dis. 6: 103–112. A. C. Steere. 1994. Detection of Borrelia burgdorferi DNA by polymerase chain 30. Kendziorski, C., R. A. Irizarry, K. S. Chen, J. D. Haag, and M. N. Gould. 2005. reaction in synovial fluid from patients with Lyme arthritis. N. Engl. J. Med. 330: On the utility of pooling biological samples in microarray experiments. Proc. 229–234. Natl. Acad. Sci. USA 102: 4252–4257. 4. Yang, L., J. H. Weis, E. Eichwald, C. P. Kolbert, D. H. Persing, and J. J. Weis. 31. Hodzic, E., S. Feng, K. J. Freet, and S. W. Barthold. 2003. Borrelia burgdorferi 1994. Heritable susceptibility to severe Borrelia burgdorferi-induced arthritis is population dynamics and prototype gene expression during infection of immu- dominant and is associated with persistence of large numbers of spirochetes in nocompetent and immunodeficient mice. Infect. Immun. 71: 5042–5055. tissues. Infect. Immun. 62: 492–500. 32. Moore, K. W., R. de Waal Malefytqq, R. L. Coffman, and A. O’Garra. 2001. 5. Steere, A. C., R. T. Schoen, and E. Taylor. 1987. The clinical evolution of Lyme Interleukin-10 and the interleukin-10 receptor. Annu. Rev. Immunol. 19: 683–765. arthritis. Ann. Intern. Med. 107: 725–731. 33. Platanias, L. C. 2005. Mechanisms of type-I- and type-II-interferon-mediated 6. Gross, D. M., T. Forsthuber, M. Tary-Lehmann, C. Etling, K. Ito, Z. A. Nagy, signalling. Nat. Rev. Immunol. 5: 375–386. J. A. Field, A. C. Steere, and B. T. Huber. 1998. Identification of LFA-1 as a 34. Mack, J. A., S. Anand, and E. V. Maytin. 2005. Proliferation and cornification candidate autoantigen in treatment-resistant Lyme arthritis. Science 281: during development of the mammalian epidermis. Birth Defects Res. C Embryo 703–706. Today 75: 314–329. 7. Barthold, S. W., D. H. Persing, A. L. Armstrong, and R. A. Peeples. 1991. 35. Wojcik, S. M., D. S. Bundman, and D. R. Roop. 2000. Delayed wound healing Kinetics of Borrelia burgdorferi dissemination and evolution of disease after in keratin 6a knockout mice. Mol. Cell. Biol. 20: 5248–5255. intradermal inoculation of mice. Am. J. Pathol. 139: 263–273. 36. Brakenhoff, R. H., M. Gerretsen, E. M. Knippels, M. van Dijk, H. van Essen, 8. Barthold, S. W., D. S. Beck, G. M. Hansen, G. A. Terwilliger, and K. D. Moody. D. O. Weghuis, R. J. Sinke, G. B. Snow, and G. A. van Dongen. 1995. The human 1990. Lyme borreliosis in selected strains and ages of laboratory mice. J. Infect. E48 antigen, highly homologous to the murine Ly-6 antigen ThB, is a GPI- Dis. 162: 133–138. anchored molecule apparently involved in keratinocyte cell-cell adhesion. J. Cell 9. Ma, Y., K. P. Seiler, E. J. Eichwald, J. H. Weis, C. Teuscher, and J. J. Weis. 1998. Biol. 129: 1677–1689. Distinct characteristics of resistance to Borrelia burgdorferi-induced arthritis in 37. Esche, C., C. Stellato, and L. A. Beck. 2005. Chemokines: key players in innate C57BL/6N mice. Infect. Immun. 66: 161–168. and adaptive immunity. J. Invest. Dermatol. 125: 615–628. 10. Roper, R. J., J. J. Weis, B. A. McCracken, C. B. Green, Y. Ma, K. S. Weber, 38. Narayan, K., D. Dail, L. Li, D. Cadavid, S. Amrute, P. Fitzgerald-Bocarsly, and D. Fairbairn, R. J. Butterfield, M. R. Potter, J. F. Zachary, et al. 2001. Genetic A. R. Pachner. 2005. The nervous system as ectopic germinal center: CXCL13 control of susceptibility to experimental Lyme arthritis is polygenic and exhibits and IgG in Lyme neuroborreliosis. Ann. Neurol. 57: 813–823. consistent linkage to multiple loci on 5 in four independent mouse 39. Wooten, R. M., V. R. Modur, T. M. McIntyre, and J. J. Weis. 1996. Borrelia crosses. Genes Immun. 2: 388–397. burgdorferi outer membrane protein A induces nuclear translocation of nuclear 11. Weis, J. J., B. A. McCracken, Y. Ma, D. Fairbairn, R. J. Roper, T. B. Morrison, factor-␬B and inflammatory activation in human endothelial cells. J. Immunol. J. H. Weis, J. F. Zachary, R. W. Doerge, and C. Teuscher. 1999. Identification of 157: 4584–4590. quantitative trait loci governing arthritis severity and humoral responses in the 40. Sellati, T. J., D. A. Bouis, R. L. Kitchens, R. P. Darveau, J. Pugin, R. J. Ulevitch, murine model of Lyme disease. J. Immunol. 162: 948–956. S. C. Gangloff, S. M. Goyert, M. V. Norgard, and J. D. Radolf. 1998. Treponema 7942 NOVEL PATHWAYS IN B. burgdorferi INFECTION

pallidum and Borrelia burgdorferi lipoproteins and synthetic lipopeptides acti- 51. Strueby, L., B. Nair, A. Kirk, and R. M. Taylor-Gjevre. 2005. Arthritis and vate monocytic cells via a CD14-dependent pathway distinct from that used by bursitis in multiple sclerosis patients treated with interferon-␤. Scand. J. Rheu- lipopolysaccharide. J. Immunol. 160: 5455–5464. matol. 34: 485–488. 41. Ibrahim, S. M., D. Koczan, and H. J. Thiesen. 2002. Gene-expression profile of 52. Wilson, L. E., D. Widman, S. H. Dikman, and P. D. Gorevic. 2002. Autoimmune collagen-induced arthritis. J. Autoimmun. 18: 159–167. disease complicating antiviral therapy for hepatitis C virus infection. Semin. Ar- 42. Behera, A. K., E. Hildebrand, J. Scagliotti, A. C. Steere, and L. T. Hu. 2005. thritis Rheum. 32: 163–173. Induction of host matrix metalloproteinases by Borrelia burgdorferi differs in 53. Li, Q., Q. Lu, J. Y. Hwang, D. Buscher, K. F. Lee, J. C. Izpisua-Belmonte, and human and murine Lyme arthritis. Infect. Immun. 73: 126–134. I. M. Verma. 1999. IKK1-deficient mice exhibit abnormal development of skin 43. Gebbia, J. A., J. L. Coleman, and J. L. Benach. 2001. Borrelia spirochetes up- and skeleton. Genes Dev. 13: 1322–1328. regulate release and activation of matrix metalloproteinase gelatinase B (MMP-9) 54. Zenz, R., R. Eferl, L. Kenner, L. Florin, L. Hummerich, D. Mehic, H. Scheuch, and collagenase 1 (MMP-1) in human cells. Infect. Immun. 69: 456–462. P. Angel, E. Tschachler, and E. F. Wagner. 2005. Psoriasis-like skin disease and 44. Arredondo, J., A. I. Chernyavsky, D. L. Jolkovsky, R. J. Webber, and S. A. Grando. arthritis caused by inducible epidermal deletion of Jun proteins. Nature 437: 2006. SLURP-2: a novel cholinergic signaling peptide in human mucocutaneous 369–375. epithelium. J. Cell. Physiol. 208: 238–245. 55. Sellati, T. J., S. L. Waldrop, J. C. Salazar, P. R. Bergstresser, L. J. Picker, and 45. Gallagher, J., J. Howlin, C. McCarthy, E. P. Murphy, B. Bresnihan, O. FitzGerald, J. D. Radolf. 2001. The cutaneous response in humans to Treponema pallidum C. Godson, H. R. Brady, and F. Martin. 2003. Identification of Naf1/ABIN-1 among lipoprotein analogues involves cellular elements of both innate and adaptive im- TNF-␣-induced expressed genes in human synoviocytes using oligonucleotide mi- munity. J. Immunol. 166: 4131–4140. croarrays. FEBS Lett. 551: 8–12. 56. Norgard, M. V., B. S. Riley, J. A. Richardson, and J. D. Radolf. 1995. Dermal 46. Brown, C. R., and S. L. Reiner. 1999. Experimental Lyme arthritis in the absence inflammation elicited by synthetic analogs of Treponema pallidum and Borrelia of interleukin-4 or ␥ interferon. Infect. Immun. 67: 3329–3333. burgdorferi lipoproteins. Infect. Immun. 63: 1507–1515. 47. Ma, Y., K. P. Seiler, K. F. Tai, L. Yang, M. Woods, and J. J. Weis. 1994. Outer 57. Baeten, D., I. Peene, A. Union, L. Meheus, M. Sebbag, G. Serre, E. M. Veys, and surface lipoproteins of Borrelia burgdorferi stimulate nitric oxide production by F. De Keyser. 2001. Specific presence of intracellular citrullinated proteins in the cytokine-inducible pathway. Infect. Immun. 62: 3663–3671. rheumatoid arthritis synovium: relevance to antifilaggrin autoantibodies. Arthritis 48. Kang, I., S. W. Barthold, D. H. Persing, and L. K. Bockenstedt. 1997. T-helper- Rheum. 44: 2255–2262. cell cytokines in the early evolution of murine Lyme arthritis. Infect. Immun. 65: 58. Wooten, R. M., Y. Ma, R. A. Yoder, J. P. Brown, J. H. Weis, J. F. Zachary, 3107–3111. C. J. Kirschning, and J. J. Weis. 2002. Toll-like receptor 2 is required for innate, Downloaded from 49. Tiefenthaler, M., R. Marksteiner, S. Neyer, F. Koch, S. Hofer, G. Schuler, but not acquired, host defense to Borrelia burgdorferi. J. Immunol. 168: M. Nussenzweig, R. Schneider, and C. Heufler. 1999. M1204, a novel 2Ј,5Ј 348–355. oligoadenylate synthetase with a ubiquitin-like extension, is induced during mat- 59. Wang, G., Y. Ma, A. Buyuk, S. McClain, J. J. Weis, and I. Schwartz. 2004. uration of murine dendritic cells. J. Immunol. 163: 760–765. Impaired host defense to infection and Toll-like receptor 2-independent killing of 50. Honda, K., H. Yanai, A. Takaoka, and T. Taniguchi. 2005. Regulation of the type Borrelia burgdorferi clinical isolates in TLR2-deficient C3H/HeJ mice. FEMS I IFN induction: a current view. Int. Immunol. 17: 1367–1378. Microb. Lett. 231: 219–225. http://www.jimmunol.org/ by guest on September 25, 2021