Molecular Cloning and Characterization of Cytoplasmic Polyhedrosis Virus Polyhedrin and a Viable Deletion Mutant Gene

Home , Molecular cloning

JOURNAL OF VIROLOGY, Jan. 1988, p. 211-217 Vol. 62, No. 1 0022-538X/88/010211-07$02.00/0 Copyright © 1988, American Society for Microbiology Molecular Cloning and Characterization of Cytoplasmic Polyhedrosis Virus Polyhedrin and a Viable Deletion Mutant Gene MAX ARELLA,1 CLAUDE LAVALLEIE,12 SERGE BELLONCIK,l AND YASUHIRO FURUICHI2* Department of Virology, Institut Armand-Frappier, University of Quebec, Montreal, Quebec, Canada,' and Nippon Roche Research Center, Department of Molecular Genetics, Kamakura, Japan2 Received 12 May 1987/Accepted 21 September 1987

The double-stranded RNA genome of Bombyx mori cytoplasmic polyhedrosis virus (CPV) was converted to double-stranded DNA and cloned into plasmid pBR322. The complete nucleotide sequence of cloned genome segment 10, which encodes virus polyhedrin polypeptide, was determined. The CPV polyhedrin gene consists of 942 based pairs and possesses a long open reading frame that codes for a polypeptide of 248 amino acids (molecular weight, 28,500), consistent with an apparent molecular weight of 28,000 previously determined for purffied polyhedrin. No sequence homology was found between CPV polyhedrin and polyhedrins from several nuclear polyhedrosis viruses. In addition to the polyhedrin gene, we completed the sequence analysis of a small deletion mutant gene derived from the polyhedrin gene. This mutant gene consists of two subset domains of the polyhedrin gene, i.e., the 5'-terminal 121 base pairs and the 3'-terminal 200 base pairs. An in vitro transcription demonstrated that the small mutant gene is transcribed by virion-associated RNA polymerases. These data confirm the importance of CPV terminal sequences in virus genome replication.

Cytoplasmic polyhedrosis viruses (CPVs), one genus of reported previously (12). During the process, unexpectedly, the family Reoviridae, infect midgut cells of a wide range of we found in a CPV dsRNA mixture an extra subgenomic insects (22). Cytoplasmic polyhedrosis disease caused by segment of about 300 base pairs referred to here as the SP CPV infection results in the accumulation of occlusion gene (small polyhedrin gene). Since the SP gene appeared to bodies or polyhedra in the cytoplasm which are formed by be related in sequence to the polyhedrin gene, we also the crystallization of the viral polyhedrin polypeptide. In the cloned the cDNA into Escherichia coli plasmid pBR322 and late infection stage, newly formed viruses are occluded in investigated it together with the polyhedrin gene. A direct the polyhedron complex, perhaps to stabilize infectious sequencing and a comparative study clearly indicated that virus particles. Greater biological meaning of the virus the SP gene is a deletion mutant derived from the polyhedrin occlusion bodies may lie in the accurate delivery of virus to gene. This report describes the complete sequence informa- the target intestinal cells, where the occlusion bodies are tion of CPV polyhedrin as well as its deletion mutant gene. solubilized by intestinal alkaline pH and the infectious virus particles are released. MATERIALS AND METHODS The genome of CPV, like that of other members of the Preparation of CPVs and genomic dsRNAs. The type 1 Reoviridae, consists of 10 double-stranded RNA (dsRNA) CPV of B. mori was propagated by infecting fifth-instar segments (4). Each genome dsRNA segment is composed of larvae with purified CPV. The polyhedra that contain virus an mRNA (plus strand) and its complement (minus strand) in particles were isolated from infected midguts, and the virus an end-to-end base-paired configuration, except for the was purified from polyhedra as described previously (6, 27). protruding 5' cap in the plus strand (6, 7). The segments are Other CPVs were prepared similarly from infected Euxoa transcribed by virus-associated RNA polymerase to form scandens (type 5 virus) and from Inachis io and Spodoptera capped mRNAs which also function as templates for a exigua (type 2 and type 11 viruses, respectively) (22) and replicase in virus-infected cells. Thus, each genome segment were kindly provided by C. C. Payne at the Glasshouse should contain recognition sites for genome transcription, Crops Research Institute, Littlehampton, United Kingdom. mRNA translation, duplex segment replication, and correct Molecular cloning of CPV polyhedrin and SP dsRNA genes. assembly into virus particles. Consistently, a terminal se- The cDNA for the polyhedrin gene was prepared from quence of denatured CPV dsRNA and cloned into E. coli plasmid m7GpppAmGUAAA-----GUUAGCC pBR322 (at the PstI site) as described previously for human U CAUUU-----CAAUCGG reovirus (2), human rotavirus (12), and wound tumor virus (1). E. coli clones that contained the recombinant plasmids was identified for segments of the prototype CPV that infects which harbor polyhedrin cDNA were detected by colony Bombyx mori, suggesting that the conserved terminal se- hybridization (8) with [32P]pCp-end-labeled segment 10 quence is important for viral replication (15). dsRNA which was purified by polyacrylamide gel electro- The polyhedrin protein is coded for by the smallest phoresis. genome segment, segment 10, and its expression appears to For SP gene cloning, SP dsRNA was first purified from the occur most extensively in the late infection stage (21). In an mixture of CPV dsRNA by polyacrylamide gel electropho- effort to understand the regulation of polyhedrin gene resis. After cDNA synthesis, it was cloned into pBR322 in expression and to characterize the genome structure, we the same way as the polyhedrin gene and the bacteria which cloned the segment 10 cDNA by the method which we have harbored a recombinant SP cDNA-pBR322 were identified by colony hybridization with [32P]pCp-end-labeled segment * Corresponding author. 10 and SP dsRNAs. 211 212 ARELLA ET AL. J. VIROL. A B RESULTS Presence in B. mori CPV of small polyhedrin-related gen- G t.- n tri to- ome segment. A mixture of genome dsRNA segments of B. '_;,'1:'.'.a% mori CPV (BmCPV) extracted from purified virus were resolved into nine discrete bands by polyacrylamide gel ' 'M electrophoresis (Fig. 1A). Recently, we found an extra, small genomic dsRNA segment in a CPV genome RNA ltx preparation (Fig. 1B). This small segment had been over- looked before, since it ran off the gel under the normal

2 .z: WmA'InIt.aNk, electrophoresis conditions, which were intended to resolve SP dsRNA high-molecular-weight segments. A preliminary 3'-terminal analysis of the [32P]pCp-end-labeled small RNA indicated that it contained 3'-ACU-OH and 3'-GCC-OH, the common '5. 3'-terminal sequences for CPV genome dsRNA segments : (data not shown). When the [32P]pCp-3'-end-labeled small RNA was isolated from gels and used for hybridization to the other individual genome dsRNA segments, which were denatured and fixed on a nitrocellulose filter, it hybridized to genome segment 10 and segments 1 to 3 (Fig. 2A). The labeled segment 10 also hybridized specifically with this small RNA (Fig. 2B). Molecular cloning of polyhedrin and its related SP genome RNAs. A mixture of duplex cDNA of CPV genome dsRNAs 7- was prepared as described before (6) except that the 3' tailing of the template dsRNAs was done by polyadenylation 9- with E. coli poly(A) polymerase as described by Cashdollar et al. (2). The cDNAs were then poly(dC) tailed with E. coli terminal deoxytransferase, annealed to poly(dG)-tailed pBR322 plasmid DNA, and cloned into E. coli RR1 cells. Clones that contained the recombinant plasmids harboring the polyhedrin cDNA gene were isolated after colony hybridization with 3'-[132P]pCp-labeled polyhedrin gene FIG. 1. Detection of small dsRNA molecules in CPV genome (genome segment 10) as a probe. The CPV polyhedrin cDNA RNA. CPV genome RNA was prepared from purified virus, and the was excised with PstI as a single band which migrated 3' termini were radiolabeled with [32P]pCp with RNA ligase as slightly slower than genome segment 10 (Fig. 3). described before (28). The labeled CPV genome segments were For cloning of SP dsRNA, the mixture of CPV genome separated by 5% polyacrylamide gel electrophoresis in 50 mM Tris-phosphate buffer (pH 8) containing 5 mM EDTA at approxi- RNA was first resolved by polyacrylamide gel electrophore- mately 5 to 7 V/cm. Electrophoresis was run for 4 h (lane B) and 18 sis and the SP dsRNA was extracted from the gel to avoid h (lane A). contamination of the polyhedrin gene. A small amount (approximately 100 ng) of purified SP dsRNA was 3' poly- adenylated, and the cDNA was prepared as the polyhedrin gene was. Clones containing the SP cDNA gene were Determination of nucleotide sequence. Cloned polyhedrin detected with [32P]pCp-labeled polyhedrin and SP RNAs. and SP cDNA genes were excised from the recombinant Several cDNA clones that contained the full length were pBR322 DNA by digestion with endonuclease PstI and their obtained for SP RNA genes as determined by agarose gel nucleotide sequences were analyzed by the Maxam-Gilbert (18) and M13 chain termination procedures (26). Sequence analysis was done for both plus and minus strands. GENOME SEGmE\TS CPV in vitro transcription. CPV mRNAs were synthesized in the in vitro transcription reaction as described before (5, 2 28). Purified CPV (-10 pg) was incubated at 30°C in a 1 3 4 5 6 7 a 9 C transcription reaction mixture (100 Rl) consisting of 10 mM Tris hydrochloride (pH 8.0), 10 mM MgCl2, 1 mM each ATP, A *. * 0, - CTP, and GTP, 0.4 mM UTP, 10 pLCi of [a-32P]UTP (specific activity, 3,000 Ci/mmol; Amersham Corp., Arlington Heights, Ill.), 1 mM S-adenosylmethionine, and 50 units of B . . . . RNasin (catalog no. 121800; Promega Biotec, Madison, Wis.) per ml. After 1 h, the reaction mixture was diluted FIG. 2. Characterization of small dsRNA by dot-blot hybridiza- fivefold with 50 mM Tris hydrochloride buffer (pH 8.0) and tion. CPV genome segments were resolved by polyacrylamide gel centrifuged (Beckman SW60 rotor, 30,000 rpm, 60 min, 4°C) electrophoresis into nine discrete bands and an SP RNA as shown in to remove virus Fig. 1. Each RNA segment (about 10 ng) was extracted from the gel, particles. CPV mRNAs in the supernatant converted to single-stranded form by heat denaturation (100°C, 5 fraction were extracted with phenol-chloroform (2:1, min), and fixed on a nitrocellulose filter as described by Thomas vol/vol), isolated from unreacted reagents by passing (30). Genome segment 10 and SP RNA were [32P]pCp end labeled through a Sephadex G-50 column (0.6 by 20 cm), and and used as probes for hybridization. (A) Labeled SP RNA was used precipitated with 2.5 volumes of cold ethanol. as the probe; (B) labeled segment 10 RNA was used as the probe. VOL. 62, 1988 CYTOPLASMIC POLYHEDROSIS VIRUS POLYHEDRIN 213

from different insect viruses have also been established (24). These include polyhedrins from B. mori nuclear polyhedrosis virus (NPV) (11), Autographa californica NPV (9), and Orgyia pseudotsugata NPV (16). The amino acid composi- tions of these polyhedrins were compared to see whether there was any common feature among various polyhedrins .. , .. r- which form a unique crystalline occlusion body (Table 1).

, i ..- . t Ii-.. I There was no noticeable common feature to the four polyhedrins except that they all consist of 245 to 248 amino acids, a very narrow range in the number of composite amino acid residues. There is no apparent amino acid

4 sequence homology between CPV polyhedrin and the NPV polyhedrins (data not shown), while the three NPV polyhedrins are closely related (24). It is apparent from Table 1 that "a t1 CPV polyhedrin and, to a lesser extent, NPV polyhedrins are rich in tyrosine. An involvement of tyrosine residues in the alkali-sensitive nature of the polyhedra was previously implicated for 0. pseudotsugata NPV polyhedrin (25). The %m 9 secondary structure analysis by Hopp and Wood (10) indicated that CPV polyhedrin as well as BmNPV polyhedrin are hydrophilic polypeptides (Fig. 6) and rich in ,-sheet and turn structures as expected from an ability to aggregate into a polyhedron complex. These two polyhedrins, however, are dissimilar in details of their secondary structure. CPV SP RNA. Our preliminary hybridization experiments *,,. ;. showed that the SP RNA relates to the polyhedrin gene.

... Indeed, the nucleotide sequence analysis revealed that CPV

,_ SP RNA consists of two identical subset regions of the polyhedrin gene. Namely, the 5'-terminal 121 bases and the v. \ r 3'-terminal 200 bases of the SP gene were identical to the respective areas of the polyhedrin gene. These regions are FIG. 3. Characterization of polyhedrin cDNA cloned in pBR322. shown in Fig. 5 in bold face. This small RNA is apparently Polyhedrin cDNA was cloned in the PstI site of pBR322. It was formed from the polyhedrin gene by deletion of the internal excised by Pstl and analyzed by 1% agarose gel electrophoresis. 621 bases. At present, the mechanism for the formation of Lanes: A, molecular size markers; B, recombinant pBR322 DNA the SP gene is unclear; however, the 5' and 3' halves of SP digested with endonuclease PstI; C, CPV genome dsRNAs. gene were apparently linked at the overlapping two ATs at residues 120 to 121 and 742 to 743 by losing one base, electrophoresis after digestion of the individual recombinant N A plasmid with PstI (Fig. 4). The complete nucleotide sequences of both the polyhedrin and SP genes were determined by the Maxam-Gilbert (18) and Sanger et al. M13 (26) methods. _r . CPV polyhedrin gene and predicted amino acid sequence of polyhedrin. The polyhedrin gene consists of 942 nucleotides with a long open reading frame that starts with a possible initiator AUG triplet at residues 42 through 44 and termi- nates with a single terminator UGA at residues 786 through 788 (Fig. 5). The polyhedrin gene thus encodes a polypeptide of 248 amino acids. This initiation codon has the sequence AXXATGG, characteristic of a strong initiator in eucaryotic protein synthesis systems (14). The second in-phase AUG triplet is present at residues 411 through 413, but it is *~~~~~~~~~~~ A unlikely that this AUG is used as an initiator, based on its limited coding capacity (125 amino acids) that does not account for the apparent molecular weight of 28,000 estimated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (21). The predicted amino acid sequence indicated that the CPV polyhedrin is a tyrosine-rich (9%) polypeptide with a molecular of 28,456. As expected from its exist- FIG. 4. Characterization of cloned cDNAs of SP RNA. cDNAs weight cytosolic prepared from the isolated SP RNA were cloned into the PstI site of ence in virus-infected cells, the polyhedrin does not contain pBR322. Three SP cDNA clones which hybridized with the 32P- a transmembrane signal peptide. There are four potential labeled polyhedrin RNA probe were digested with PstI, and the N-linked glycosylation sites of the Asn-X-Ser/Thr type at length of inserts was analyzed by 1% agarose gel electrophoresis. amino acid residues 27 to 29, 77 to 79, 86 to 88, and 237 to cDNA clone 12 was chosen for extensive analysis of the nucleotide 239. The amino acid sequences of several other polyhedrins sequence. 214 ARELLA ET AL. J. VIROL.

cap site I 50 AGTAAAAGTCAGTATCTTACCGGCATAATACGTAAAGGATC ATG 6CA GAC GTA GCA GGA ACA AGT ARC Met Ala Asp Val Ala Gly Thr Ser Asn 100 CGA GAC m CGC GGA CGC GA CAR AGA CTA TTC ART AGC GA CAR TAC ARC TAT AAC AAC Arg Asp Phe Arg Gly Arg Glu Gln Arg Leu Phe Asn Ser Glu Gln Tyr Asn Tyr Asn Asn 150 AGC TTG AAC GGA GM GTG AGC GTG TGG GTA TAC GCA TAC TAC TCA GAC GGG TCT GTA CTC Ser Leu Asn Gly Glu Val Ser Val Trp Val Tyr Ala Tyr Tyr Ser Asp Gly Ser Val Leu 200 GTA ATC AAC AAG AAC TCG CAA TAC AAG GTT GGC ATT TCA GAG ACA TTC AAG GCA CTT AAG Val Ile Asn Lys Asn Ser Gln Tyr Lys Val Gly Ile Ser Glu Thr Phe Lys Ala Leu Lys 250 300 GM TAT CGC GAG GGA CAA CAC MC GAC TCT TAC GAT GAG TAT GM GTG MT CAG AGC ATC Glu Tyr Arg Glu Gly Gln His Asn Asp Ser Tyr Asp Glu Tyr Glu Val Asn Gln Ser Ile 350 TAC TAT CCT AAC GGC GGT GAC GCT CGC AM TTC CAT TCA AAT GCT AM CCA CGC GCG ATC Tyr Tyr Pro Asn Gly Gly Asp Ala Arg Lys Phe His Ser Asn Ala Lys Pro Arg Ala Ile 400 CAG ATC ATC TTC AGT CCT AGT GTG AAT GTG CGT ACT ATC AAG ATG GCT AAA GGC AAC GCG Gln Ile Ile Phe Ser Pro Ser Val Asn Val Arg Thr Ile Lys Met Ala Lys Gly Asn Ala 450 GTA TCC GTG CCC GAT GAG TAC CTA CAG CGA TCT CAC CCA TGG GAA GCG ACC GGA ATC MG Val Ser Val Pro Asp Glu Tyr Leu Gln Arg Ser His Pro Trp Glu Ala Thr Gly Ile Lys 500 TAC CGC AAG ATT AAG AGA GAC GGG GAA ATC GTT GGT TAC AGC CAT TAC TTT GAA CTA CCC Tyr Arg Lys Ile Lys Arg Asp Gly Glu Ile Val Gly Tyr Ser His Tyr Phe Glu Leu Pro 550 600 CAT GAA TAC AAC TCC ATC TCC CTA GCG GTA AGT GGT GTA CAT MG MC CCA TCA TCA TAC His Glu Tyr Asn Ser Ile Ser Leu Ala Val Ser Gly Val His Lys Asn Pro Ser Ser Tyr 650 AAT GTC GGA TCA GCA CAT AAC GTA ATG GAC GTC TTC CAA TCA TGC GAC TTG GCT CTC AGA Asn Val Gly Ser Ala His Asn Val Met Asp Val Phe Gln Ser Cys Asp Leu Ala Leu Arg 700 TTC TGC AAC CGC TAC TGG GCC GAA CTC GAA TTG GTG AAC CAC TAC ATT TCG CCG MC GCC Phe Cys Asn Arg Tyr Trp Ala Glu Leu Glu Leu Val Asn His Tyr Ile Ser Pro Asn Ala 750 TAC CCA TAC CTC GAT ATT AC ART CAT AGC TAT 66A GTA GCT CTG AGT ARC CGT CAG TGA Tyr Pro Tyr Leu Asp Ile Asn Asn His Ser Tyr Gly Val Ala Leu Ser Asn Arg Gln 800 850 TTGCTCGTGTARCTTGGATACCGGARCACATGACGCTGTGATGMATACGCGCCCGGTCTTCGGATAGGGTGACGCTCT 900 ACCTGCGCCAACAGGATATCGAAAAATTATACCGGATCCCGATGCTGACGGGATGCGGTACTGACTGACCGTTAGCC FIG. 5. Nucleotide sequence of CPV polyhedrin gene and the predicted amino acid sequence of polyhedrin polypeptide. Sequences shown in bold face are those present in SP RNA. Two ATs at regions 120 to 121 and 742 to 743 overlap upon ligation. The underlines indicate possible N-linked glycosylation sites. (This sequence was presented in the poster session of the 6th International Congress of Virology, September 1984. For convenience, uracil residues in the RNA sequence are represented by T.) either A or T. The neighboring sequences are rich in A and presence of small subgenomic RNA by agarose gel electro- AA-pyrimidine. The 5'-half donor fragment contains phoresis (Fig. 8). However, there were no small subgenomic GAACAATACAACTATAACAAC, and the 3'-half acceptor dsRNA species present, at least in CPV type 2 and 11 fragment contains GATATTAACAAT. Interestingly, the genome RNAs, that could be detected by ethidium bromide junction of the two fragments does not cause a change in the staining. coding frame for the remainder of the original coding region Transcription of CPV SP gene by virus-associated transcrip- of polyhedrin. Therefore, the transcripts of SP dsRNA can tase. To examine whether the CPV SP gene is transcribed by code for a small polypeptide of 41 amino acid residues whose a virus-associated RNA polymerase, we performed the in N-terminal 27 amino acids and C-terminal 14 amino acids are vitro transcription as described before (28). The purified identical to those of mature polyhedrin. A schematic repre- CPV was incubated in a transcription reaction mixture that sentation for the generation of the deletion mutant gene is contained [o-32P]UTP. Viral mRNAs synthesized and represented in Fig. 7. A similar observation has recently been leased from virus particles were resolved by 8% polyacryl- reported by Nuss and Summers (19) for wound tumor virus amide gel electrophoresis in the presence of 7 M urea. A genome segment 12. distinct RNA band of low molecular weight comigrated with CPVs are classified into 12 types in which BmCPV is the heat-denatured SP RNA, in addition to mRNAs of high designated type 1 (1). CPV genome RNAs extracted from molecular weight which correspond to genomic segments 1 purified type 2, 5, and 11 viruses were analyzed for the to 10 (Fig. 8). These results demonstrated that subgenomic VOL. 62, 1988 CYTOPLASMIC POLYHEDROSIS VIRUS POLYHEDRIN 215

TABLE 1. Amino acid composition (%) of polyhedrin proteins of insect viruses Amino acid BmCPVU BmCPVb A. californica NPV BmNPV 0. pseudotsugata NPV Glycine 6.0 2.9 4.9 4.9 4.5 Alanine 6.5 4.8 4.9 4.1 4.9 Valine 8.1 8.7 8.2 7.3 7.7 Leucine 5.2 7.3 6.9 7.3 7.7 Isoleucine 5.2 6.3 5.7 6.5 5.3 Methionine 1.2 1.4 2.4 2.9 2.4 Phenylalanine 3.2 6.1 5.7 4.9 5.3 Tryptophan 1.2 2.2 1.6 2.0 1.2 Proline 3.6 3.1 6.9 6.1 6.5 Serine 10.5 7.4 3.7 4.1 4.5 Threonine 1.6 2.4 4.5 4.1 4.1 Asparagine 9.7 5.7 7.3 6.5 Glutamine 3.6 1.6 2.0 1.6 Cysteine 0.8 0.7 1.2 0.8 1.2 Aspartic acid 4.4 12.6c 6.1 4.9 4.5 Glutamic acid 6.0 1O.9d 8.6 9.0 9.8 Lysine 4.8 5.7 7.8 8.6 6.9 Histidine 3.6 2.3 2.0 2.0 2.8 Arginine 5.6 5.8 5.3 4.5 6.1 Tyrosine 8.9 9.2 6.1 6.5 6.5 Total residues 248 245 245 246 a Amino acid composition predicted from cloned polyhedrin cDNA described in this study. b Data from Kawase (13). ' Value represents the sum of aspartic acid and asparagine. d Value represents the sum of glutamic acid and glutamine.

SP dsRNAs are transcribed by a virus-associated RNA the polyhedrin polypeptide in E. coli cells by transfection of polymerase. an expression plasmid containing the polyhedrin gene. The nonglycosylated polyhedrin molecules synthesized in E. coli DISCUSSION cells (which do not have a glycosylation capacity) comigrated in the sodium dodecyl sulfate-polyacrylamide gels Several polyhedrin genes of DNA containing NPV have with the authentic polyhedrin prepared from virus-infected previously been cloned and characterized (9, 11, 16, 24). The B. mori cells (C. Lavallee and Y. Furuichi, unpublished CPV polyhedrin gene, on the other hand, has not been data). elucidated at the molecular level, perhaps because of the Conservation of amino acid sequences is found among difficulty in handling its dsRNA genomes by recombinant NPV polyhedrins (24), perhaps because NPV strains which DNA technology. Successful approaches in the conversion infect various insects are genetically related. No homology, of dsRNA to dscDNA shown for human reovirus (2) and however, was found between CPV polyhedrin and NPV rotavirus (12) made the analysis of the CPV polyhedrin gene polyhedrins, although polyhedrins of both viruses consist of possible at the DNA level. In this report, we showed the entire nucleotide sequence of the CPV polyhedrin gene after the cDNA was cloned in E. coli plasmid pBR322. The 3 5'-terminal 23-mer and 3'-terminal 20-mer of genome dsRNA 2 segment 10 that had previously been determined by the 1, RNA are identical to the limited sequencing procedure (15) 0 present sequence established by DNA sequencing. -1- The predicted amino acid sequence is consistent with the 1I -2- amino acid composition data obtained previously by Kawase y d (13) from purified BmCPV polyhedrin (Table 1). The molec- r -3 ular weight of polyhedrin (28,500) predicted from the cloned 0 -4 cDNA sequence is in agreement with that estimated by the ap 3 electrophoretic mobility in sodium dodecyl sulfate-poly- t 2- acrylamide gels (21). The glycosylation of CPV polyhedrin h B has previously been suggested, based on positive color reactions with periodic acid-Schiff reagent (20). The pre- 0 dicted polyhedrin sequence contains four possible N-linked -1- glycosylation sites (Fig. 5). However, it is not likely that -2 these sites are used for glycosylation since there is no -3 in the apparent transmembrane signal peptide present poly- -4 hedrin sequence and the apparent molecular weight (28,000) 50 100 150 200 250 determined by sodium dodecyl sulfate-polyacrylamide gel Residue Number electrophoresis is virtually the same as that of nonglycosy- FIG. 6. Comparison of secondary structure of polyhedrins of lated polyhedrin (28,500) predicted here from the defined BmCPV and BmNPV. The hydropathy profiles of BmCPV (A) and nucleotide sequence. Moreover, we have recently produced BmNPV (B) determined by Hopp and Wood (10) were compared. 216 ARELLA ET AL. J. VIROL.

Polyhedrin RNA

I AACAATACAAC A ACAAC------TTAC TTAACAAT

SP RNA

A AAACAACTT TTAACAAT. FIG. 7. Schematic representation of the generation of SP RNA from the polyhedrin gene. The two ATs in boxes in polyhedrin RNA indicate the deletion breakpoints. It is not known which AT (or which A or T) survives the deletion event and is present in SP RNA. The lines over the polyhedrin sequence show the AA-pyrimidine repeated in this particular region. For simplicity, only the strands of positive polarity (same as mRNA strand) are illustrated. a polypeptide of similar molecular weight (28,000) and form mutant, or remnant RNA, derived from the polyhedrin gene. a morphologically similar crystalline structure. The two deletion breakpoints are located about 120 bases During our studies, we found that BmCPV contains a from the 5' terminal and 200 bases from the 3' terminal of the small polyhedrin-related genome dsRNA. Nucleotide se- polyhedrin gene. The regions including these sites are rich in quence analysis revealed that the small dsRNA is a deletion A and AA-pyrimidine residues. To examine whether these two regions can form a base-paired configuration that could permit viral RNA polymerase (or replicase) to skip the Molecular CPV types intervening coding sequence during replication, we per-

Marker formed a dyad symmetry search with the Intelligenetics 11 5 2 1 computer program. No significant array of base pairings, however, was found between the two regions. The mechanism of genomic replication of CPV has not been well studied, but it is believed to be similar to that involved for human reovirus, the prototype of the Reoviri- Molecular size (bp) dae. The replication of genomic dsRNA includes the synthesis of single-stranded RNAs with positive polarity from a dsRNA template. This process is catalyzed by a virus- associated RNA polymerase often referred to as transcrip- 2322- tase. These single-stranded RNAs are then converted to 2028-

1057-

770-

612-

495-

392- 343-

294-

210- FIG. 8. Absence of small subgenomic RNA in the genome RNAs from other types of CPV. Genome RNAs extracted from type 2, 5, and 11 CPVs were analyzed for the presence of small subgenomic RNA by 1% agarose gel electrophoresis. As controls, molecular FIG. 9. Analysis by gel electrophoresis of CPV mRNA synthe- markers (lanes 1 and 2) and genome RNA of type 1 CPV (right-end sized in vitro by virus-associated transcriptase. The in vitro CPV lane) were run in parallel. The gel was stained with ethidium transcription was done as described in Materials and Methods, arnd bromide. The amounts of RNA loaded onto the gel for CPV type 2 the [32P]UMP-labeled transcripts were resolved on a 10% polyacryl- and 11 are high enough to detect small subgenomic RNA, although amide sequencing gel. The 3'-[3PIpCp-1abe1ed dsRNA was heat the amount of CPV type 5 RNA is apparently too low to assess the denatured and run in parallel as a reference (lane B). The arrow presence of small RNA. An arrow indicates the migration position of indicates a faint, but discrete, RNA transcript synthesized by SP RNA of type 1 CPV. CPV-associated RNA polymerase. VOL. 62, 1988 CYTOPLASMIC POLYHEDROSIS VIRUS POLYHEDRIN 217 dsRNAs by a RNA-dependent RNA polymerase, the repli- gene. Proc. Natl. Acad. Sci. USA 72:3961-3965. case. The mechanism responsible for the generation of 9. Hooft van Iddekinge, B. J. L., G. E. Smith, and M. D. Summers. deletion mutant dsRNA is not clear at present; however, it 1983. Nucleotide sequence of the polyhedrin gene of Autogra- pha californica nuclear polyhedrosis virus. Virology 131: most likely proceeds by a deletion caused by a copy-choice 561-565. mechanism involving the intramolecular or intermolecular 10. Hopp, T. P., and K. R. Wood. 1981. Prediction of protein "jumping" of the viral transcriptase-replicase. There is no antigenic determinants from amino acid sequences. Proc. Natl. evidence of splicing events for genome dsRNAs or their Acad. Sci. USA 78:3824-3828. transcripts. 11. Iatrou, K., K. Ito, and H. Witkiewicz. 1985. Polyhedrin gene of The generation of terminally conserved mutant dsRNA Bombyx mori nuclear polyhedrosis virus. J. Virol. 54:436445. gene by internal deletion events has been previously re- 12. Imai, M., M. A. Richardson, N. Ikegami, A. J. Shatkin, and Y. ported for Saccharomyces cerevisiae virus (29) and wound Furuichi. 1983. Molecular cloning of double-stranded RNA viral tumor virus genome RNA (19). Additionally, terminal se- genomes. Proc. Natl. Acad. Sci. USA 80:373-377. 13. Kawase, S. 1964. The amino acid composition of viruses and quences are conserved in the formation of defective inter- their polyhedron proteins of the polyhedroses of the silkworm, fering RNA genomes of Sendai virus (23), Sindbis virus (17), Bombyx mori (Linnaeus). J. Insect Pathol. 6:156-163. and influenza virus (3). In all these systems, the internal 14. Kozak, M. 1981. Possible role of flanking nucleotides in recog- deletion yielded genomic RNAs that were functional with nition of the AUG initiator codon by eukaryotic ribosomes. respect to transcription, replication, and packaging. Nucleic Acids Res. 9:1111-1121. Indeed, the CPV SP RNA gene is apparently viable in 15. Kuchino, Y., S. Nishimura, R. E. Smith, and Y. Furuichi. 1982. replication and packaging into virus particles since it is Homologous terminal sequences in the double-stranded RNA present in the purified virus. In addition, the SP RNA gene genome segments of cytoplasmic polyhedrosis virus of the can be transcribed by virus-associated RNA polymerase silkworm Bombyx mori. J. Virol. 44:538-543. 16. Leisy, D., M. Nesson, M. Pearson, G. Rohrmann, and G. (Fig. 9). These observations indicate that the conserved Beaudreau. 1986. Location and nucleotide sequence of the terminal sequence of 321 bases present in CPV SP RNA Orgyia pseudotsugata single nucleocapsid nuclear polyhedrosis contain all the recognition signals required for virus genome virus polyhedrin gene. J. Gen. Virol. 67:1073-1079. replication and packaging into virus particles. 17. Levis, R., B. G. Weiss, M. Tsiang, H. Huang, and S. Schlesinger. Apart from SP RNA, there seem to be small deletion 1986. Deletion mapping of Sindbis virus DI RNAs derived from mutants generated from other genomic segments, since the cDNAs defines the sequences essential for replication and labeled small RNA fraction could hybridize also with CPV packaging. Cell 44:137-145. segments 1, 2, and 3 (Fig. 2A). The results suggest that the 18. Maxam, A. M., and W. Gilbert. 1977. A new method for SP RNA is a mixture of deletion mutants in which the sequencing DNA. Proc. Natl. Acad. Sci. USA 74:560-564. 19. Nuss, D. L., and D. Summers. 1984. Variant dsRNAs associated polyhedrin-related gene is, for some unknown reason, most with transmission-defective isolates of wound tumor virus rep- abundant. It will be important to determine and compare the resent terminally conserved remnants of genome segments. minimal sequence requirements of these deletion mutants to Virology 133:276-288. understand the molecular mechanism of CPV genome repli- 20. Payne, C. C., and J. Kalmakoff. 1974. Biochemical properties of cation and packaging. polyhedra and virus particles of cytoplasmic polyhedrosis virus of Bombyx mori. Intervirology 4:354-364. 21. Payne, C. C., and P. P. C. Mertens. 1983. Cytoplasmic poly- ACKNOWLEDGMENT hedrosis viruses, p. 425-504. In W. K. Joklik (ed.), The reovi- We thank Mariko Shida for excellent assistance in preparation of ridae. Plenum Publishing Corp., New York. the manuscript. 22. Payne, C. C., and C. F. Rivers. 1976. A provisional classification of cytoplasmic polyhedrosis viruses based on the sizes of the RNA genome segments. J. Gen. Virol. 33:71-81. LITERATURE CITED 23. Re, G. G., E. M. Morgan, and D. W. Kingsbury. 1985. Nucle- 1. Asamizu, T., D. Summers, M. B. Motika, J. V. Anzola, and D. L. otide sequences responsible for generation of internally deleted Nuss. 1985. Molecular cloning and characterization of the gen- Sendai virus defective interfering genomes. Virology 146:27-37. ome of wound tumor virus: a tumor-inducing plant reovirus. 24. Rohrmann, G. F. 1986. Review article: polyhedrin structure. J. Virology 144:398-407. Gen. Virol. 67:1499-1513. 2. Cashdollar, L. M., J. Espoza, G. R. Hudson, R. Chmelo, 25. Rohrmann, G. F., T. J. Bailey, B. Brimhall, R. R. Becker, and P. N. K. Lee, and W. K. Joklik. 1982. Cloning the double- G. S. Beaudreau. 1979. Tryptic peptide analysis and NH2- stranded RNA genes of reovirus: sequence of the cloned S2 terminal amino acid sequences of polyhedrins of two baculovi- gene. Proc. Natl. Acad. Sci. USA 79:7644-7648. ruses from Orgyia pseudotsugata. Proc. Natl. Acad. Sci. USA 3. Davis, A., A. L. Hiti, and D. P. Nayak. 1980. Influenza defective 76:4976-4980. interfering viral RNA is formed by internal deletion of genomic 26. Sanger, F., S. Nicklen, and A. F. Coulson. 1977. DNA sequenc- RNA. Proc. Natl. Acad. Sci. USA 77:215-219. ing with chain-terminating inhibitors. Proc. Natl. Acad. Sci. 4. Fujii-Kawata, I., K.-I. Miura, and M. Fuke. 1979. Segments of USA 74:5463-5467. genomes of viruses containing double-stranded ribonucleic acid. 27. Smith, R. E., and Y. Furuichi. 1980. Gene mapping of cytoplas- J. Mol. Biol. 51:247-253. mic polyhedrosis virus of silkworm by the full-length mRNA 5. Furuichi, Y. 1974. "Methylation-coupled" transcription by vi- prepared under optimized conditions of transcription in vitro. rus-associated transcriptase of cytoplasmic polyhedrosis virus Virology 103:279-290. containing double-stranded RNA. Nucleic Acids Res. 1: 28. Smith, R. E., M. A. Morgan, and Y. Furuichi. 1981. Separation 809-822. of the plus and minus strands of cytoplasmic polyhedrosis virus 6. Furuichi, Y., and K.-I. Miura. 1973. Identity of the 3'-terminal and human reovirus double-stranded genome RNAs by gel sequences in ten genome segments of silkworm cytoplasmic electrophoresis. Nucleic Acids Res. 9:5269-5286. polyhedrosis virus. Virology 55:418-425. 29. Thiele, D. J., E. M. Hannig, and M. J. Leibowitz. 1984. Genome 7. Furuichi, Y., and K.-I. Miura. 1975. A blocked structure at the structure and expression of a defective interfering mutant of the 5'-terminus of mRNA of cytoplasmic polyhedrosis virus. Na- killer virus of yeast. Virology 137:20-31. ture (London) 253:374-375. 30. Thomas, P. S. 1980. Hybridization of denatured RNA and small 8. Grunstein, M., and D. Hogness. 1975. Colony hybridization: a DNA fragments transferred to nitrocellulose. Proc. Natl. Acad. method for the isolation of cloned DNAs that contain a specific Sci. USA 77:5201-5205.