Barcoding Beetles: a Regional Survey of 1872 Species Reveals High Identification Success and Unusually Deep Interspecific Divergences

Total Page:16

File Type:pdf, Size:1020Kb

Load more

Barcoding Beetles: A Regional Survey of 1872 Species Reveals High Identification Success and Unusually Deep Interspecific Divergences Mikko Pentinsaari1*, Paul D. N. Hebert2, Marko Mutanen3 1 Department of Biology, University of Oulu, Oulu, Finland, 2 Biodiversity Institute of Ontario, University of Guelph, Guelph, Ontario, Canada, 3 Department of Biology, University of Oulu, Oulu, Finland Abstract With 400 K described species, beetles (Insecta: Coleoptera) represent the most diverse order in the animal kingdom. Although the study of their diversity currently represents a major challenge, DNA barcodes may provide a functional, standardized tool for their identification. To evaluate this possibility, we performed the first comprehensive test of the effectiveness of DNA barcodes as a tool for beetle identification by sequencing the COI barcode region from 1872 North European species. We examined intraspecific divergences, identification success and the effects of sample size on variation observed within and between species. A high proportion (98.3%) of these species possessed distinctive barcode sequence arrays. Moreover, the sequence divergences between nearest neighbor species were considerably higher than those reported for the only other insect order, Lepidoptera, which has seen intensive analysis (11.99% vs up to 5.80% mean NN divergence). Although maximum intraspecific divergence increased and average divergence between nearest neighbors decreased with increasing sampling effort, these trends rarely hampered identification by DNA barcodes due to deep sequence divergences between most species. The Barcode Index Number system in BOLD coincided strongly with known species boundaries with perfect matches between species and BINs in 92.1% of all cases. In addition, DNA barcode analysis revealed the likely occurrence of about 20 overlooked species. The current results indicate that DNA barcodes distinguish species of beetles remarkably well, establishing their potential to provide an effective identification tool for this order and to accelerate the discovery of new beetle species. Citation: Pentinsaari M, Hebert PDN, Mutanen M (2014) Barcoding Beetles: A Regional Survey of 1872 Species Reveals High Identification Success and Unusually Deep Interspecific Divergences. PLoS ONE 9(9): e108651. doi:10.1371/journal.pone.0108651 Editor: Diego Fontaneto, Consiglio Nazionale delle Ricerche (CNR), Italy Received June 26, 2014; Accepted September 3, 2014; Published September 25, 2014 Copyright: ß 2014 Pentinsaari et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. Data Availability: The authors confirm that all data underlying the findings are fully available without restriction. All barcode sequences and all relevant collection data (localities, coordinates, dates etc.) are available in BOLD. (http://www.boldsystems.org), along with voucher deposition details, original sequence trace files and photographs of the specimens. All these data are combined into a single citable dataset (doi: dx.doi.org/10.5883/DS-FBCOL). The sequences are also available in GenBank (see Supporting information, Table S1 for accession numbers). Funding: Funding from the government of Canada through Genome Canada (http://www.genomecanada.ca) and the Ontario Genomics Institute (http://www. ontariogenomics.ca/) to the International Barcode of Life Project enabled the Canadian Centre for DNA Barcoding (University of Guelph) to carry out the sequence analysis on our specimens. The authors also thank the Ontario Ministry of Research and Innovation (https://www.ontario.ca/ministry-research-innovation) for funding the ongoing development of BOLD. This study was funded by personal grants to MP from the Ella and Georg Ehrnrooth Foundation (http://www. ellageorg.fi/) and from the Jenny and Antti Wihuri Foundation (http://www.wihurinrahasto.fi/). The FinBOL project is funded by the Kone Foundation (http://www. koneensaatio.fi/), the Finnish Cultural Foundation (https://www.skr.fi/) and the University of Oulu (http://www.oulu.fi/yliopisto/). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. Competing Interests: The authors have declared that no competing interests exist. * Email: [email protected] Introduction important model organisms, including Tribolium castaneum (Herbst, 1797) [9] and Callosobruchus maculatus (Fabricius, With almost 400,000 described species [1], beetles (Coleoptera) 1775) [10], [11]. are the most speciose order of animals. Estimates of undescribed The vast number of animal, fungal, plant and protist species beetle diversity vary considerably ([2], [3]), but it is agreed that creates an insurmountable barrier for any comprehensive effort to many species await description. For example, about 62,000 species catalogue biodiversity by means of traditional taxonomy. Trig- of the relatively well-studied weevils (Curculionoidea) have been gered by this realization, often called the taxonomic impediment described, but the total species count is estimated to be about ([12], [13], [14]), Tautz et al. in 2003 [12] proposed an entirely 220,000 [4]. On this basis, it is likely that total number of beetle DNA-based system for the delineation of species. Almost species exceeds one million. As might be expected from their high simultaneously, Hebert et al. [15] suggested DNA barcoding as diversity, beetles show an extraordinary variety of life histories, a universal DNA-based identification system for species that was habitat and diet and occur in all biogeographical regions except designed to reinforce the capacity of Linnean taxonomy. Since the for mainland Antarctica. Their ecological importance is immense, original proposal, DNA barcoding has become a global enterprise and many are important pests of cultivated plants, stored products with more than 3000 publications on the theme. Large-scale and timber ([5], [6], [7], [8]). Some beetle species serve as projects targeting specific geographical regions or taxonomic PLOS ONE | www.plosone.org 1 September 2014 | Volume 9 | Issue 9 | e108651 Barcoding Beetles groups have been established, such as Fauna Bavarica (http:// Zoological Museum at the University of Oulu, Finland. Our www.faunabavarica.de/), NorBOL (http://www.norbol.org/), sampling efforts form a part of the Finnish Barcode of Life project GBOL (https://www.bolgermany.de/), the Lepidoptera Barcode (FinBOL, http://finbol.org/) which aims to assemble DNA of Life (http://www.lepbarcoding.org/) and FISH-BOL (http:// barcodes for all species of animals, plants and fungi occurring in www.fishbol.org/), initiatives which are contributing to the Finland. The present data represent progress toward a compre- International Barcode of Life Project (http://ibol.org/). However, hensive barcode library for Finnish Coleoptera after two years of despite the momentum that DNA barcoding has gained, beetles work. have received little attention. Some studies have tackled a DNA was extracted from 6423 specimens representing about particular species group or members of a family within a particular 2070 species. Most of these specimens (5855; 91%) were collected region ([16], [17], [18], [19]), but no taxonomically comprehen- from Finland. The others originate from Sweden (317; 5%), sive test of the effectiveness of DNA barcoding has been carried Estonia (235; 4%), Russia (15; ,1%), and some single specimens out at any geographical scale. from other countries. The sampling localities are situated between DNA barcoding relies on the assumption that sequences in the 56uN–71uN and 15uE–32uE. 59 region of the cytochrome c oxidase I (COI) gene are more Tissue samples were placed in 96-well microplates and sent to similar among members of a species than to sequences of any other the Canadian Centre for DNA Barcoding (CCDB) for DNA species. For the most part, this seems to be the case ([20], [21], extraction, PCR and sequencing of the 648 bp COI barcode [22]), although increasing the geographical scale of sampling often region. Depending on the size and state (fresh/dry) of the sampled reduces its success ([23], [24], [25], but see [26]). This decline is individual, one to three whole leg(s), part of a leg, a piece of the due to the increase in number of closely related species and to a thoracic flight muscles or the whole beetle was used for extraction. rise in genetic variation within species as geographical scale CCDB’s standard high-throughput protocols (documentation expands and more specimens are analyzed. Sampling can also available at http://ccdb.ca/resources.php) were used for extrac- impact results on a local scale. The proportion of a clade’s local tion, PCR and sequencing. A cocktail of the Folmer primers species sampled and the number of specimens sampled per species LCO1490 (GGTCAACAAATCATAAAGATATTGG) and both contribute to observed variation within and between species. HCO2198 (TAAACTTCAGGGTGACCAAAAAATCA) [30], The rate of success of COI barcoding varies across animal and the LepF1 (ATTCAACCAATCATAAAGATATTGG) and lineages. Some cnidarians are, for example, problematic because LepR1 (TAAACTTCTGGATGTCCAAAAAATCA) primers of their slowed rate of mitochondrial evolution [27] and within [31] was used in the first PCR amplification attempt for most insects, there are differences among orders [28]. specimens.
Recommended publications
  • (Iaps) and Other Small Waterbodies in Northern Ireland Quercus Project QU09-03

    (Iaps) and Other Small Waterbodies in Northern Ireland Quercus Project QU09-03

    Natural Heritage Research Partnership Important Areas for Ponds (IAPs) and other small waterbodies in Northern Ireland Quercus Project QU09-03 Bog pool at Montiaghs Moss Nature Reserve and ASSI Prepared for the Northern Ireland Environment Agency (NIEA) by Helen Keeble, Penny Williams, Jeremy Biggs, Pond Conservation & Neil Reid, Natural Heritage Research Partnership, Quercus This report should be cited as: Keeble, H. Williams, P. Biggs, J. & Reid, N. (2009) Important Areas for Ponds (IAPs) and other small waterbodies in Northern Ireland. Report prepared by Pond Conservation and the Natural Heritage Research Partnership, Quercus for the Northern Ireland Environment Agency, Northern Ireland, UK. Pond Conservation c/o Oxford Brookes University Gipsy Lane, Headington Oxford, OX3 0BP www.pondconservation.org.uk Quercus project QU09-03 Quercus hosts the Natural Heritage Research Partnership between the Northern Ireland Environment Agency and Queen's University Belfast. http://www.quercus.ac.uk/ www.quercus.ac.uk Acknowledgements We would like to thank all those who provided data, photos or other information for this assessment, and especially those who took time to visit sites with us in June 2009. In particular: Bob Davidson, Brian Nelson, Catherine McSorley, Jane Preston, John Early, Lynne Rendle, Marcus Malley, Mary Gallagher, Patrick Kelly, Richard Weyl, Seamus Burns and Tony Waterman. Report production: July 2009 Consultation: August 2009 SUMMARY Ponds are an important freshwater habitat that has been shown to play a key role in maintaining biodiversity at landscape level. However, ponds are also vulnerable to environmental degradation and there is evidence that, at a national level, pond quality is declining. In 2007, the biodiversity importance of ponds was recognised when high quality ponds (Priority Ponds) were added to the list of UK Biodiversity Action Plan (BAP) Priority Habitats.
  • Green-Tree Retention and Controlled Burning in Restoration and Conservation of Beetle Diversity in Boreal Forests

    Green-Tree Retention and Controlled Burning in Restoration and Conservation of Beetle Diversity in Boreal Forests

    Dissertationes Forestales 21 Green-tree retention and controlled burning in restoration and conservation of beetle diversity in boreal forests Esko Hyvärinen Faculty of Forestry University of Joensuu Academic dissertation To be presented, with the permission of the Faculty of Forestry of the University of Joensuu, for public criticism in auditorium C2 of the University of Joensuu, Yliopistonkatu 4, Joensuu, on 9th June 2006, at 12 o’clock noon. 2 Title: Green-tree retention and controlled burning in restoration and conservation of beetle diversity in boreal forests Author: Esko Hyvärinen Dissertationes Forestales 21 Supervisors: Prof. Jari Kouki, Faculty of Forestry, University of Joensuu, Finland Docent Petri Martikainen, Faculty of Forestry, University of Joensuu, Finland Pre-examiners: Docent Jyrki Muona, Finnish Museum of Natural History, Zoological Museum, University of Helsinki, Helsinki, Finland Docent Tomas Roslin, Department of Biological and Environmental Sciences, Division of Population Biology, University of Helsinki, Helsinki, Finland Opponent: Prof. Bengt Gunnar Jonsson, Department of Natural Sciences, Mid Sweden University, Sundsvall, Sweden ISSN 1795-7389 ISBN-13: 978-951-651-130-9 (PDF) ISBN-10: 951-651-130-9 (PDF) Paper copy printed: Joensuun yliopistopaino, 2006 Publishers: The Finnish Society of Forest Science Finnish Forest Research Institute Faculty of Agriculture and Forestry of the University of Helsinki Faculty of Forestry of the University of Joensuu Editorial Office: The Finnish Society of Forest Science Unioninkatu 40A, 00170 Helsinki, Finland http://www.metla.fi/dissertationes 3 Hyvärinen, Esko 2006. Green-tree retention and controlled burning in restoration and conservation of beetle diversity in boreal forests. University of Joensuu, Faculty of Forestry. ABSTRACT The main aim of this thesis was to demonstrate the effects of green-tree retention and controlled burning on beetles (Coleoptera) in order to provide information applicable to the restoration and conservation of beetle species diversity in boreal forests.
  • Water Beetles

    Water Beetles

    Ireland Red List No. 1 Water beetles Ireland Red List No. 1: Water beetles G.N. Foster1, B.H. Nelson2 & Á. O Connor3 1 3 Eglinton Terrace, Ayr KA7 1JJ 2 Department of Natural Sciences, National Museums Northern Ireland 3 National Parks & Wildlife Service, Department of Environment, Heritage & Local Government Citation: Foster, G. N., Nelson, B. H. & O Connor, Á. (2009) Ireland Red List No. 1 – Water beetles. National Parks and Wildlife Service, Department of Environment, Heritage and Local Government, Dublin, Ireland. Cover images from top: Dryops similaris (© Roy Anderson); Gyrinus urinator, Hygrotus decoratus, Berosus signaticollis & Platambus maculatus (all © Jonty Denton) Ireland Red List Series Editors: N. Kingston & F. Marnell © National Parks and Wildlife Service 2009 ISSN 2009‐2016 Red list of Irish Water beetles 2009 ____________________________ CONTENTS ACKNOWLEDGEMENTS .................................................................................................................................... 1 EXECUTIVE SUMMARY...................................................................................................................................... 2 INTRODUCTION................................................................................................................................................ 3 NOMENCLATURE AND THE IRISH CHECKLIST................................................................................................ 3 COVERAGE .......................................................................................................................................................
  • The Evolution and Genomic Basis of Beetle Diversity

    The Evolution and Genomic Basis of Beetle Diversity

    The evolution and genomic basis of beetle diversity Duane D. McKennaa,b,1,2, Seunggwan Shina,b,2, Dirk Ahrensc, Michael Balked, Cristian Beza-Bezaa,b, Dave J. Clarkea,b, Alexander Donathe, Hermes E. Escalonae,f,g, Frank Friedrichh, Harald Letschi, Shanlin Liuj, David Maddisonk, Christoph Mayere, Bernhard Misofe, Peyton J. Murina, Oliver Niehuisg, Ralph S. Petersc, Lars Podsiadlowskie, l m l,n o f l Hans Pohl , Erin D. Scully , Evgeny V. Yan , Xin Zhou , Adam Slipinski , and Rolf G. Beutel aDepartment of Biological Sciences, University of Memphis, Memphis, TN 38152; bCenter for Biodiversity Research, University of Memphis, Memphis, TN 38152; cCenter for Taxonomy and Evolutionary Research, Arthropoda Department, Zoologisches Forschungsmuseum Alexander Koenig, 53113 Bonn, Germany; dBavarian State Collection of Zoology, Bavarian Natural History Collections, 81247 Munich, Germany; eCenter for Molecular Biodiversity Research, Zoological Research Museum Alexander Koenig, 53113 Bonn, Germany; fAustralian National Insect Collection, Commonwealth Scientific and Industrial Research Organisation, Canberra, ACT 2601, Australia; gDepartment of Evolutionary Biology and Ecology, Institute for Biology I (Zoology), University of Freiburg, 79104 Freiburg, Germany; hInstitute of Zoology, University of Hamburg, D-20146 Hamburg, Germany; iDepartment of Botany and Biodiversity Research, University of Wien, Wien 1030, Austria; jChina National GeneBank, BGI-Shenzhen, 518083 Guangdong, People’s Republic of China; kDepartment of Integrative Biology, Oregon State
  • Dytiscid Water Beetles (Coleoptera: Dytiscidae) of the Yukon

    Dytiscid Water Beetles (Coleoptera: Dytiscidae) of the Yukon

    Dytiscid water beetles of the Yukon FRONTISPIECE. Neoscutopterus horni (Crotch), a large, black species of dytiscid beetle that is common in sphagnum bog pools throughout the Yukon Territory. 491 Dytiscid Water Beetles (Coleoptera: Dytiscidae) of the Yukon DAVID J. LARSON Department of Biology, Memorial University of Newfoundland St. John’s, Newfoundland, Canada A1B 3X9 Abstract. One hundred and thirteen species of Dytiscidae (Coleoptera) are recorded from the Yukon Territory. The Yukon distribution, total geographical range and habitat of each of these species is described and multi-species patterns are summarized in tabular form. Several different range patterns are recognized with most species being Holarctic or transcontinental Nearctic boreal (73%) in lentic habitats. Other major range patterns are Arctic (20 species) and Cordilleran (12 species), while a few species are considered to have Grassland (7), Deciduous forest (2) or Southern (5) distributions. Sixteen species have a Beringian and glaciated western Nearctic distribution, i.e. the only Nearctic Wisconsinan refugial area encompassed by their present range is the Alaskan/Central Yukon refugium; 5 of these species are closely confined to this area while 11 have wide ranges that extend in the arctic and/or boreal zones east to Hudson Bay. Résumé. Les dytiques (Coleoptera: Dytiscidae) du Yukon. Cent treize espèces de dytiques (Coleoptera: Dytiscidae) sont connues au Yukon. Leur répartition au Yukon, leur répartition globale et leur habitat sont décrits et un tableau résume les regroupements d’espèces. La répartition permet de reconnaître plusieurs éléments: la majorité des espèces sont holarctiques ou transcontinentales-néarctiques-boréales (73%) dans des habitats lénitiques. Vingt espèces sont arctiques, 12 sont cordillériennes, alors qu’un petit nombre sont de la prairie herbeuse (7), ou de la forêt décidue (2), ou sont australes (5).
  • Colorado Potato Beetle.Pub

    Colorado Potato Beetle.Pub

    CORNELL COOPERATIVE EXTENSION OF ONEIDA COUNTY 121 Second Street Oriskany, NY 13424-9799 (315) 736-3394 or (315) 337-2531 FAX: (315) 736-2580 Colorado Potato Beetle Leptinotarsa decemlineata Description: The Colorado potato beetle was first described in 1824 from the upper Missouri River Valley where it fed on a weed called buffalo bur or sand bur, but when early settlers first began to plant potatoes, the beetles discovered the new food plant and liked it. Adult Colorado Potato Beetle Colorado Potato Beetle larva Injury: Larvae and adults feed on the foliage of potato, eggplant, tomatoes and peppers. They may reach large numbers and eat all the foliage from the plant as well as spoil the fruit by eating into it. They are especially de- structive to small plantings. Life History: Adult beetles come out of winter hibernation in mid-May on Long Island and a week or ten days later in central New York just before the early-planted potatoes are up. Clusters of 20 or more eggs are laid on the underside of the leaves soon after the beetles emerge. The eggs hatch in seven to ten days. The larvae feed on the foliage, grow rapidly and complete their development in 18 to 21 days. The full-grown larva burrows into the ground and changes to the pupa or resting stage. After seven to ten days, the adult beetle emerges from the pupa, crawls up out of the ground, and after a short period of waiting, lays eggs for the second generation. Management: In the past several years, the Colorado potato beetle has become increasingly difficult to control because it has developed resistance to many commonly used chemical insecticides.
  • Annales Zoologici Fennici 39: 109-123

    Annales Zoologici Fennici 39: 109-123

    ANN. ZOOL. FENNICI Vol. 39 • Dispersing diving beetles in different landscapes 109 Ann. Zool. Fennici 39: 109–123 ISSN 0003-455X Helsinki 14 June 2002 © Finnish Zoological and Botanical Publishing Board 2002 Dispersing diving beetles (Dytiscidae) in agricultural and urban landscapes in south-eastern Sweden Elisabeth Lundkvist*, Jan Landin & Fredrik Karlsson Department of Biology, Linköping University, SE-581 83 Linköping, Sweden (*e-mail: [email protected]) Received 6 April 2001, accepted 15 October 2001 Lundkvist, E., Landin, J. & Karlsson, F. 2002: Dispersing diving beetles (Dytiscidae) in agricultural and urban landscapes in south-eastern Sweden. — Ann. Zool. Fennici 39: 109–123. Flying dytiscids were trapped in an agricultural landscape with wetlands in different successional stages and in two urban landscapes with young wetlands. We compared the faunas in air and in water. Hydroporus and Agabus were the most frequently trapped genera in air. Most species were trapped near water in the agricultural landscape; species characteristic of later successional stages were common in air and dominated in water. In the urban landscapes, species were mainly trapped far from water and species known to colonise new waters were common in air and in the youngest waters. Overall, females and immature adults were more common in fl ight catches during April–July than during August–October. Our results indicate that urbanisation would result in a less diverse fauna, but may lead to an assemblage dominated by species that are infrequent in agricultural landscapes. To obtain a rich wetland insect fauna, a wide range of wetland types is required at the landscape scale. Introduction both in space and time (Bilton 1994).
  • Susceptibility of Adult Colorado Potato Beetle (Leptinotarsa Decemlineata) to the Fungal Entomopathogen Beauveria Bassiana Ellen Klinger

    Susceptibility of Adult Colorado Potato Beetle (Leptinotarsa Decemlineata) to the Fungal Entomopathogen Beauveria Bassiana Ellen Klinger

    The University of Maine DigitalCommons@UMaine Electronic Theses and Dissertations Fogler Library 8-2003 Susceptibility of Adult Colorado Potato Beetle (Leptinotarsa Decemlineata) to the Fungal Entomopathogen Beauveria Bassiana Ellen Klinger Follow this and additional works at: http://digitalcommons.library.umaine.edu/etd Part of the Agricultural Science Commons, Agriculture Commons, Entomology Commons, and the Environmental Sciences Commons Recommended Citation Klinger, Ellen, "Susceptibility of Adult Colorado Potato Beetle (Leptinotarsa Decemlineata) to the Fungal Entomopathogen Beauveria Bassiana" (2003). Electronic Theses and Dissertations. 386. http://digitalcommons.library.umaine.edu/etd/386 This Open-Access Thesis is brought to you for free and open access by DigitalCommons@UMaine. It has been accepted for inclusion in Electronic Theses and Dissertations by an authorized administrator of DigitalCommons@UMaine. SUSCEPTIBILITY OF ADULT COLORADO POTATO BEETLE (LEPTINOTARSA DECEMLINEATA) TO THE FUNGAL ENTOMOPATHOGEN BEAUVERIA BASSIANA BY Ellen Klinger B.S. Lycoming College, 2000 A THESIS Submitted in Partial Fulfillment of the Requirements for the Degree of Master of Science (in Ecology and Environmental Sciences) The Graduate School The University of Maine August, 2003 Advisory Committee: Eleanor Groden, Associate Professor of Entomology, Advisor Francis Drumrnond, Professor of Entomology Seanna Annis, Assistant Professor of Mycology SUSCEPTIBILITY OF ADULT COLORADO POTATO BEETLE (LEPTINOTARSA DECEMLINEATA) TO THE FUNGAL ENTOMOPATHOGEN BEAUVERIA BASSIANA By Ellen Klinger Thesis Advisor: Dr. Eleanor Groden An Abstract of the Thesis Presented in Partial Fulfillment of the Requirements for the Degree of Master of Science (in Ecology and Environmental Sciences) August, 2003 Factors influencing the susceptibility of adult Colorado potato beetle (CPB), Leptinotarsa decemlineata (Say), to the fungal entomopathogen, Beauveria bassiana (Bals.), were studied.
  • Coleoptera: Introduction and Key to Families

    Coleoptera: Introduction and Key to Families

    Royal Entomological Society HANDBOOKS FOR THE IDENTIFICATION OF BRITISH INSECTS To purchase current handbooks and to download out-of-print parts visit: http://www.royensoc.co.uk/publications/index.htm This work is licensed under a Creative Commons Attribution-NonCommercial-ShareAlike 2.0 UK: England & Wales License. Copyright © Royal Entomological Society 2012 ROYAL ENTOMOLOGICAL SOCIETY OF LONDON Vol. IV. Part 1. HANDBOOKS FOR THE IDENTIFICATION OF BRITISH INSECTS COLEOPTERA INTRODUCTION AND KEYS TO FAMILIES By R. A. CROWSON LONDON Published by the Society and Sold at its Rooms 41, Queen's Gate, S.W. 7 31st December, 1956 Price-res. c~ . HANDBOOKS FOR THE IDENTIFICATION OF BRITISH INSECTS The aim of this series of publications is to provide illustrated keys to the whole of the British Insects (in so far as this is possible), in ten volumes, as follows : I. Part 1. General Introduction. Part 9. Ephemeroptera. , 2. Thysanura. 10. Odonata. , 3. Protura. , 11. Thysanoptera. 4. Collembola. , 12. Neuroptera. , 5. Dermaptera and , 13. Mecoptera. Orthoptera. , 14. Trichoptera. , 6. Plecoptera. , 15. Strepsiptera. , 7. Psocoptera. , 16. Siphonaptera. , 8. Anoplura. 11. Hemiptera. Ill. Lepidoptera. IV. and V. Coleoptera. VI. Hymenoptera : Symphyta and Aculeata. VII. Hymenoptera: Ichneumonoidea. VIII. Hymenoptera : Cynipoidea, Chalcidoidea, and Serphoidea. IX. Diptera: Nematocera and Brachycera. X. Diptera: Cyclorrhapha. Volumes 11 to X will be divided into parts of convenient size, but it is not possible to specify in advance the taxonomic content of each part. Conciseness and cheapness are main objectives in this new series, and each part will be the work of a specialist, or of a group of specialists.
  • The Staphylinoid and Dascilloid Aquatic Coleoptera of the Nevada Area

    The Staphylinoid and Dascilloid Aquatic Coleoptera of the Nevada Area

    Great Basin Naturalist Volume 10 Article 7 Number 1 – Number 4 10-10-1950 The ts aphylinoid and dascilloid aquatic Coleoptera of the Nevada area Ira La Rivers University of Nevada, Reno Follow this and additional works at: https://scholarsarchive.byu.edu/gbn Recommended Citation Rivers, Ira La (1950) "The ts aphylinoid and dascilloid aquatic Coleoptera of the Nevada area," Great Basin Naturalist: Vol. 10 : No. 1 , Article 7. Available at: https://scholarsarchive.byu.edu/gbn/vol10/iss1/7 This Article is brought to you for free and open access by the Western North American Naturalist Publications at BYU ScholarsArchive. It has been accepted for inclusion in Great Basin Naturalist by an authorized editor of BYU ScholarsArchive. For more information, please contact [email protected], [email protected]. THE STAPHYLINOID AND DASCILLOID AQUATIC COLEOPTERA OF THE NEVADA AREA IRA LA RIVERS University of Nevada, Reno Included in the following list, in addition to actual records, are what are considered to be the most likely probables (genera and spe- are placed in cies ) to be added to the list with future collecting. These the text and keys in the belief that such information will render their detection easier. STAPHYLINOIDEA HYDRAENIDAE ( Limnehiidae) The three genera currently placed in this family may be separated by Leech's 1948 key. He also gives a good review of the vicissitudes of the group, until comparatively recently included in the Hydrophi- lidae. On the basis of larval structure, they have been placed in the Staphylinoidea.
  • Integrated Pest Management in the Global Arena

    Integrated Pest Management in the Global Arena

    Integrated Pest Management in the Global Arena This Handbook is dedicated to all the participants of the Michigan State University’s International IPM Short Course and to the faculty members who have provided support to this course. Integrated Pest Management in the Global Arena Edited by K.M. Maredia Professor Institute of International Agriculture and Department of Entomology Michigan State University East Lansing Michigan USA D. Dakouo Senior Research Scientist INERA Bobo-Dioulasso Burkina Faso and D. Mota-Sanchez Research Associate Department of Entomology Michigan State University East Lansing Michigan USA CABI Publishing CABI Publishing is a division of CAB International CABI Publishing CABI Publishing CAB International 44 Brattle Street Wallingford 4th Floor Oxon OX10 8DE Cambridge, MA 02138 UK USA Tel: +44 (0)1491 832111 Tel: +1 617 395 4056 Fax: +44 (0)1491 833508 Fax: +1 617 354 6875 Email: [email protected] E-mail: [email protected] Website: www.cabi-publishing.org ©CAB International 2003. All rights reserved. No part of this publication may be reproduced in any form or by any means, electronically, mechanically, by photocopying, recording or otherwise, without the prior permission of the copyright owners. A catalogue record for this book is available from the British Library, London, UK. Library of Congress Cataloging-in-Publication Data Integrated pest management in the global arena /edited by K.M. Maredia, D. Dakouo, D. Mota-Sanchez p. cm. Includes bibliographical references. ISBN 0-85199-652-3 1. Pests--Integrated control. I. Maredia, Karim M. II. Dakouo, D. (Dona), 1951- III. Mota-Sanchez, D. (David), 1960- SB950.I4575 2003 632′.9--dc21 2002154965 ISBN 0 85199 652 3 Typeset by AMA DataSet, UK Printed and bound in the UK by Cromwell Press, Trowbridge Contents Contributors ix Preface xv Acknowledgments xvii Foreword xix Acronyms and Abbreviations xxi 1Introduction and Overview 1 K.M.
  • Modern Techniques in Colorado Potato Beetle (Leptinotarsa Decemlineata Say) Control and Resistance Management: History Review and Future Perspectives

    Modern Techniques in Colorado Potato Beetle (Leptinotarsa Decemlineata Say) Control and Resistance Management: History Review and Future Perspectives

    insects Review Modern Techniques in Colorado Potato Beetle (Leptinotarsa decemlineata Say) Control and Resistance Management: History Review and Future Perspectives Martina Kadoi´cBalaško 1,* , Katarina M. Mikac 2 , Renata Bažok 1 and Darija Lemic 1 1 Department of Agricultural Zoology, Faculty of Agriculture, University of Zagreb, Svetošimunska 25, 10000 Zagreb, Croatia; [email protected] (R.B.); [email protected] (D.L.) 2 Centre for Sustainable Ecosystem Solutions, School of Earth, Atmospheric and Life Sciences, Faculty of Science, Medicine and Health, University of Wollongong, Wollongong 2522, Australia; [email protected] * Correspondence: [email protected]; Tel.: +385-1-239-3654 Received: 8 July 2020; Accepted: 22 August 2020; Published: 1 September 2020 Simple Summary: The Colorado potato beetle (CPB) is one of the most important potato pest worldwide. It is native to U.S. but during the 20th century it has dispersed through Europe, Asia and western China. It continues to expand in an east and southeast direction. Damages are caused by larvae and adults. Their feeding on potato plant leaves can cause complete defoliation and lead to a large yield loss. After the long period of using only chemical control measures, the emergence of resistance increased and some new and different methods come to the fore. The main focus of this review is on new approaches to the old CPB control problem. We describe the use of Bacillus thuringiensis and RNA interference (RNAi) as possible solutions for the future in CPB management. RNAi has proven successful in controlling many pests and shows great potential for CPB control. Better understanding of the mechanisms that affect efficiency will enable the development of this technology and boost potential of RNAi to become part of integrated plant protection in the future.