Barcoding Beetles: A Regional Survey of 1872 Species Reveals High Identification Success and Unusually Deep Interspecific Divergences Mikko Pentinsaari1*, Paul D. N. Hebert2, Marko Mutanen3 1 Department of Biology, University of Oulu, Oulu, Finland, 2 Biodiversity Institute of Ontario, University of Guelph, Guelph, Ontario, Canada, 3 Department of Biology, University of Oulu, Oulu, Finland Abstract With 400 K described species, beetles (Insecta: Coleoptera) represent the most diverse order in the animal kingdom. Although the study of their diversity currently represents a major challenge, DNA barcodes may provide a functional, standardized tool for their identification. To evaluate this possibility, we performed the first comprehensive test of the effectiveness of DNA barcodes as a tool for beetle identification by sequencing the COI barcode region from 1872 North European species. We examined intraspecific divergences, identification success and the effects of sample size on variation observed within and between species. A high proportion (98.3%) of these species possessed distinctive barcode sequence arrays. Moreover, the sequence divergences between nearest neighbor species were considerably higher than those reported for the only other insect order, Lepidoptera, which has seen intensive analysis (11.99% vs up to 5.80% mean NN divergence). Although maximum intraspecific divergence increased and average divergence between nearest neighbors decreased with increasing sampling effort, these trends rarely hampered identification by DNA barcodes due to deep sequence divergences between most species. The Barcode Index Number system in BOLD coincided strongly with known species boundaries with perfect matches between species and BINs in 92.1% of all cases. In addition, DNA barcode analysis revealed the likely occurrence of about 20 overlooked species. The current results indicate that DNA barcodes distinguish species of beetles remarkably well, establishing their potential to provide an effective identification tool for this order and to accelerate the discovery of new beetle species. Citation: Pentinsaari M, Hebert PDN, Mutanen M (2014) Barcoding Beetles: A Regional Survey of 1872 Species Reveals High Identification Success and Unusually Deep Interspecific Divergences. PLoS ONE 9(9): e108651. doi:10.1371/journal.pone.0108651 Editor: Diego Fontaneto, Consiglio Nazionale delle Ricerche (CNR), Italy Received June 26, 2014; Accepted September 3, 2014; Published September 25, 2014 Copyright: ß 2014 Pentinsaari et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. Data Availability: The authors confirm that all data underlying the findings are fully available without restriction. All barcode sequences and all relevant collection data (localities, coordinates, dates etc.) are available in BOLD. (http://www.boldsystems.org), along with voucher deposition details, original sequence trace files and photographs of the specimens. All these data are combined into a single citable dataset (doi: dx.doi.org/10.5883/DS-FBCOL). The sequences are also available in GenBank (see Supporting information, Table S1 for accession numbers). Funding: Funding from the government of Canada through Genome Canada (http://www.genomecanada.ca) and the Ontario Genomics Institute (http://www. ontariogenomics.ca/) to the International Barcode of Life Project enabled the Canadian Centre for DNA Barcoding (University of Guelph) to carry out the sequence analysis on our specimens. The authors also thank the Ontario Ministry of Research and Innovation (https://www.ontario.ca/ministry-research-innovation) for funding the ongoing development of BOLD. This study was funded by personal grants to MP from the Ella and Georg Ehrnrooth Foundation (http://www. ellageorg.fi/) and from the Jenny and Antti Wihuri Foundation (http://www.wihurinrahasto.fi/). The FinBOL project is funded by the Kone Foundation (http://www. koneensaatio.fi/), the Finnish Cultural Foundation (https://www.skr.fi/) and the University of Oulu (http://www.oulu.fi/yliopisto/). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. Competing Interests: The authors have declared that no competing interests exist. * Email: [email protected] Introduction important model organisms, including Tribolium castaneum (Herbst, 1797) [9] and Callosobruchus maculatus (Fabricius, With almost 400,000 described species [1], beetles (Coleoptera) 1775) [10], [11]. are the most speciose order of animals. Estimates of undescribed The vast number of animal, fungal, plant and protist species beetle diversity vary considerably ([2], [3]), but it is agreed that creates an insurmountable barrier for any comprehensive effort to many species await description. For example, about 62,000 species catalogue biodiversity by means of traditional taxonomy. Trig- of the relatively well-studied weevils (Curculionoidea) have been gered by this realization, often called the taxonomic impediment described, but the total species count is estimated to be about ([12], [13], [14]), Tautz et al. in 2003 [12] proposed an entirely 220,000 [4]. On this basis, it is likely that total number of beetle DNA-based system for the delineation of species. Almost species exceeds one million. As might be expected from their high simultaneously, Hebert et al. [15] suggested DNA barcoding as diversity, beetles show an extraordinary variety of life histories, a universal DNA-based identification system for species that was habitat and diet and occur in all biogeographical regions except designed to reinforce the capacity of Linnean taxonomy. Since the for mainland Antarctica. Their ecological importance is immense, original proposal, DNA barcoding has become a global enterprise and many are important pests of cultivated plants, stored products with more than 3000 publications on the theme. Large-scale and timber ([5], [6], [7], [8]). Some beetle species serve as projects targeting specific geographical regions or taxonomic PLOS ONE | www.plosone.org 1 September 2014 | Volume 9 | Issue 9 | e108651 Barcoding Beetles groups have been established, such as Fauna Bavarica (http:// Zoological Museum at the University of Oulu, Finland. Our www.faunabavarica.de/), NorBOL (http://www.norbol.org/), sampling efforts form a part of the Finnish Barcode of Life project GBOL (https://www.bolgermany.de/), the Lepidoptera Barcode (FinBOL, http://finbol.org/) which aims to assemble DNA of Life (http://www.lepbarcoding.org/) and FISH-BOL (http:// barcodes for all species of animals, plants and fungi occurring in www.fishbol.org/), initiatives which are contributing to the Finland. The present data represent progress toward a compre- International Barcode of Life Project (http://ibol.org/). However, hensive barcode library for Finnish Coleoptera after two years of despite the momentum that DNA barcoding has gained, beetles work. have received little attention. Some studies have tackled a DNA was extracted from 6423 specimens representing about particular species group or members of a family within a particular 2070 species. Most of these specimens (5855; 91%) were collected region ([16], [17], [18], [19]), but no taxonomically comprehen- from Finland. The others originate from Sweden (317; 5%), sive test of the effectiveness of DNA barcoding has been carried Estonia (235; 4%), Russia (15; ,1%), and some single specimens out at any geographical scale. from other countries. The sampling localities are situated between DNA barcoding relies on the assumption that sequences in the 56uN–71uN and 15uE–32uE. 59 region of the cytochrome c oxidase I (COI) gene are more Tissue samples were placed in 96-well microplates and sent to similar among members of a species than to sequences of any other the Canadian Centre for DNA Barcoding (CCDB) for DNA species. For the most part, this seems to be the case ([20], [21], extraction, PCR and sequencing of the 648 bp COI barcode [22]), although increasing the geographical scale of sampling often region. Depending on the size and state (fresh/dry) of the sampled reduces its success ([23], [24], [25], but see [26]). This decline is individual, one to three whole leg(s), part of a leg, a piece of the due to the increase in number of closely related species and to a thoracic flight muscles or the whole beetle was used for extraction. rise in genetic variation within species as geographical scale CCDB’s standard high-throughput protocols (documentation expands and more specimens are analyzed. Sampling can also available at http://ccdb.ca/resources.php) were used for extrac- impact results on a local scale. The proportion of a clade’s local tion, PCR and sequencing. A cocktail of the Folmer primers species sampled and the number of specimens sampled per species LCO1490 (GGTCAACAAATCATAAAGATATTGG) and both contribute to observed variation within and between species. HCO2198 (TAAACTTCAGGGTGACCAAAAAATCA) [30], The rate of success of COI barcoding varies across animal and the LepF1 (ATTCAACCAATCATAAAGATATTGG) and lineages. Some cnidarians are, for example, problematic because LepR1 (TAAACTTCTGGATGTCCAAAAAATCA) primers of their slowed rate of mitochondrial evolution [27] and within [31] was used in the first PCR amplification attempt for most insects, there are differences among orders [28]. specimens.