DOCSLIB.ORG

Full Text (PDF)

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Full Text (PDF) The 3′ IgH Locus Control Region Is Sufficient to Deregulate a c- myc Transgene and Promote Mature B Cell Malignancies with a Predominant Burkitt-Like Phenotype This information is current as of September 29, 2021. Véronique Truffinet, Eric Pinaud, Nadine Cogné, Barbara Petit, Laurence Guglielmi, Michel Cogné and Yves Denizot J Immunol 2007; 179:6033-6042; ; doi: 10.4049/jimmunol.179.9.6033 http://www.jimmunol.org/content/179/9/6033 Downloaded from Supplementary http://www.jimmunol.org/content/suppl/2008/03/12/179.9.6033.DC1 Material http://www.jimmunol.org/ References This article cites 36 articles, 18 of which you can access for free at: http://www.jimmunol.org/content/179/9/6033.full#ref-list-1 Why The JI? Submit online. • Rapid Reviews! 30 days* from submission to initial decision by guest on September 29, 2021 • No Triage! Every submission reviewed by practicing scientists • Fast Publication! 4 weeks from acceptance to publication *average Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2007 by The American Association of Immunologists All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology The 3؅ IgH Locus Control Region Is Sufficient to Deregulate a c-myc Transgene and Promote Mature B Cell Malignancies with a Predominant Burkitt-Like Phenotype1 Ve´ronique Truffinet,* Eric Pinaud,* Nadine Cogne´,* Barbara Petit,*† Laurence Guglielmi,2* Michel Cogne´,* and Yves Denizot3* Burkitt lymphoma (BL) features translocations linking c-myc to an Ig locus. Breakpoints in the H chain locus (IgH) stand either ؅ ؅ close to JH or within switch regions and always link c-myc to the 3 IgH locus control region (3 LCR). To test the hypothesis that the 3؅ LCR alone was sufficient to deregulate c-myc, we generated mice carrying a 3؅ LCR-driven c-myc transgene and specifically up-regulating c-myc in B cells. Splenic B cells from mice proliferated exaggeratedly in response to various signals had an elevated apoptosis rate but normal B220/IgM/IgD expression. Although all Ig levels were lowered in vivo, class switching and Ig secretion Downloaded from proved normal in vitro. Beginning at the age of 12 wk, transgenic mice developed clonal lymphoblastic lymphomas or diffuse anaplastic plasmacytomas with an overall incidence of 80% by 40 wk. Lymphoblastic lymphomas were B220؉IgM؉IgD؉ with the BL “starry sky” appearance. Gene expression profiles revealed broad alterations in the proliferation program and the Ras-p21 pathway. Our study demonstrates that 3؅ IgH enhancers alone can deregulate c-myc and initiate the development of BL-like lymphomas. The rapid and constant occurrence of lymphoma in this model makes it valuable for the understanding and the potential therapeutic manipulation of c-myc oncogenicity in vivo. The Journal of Immunology, 2007, 179: 6033–6042. http://www.jimmunol.org/ ␮ xpression of c-myc is tightly linked to the early G1 phase linked to E were shown to promote B cell malignancies, although of the cell cycle and plays a critical role in cell prolifer- with a pro-B phenotype (5). Whether E␮ was included, mice car- ation, differentiation, metabolism, and apoptosis (1). Bur- rying yeast artificial chromosomes linking the c-myc gene to a 5Ј E 4 ␦ kitt lymphoma (BL) is characterized by specific chromosomal portion of the IgH locus (VH to C ) developed rather immature B translocations involving the c-myc gene and one of the Ig loci (Ig␬, cell malignancies expressing a variable degree of CD43 (6, 7). Ig␭, and IgH) (2). Once translocated and having lost its normal Altogether, 5Ј elements of the locus induced malignancies with control, c-myc is constitutively expressed throughout the cell cycle features of pre-B, immature B, or transitional B cells rather than by guest on September 29, 2021 in B-lineage cells, the oncogene deregulation being considered the mature B cells as in BL. These results suggest that downstream result from juxtaposition to the Ig gene enhancers. In 80% of cases, IgH elements must deregulate c-myc in BL. the translocation involves the IgH locus (2), itself regulated by a Several lymphoid-specific transcriptional enhancers (hs3a, hs1, complex interplay of regulatory elements responsible for tissue- 2, hs3b, and hs4 in the mouse) have been identified within a 3Ј and stage-specific regulation of both transcription and rearrange- regulatory region lying downstream of the IgH locus. The hs4 ments. Early B cell-specific events such as the germline transcrip- distal element is active from the pre-B cell stage and throughout B tion initiated at the DQ52 promoter and the initiation of VDJ cell ontogeny. A larger region with a global “palindromic” struc- recombination are regulated by upstream elements including the ture encompassing the hs1, 2 central enhancer flanked by inverted E␮ enhancer (3, 4). This cis-acting element was the first candidate repeats, including hs3a and hs3b elements, is active at late B cell proposed for c-myc deregulation in BL because c-myc transgenes stages (8). Altogether, the four elements constitute a potent locus control region (LCR) conferring position-independent and copy- dependent expression to transgenes (9). These elements display *Unite´Mixte de Recherche, Centre National de la Recherche Scientifique 6101, Uni- versite´de Limoges, Limoges, France; and †Service d’Anatomie Pathologique, Uni- specific activity during terminal B cell differentiation, with a major versity Hospital, Limoges, France role in class switch recombination (CSR) (10–12). A construct Received for publication May 11, 2007. Accepted for publication August 13, 2007. containing the four 3Ј IgH enhancers confers, when surrounded by The costs of publication of this article were defrayed in part by the payment of page insulators, an expression from pre-B cells to mature B cells that is charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. strictly confined to the B cell lineage (13). In BL, IgH locus breakpoints are located either in the VDJ (en- 1 This work was supported by grants from Ligue Nationale contre le Cancer, Conseil Re´gional du Limousin, and “Lions Club de la Corre`ze, Zone 33 district 103 Sud.” demic BL) or the switch region (sporadic BL). When upstream of 2 Current address: Institut National de la Sante´et de la Recherche Me´dicale Unite´ E␮, the chromosomal breakage may result from an abnormal so- 454, Centre Hospitalier de l’Universite´Arnaud de Villeneuve, Montpellier, France. matic hypermutation event in early germinal center B cells. Break- 3 Address correspondence and reprint requests to Dr. Yves Denizot, Faculte´Me´- points located within switch regions are rather initiated by an er- decine, Laboratoire d’Immunologie, Unite´Mixte de Recherche, Centre National de la Recherche Scientifique 6101, 2 rue Dr. Marcland, 87025, Limoges, France. E-mail roneous class switching and link c-myc to a downstream portion of address: [email protected] the locus lacking E␮ (2). By contrast, 3Ј IgH enhancers are always 4 Abbreviations used in this paper: BL, Burkitt lymphoma; LCR, locus control region; conserved on the c-myc-translocated chromosome and constitute CSR, class switch recombination; ES, embryonic stem; wt, wild type; WBC, white candidates for oncogene deregulation. blood cell. In 20% of cases, c-myc translocation involved the Ig L chain Copyright © 2007 by The American Association of Immunologists, Inc. 0022-1767/07/$2.00 (Ig␬ and Ig␭) loci. A BL-like model has been previously generated www.jimmunol.org 6034 c-myc-3Ј LCR AND BL by using the c-myc gene fused to elements of the ␭ L chain locus ␮l. Quantitative PCR was performed in duplicate by using TaqMan assay (14). However, in 80% of cases, c-myc translocation involved the reagents and analyzed on an ABI Prism 7000 system (Applied Biosys- IgH locus. For now, two mouse models have closely mimicked tems). Product reference for c-myc was Mm00487803-m1 and for the 18S RNA used for normalization of gene expression levels was Hs99999901-s1 c-myc translocation into the IgH locus. In one case, a c-myc in- (Applied Biosystems). Primers and probe for the P1 promoter were: 5Ј- sertion downstream of JH imitates the translocation observed in GAGGGATCCTGAGTCGCAGTAT-3Ј,5Ј-CTCTGCACACACGGCTCTT endemic BL. Aged animals develop B cell and plasma cell neo- C-3Ј and 5Ј-(6-FAM)TCTCCTGCCTGATAAACAACAACTTGGGATG-3Ј. plasms resulting from c-myc activation (15, 16). Deregulation of Flow cytometry analysis c-myc cannot be attributed to any precise cis-responsive elements because the transgene is integrated in the whole IgH locus chro- Single-cell suspensions from thymus, spleen, liver, and bone marrow were matin environment. In the second model, a truncated 3Ј IgH cas- labeled with various Abs (Southern Biotechnology Associates): anti-B220- conjugated with Spectral Red (PC5), anti-CD19, anti-CD117, anti-IgM, sette (lacking hs3a) was integrated upstream of the c-myc-coding and anti-IgD conjugated with PE. Control experiments included irrelevant region on mouse chromosome 15 and induced B cell lymphomas isotype-matched Abs conjugated with PC5 or PE. Cells were analyzed on in aged animals (17). This latter model demonstrated the important a Coulter XL apparatus (Beckman Coulter). role of the 3Ј IgH LCR on c-myc deregulation, although it is not excluded that the knockin might also have disrupted upstream Proliferation and cell cycle analysis and/or downstream c-myc regulatory elements (18, 19).
Load more

Recommended publications
  • Deregulated Gene Expression Pathways in Myelodysplastic Syndrome Hematopoietic Stem Cells
    Leukemia (2010) 24, 756–764 & 2010 Macmillan Publishers Limited All rights reserved 0887-6924/10 $32.00 www.nature.com/leu ORIGINAL ARTICLE Deregulated gene expression pathways in myelodysplastic syndrome hematopoietic stem cells A Pellagatti1, M Cazzola2, A Giagounidis3, J Perry1, L Malcovati2, MG Della Porta2,MJa¨dersten4, S Killick5, A Verma6, CJ Norbury7, E Hellstro¨m-Lindberg4, JS Wainscoat1 and J Boultwood1 1LRF Molecular Haematology Unit, NDCLS, John Radcliffe Hospital, Oxford, UK; 2Department of Hematology Oncology, University of Pavia Medical School, Fondazione IRCCS Policlinico San Matteo, Pavia, Italy; 3Medizinische Klinik II, St Johannes Hospital, Duisburg, Germany; 4Division of Hematology, Department of Medicine, Karolinska Institutet, Stockholm, Sweden; 5Department of Haematology, Royal Bournemouth Hospital, Bournemouth, UK; 6Albert Einstein College of Medicine, Bronx, NY, USA and 7Sir William Dunn School of Pathology, University of Oxford, Oxford, UK To gain insight into the molecular pathogenesis of the the World Health Organization.6,7 Patients with refractory myelodysplastic syndromes (MDS), we performed global gene anemia (RA) with or without ringed sideroblasts, according to expression profiling and pathway analysis on the hemato- poietic stem cells (HSC) of 183 MDS patients as compared with the the French–American–British classification, were subdivided HSC of 17 healthy controls. The most significantly deregulated based on the presence or absence of multilineage dysplasia. In pathways in MDS include interferon signaling, thrombopoietin addition, patients with RA with excess blasts (RAEB) were signaling and the Wnt pathways. Among the most signifi- subdivided into two categories, RAEB1 and RAEB2, based on the cantly deregulated gene pathways in early MDS are immuno- percentage of bone marrow blasts.
    [Show full text]
  • Mouse Rras2 Knockout Project (CRISPR/Cas9)
    https://www.alphaknockout.com Mouse Rras2 Knockout Project (CRISPR/Cas9) Objective: To create a Rras2 knockout Mouse model (C57BL/6J) by CRISPR/Cas-mediated genome engineering. Strategy summary: The Rras2 gene (NCBI Reference Sequence: NM_025846 ; Ensembl: ENSMUSG00000055723 ) is located on Mouse chromosome 7. 6 exons are identified, with the ATG start codon in exon 1 and the TAA stop codon in exon 6 (Transcript: ENSMUST00000069449). Exon 3~5 will be selected as target site. Cas9 and gRNA will be co-injected into fertilized eggs for KO Mouse production. The pups will be genotyped by PCR followed by sequencing analysis. Note: Homozygote and heterozygote null mice are lymphopenic, resulting from diminished homeostatic proliferation and impaired T cell and B cell survival. Mice homozygous for a gene trap insertion exhibit retinal degeneration, and increased total body mass and total body fat. Exon 3 starts from about 32.19% of the coding region. Exon 3~5 covers 54.08% of the coding region. The size of effective KO region: ~8729 bp. The KO region does not have any other known gene. Page 1 of 8 https://www.alphaknockout.com Overview of the Targeting Strategy Wildtype allele 5' gRNA region gRNA region 3' 1 3 4 5 6 Legends Exon of mouse Rras2 Knockout region Page 2 of 8 https://www.alphaknockout.com Overview of the Dot Plot (up) Window size: 15 bp Forward Reverse Complement Sequence 12 Note: The 1302 bp section upstream of Exon 3 is aligned with itself to determine if there are tandem repeats. Tandem repeats are found in the dot plot matrix.
    [Show full text]
  • The Capacity of Long-Term in Vitro Proliferation of Acute Myeloid
    The Capacity of Long-Term in Vitro Proliferation of Acute Myeloid Leukemia Cells Supported Only by Exogenous Cytokines Is Associated with a Patient Subset with Adverse Outcome Annette K. Brenner, Elise Aasebø, Maria Hernandez-Valladares, Frode Selheim, Frode Berven, Ida-Sofie Grønningsæter, Sushma Bartaula-Brevik and Øystein Bruserud Supplementary Material S2 of S31 Table S1. Detailed information about the 68 AML patients included in the study. # of blasts Viability Proliferation Cytokine Viable cells Change in ID Gender Age Etiology FAB Cytogenetics Mutations CD34 Colonies (109/L) (%) 48 h (cpm) secretion (106) 5 weeks phenotype 1 M 42 de novo 241 M2 normal Flt3 pos 31.0 3848 low 0.24 7 yes 2 M 82 MF 12.4 M2 t(9;22) wt pos 81.6 74,686 low 1.43 969 yes 3 F 49 CML/relapse 149 M2 complex n.d. pos 26.2 3472 low 0.08 n.d. no 4 M 33 de novo 62.0 M2 normal wt pos 67.5 6206 low 0.08 6.5 no 5 M 71 relapse 91.0 M4 normal NPM1 pos 63.5 21,331 low 0.17 n.d. yes 6 M 83 de novo 109 M1 n.d. wt pos 19.1 8764 low 1.65 693 no 7 F 77 MDS 26.4 M1 normal wt pos 89.4 53,799 high 3.43 2746 no 8 M 46 de novo 26.9 M1 normal NPM1 n.d. n.d. 3472 low 1.56 n.d. no 9 M 68 MF 50.8 M4 normal D835 pos 69.4 1640 low 0.08 n.d.
    [Show full text]
  • RRAS2 Rabbit Polyclonal Antibody – TA308124 | Origene
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for TA308124 RRAS2 Rabbit Polyclonal Antibody Product data: Product Type: Primary Antibodies Applications: IHC, WB Recommended Dilution: IHC:1:100-1:1000; WB:1:1000-1:10000 Reactivity: Human, Mouse (Predicted: Bovine, Rhesus Monkey, Rat) Host: Rabbit Isotype: IgG Clonality: Polyclonal Immunogen: Recombinant fragment corresponding to a region within amino acids 1 and 204 of TC21 (Uniprot ID#P62070) Formulation: 0.1M Tris, 0.1M Glycine, 10% Glycerol (pH7). 0.01% Thimerosal was added as a preservative. Concentration: lot specific Purification: Purified by antigen-affinity chromatography. Conjugation: Unconjugated Storage: Store at -20°C as received. Stability: Stable for 12 months from date of receipt. Predicted Protein Size: 23 kDa Gene Name: related RAS viral (r-ras) oncogene homolog 2 Database Link: NP_001096139 Entrez Gene 66922 MouseEntrez Gene 365355 RatEntrez Gene 22800 Human P62070 Synonyms: TC21 Note: Seq homology of immunogen across species: Rat (100%), Rhesus Monkey (100%), Bovine (100%) Protein Families: Druggable Genome Protein Pathways: MAPK signaling pathway, Regulation of actin cytoskeleton, Tight junction This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 3 RRAS2 Rabbit Polyclonal Antibody – TA308124 Product images: Sample (50 ug of whole cell lysate). A: mouse brain. 12% SDS PAGE. TA308124 diluted at 1:5000. Sample (30 ug of whole cell lysate).
    [Show full text]
  • LIAO-DISSERTATION-2019.Pdf (4.688Mb)
    A Genetic Interaction Analysis Identifies Novel Cancer Driver Modifiers and a Combination Therapy The Harvard community has made this article openly available. Please share how this access benefits you. Your story matters Citation Liao, Sida. 2019. A Genetic Interaction Analysis Identifies Novel Cancer Driver Modifiers and a Combination Therapy. Doctoral dissertation, Harvard University, Graduate School of Arts & Sciences. Citable link http://nrs.harvard.edu/urn-3:HUL.InstRepos:42029794 Terms of Use This article was downloaded from Harvard University’s DASH repository, and is made available under the terms and conditions applicable to Other Posted Material, as set forth at http:// nrs.harvard.edu/urn-3:HUL.InstRepos:dash.current.terms-of- use#LAA A genetic interaction analysis identifies novel cancer driver modifiers and a combination therapy A dissertation presented by Sida Liao To The Division of Medical Sciences In partial fulfillment of the requirements for the degree of Doctor of Philosophy in the subject of Biological and Biomedical Sciences Harvard University Cambridge, Massachusetts April 2019 © 2019 Sida Liao All rights reserved. Dissertation Advisor: Dr. Stephen J. Elledge Sida Liao A genetic interaction analysis identifies novel cancer driver modifiers and a combination therapy Abstract A large number of cancer drivers have been identified through tumor sequencing efforts but how they interact and the degree to which they can substitute for each other has not been systematically explored. To comprehensively investigate how cancer drivers genetically interact, I searched for modifiers of EGFR dependency by performing CRISPR, shRNA and expression screens in a non-small cell lung cancer model. I elucidated a broad spectrum of TSGs and OGs that can genetically modify proliferation and survival of cancer cells when EGFR signaling is altered.
    [Show full text]
  • Role and Regulation of the P53-Homolog P73 in the Transformation of Normal Human Fibroblasts
    Role and regulation of the p53-homolog p73 in the transformation of normal human fibroblasts Dissertation zur Erlangung des naturwissenschaftlichen Doktorgrades der Bayerischen Julius-Maximilians-Universität Würzburg vorgelegt von Lars Hofmann aus Aschaffenburg Würzburg 2007 Eingereicht am Mitglieder der Promotionskommission: Vorsitzender: Prof. Dr. Dr. Martin J. Müller Gutachter: Prof. Dr. Michael P. Schön Gutachter : Prof. Dr. Georg Krohne Tag des Promotionskolloquiums: Doktorurkunde ausgehändigt am Erklärung Hiermit erkläre ich, dass ich die vorliegende Arbeit selbständig angefertigt und keine anderen als die angegebenen Hilfsmittel und Quellen verwendet habe. Diese Arbeit wurde weder in gleicher noch in ähnlicher Form in einem anderen Prüfungsverfahren vorgelegt. Ich habe früher, außer den mit dem Zulassungsgesuch urkundlichen Graden, keine weiteren akademischen Grade erworben und zu erwerben gesucht. Würzburg, Lars Hofmann Content SUMMARY ................................................................................................................ IV ZUSAMMENFASSUNG ............................................................................................. V 1. INTRODUCTION ................................................................................................. 1 1.1. Molecular basics of cancer .......................................................................................... 1 1.2. Early research on tumorigenesis ................................................................................. 3 1.3. Developing
    [Show full text]
  • Transcriptomic and Epigenomic Characterization of the Developing Bat Wing
    ARTICLES OPEN Transcriptomic and epigenomic characterization of the developing bat wing Walter L Eckalbar1,2,9, Stephen A Schlebusch3,9, Mandy K Mason3, Zoe Gill3, Ash V Parker3, Betty M Booker1,2, Sierra Nishizaki1,2, Christiane Muswamba-Nday3, Elizabeth Terhune4,5, Kimberly A Nevonen4, Nadja Makki1,2, Tara Friedrich2,6, Julia E VanderMeer1,2, Katherine S Pollard2,6,7, Lucia Carbone4,8, Jeff D Wall2,7, Nicola Illing3 & Nadav Ahituv1,2 Bats are the only mammals capable of powered flight, but little is known about the genetic determinants that shape their wings. Here we generated a genome for Miniopterus natalensis and performed RNA-seq and ChIP-seq (H3K27ac and H3K27me3) analyses on its developing forelimb and hindlimb autopods at sequential embryonic stages to decipher the molecular events that underlie bat wing development. Over 7,000 genes and several long noncoding RNAs, including Tbx5-as1 and Hottip, were differentially expressed between forelimb and hindlimb, and across different stages. ChIP-seq analysis identified thousands of regions that are differentially modified in forelimb and hindlimb. Comparative genomics found 2,796 bat-accelerated regions within H3K27ac peaks, several of which cluster near limb-associated genes. Pathway analyses highlighted multiple ribosomal proteins and known limb patterning signaling pathways as differentially regulated and implicated increased forelimb mesenchymal condensation in differential growth. In combination, our work outlines multiple genetic components that likely contribute to bat wing formation, providing insights into this morphological innovation. The order Chiroptera, commonly known as bats, is the only group of To characterize the genetic differences that underlie divergence in mammals to have evolved the capability of flight.
    [Show full text]
  • The Human Gene Connectome As a Map of Short Cuts for Morbid Allele Discovery
    The human gene connectome as a map of short cuts for morbid allele discovery Yuval Itana,1, Shen-Ying Zhanga,b, Guillaume Vogta,b, Avinash Abhyankara, Melina Hermana, Patrick Nitschkec, Dror Friedd, Lluis Quintana-Murcie, Laurent Abela,b, and Jean-Laurent Casanovaa,b,f aSt. Giles Laboratory of Human Genetics of Infectious Diseases, Rockefeller Branch, The Rockefeller University, New York, NY 10065; bLaboratory of Human Genetics of Infectious Diseases, Necker Branch, Paris Descartes University, Institut National de la Santé et de la Recherche Médicale U980, Necker Medical School, 75015 Paris, France; cPlateforme Bioinformatique, Université Paris Descartes, 75116 Paris, France; dDepartment of Computer Science, Ben-Gurion University of the Negev, Beer-Sheva 84105, Israel; eUnit of Human Evolutionary Genetics, Centre National de la Recherche Scientifique, Unité de Recherche Associée 3012, Institut Pasteur, F-75015 Paris, France; and fPediatric Immunology-Hematology Unit, Necker Hospital for Sick Children, 75015 Paris, France Edited* by Bruce Beutler, University of Texas Southwestern Medical Center, Dallas, TX, and approved February 15, 2013 (received for review October 19, 2012) High-throughput genomic data reveal thousands of gene variants to detect a single mutated gene, with the other polymorphic genes per patient, and it is often difficult to determine which of these being of less interest. This goes some way to explaining why, variants underlies disease in a given individual. However, at the despite the abundance of NGS data, the discovery of disease- population level, there may be some degree of phenotypic homo- causing alleles from such data remains somewhat limited. geneity, with alterations of specific physiological pathways under- We developed the human gene connectome (HGC) to over- come this problem.
    [Show full text]
  • Download a Subgraph Composed of the Initially 32 Raso- of Proteins Underlying Rasopathies in Order to Iden- Pathy Proteins Selected in This Study
    Montero‑Bullón et al. Orphanet J Rare Dis (2021) 16:303 https://doi.org/10.1186/s13023‑021‑01934‑x RESEARCH Open Access Integrated in silico MS‑based phosphoproteomics and network enrichment analysis of RASopathy proteins Javier‑Fernando Montero‑Bullón1, Óscar González‑Velasco2, María Isidoro‑García3,4,5,6 and Jesus Lacal3,7* Abstract Background: RASopathies are a group of syndromes showing clinical overlap caused by mutations in genes afect‑ ing the RAS‑MAPK pathway. Consequent disruption on cellular signaling leads and is driven by phosphoproteome remodeling. However, we still lack a comprehensive picture of the diferent key players and altered downstream efectors. Methods: An in silico interactome of RASopathy proteins was generated using pathway enrichment analysis/STRING tool, including identifcation of main hub proteins. We also integrated phosphoproteomic and immunoblotting stud‑ ies using previous published information on RASopathy proteins and their neighbors in the context of RASopathy syndromes. Data from Phosphosite database (www. phosp hosite. org) was collected in order to obtain the potential phosphosites subjected to regulation in the 27 causative RASopathy proteins. We compiled a dataset of dysregulated phosphosites in RASopathies, searched for commonalities between syndromes in harmonized data, and analyzed the role of phosphorylation in the syndromes by the identifcation of key players between the causative RASopathy proteins and the associated interactome. Results: In this study, we provide a curated data set of 27 causative RASopathy genes, identify up to 511 protein– protein associations using pathway enrichment analysis/STRING tool, and identify 12 nodes as main hub proteins. We found that a large group of proteins contain tyrosine residues and their biological processes include but are not limited to the nervous system.
    [Show full text]
  • Integrative Analysis of Disease Signatures Shows Inflammation Disrupts Juvenile Experience-Dependent Cortical Plasticity
    New Research Development Integrative Analysis of Disease Signatures Shows Inflammation Disrupts Juvenile Experience- Dependent Cortical Plasticity Milo R. Smith1,2,3,4,5,6,7,8, Poromendro Burman1,3,4,5,8, Masato Sadahiro1,3,4,5,6,8, Brian A. Kidd,2,7 Joel T. Dudley,2,7 and Hirofumi Morishita1,3,4,5,8 DOI:http://dx.doi.org/10.1523/ENEURO.0240-16.2016 1Department of Neuroscience, Icahn School of Medicine at Mount Sinai, New York, New York 10029, 2Department of Genetics and Genomic Sciences, Icahn School of Medicine at Mount Sinai, New York, New York 10029, 3Department of Psychiatry, Icahn School of Medicine at Mount Sinai, New York, New York 10029, 4Department of Ophthalmology, Icahn School of Medicine at Mount Sinai, New York, New York 10029, 5Mindich Child Health and Development Institute, Icahn School of Medicine at Mount Sinai, New York, New York 10029, 6Graduate School of Biomedical Sciences, Icahn School of Medicine at Mount Sinai, New York, New York 10029, 7Icahn Institute for Genomics and Multiscale Biology, Icahn School of Medicine at Mount Sinai, New York, New York 10029, and 8Friedman Brain Institute, Icahn School of Medicine at Mount Sinai, New York, New York 10029 Visual Abstract Throughout childhood and adolescence, periods of heightened neuroplasticity are critical for the development of healthy brain function and behavior. Given the high prevalence of neurodevelopmental disorders, such as autism, identifying disruptors of developmental plasticity represents an essential step for developing strategies for prevention and intervention. Applying a novel computational approach that systematically assessed connections between 436 transcriptional signatures of disease and multiple signatures of neuroplasticity, we identified inflammation as a common pathological process central to a diverse set of diseases predicted to dysregulate Significance Statement During childhood and adolescence, heightened neuroplasticity allows the brain to reorganize and adapt to its environment.
    [Show full text]
  • Primepcr™Assay Validation Report
    PrimePCR™Assay Validation Report Gene Information Gene Name ras-related protein R-Ras2 Gene Symbol Rras2 Organism Rat Gene Summary Description Not Available Gene Aliases Not Available RefSeq Accession No. Not Available UniGene ID Rn.3271 Ensembl Gene ID ENSRNOG00000012258 Entrez Gene ID 365355 Assay Information Unique Assay ID qRnoCID0006243 Assay Type SYBR® Green Detected Coding Transcript(s) ENSRNOT00000017199 Amplicon Context Sequence TTCTTGTCTTTTTCTTTCCGGGTTGGTTCTGGTGAAGGAGGACATTCTTGTTCTTG AAACTTCCTGATAACTCGGACAAGTTCGTGGAAAGCTTGATCTACATTCATCCTG ATCTTTGCCGACGCCTCCATATACGTGACCTTGAGC Amplicon Length (bp) 117 Chromosome Location 1:185909667-185912813 Assay Design Intron-spanning Purification Desalted Validation Results Efficiency (%) 94 R2 0.9968 cDNA Cq 19.45 cDNA Tm (Celsius) 82 gDNA Cq 27.52 Specificity (%) 100 Information to assist with data interpretation is provided at the end of this report. Page 1/4 PrimePCR™Assay Validation Report Rras2, Rat Amplification Plot Amplification of cDNA generated from 25 ng of universal reference RNA Melt Peak Melt curve analysis of above amplification Standard Curve Standard curve generated using 20 million copies of template diluted 10-fold to 20 copies Page 2/4 PrimePCR™Assay Validation Report Products used to generate validation data Real-Time PCR Instrument CFX384 Real-Time PCR Detection System Reverse Transcription Reagent iScript™ Advanced cDNA Synthesis Kit for RT-qPCR Real-Time PCR Supermix SsoAdvanced™ SYBR® Green Supermix Experimental Sample qPCR Reference Total RNA Data Interpretation Unique Assay ID This is a unique identifier that can be used to identify the assay in the literature and online. Detected Coding Transcript(s) This is a list of the Ensembl transcript ID(s) that this assay will detect. Details for each transcript can be found on the Ensembl website at www.ensembl.org.
    [Show full text]
  • Presenters' Abstracts
    7th International RASopathies Symposium: Pathways to Understanding – Expanding Knowledge, Enhancing Research and Therapeutic Discovery July 23-25, 2021 VIRTUAL MEETING Chairs Maria Kontaridis, PhD, Masonic Medical Research Institute Amy Roberts, MD, Boston Children’s Hospital Honorary Chairs: Marco Tartaglia, PhD, Bambino Gesù Children’s Hospital, and Martin Zenker, MD, Universitätsklinikum Magdeburg SESSION 1: Genes, Pathways and Genocopies Moderator: Katherine A. Rauen MD PhD, UC Davis, CA CDC42, RASA2, FBXW11, ZNF426, YWHAZ, TRAF7: Novel Martin Zenker MD, Institute of Human Genetics, RASopathy genes or not? University Hospital Magdeburg, Germany In this contribution, recently reported new associations of genes / gene variants with RASopathies or RASopathy-like phenotypes are reviewed. Contrary to the title in the agenda, ZNF426 was skipped, for which no explicit assertion has been made to be a RASopathy- associated gene, but instead RALA was included, which has been reported in 2019 as causing a RASopathy-like disorder. Assessment of the genes’ associations to RASopathies considered the number of observations, the quality of phenotypic overlap, the evidence of causality for the variant, the link to the RAS-MAPK pathway, and the experimental evidence for its dysregulation by the mutant proteins. For all six genes, the number of cases reported to have a RASopathy / RASopathy-like disorder is currently too small to establish robust case-level evidence for them to be novel RASopathy genes. For FBXW11and TRAF7, the RASopathy-like phenotype has only been observed in some of the mutation carriers; for CDC42, one specific mutation has been proposed to be associated with a Noonan-like phenotype, while others are not.
    [Show full text]