Grouper TRAF4, a Novel, CP-Interacting Protein That Promotes Red-Spotted Grouper Nervous Necrosis Virus Replication

International Journal of Molecular Sciences

Article Grouper TRAF4, a Novel, CP-Interacting Protein That Promotes Red-Spotted Grouper Nervous Necrosis Virus Replication

Siting Wu 1, Mengshi Sun 1, Xin Zhang 1, Jiaming Liao 1, Mengke Liu 1, Qiwei Qin 1,2,* and Jingguang Wei 1,*

1 Guangdong Laboratory for Lingnan Modern Agriculture, Joint Laboratory of Guangdong Province and Hong Kong Region on Marine Bioresource Conservation and Exploitation, College of Marine Sciences, South China Agricultural University, Guangzhou 510642, China; [email protected] (S.W.); [email protected] (M.S.); [email protected] (X.Z.); [email protected] (J.L.); [email protected] (M.L.) 2 Laboratory for Marine Biology and Biotechnology, Qingdao National Laboratory for Marine Science and Technology, Qingdao 266000, China * Correspondence: [email protected] (Q.Q.); [email protected] (J.W.)

Abstract: Tumor necrosis factor receptor-associated factors (TRAFs) play important roles in the biological processes of immune regulation, the inflammatory response, and apoptosis. TRAF4 belongs to the TRAF family and plays a major role in many biological processes. Compared with other TRAF proteins, the functions of TRAF4 in teleosts have been largely unknown. In the present study, the TRAF4 homologue (EcTRAF4) of the orange-spotted grouper was characterized. EcTRAF4 consisted of 1413 bp encoding a 471-amino-acid protein, and the predicted molecular mass was 54.27 kDa. EcTRAF4 shares 99.79% of its identity with TRAF4 of the giant grouper (E. lanceolatus). EcTRAF4 transcripts were ubiquitously and differentially expressed in all the examined tissues. EcTRAF4 Citation: Wu, S.; Sun, M.; Zhang, X.; expression in GS cells was significantly upregulated after stimulation with red-spotted grouper Liao, J.; Liu, M.; Qin, Q.; Wei, J. nervous necrosis virus (RGNNV). EcTRAF4 protein was distributed in the cytoplasm of GS cells. Grouper TRAF4, a Novel, Overexpressed EcTRAF4 promoted RGNNV replication during viral infection in vitro. Yeast two- CP-Interacting Protein That Promotes hybrid and coimmunoprecipitation assays showed that EcTRAF4 interacted with the coat protein Red-Spotted Grouper Nervous (CP) of RGNNV. EcTRAF4 inhibited the activation of IFN3, IFN-stimulated response element (ISRE), Necrosis Virus Replication. Int. J. Mol. Sci. 2021, 22, 6136. https://doi.org/ and nuclear factor-κB (NF-κB). Overexpressed EcTRAF4 also reduced the expression of interferon 10.3390/ijms22116136 (IFN)-related molecules and pro-inflammatory factors. Together, these results demonstrate that EcTRAF4 plays crucial roles in RGNNV infection. Academic Editors: Daniela Bosisio and Valentina Salvi Keywords: Epinephelus coioides; TRAF4; RGNNV; cellular localization; viral replication

Received: 25 April 2021 Accepted: 3 June 2021 Published: 7 June 2021 1. Introduction Grouper, Epinephelus spp., is one of the most important marine aquaculture fish species Publisher’s Note: MDPI stays neutral in China [1]. The orange-spotted grouper, Epinephelus coioides, is a popular marine fish with regard to jurisdictional claims in cultured in Southeast Asia and China. However, for many years, outbreaks of infectious published maps and institutional affil- bacterial and viral diseases have seriously affected the grouper aquaculture industry, caus- iations. ing large economic losses [2,3]. Larval and juvenile grouper are susceptible to fatal epidemic outbreaks of diseases caused by infections with Betanodavirus or nervous necrosis viruses (NNVs) and iridoviruses [2–4]. NNVs are some of the most destructive viruses of cultured marine fishes throughout the world [5–7]. Their genomes contain two single-stranded Copyright: © 2021 by the authors. RNAs and RNA2, and RNA1 encodes the RNA-dependent RNA polymerase (RdRp) while Licensee MDPI, Basel, Switzerland. RNA2 encodes the coat protein (CP), respectively [8]. RNA1 is longer than RNA2. NNVs This article is an open access article have been classified into four primary genotypes: striped jacked NNV, red-spotted grouper distributed under the terms and NNV (RGNNV), barfin flounder NNV, and tiger puffer NNV [5]. An effective method for conditions of the Creative Commons preventing grouper virus disease is urgently required, and improving the immunity of the Attribution (CC BY) license (https:// grouper is the most promising approach to the prevention and treatment of viral infections. creativecommons.org/licenses/by/ 4.0/).

Int. J. Mol. Sci. 2021, 22, 6136. https://doi.org/10.3390/ijms22116136 https://www.mdpi.com/journal/ijms Int. J. Mol. Sci. 2021, 22, x FOR PEER REVIEW 2 of 15

Int. J. Mol. Sci. 2021, 22, 6136 effective method for preventing grouper virus disease is urgently required, and improv-2 of 14 ing the immunity of the grouper is the most promising approach to the prevention and treatment of viral infections. Tumor necrosis factor receptor (TNFR)-associated factors (TRAFs) are considered the Tumor necrosis factor receptor (TNFR)-associated factors (TRAFs) are considered the central signal transducers of some signaling pathways and play important roles in some central signal transducers of some signaling pathways and play important roles in some bi- biological processes such as immune regulation, inflammatory response, and apoptosis ological processes such as immune regulation, inflammatory response, and apoptosis [9,10]. [9,10]. Seven members of the TRAF family have been identified, designated TRAF1–7 [11]. Seven members of the TRAF family have been identified, designated TRAF1–7 [11]. Most MostTRAFs TRAFs (except (except TRAF7) TRAF7) contain contain a TRAF a domainTRAF domain in the C-terminalin the C-terminal region andregion a C-terminal and a C- terminalβ-sandwich β-sandwich domain (TRAF-C domain (TRAF-C or MATH or domain) MATH [12 do,13main)]. TRAFs [12,13]. also TRAFs contain also an N-terminalcontain an N-terminalRING finger RING domain finger followed domain by followed multiple by zinc mu fingerltiple zinc motifs finger [12, 14motifs]. They [12,14]. determine They de- the termineE3 ligase the activity E3 ligase of the activity TRAFs of and the areTRAFs crucial and for are the crucial activation for the of activation downstream of down- signal- streaming cascades signaling [15]. cascades TRAF4 [15]. was firstTRAF4 cloned was fromfirst cloned breast from cancer-derived breast cancer-derived metastatic lymph meta- staticnodes lymph [16,17 nodes]. TRAF4 [16,17]. contains TRAF4 a contains nuclear localizationa nuclear localization signal (NLS), signal which (NLS), is which a unique is a uniquemember member of the TRAF of the family TRAF [ 17family,18]. TRAF4[17,18]. has TRAF4 a RING has domain a RING and domain an E3 and ubiquitin an E3 ligaseubiq- uitindomain, ligase so domain, it can mediate so it can activation mediate activation of the target of the proteins target ofproteins TAK1 of and TAK1 AKT1 and and AKT1 the andK63-linked the K63-linked ubiquitination ubiquitination [19,20]. [19,20]. TRAF4 TRAF4 interacts interacts with thewith deubiquitinase the deubiquitinase USP10 USP10 and andblocks blocks the accessthe access of tumor of tumor protein protein P53 P53 (TP53) (TP53) to USP10, to USP10, destabilizing destabilizing TP53 TP53 [16 ].[16]. Unlike Un- likeother other proteins proteins of the of TRAFthe TRAF family, family, TRAF4-deficient TRAF4-deficient mice mice display display impaired impaired neural neural tube tubeclosures closures and and tracheal tracheal ring ring disruptions disruptions [21 [2].1]. TRAF4 TRAF4 can can also also interact interact weaklyweakly withwith the humanhuman p75 p75 neurotrophin neurotrophin receptor receptor (p75-NGFR), (p75-NGFR), a a member member of of the TNF-R present in the nervousnervous system, system, and and with with a lymphotoxin-beta a lymphotoxin-beta receptor receptor (LTp-R) (LTp-R) [22]. [22 TRAF4]. TRAF4 increases increases NF- κNF-B activationκB activation through through glucocorticoid-induced glucocorticoid-induced TNF-R TNF-R (GITR). (GITR). This Thiseffect effect is mediated is mediated by a TRAF-bindingby a TRAF-binding site located site located in the in cytoplasmic the cytoplasmic domain domain of GITR of GITRand is and inhibited is inhibited by cyto- by plasmiccytoplasmic protein protein A20 A20[23]. [23]. ComparedCompared with with other other teleost teleost TRAF TRAF proteins, proteins, little little is isknown known of teleost of teleost TRAF4. TRAF4. To ex- To amineexamine the the roles roles of TRAF4 of TRAF4 in the in theinnate innate immunity immunity of teleosts, of teleosts, the theTRAF4 TRAF4 homologue homologue of the of orange-spottedthe orange-spotted grouper grouper (EcTRAF4)(EcTRAF4) was wascharacterized characterized in the in present the present study. study. Next, Next, the theex- pressionexpression profiles profiles of ofEcTRAF4 EcTRAF4 were were analyzed analyzed in in the the tissues tissues of of healthy healthy fish fish and and in in GS cells afterafter viral infection. Finally,Finally, thethe effects effects of of overexpressed overexpressed EcTRAF4 EcTRAF4 on on RGNNV RGNNV proliferation prolifera- tionwere were investigated. investigated.

2.2. Results Results 2.1. Identification and Sequence Analysis of EcTRAF4 2.1. Identification and Sequence Analysis of EcTRAF4 EcTRAF4 consisted of 1413 nucleotides encoding a 471-amino-acid protein, with a EcTRAF4 consisted of 1413 nucleotides encoding a 471-amino-acid protein, with a predicted molecular mass of 54.27 kDa. No signal peptide or transmembrane helices predicted molecular mass of 54.27 kDa. No signal peptide or transmembrane helices were were detected in the deduced amino acid sequence of EcTRAF4. Like its mammalian detected in the deduced amino acid sequence of EcTRAF4. Like its mammalian counter- counterparts, EcTRAF4 contained an N-terminal RING finger domain, three zinc finger parts, EcTRAF4 contained an N-terminal RING finger domain, three zinc finger domains, domains, and a MATH domain (Figure1). and a MATH domain (Figure 1).

Figure 1. PutativePutative conserved conserved domains domains of EcTRAF EcTRAF4.4. One One RING RING domain, domain, three three zinc zinc fing ﬁngerer domains, domains, and and one one MATH MATH domain were predicted by SMART (http://smart.embl-heidelberg.de/, accessed on 1 May 2021). were predicted by SMART (http://smart.embl-heidelberg.de/, accessed on 1 May 2021).

EcTRAF4EcTRAF4 shared shared 99.79% 99.79% identity identity with with TRAF4 TRAF4 of of the giant grouper E. lanceolatus ..A A multiplemultiple sequence sequence alignment alignment was was constructed constructed with with ClustalX1.83 ClustalX1.83 software. software. On On a a neighbor- neighbor- joiningjoining tree tree of of TRAF4 proteins, EcTRAF4 clusteredclustered with the giantgiant groupergrouper TRAF4.TRAF4. The grouping of TRAF4 proteins was supported well by bootstrapping and was in accordance with the assumed evolutionary trends of the species represented (Figure2).

Int. J. Mol. Sci. 2021, 22, x FOR PEER REVIEW 3 of 15

Int. J. Mol. Sci. 2021, 22, 6136 grouping of TRAF4 proteins was supported well by bootstrapping and was in accordance3 of 14 withgrouping the assumed of TRAF4 evolutionary proteins was trends supported of the well species by bootstrapping represented and (Figure was in 2). accordance with the assumed evolutionary trends of the species represented (Figure 2). 88 XP_010747668.1Larimichthys_crocea XP_010747668.1Larimichthys_crocea 6688 XP_030259023.1Sparus_aurata 66 XP_030259023.1Sparus_aurata 47 XP_038548603.1Micropterus_salmoides 47 XP_038548603.1Micropterus_salmoides XP_033488065.1Epinephelus_lanceolatus 54 XP_033488065.1Epinephelus_lanceolatus 54 84 Epinephelus_coloides 1584 Epinephelus_coloides Fish 15 XP_035478637.1Scophthalmus_maximus Fish XP_035478637.1Scophthalmus_maximus 39 39 XP_026227985.1Anabas_testudineusXP_026227985.1Anabas_testudineus 100 XP_034556634.1Notolabrus_celidotusXP_034556634.1Notolabrus_celidotus 72 72 XP_020784243.1Boleophthalmus_pectinirostrisXP_020784243.1Boleophthalmus_pectinirostris XP_033778390.1Geotrypetes_seraphiniXP_033778390.1Geotrypetes_seraphini 100100 XP_030041614.1Microcaecilia_unicolorXP_030041614.1Microcaecilia_unicolor AmpAmhibianphibian XP_032056864.1Aythya_fuligula XP_032056864.1Aythya_fuligula 100100 XP_035198719.1Oxyura_jamaicensis XP_035198719.1Oxyura_jamaicensis BirdBir d NP_033449.2Mus_musculusNP_033449.2Mus_musculus 100 NP_004286.2Homo_sapiens 100 NP_004286.2Homo_sapiens 83 XP_002718965.1Oryctolagus_cuniculus Mammal 83 XP_002718965.1Oryctolagus_cuniculus Mammal

0.02 0.02 FigureFigure 2. 2.Phylogenetic Phylogenetic analysis analysis of of the the EcTRAF4 EcTRAF4 proteins. proteins. The The GenBank GenBank accession accession number number for eachfor each species Scheme is listed 4. 0. to The the rela- left Figureoftionships the 2. species Phylogenetic among name. the The variousanalysis phylogenetic components of the treeEcTRAF4was were constructed analyzedproteins. by usingThe th eGenB MEGAneighbor-joiningank software accession 4.0. (NJ) number The meth relationshipsod. for Numbers each amongScheme on the the 4. branches various 0. The rela- tionshipscomponentsindicate among percent were the bootstrap analyzed various confid components by theence neighbor-joining values were from analyzed 1000 (NJ) replicates. method.by the neighbor-joining Numbers on the (NJ) branches meth indicateod. Numbers percent on bootstrap the branches indicate percent bootstrap confidence values from 1000 replicates. conﬁdence values from 1000 replicates. 2.2. Tissue Expression Analysis of EcTRAF4 2.2.2.2. Tissue TissueTo investigate Expression the AnalysisAnalysis tissue of expressionof EcTRAF4 EcTRAF4 profile of EcTRAF4 under normal physiological conditions,ToTo investigate the total thethe RNAs tissue tissue were expression expression extracted proﬁle profilefrom of 10 EcTRAF4of different EcTRAF4under tissues under normal (kidney, normal physiological heart, physiological liver, conditions,conditions,spleen, intestine, the the total stomach, RNAsRNAs brain, werewere gill, extracted extracted head kidney, from from 10 and10 different different skin) and tissues tissuesanalyzed (kidney, (kidney, with heart, RT–qPCR. heart, liver, liver, spleen,spleen,Figure intestine, 3 intestine, shows that stomach, stomach, EcTRAF4 brain, brain, was gill, expressed gill, head head kidney, in kidney, all the and andtissues skin) skin) examined, and and analyzed analyzed but was with with predom- RT–qPCR. RT– FigureqPCR.inantly 3 Figure expressedshows3 showsthat in EcTRAF4 the that spleen,EcTRAF4 was gill, expressed skin,was expressedand stomachin all the in all(Figure tissues the tissues 3). examined, examined, but was but waspredom- inantlypredominantly expressed expressed in the spleen, in the spleen, gill, skin, gill, and skin, stomach and stomach (Figure (Figure 3). 3).

Figure 3. Tissue distribution of EcTRAF4 in healthy grouper. β-actin was used as the internal control. The expression of EcTRAF4 in the head kidney was set to 1.0. Data are expressed as the mean fold change (means ± S.E., n = 3) from the head kidney. FigureFigure 3. 3. TissueTissue distributiondistribution of of EcTRAF4 EcTRAF4 in healthyin healthy grouper. grouper.β-actin β-actin was usedwas asused the as internal the internal control. control.The The expression expression of EcTRAF4 of EcTRAF4 in the in head the kidneyhead kidney was set was to 1.0. setData to 1.0. are Data expressed are expressed as the mean as the fold mean foldchange change (means (means± S.E., ± S.E.,n = 3) n from= 3) from the head the kidney.head kidney.

Int. J. Mol. Sci. 2021, 22, x FOR PEER REVIEW 4 of 15 Int. J. Mol. Sci. 2021, 22, 6136 4 of 14

2.3. Intracellular Localization of EcTRAF4 2.3. Intracellular Localization of EcTRAF4 The intracellular localization of EcTRAF4 was determined by analyzing the expres- The intracellular localization of EcTRAF4 was determined by analyzing the expression of the enhanced green fluorescent protein (EGFP)–EcTRAF4 fusion protein. First, sion of the enhanced green fluorescent protein (EGFP)–EcTRAF4 fusion protein. First, pEGFP–EcTRAF4pEGFP–EcTRAF4 was was constructed constructed and and used used to transfect to transfect GS cells. GS The cells. resulting The fluorescentresulting fluores- centsignal signal was observed was observed with a fluorescencewith a fluorescen microscope.ce microscope. Fluorescence Fluorescence was equally distributed was equally dis- tributedthroughout throughout the cytoplasm the cytoplasm and nuclei and in the nuclei pEGFP–C1-transfected in the pEGFP–C1-transfected cells, whereas cells, in the whereas inpEGFP–EcTRAF4-transfected the pEGFP–EcTRAF4-transfected cells, green cells, fluorescence green fluorescence was mainly was observed mainly in observed the cyto- in the cytoplasmplasm (Figure (Figure4). 4).

FigureFigure 4. 4. SubcellularSubcellular localizations ofof EcTRAF4EcTRAF4 in in GS GS cells. cells. GS GS cells cells were were transfected transfected with with the the plas- midsplasmids of pEGFP–C1 of pEGFP–C1 and and pEGFP–EcTRAF4 pEGFP–EcTRAF4 separately separately and and then then stained stained with DAPI.with DAPI. Samples Samples were were observedobserved under fluorescencefluorescence microscopy. microscopy. 2.4. EcTRAF4 Overexpression Promotes RGNNV Replication 2.4. EcTRAF4 Overexpression Promotes RGNNV Replication To confirm the effect of EcTRAF4 on RGNNV replication, EcTRAF4-transfected cells wereTo infected confirm with the RGNNV, effect of and EcTRAF4 viral replication on RGNNV was replication, investigated. EcTRAF4 The cells-transfected were har- cells werevested infected after 12 orwith 24 h,RGNNV, and the transcription and viral replication kinetics of thewas indicated investigated. RGNNV The genes cells were were har- vestedmeasured after with 12 RT–qPCR.or 24 h, and EcTRAF4 the transcriptio overexpressionn kinetics significantly of the indicated increased RGNNV the transcrip- genes were measuredtion of RGNNV with genesRT–qPCR. (CP and EcTRAF4 RdRp) (Figure overexpressi5A). We alsoon significantly evaluated the effectincreased of EcTRAF4 the transcrip- tionoverexpression of RGNNV on genes viral protein (CP and synthesis. RdRp) Consistent(Figure 5A). with We the also RT–qPCR evaluated results, the the effect level of Ec- TRAF4of RGNNV overexpression CP protein was on higher viral inprotein the EcTRAF4-overexpressing synthesis. Consistent cells with than the in RT–qPCR the control results, cells (Figure5B). the level of RGNNV CP protein was higher in the EcTRAF4-overexpressing cells than in the2.5. control EcTRAF4 cells Knockdown (Figure Inhibits5B). RGNNV Replication To determine the relationship between EcTRAF4 and RGNNV replication, we determined RGNNV replication in EcTRAF4-knockdown GS cells. Three siRNAs directed against EcTRAF4 mRNA were designed, and their knockdown efficiencies were determined. As shown in Figure6A, siRNA1 had the highest knockdown efficiency (70%) in GS cells, and siRNAs had no efficiency to EcTRAF6. Therefore, we used siRNA1 to study the effects of silencing EcTRAF4 on RGNNV replication. An RT–qPCR analysis showed that the transcription levels of the RGNNV CP and RdRp genes decreased after EcTRAF4 knockdown (Figure6B). We also evaluated the effects of EcTRAF4 knockdown on viral protein synthesis. Consistent with the RT–qPCR results, the RGNNV CP protein levels were lower in the EcTRAF4-knockdown cells than in the control cells (Figure6C).

(A) (B) Figure 5. Effect of EcTRAF4 overexpression on RGNNV replication. (A) EcTRAF4 overexpression increased RGNNV gene transcription. Expression levels of CP and RdRp were measured using qRT-PCR (means ± S.E., n = 3). Statistical difference

Int. J. Mol. Sci. 2021, 22, x FOR PEER REVIEW 4 of 15

2.3. Intracellular Localization of EcTRAF4 The intracellular localization of EcTRAF4 was determined by analyzing the expression of the enhanced green fluorescent protein (EGFP)–EcTRAF4 fusion protein. First, pEGFP–EcTRAF4 was constructed and used to transfect GS cells. The resulting fluorescent signal was observed with a fluorescence microscope. Fluorescence was equally distributed throughout the cytoplasm and nuclei in the pEGFP–C1-transfected cells, whereas in the pEGFP–EcTRAF4-transfected cells, green fluorescence was mainly observed in the cytoplasm (Figure 4).

Figure 4. Subcellular localizations of EcTRAF4 in GS cells. GS cells were transfected with the plasmids of pEGFP–C1 and pEGFP–EcTRAF4 separately and then stained with DAPI. Samples were observed under fluorescence microscopy.

2.4. EcTRAF4 Overexpression Promotes RGNNV Replication To confirm the effect of EcTRAF4 on RGNNV replication, EcTRAF4-transfected cells were infected with RGNNV, and viral replication was investigated. The cells were harvested after 12 or 24 h, and the transcription kinetics of the indicated RGNNV genes were measured with RT–qPCR. EcTRAF4 overexpression significantly increased the transcription of RGNNV genes (CP and RdRp) (Figure 5A). We also evaluated the effect of Ec- Int. J. Mol. Sci. 2021, 22, 6136 TRAF4 overexpression on viral protein synthesis. Consistent with the RT–qPCR results, 5 of 14 the level of RGNNV CP protein was higher in the EcTRAF4-overexpressing cells than in the control cells (Figure 5B).

Int. J. Mol. Sci. 2021, 22, x FOR PEER REVIEW 5 of 15

is with each pcDNA3.1-3HA-transfected cell. Asterisk denotes a significant difference (* p < 0.05 and ** p < 0.01). (B) Virus protein level after transfection with EcTRAF4. The level of RGNNV-CP was detected by western blot, and β-Tubulin was used as the internal control.

2.5. EcTRAF4 Knockdown Inhibits RGNNV Replication To determine the relationship between EcTRAF4 and RGNNV replication, we determined RGNNV replication in EcTRAF4-knockdown GS cells. Three siRNAs directed against EcTRAF4 mRNA were designed, and their knockdown efficiencies were determined. (AsA) shown in Figure 6A, siRNA1 had the highest knockdown(B efficiency) (70%) in GS cells, and siRNAs had no efficiency to EcTRAF6. Therefore, we used siRNA1 to study FigureFigure 5. Effect 5. Effect of EcTRAF4 of EcTRAF4 overexpression overexpression on on RGNNV RGNNV replication.replication. ( (AA) )EcTRAF4 EcTRAF4 overexpression overexpression increased increased RGNNV RGNNV gene gene transcription. Expression levelsthe ofeffects CP and of RdRp silencing were EcTRAF4measured usingon RGNNV qRT-PCR replication. (means ± S.E., An n RT–qPCR = 3). Statistical analysis difference showed transcription. Expression levels ofthat CP the and transcription RdRp were levels measured of the using RGNNV qRT-PCR CP and (means RdRp± genesS.E., decreasedn = 3). Statistical after EcTRAF4 difference is with each pcDNA3.1-3HA-transfectedknockdown cell. (Figure Asterisk 6B). denotes We also a signiﬁcantevaluated differencethe effects (*ofp EcTRAF4< 0.05 and knockdown ** p < 0.01). on (B viral) Virus protein level after transfection withprotein EcTRAF4. synthesis. The Consistent level of RGNNV-CP with the RT–qPCR was detected results, by westernthe RGNNV blot, CP and proteinβ-Tubulin levels was used as the internal control. were lower in the EcTRAF4-knockdown cells than in the control cells (Figure 6C).

(A)

(B) (C) Figure 6. Effect of EcTRAF4 knockdown on RGNNV replication. (A) Three siRNA sequences were designed based on the Figure 6. Effect of EcTRAF4 knockdown on RGNNV replication. (A) Three siRNA sequences were designed based on the sequence of EcTRAF4, the expression of EcTRAF4 was tested, and EcTRAF6 was used as the control (means ± S.E., n = 3). sequenceScheme of EcTRAF4, 4. Decreased the expressionRGNNV gene of transcription, EcTRAF4 was including tested, CP and and EcTRAF6 RdRp (means was used ± S.E., as nthe = 3). control Statistical (means difference± S.E., is n = 3). (B) Decreasedwith each RGNNV NC at a genedifferent transcription, time. Asterisk including denotes a CP signif andicant RdRp difference (means (* p± < S.E.,0.05 andn = ** 3). p < Statistical 0.01) (C) Virus difference protein is level with each NC at aafter different transfection time. with Asterisk siRNA1 denotes of EcTRAF4. a signiﬁcant The level difference of RGNNV-CP (* p

Int. J. Mol. Sci. 2021, 22, x FOR PEER REVIEW 6 of 15

2.6. RGNNV CP Interacts with EcTRAF4

Int. J. Mol. Sci. 2021, 22, 6136 To further investigate the function of EcTRAF4, we examined the relationship6 of 14 between CP and EcTRAF4. First, a prey vector containing full-length traf5 was constructed, and the EcTRAF4–CP interaction was verified with a yeast two-hybrid system. Yeast strain Y2H Gold was co-transformed with prey plasmid AD–EcTRAF4 and bait plasmid 2.6.BD–CP RGNNV or CP BD. Interacts The cells with EcTRAF4co-transformed with AD–EcTRAF4/BD-CP and BD-p53/AD-T grewTo further on QDO/X/A investigate plates, the functionindicating of an EcTRAF4, interaction we between examined EcTRAF4 the relationship and CP between(Figure 7A). CP and EcTRAF4.To confirm First, the EcTRAF4–CP a prey vector interaction, containing coimmunoprecipitation full-length traf5 was constructed, (co-IP) experiments and the EcTRAF4–CPwere performed interaction by co-expressing was veriﬁed EcTRAF4–GFP with a yeast and two-hybrid CP–HA. system. After incubation Yeast strain with Y2HAnti-GFP Gold was M2 co-transformed Affinity Gel, withEcTRAF4–GFP prey plasmid successfully AD–EcTRAF4 precipitated and bait CP–HA plasmid (Figure BD–CP 7B). or BD.These The results, cells co-transformed together with the with yeast AD–EcTRAF4/BD-CP two-hybrid and co-IP and results, BD-p53/AD-T demonstrated grew onthe in- QDO/X/Ateraction plates, between indicating EcTRAF4 an and interaction CP. between EcTRAF4 and CP (Figure7A).

(A) (B)

FigureFigure 7. Interaction 7. Interaction of CP of with CP EcTRAF4.with EcTRAF4. (A) For (A yeast) For two-hybrid yeast two-hybrid analysis, analysis, pGBKT7-CP pGBKT7-CP and pGADT7-EcTRAF4 and pGADT7-EcTRAF4 plasmids plas- weremids constructed were constructed for interaction for verification.interaction veri Thefication. two plasmids The two were plasmids co-transformed were co-transformed into S. cerevisiae into strain S. cerevisiae Y2H Gold. strain The Y2H transformantsGold. The weretransformants tested on awere non-selective tested on a medium non-selective plate SD/-leu/-trp medium plate (DDO/X) SD/-leu/-trp to check (DDO/X) whether to check the transformation whether the transformation was successful and the selective medium plate SD/-leu/-trp/-his/-ade/X-α-gal/AbA (QXA) to detect whether was successful and the selective medium plate SD/-leu/-trp/-his/-ade/X-α-gal/AbA (QXA) to detect whether there was there was interaction between two proteins. (B) Co-immunoprecipitation resulted in GS cells showing that EcTRAF4 might interaction between two proteins. (B) Co-immunoprecipitation resulted in GS cells showing that EcTRAF4 might interact interact with CP. with CP. 2.7.To confirmRGNNV theor CP EcTRAF4–CP Promotes EcTRAF4 interaction, Expression. coimmunoprecipitation (co-IP) experiments were performedAfter we by confirmed co-expressing the positive EcTRAF4–GFP effect of andEcTRAF4 CP–HA. on AfterRGNNV incubation replication, with we Anti- inves- GFPtigated M2 Affinity the effect Gel, EcTRAF4–GFPof RGNNV infection successfully on EcTRAF4 precipitated expression. CP–HA In (Figure response7B). to These RGNNV results,infection, together the with transcription the yeast two-hybridof EcTRAF4 andin GS co-IP cells results, was higher demonstrated than that thein uninfected interaction cells between(Figure EcTRAF4 8A). Because and CP. EcTRAF4 interacted with RGNNV CP, the effect of CP on EcTRAF4 expression was investigated. As shown in Figure 8B, EcTRAF4 mRNA was increased in 2.7. RGNNV or CP Promotes EcTRAF4 Expression GS cells expressing CP, indicating that RGNNV or CP increased cellular EcTRAF4 expression.After Together we confirmed with the the fact positive that EcTRAF4 effect of EcTRAF4promoted on RGNNV RGNNV propagation, replication, these we inves- data im- tigatedplied the that effect RGNNV of RGNNV exploited infection EcTRAF4 on EcTRAF4 via CP toexpression. improve its In proliferation response to RGNNVand that Ec- infection,TRAF4 the played transcription an important of EcTRAF4 role inin RGNNV GS cells infection. was higher than that in uninfected cells (Figure8A). Because EcTRAF4 interacted with RGNNV CP, the effect of CP on EcTRAF4 expression was investigated. As shown in Figure8B, EcTRAF4 mRNA was increased in GS cells expressing CP, indicating that RGNNV or CP increased cellular EcTRAF4 expression. Together with the fact that EcTRAF4 promoted RGNNV propagation, these data implied that RGNNV exploited EcTRAF4 via CP to improve its proliferation and that EcTRAF4 played an important role in RGNNV infection.

Int. J. Mol. Sci. 2021, 22, x FOR PEER REVIEW 7 of 15 Int. Int. J. Mol.J. Mol. Sci. Sci.2021 2021, 22, 22, 6136, x FOR PEER REVIEW 7 of7 of 14 15

(A) (B) (A) (B) Figure 8. RGNNV and CP promoted EcTRAF4 expression. (A) Expression changes of EcTRAF4 in RGNNV-infected cells Figure(meansFigure 8. ±8.RGNNV S.E., RGNNV n = and3). and β CP-actin CP promoted promoted was used EcTRAF4 EcTRAF4 as the internal expression. expression. control. (A (A) Statistical Expression) Expression difference changes changes ofis of EcTRAF4with EcTRAF4 mock. in in( RGNNV-infectedB RGNNV-infected) EcTRAF4 mRNA cells cells in (meansCP-expressing(means± ±S.E., S.E., n GS.n= =3). 3).GS β βwere-actin-actin transfected waswas usedused asaswith thethe CP. internalinternal TRAF4 control.control. mRNA Statistical expression difference difference was analyzed is is with with mock. mock.by RT–qPCR ( (BB)) EcTRAF4 EcTRAF4 at 12 and mRNA mRNA 24 h. in inSchemeCP-expressing CP-expressing 3. 1-3HA-transfected GS. GS. GS GS were were cell.transfected transfected Asterisk with with denotes CP. TRAF4TRAF4a significant mRNAmRNA difference expressionexpression (* p waswas< 0.05 analyzedanalyzed and ** p by by< 0.01). RT–qPCRRT–qPCR atat 12 12 and and 24 24 h. h. Scheme 3. 1-3HA-transfected cell. Asterisk denotes a significant difference (* p < 0.05 and ** p < 0.01). Asterisk denotes a signiﬁcant difference (* p < 0.05 and ** p < 0.01). 2.8. EcTRAF4 Is a Negative Regulator of Virus-Induced IFN Signaling 2.8. EcTRAF4 Is a Negative Regulator of Virus-Induced IFN Signaling 2.8. EcTRAF4To investigate Is a Negative whether Regulator EcTRAF4 of Virus-Induced was involved IFN in Signaling the regulation of virus-induced IFN signaling,To investigate GS cells whether were co-transfectedEcTRAF4 was with involved 200 ng in ofthe plasmid-encoding regulation of virus-induced ISRE–Luc, To investigate whether EcTRAF4 was involved in the regulation of virus-induced IFN IFN3–Luc,IFN signaling, or NF- GSκ B-Luccells were and co-transfected600 ng of pcDNA3.1-3×HA with 200 ng of or plasmid-encoding plasmid-encoding ISRE–Luc, HA–Ec- signaling,IFN3–Luc, GS or cells NF- wereκB-Luc co-transfected and 600 ng with of pcDNA3.1-3×HA 200 ng of plasmid-encoding or plasmid-encoding ISRE–Luc, HA–Ec- IFN3– TRAF4. A totalκ of 50 ng of pRL-SV40 Renilla luciferase× vector (Promega, USA) was used Luc,TRAF4. or NF- A totalB-Luc of and50 ng 600 of ngpRL-SV40 of pcDNA3.1-3 Renilla luciferaseHA or plasmid-encoding vector (Promega, HA–EcTRAF4.USA) was used Aas total the internal of 50 ng control. of pRL-SV40 The cells Renilla were luciferaseharvested vectorafter 48 (Promega, h to measure USA) the was luciferase used as activ- the as the internal control. The cells® were harvested after 48 h to measure the luciferase activ- internalities with control. the Dual-Luciferase The cells were harvested Reporter afterAssay 48 System. h to measure As shown the luciferase in Figure activities 9, the overex- with ities with the Dual-Luciferase® Reporter Assay System. As shown in Figure 9, the overex- thepression Dual-Luciferase of EcTRAF4® Reporter inhibited Assay the RGNNV-indu System. As shownced activation in Figure of9 IFN3,, the overexpression the ISRE, and NF- of pression of EcTRAF4 inhibited the RGNNV-induced activation of IFN3, the ISRE, and NF- EcTRAF4κB. inhibited the RGNNV-induced activation of IFN3, the ISRE, and NF-κB. κB.

FigureFigure 9. 9.The The relativerelative luciferaseluciferase activityactivity ofof IFN,IFN, ISRE,ISRE, andand NF-NF-κκBB promoterpromoter inin EcTRAF4-overexpressingEcTRAF4-overexpressing cells. cells. GS GS cells cells were were co-transfectedco-transfectedFigure 9. The with withrelative NF- NF- luciferaseκκB-Luc/IFN-B-Luc/IFN- activityββ-Luc/ISRE-Luc,-Luc/ISRE-Luc, of IFN, ISRE, pEGFP-C1, and NF-κB andpromoter pEGFP-EcTRAF4.pEGFP-EcTR in EcTRAF4-overexpressingAF4. Twenty-four hourshours cells. afterafter GS transfec-cellstransfec- were tion,tion,co-transfected cells cells werewere infected infectedwith NF- withwithκB-Luc/IFN- RGNNVRGNNVβ oror-Luc/ISRE-Luc, leftleft uninfecteduninfected pEGFP-C1, for 20 h before and pEGFP-EcTR luciferase assays assaysAF4. wereTwenty-four were performed performed hours (means (means after ±transfec-± S.E.,S.E. n, n==tion, 3). 3). Asterisk Asteriskcells were denotes denotes infected a asignificant significantwith RGNNV difference difference or left (* uninfected (* pp << 0.05 0.05 andand for ** 20 ** p ph< <0.01).before 0.01). luciferase assays were performed (means ± S.E., n = 3). Asterisk denotes a significant difference (* p < 0.05 and ** p < 0.01). ToTo investigate investigate the the mechanisms mechanisms involved involved in in the the action action of EcTRAF4of EcTRAF4 during during viral viral infection infec- intion fish, inTo wefish, investigate evaluated we evaluated the the mechanisms roles the ofroles EcTRAF4 ofinvolved EcTRAF4 in thein the hostin actionthe IFN-mediated host of EcTRAF4IFN-mediated immune during immune viral response infec- re- andsponsetion inflammatory in and fish, inflammatory we evaluated response. response. the At roles 24 hAt afterof 24 Ec h TRAF4transfection,after transfection, in the the host expression the IFN-mediated expression levels levels immune of IFN of IFN or re- inflammation-relatedorsponse inflammation-related and inflammatory genes genes response. (ISG15, (ISG15, ISG56, At ISG56, 24 IFN-2,h after IFN-2, TNFtransfection, TNFα, IL-1α, βIL-1 ,the andβ expression, and IL-8) IL-8) were levelswere measured meas-of IFN withor inflammation-related RT–qPCR. The expression genes of(ISG15, all genes ISG56, was IFN-2, significantly TNFα, IL-1 reducedβ, and in IL-8) the EcTRAF4-were meas-

Int. J. Mol. Sci. 2021, 22, x FOR PEER REVIEW 8 of 15

Int. J. Mol. Sci. 2021, 22, 6136 8 of 14

ured with RT–qPCR. The expression of all genes was significantly reduced in the Ec- TRAF4-overexpressingoverexpressing cells compared cells compared with their with expression their expression in the control in the vector-transfected control vector-trans- cells fected(Figure cells 10A,B). (Figure Taken 10A,B). together, Taken these together, data indicated these data that indicated EcTRAF4 that was EcTRAF4 a negative was regulator a neg- ativeof virus-induced regulator of IFNvirus-induced signaling. IFN signaling.

(A)

(B)

Figure 10. RelativeRelative expression levels of IFN-signalingIFN-signaling moleculesmolecules and and proinflammatory proinflammatory cytokines cytokines in in EcTRAF4-overexpressing EcTRAF4-overexpress- ingcells. cells. (A) ( ExpressionA) Expression changes changes of IFN-signaling of IFN-signaling molecules molecules (ISG15, (ISG15, ISG56 ISG56 and IFN-2) and IFN-2) in EcTRAF4-overexpressing in EcTRAF4-overexpressing cells (means cells (means ± S.E., n = 3). (B) Expression changes of inflammatory factors (IL-1β and TNFα) in EcTRAF4-overexpressing cells ± S.E., n = 3). (B) Expression changes of inflammatory factors (IL-1β and TNFα) in EcTRAF4-overexpressing cells (means ± S.E., n = 3). β-actin was used as the internal control. The asterisk denotes a significant difference (* p < 0.05 and (means ± S.E., n = 3). β-actin was used as the internal control. The asterisk denotes a significant difference (* p < 0.05 and ** p < 0.01). ** p < 0.01). 3. Discussion 3. Discussion As an important family of signal transduction proteins, the TRAF proteins have been foundAs in an all important animal species family [24]. of signal Although transduction several TRAF proteins, family the TRAFmembers proteins in teleosts have beenhad beenfound studied, in all animaland the species results [showed24]. Although that they several played TRAF important family roles members in the innate in teleosts im- munehad been system studied, [25–28], and the the function results showedof TRAF that4 in theythe orange-spotted played important grouper roles had in the not innate been immune system [25–28], the function of TRAF4 in the orange-spotted grouper had not established. been established. In this study, the TRAF4 homologue in the orange-spotted grouper, EcTRAF4, was In this study, the TRAF4 homologue in the orange-spotted grouper, EcTRAF4, was cloned. Similar to its mammalian counterparts, the EcTRAF4 protein includes one N-ter- cloned. Similar to its mammalian counterparts, the EcTRAF4 protein includes one N- minal RING finger domain, three zinc finger domains, and a MATH domain. In our pre- terminal RING finger domain, three zinc finger domains, and a MATH domain. In our vious study, TRAF6 from E. tauvina (Et-TRAF6) also includes one N-terminal RING do- previous study, TRAF6 from E. tauvina (Et-TRAF6) also includes one N-terminal RING main (amino acids 78–116), two TRAF-type zinc fingers (amino acids 159–210 and 212– domain (amino acids 78–116), two TRAF-type zinc fingers (amino acids 159–210 and 269), one coiled-coil region (amino acids 370–394), and one conserved C-terminal meprin 212–269), one coiled-coil region (amino acids 370–394), and one conserved C-terminal and TRAF homology (MATH) domain (amino acids 401–526) [26]. The EcTRAF4 and Et- meprin and TRAF homology (MATH) domain (amino acids 401–526) [26]. The EcTRAF4 TRAF6 proteins apparently share a similar motif composition, indicating that they may and EtTRAF6 proteins apparently share a similar motif composition, indicating that they have potential functional similarities. may have potential functional similarities. In a previous study, fish TRAF genes were shown to be widely expressed in the examined tissues [24]. Most TRAF genes were highly expressed in the gills. Gills mediate

Int. J. Mol. Sci. 2021, 22, 6136 9 of 14

the contact between aquatic organisms and their external aquatic environments. Gills are also the first defensive barriers to pathogen invasions [29]. TRAF genes were also detected at higher levels in the liver and spleen. The liver and spleen are the important immune-related tissues in teleost fish [30]. To investigate the tissue expression profile of EcTRAF4 under normal physiological conditions, 10 different tissues from healthy grouper were analyzed with RT–qPCR. EcTRAF4 was expressed in all the examined tissues and predominantly expressed in the spleen, gill, skin, and stomach, similar to most fish TRAF genes [24,26,28]. To investigate the involvement of TRAFs in the innate immune responses of teleost fish, the expression profile of EcTRAF4 in GS cells after challenges with RGNNV was examined. In response to RGNNV infection, the transcription of EcTRAF4 in GS cells was higher than in the uninfected cells. As the infection time increased, its expression level gradually increased. EcTRAF4 could interact with RGNNV CP, and the expression of EcTRAF4 mRNA was increased in GS cells expressing CP. These results indicated that EcTRAF4 was involved in the immune response to the invasion of viral pathogens. In previous studies, TRAF5 was shown to interact with NS3 and promoted classical swine fever virus (CSFV) replication [27]. Similarly, TRAF5 also interacted with the Human Immunodeficiency Virus-1 (HIV-1) Nef protein and HIV-1 Nef-activated TRAF5 to promote HIV-1 replication in monocyte-derived macrophages [31]. To investigate the molecular mechanism underlying the host antiviral innate immune response, the effects of EcTRAF4 overexpression on RGNNV replication were studied. Overexpressed EcTRAF4 promoted RGNNV replication and reduced the transcription levels of genes encoding IFN-related cytokines (ISG15, ISG56, and IFN- 2) and proinflammatory cytokines (IL1β, IL8, and TNFα). EcTRAF4 also inhibited the RGNNV-induced activation of IFN3 and ISRE. Therefore, EcTRAF4 negatively regulated the IFN-mediated immune response and the expression of proinflammatory cytokines to facilitate RGNNV proliferation. The expression of TRAF4 has different distribution in different cells [32]. Some have reported that TRAF4 is a dynamic, tight junction-related shuttle protein [33], whereas other researchers have thought that different structural domains influence cellular localization [34]. In the present study, the localization of EcTRAF4 in GS cells was investigated with fluorescence microscopy to preliminarily determine whether TRAF4 remained in the cytoplasm as a signal transducer. Consistent with previous studies, our results showed that EcTRAF4 localized mainly in the cytoplasm of GS cells, and all the cells showed a similar appearance under a 10× microscope. It was reported that TRAF family members in mammals were involved in the innate immune and inflammatory responses to mediate the MAPK, IRF,and NF-κB pathways [15,24,26,28]. Studies in mammals have reported that TRAF4 promotes NF-κB activation by the GITR protein but inhibits the NF-κB activation induced by LPS or the binding of NOD2 [35]. In contrast, TRAF4 activates NF-κB in HEK-293 cells in the amphioxus [36]. In the present study, we found that EcTRAF4 inhibited the RGNNV-induced activation of NF-κB. In conclusion, the complete ORF of EcTRAF4 was cloned. The sequence, critical functional domains, and phylogeny were conducted with bioinformatic methods. We also analyzed the expression of EcTRAF4 in the tissues of grouper and in GS cells after viral infection. EcTRAF4 was also localized intracellularly, and the effect of EcTRAF4 overexpression on RGNNV proliferation was investigated. EcTRAF4 was then overexpressed in GS cells to determine whether it activated IFN, ISRE, and NF-κB. The results of this study provide valuable information, allowing a comprehensive understanding of the evolution of fish TRAF4 and its functions in the innate immune system.

4. Materials and Methods 4.1. Fish, Cell Lines, and Virus Healthy orange-spotted grouper (weighing 30–40 g) were purchased from Maoming Marine Fish Farm, Guangdong Province, China. The ﬁsh were maintained in the laboratory in a recirculating seawater system at 24–28 ◦C and fed twice daily for 2 weeks [37]. Tissue Int. J. Mol. Sci. 2021, 22, 6136 10 of 14

samples from six ﬁsh including kidney, heart, liver, spleen, intestine, stomach, brain, gill, head kidney, and skin samples were excised, immediately frozen in liquid nitrogen, and stored at −80 ◦C[37]. Grouper spleen (GS) cells were propagated with the recommended method in Lei- bovitz’s L15 culture medium, containing 10% fetal calf serum, at 28 ◦C[38]. Red-spotted grouper nervous necrosis virus (RGNNV) was propagated as described previously [39,40]. 5 The viral titer was 10 TCID50/mL. The GS cells were challenged with RGNNV (multiplicity of infection (MOI) = 2) for 6, 18, 24, 30, or 42 h. The RNA was then extracted from the cells to determine the expression of EcTRAF4 with reverse transcription (RT)–quantitative real-time PCR (qPCR). Unchallenged GS cells were used as the control.

4.2. RNA Isolation, cDNA Synthesis, and RT–qPCR According to the manufacturers’ instructions, RNA extraction and cDNA synthesis were performed with the SV Total RNA Isolation System (Promega, Madison, USA) and ReverTra Ace qPCR RT Kit (Toyobo, Osaka, Japan), respectively. RT–qPCR was performed with SYBR® Green Realtime PCR Master Mix (Toyobo) in an Applied Biosystems QuantStu- dio 5 Real Time PCR System (Thermo Fisher, MA, USA), as described previously [37,40]. Brieﬂy, each assay was performed in triplicate with the following cycling conditions: 95 ◦C for 1 min for activation, followed by 40 cycles of 95 ◦C for 15 s, 60 ◦C for 15 s, and 72 ◦C for 45 s. The expression levels of the target genes were normalized to that of β-actin and calculated with the 2−44CT method. The data are presented as means ± standard deviations (SD). The primer sequences used for RT–qPCR are listed in Table1.

Table 1. Primers used for host and viral gene expression analysis.

Name Sequence (50–30) RGNNV-CP-RT-F CAACTGACAACGATCACACCTTC RGNNV-CP-RT-R CAATCGAACACTCCAGCGACA RGNNV-RdRp-RT-F GTGTCCGGAGAGGTTAAGGATG RGNNV-RdRp-RT-R CTTGAATTGATCAACGGTGAACA EcTRAF4-RT-F TTCAGCCCACCCTTCTACACTCA EcTRAF4-RT-R CCACTCCAGCAGGTTGTCGTACTCT β-actin-RT-F TACGAGCTGCCTGACGGACA β-actin-RT-R GGCTGTGATCTCCTTCTGCA EcISG15-RT-F CCTATGACATCAAAGCTGACGAGAC EcISG15-RT-R GTGCTGTTGGCAGTGACGTTGTAGT EcISG56-RT-F CTGTTGTTACGCACGGAGGAT EcISG56-RT-R CCTGCGTGGGTTCATTCAGT EcIFN2-RT-S TACAGCCAGGCGTCCAAAGCATC EcIFN2-RT-R CAGTACAGGAGCGAAGGCCGACA EcIL-1β-RT-F AACCTCATCATCGCCACACA EcIL-1β-RT-R AGTTGCCTCACAACCGAACAC EcIL8-RT-F GCCGTCAGTGAAGGGAGTCTAG EcIL8-RT-R ATCGCAGTGGGAGTTTGCA EcTNFα-RT-F GTGTCCTGCTGTTTGCTTGGTA EcTNFα-RT-R CAGTGTCCGACTTGATTAGTGCTT EcTRAF6-RT-F CCCTATCTGCCTTATGGCTTTGA EcTRAF6-RT-R ACAGCGGACAGTTAGCGAGAGTAT

4.3. Cloning of EcTRAF4 and Sequence Analysis The ORF of EcTRAF4 was ampliﬁed with PCR, using primers that were designed based on the sequence of Epinephelus coioides TRAF4 (KR005609.1). The primers are listed in Table2. The sequence of EcTRAF4 was analyzed with the BLAST program (http://www.ncbi.nlm.nih.gov/blast, accessed on 1 May 2021). An amino acid sequence alignment was constructed with ClustalX1.83 software and was edited with the GeneDoc program. The neighbor-joining (NJ) method implemented in MEGA 4.0 was used for a phy- Int. J. Mol. Sci. 2021, 22, 6136 11 of 14

logenetic analysis. The robustness of the phylogenetic tree bifurcations was estimated with a bootstrap analysis, and the bootstrap percentages were calculated from 1000 replicates.

Table 2. Primers used for EcTRAF4 cloning and plasmid construction.

Name Sequence (50–30) Usage F1 ATGCCCGGGTTTGATTACAAGTTTC EcTRAF4 cloning R1 TTAAGCCATGATCTTCTGGGGAATC C1-EcTRAF4-F GCCTCGAGCTATGCCCGGGTTTGATTAC pEGFP-C1 cloning C1-EcTRAF4-R GCGGATCCTTAAGCCATGATCTTCTGG HA-EcTRAF4-F GCGGATCCTATGCCCGGGTTTGATTAC pcDNA3.1-3HA cloning HA-EcTRAF4-R GCCTCGAGTTAAGCCATGATCTTCTGG HA-CP-F GCAAGCTTATGGTACGCAAAGGTGAGAAGAAAT pcDNA3.1-3HA cloning HA-CP-R GCGAATTCGTTTTCCGAGTCAACCCTGGTGCAG

4.4. Plasmid Construction The ORF of EcTRAF4 was subcloned into the pcDNA3.1-3HA or pEGFP-C1 vector (Invitrogen) to generate the recombinant plasmids pcDNA3.1–EcTRAF4 and pEGFP– EcTRAF4, respectively. The ORF of the coat protein (CP) of RGNNV was subcloned into the pcDNA3.1-3HA vector (Invitrogen) to generate the recombinant plasmid pcDNA3.1–CP. The recombinant plasmids were conﬁrmed with DNA sequencing. The primers used to amplify these genes are listed in Table2.

4.5. Cell Transfection Cells were transfected using Lipofectamine 2000 (Invitrogen), as described previously [36,39]. Brieﬂy, GS cells (5 × 105) were seeded in 24-well plates or 6-well plates, grown to 70–80% conﬂuence, and then incubated with a mixture of Lipofectamine 2000 and plasmid for 6 h. The mixture then was replaced with fresh normal medium.

4.6. Cellular Localization Analysis GS cells (5 × 105) were seeded onto coverslips (10 mm × 10 mm) in a six-well plate. After the cells were allowed to adhere for 24 h, they were transfected with the pEGFP– EcTRAF4 or pEGFP–C1 plasmid. At 24 h post-transfection, the cells were washed with phosphate-buffered saline, ﬁxed with 4% paraformaldehyde for 1 h, and then stained with 6-diamidino-2-pheny-lindole (DAPI) for 10 min. They were then mounted with 50% glycerol and observed with ﬂuorescence microscopy (Leica, Germany).

4.7. Viral Infection Assays and Sample Collection To evaluate the effects of EcTRAF4 on viral replication, GS cells overexpressing pcDNA3.1 or pcDNA3.1-EcTRAF4 were infected with RGNNV (MOI = 2). Next, the cells were harvested and analyzed by RT–qPCR and western blotting [37].

4.8. Small Interfering RNA (siRNA)-Mediated EcTRAF4 Knockdown To knockdown the expression of EcTRAF4 in GS cells, three siRNAs, targeting different parts of the EcTRAF4 mRNA molecule, were commercially synthesized by Invitrogen. The sequences of siRNAs were as follows: siRNA1 (sense: 50-GCUAACCAUGUGAAGGACATT- 30; antisense: 50-UUGUGUCGAAGACGAACUCTT-30), siRNA2 (sense: 50-UCUCCUACAA GGUGACUUUTT-30; antisense: 50-AAAGUCACCUUGUAGGAGATT-30), and siRNA3 (sense: 50-GCUAACCAUGUGAAGGACATT-30: antisense: 50-UGUCCUUCACAUGGUUA GCTT-30). One of these three siRNAs or the same amount of the negative control siRNA were transfected into GS cells, and then infected with RGNNV or left untreated. At the end Int. J. Mol. Sci. 2021, 22, 6136 12 of 14

of the incubation period, the total RNA was extracted from the cells and analyzed with RT–qPCR and western blotting [37].

4.9. Coimmunoprecipitation Assays and Western Blotting GS cells in cell culture dishes (10 cm × 10 cm) were transfected with 16 µg of plasmid DNA (8 µg of each expression vector) for 48 h. The transfected GS cells were lysed in radioimmunoprotein assay buffer (containing 100 mM NaCl, 0.5% NP-40, 1 mM EDTA, 20 mM Tris; pH 8.0). The Dynabeads™ Protein G Immunoprecipitation Kit (Invitrogen) was used to process the collected cell samples. The proteins were separated with 12% SDS- PAGE and transferred onto Immobilon-P polyvinylidene diﬂuoride membranes (Millipore, Temecula, CA, USA). The blots were incubated with an anti-green ﬂuorescent protein (GFP, diluted 1:1000), anti-3 × hemagglutinin (3HA, diluted 1:1000), or anti-RGNNV CP primary antibody (diluted 1:1000) and then with a horseradish peroxidase (HRP)- conjugated anti-rabbit IgG antibody (diluted 1:5000) or an HRP-conjugated anti-mouse IgG antibody (diluted 1:5000). The immunoreactive proteins were observed with the Enhanced HRP-DAB Chromogenic Substrate Kit (Tiangen, Beijing, China) [40].

4.10. Yeast Two-Hybrid Analysis For the yeast two-hybrid analysis, the corresponding genes were cloned separately into the pGBKT7 and pGADT7 vectors, and the pGBKT7-BD and pGADT7–EcTRAF4 plasmids were constructed for the verification of self-activation. pGBKT7-CP was also constructed for the verification of interaction. All constructed plasmids were confirmed with DNA sequencing. Saccharomyces cerevisiae strain Y2H Gold was co-transformed with the two plasmids. The transformants were tested on SD/-leu/-trp and SD/-leu/-trp/-his/- ade/X-α-gal/AbA media.

4.11. RT–qPCR Analysis of Relative Expression Levels of host and Viral Genes To examine the transcriptional expression of host and viral genes, RT–qPCR was performed, as described above [37,40]. The primers for the ampliﬁcation of the host IFN- signaling molecules (ISG15, ISG56, and IFN-2), host proinﬂammatory factors (IL-1β, IL-8, and TNFα), and viral genes (CP and RdRp) were reported previously [40] and are listed in Table2. The expression levels of the target genes were calculated with the 2 −∆∆CT method, and gene-encoding β-actin was used as the reference gene. Samples transfected with the empty vector were used as the calibrator group against which to normalize gene expression. The data are represented as means ± standard errors of the means (SEM).

4.12. Dual-Luciferase Reporter Assays To examine the effects of EcTRAF4 on the activity of IFN and the nuclear factor-κB (NF-κB) promoter, luciferase plasmids, including those encoding zebraﬁsh IFN3–Luc, human IFN-stimulated response element (ISRE)–Luc, and NF-κB–Luc (Promega, Madison, WI, USA), were used [37,40]. In brief, GS cells were co-transfected with 200 ng of plasmid- encoding ISRE–Luc, IFN3–Luc, or NF-κB-Luc and 600 ng of pcDNA3.1-3 × HA or plasmid- encoding HA–EcTRAF4. A total of 50 ng of pRL-SV40 Renilla luciferase vector (Promega, Madison, WI, USA) was used as the internal control. The cells were harvested after 48 h to measure luciferase activities with the Dual-Luciferase® Reporter Assay System (Promega, Madison, WI, USA), according to the manufacturer’s instructions.

4.13. Statistical Analyses All statistics were calculated using SPSS version 20. Differences between control and treatment groups were assessed by one-way ANOVA. Differences were considered signiﬁcant at p < 0.05 and highly signiﬁcant at p < 0.01. Int. J. Mol. Sci. 2021, 22, 6136 13 of 14

4.14. Ethics Statement All experiments involving animals were approved by the Animal Care and Use Committee of the College of Marine Sciences, South China Agricultural University, and all efforts were made to minimize animal suffering. The ID number is HYXY20210328 (SCAU).

Author Contributions: Q.Q. and J.W. designed the experiments. S.W. performed the majority of the experiments, analyzed data, and wrote the manuscript. M.S., X.Z., J.L. and M.L. contributed experi- mental suggestions. All authors have read and agreed to the published version of the manuscript. Funding: This research was funded by the National Key R&D Program of China (2018YFD0900500 and 2018YFC0311300), the National Natural Science Foundation of China (31772882), the China Agriculture Research System of MOF and MARA(CARS-47-G16), the Science and Technology Plan- ning Project of Guangdong Province, China (2015TQ01N118), and the National High Technology Development Program of China (863) (2014AA093507). Institutional Review Board Statement: The study was conducted according to the guidelines of the Animal Care and Use Committee of the College of Marine Sciences, South China Agricultural University, and all efforts were made to minimize animal suffering. Informed Consent Statement: Patient consent was waived due to: not applicable for studies not involving humans. Data Availability Statement: Data supporting reported results can be provided by J.W. Wei. Conﬂicts of Interest: The authors declare no conﬂict of interest.

References 1. Zhu, Z.M.; Dong, C.F.; Weng, S.P.; He, J.G. The high prevalence of pathogenic Vibrio harveyi with multiple antibiotic resistance in scale drop and muscle necrosis disease of the hybrid grouper, Epinephelus fuscoguttatus (female symbol) × E. lanceolatus (male symbol), in China. J. Fish Dis. 2018, 41, 589–601. [CrossRef][PubMed] 2. Qin, Q.W.; Chang, S.F.; Ngoh-Lim, G.H.; Gibson-Kueh, S.; Shi, C.Y.; Lam, T.J. Characterization of a novel ranavirus isolated from grouper Epinephelus tauvina. Dis. Aquat. Org. 2003, 53, 1–9. [CrossRef][PubMed] 3. Wei, J.G.; Huang, Y.H.; Zhu, W.B.; Li, C.; Huang, X.H.; Qin, Q.W. Isolation and identification of Singapore grouper iridovirus Hainan strain (SGIV-HN) in China. Arch. Virol. 2019, 164, 1869–1872. [CrossRef][PubMed] 4. Hegde, A.; Chen, C.; Qin, Q.; Lam, T.; Sin, Y. Characterization, pathogenicity and neutralization studies of a nervous necrosis virus isolated from grouper, Epinephelus tauvina, in Singapore. Aquaculture 2002, 213, 55–72. [CrossRef] 5. Shetty, M.; Maiti, B.; Santhosh, K.S.; Venugopal, M.N.; Karunasagar, I. Betanodavirus of Marine and Freshwater Fish: Distribution, Genomic Organization, Diagnosis and Control Measures. Indian J. Virol. 2012, 23, 114–123. [CrossRef] 6. Toffan, A.; Pascoli, F.; Pretto, T.; Panzarin, V.; Abbadi, M.; Buratin, A.; Quartesan, R.; Gijón, D.; Padrós, F. Viral nervous necrosis in gilthead sea bream (Sparus aurata) caused by reassortant betanodavirus RGNNV/SJNNV: An emerging threat for Mediterranean aquaculture. Sci. Rep. 2017, 7, 46755. [CrossRef][PubMed] 7. Ge, H.; Lin, K.; Zhou, C.; Lin, Q.; Zhang, Z.; Wu, J.; Zheng, L.; Yang, Q.; Wu, S.; Chen, W.; et al. A multi-omic analysis of orange-spotted grouper larvae infected with nervous necrosis virus identifies increased adhesion molecules and collagen synthesis in the persistent state. Fish Shellfish Immunol. 2020, 98, 595–604. [CrossRef][PubMed] 8. Nishizawa, T.; Furuhashi, M.; Nagai, T.; Nakai, T.; Muroga, K. Genomic classification of fish nodaviruses by molecular phylogenetic analysis of the coat protein gene. Appl. Environ. Microbiol. 1997, 63, 1633–1636. [CrossRef][PubMed] 9. Bradley, R.J.; Pober, S.J. Tumor necrosis factor receptor-associated factors (TRAFs). Oncogene 2001, 20, 6482–6491. [CrossRef] 10. Lalani, A.I.; Zhu, S.; Gokhale, S.; Jin, J.; Xie, P. TRAF Molecules in Inflammation and Inflammatory Diseases. Curr. Pharmacol. Rep. 2017, 4, 64–90. [CrossRef] 11. Zotti, T.; Vito, P.; Stilo, R. The seventh ring: Exploring TRAF7 functions. J. Cell. Physiol. 2011, 227, 1280–1284. [CrossRef] 12. Xie, P. TRAF molecules in cell signaling and in human diseases. J. Mol. Signal. 2013, 8, 7. [CrossRef][PubMed] 13. Park, H.H. Structure of TRAF Family: Current Understanding of Receptor Recognition. Front. Immunol. 2018, 9, 1999. [CrossRef] 14. Deshaies, R.J.; Joazeiro, C.A. RING Domain E3 Ubiquitin Ligases. Annu. Rev. Biochem. 2009, 78, 399–434. [CrossRef][PubMed] 15. Häcker, H.; Tseng, P.-H.; Karin, M. Expanding TRAF function: TRAF3 as a tri-faced immune regulator. Nat. Rev. Immunol. 2011, 11, 457–468. [CrossRef] 16. Deng, C.-C.; Zhu, D.-H.; Chen, Y.-J.; Huang, T.-Y.; Peng, Y.; Liu, S.-Y.; Lu, P.; Xue, Y.-H.; Xu, Y.-P.; Yang, B.; et al. TRAF4 Promotes Fibroblast Proliferation in Keloids by Destabilizing p53 via Interacting with the Deubiquitinase USP10. J. Investig. Dermatol. 2019, 139, 1925–1935.e5. [CrossRef] 17. Regnier, C.; Tomasetto, C.; Moog-Lutz, C.; Chenard, M.-P.; Wendling, C.; Basset, P.; Rio, M.-C. Presence of a New Conserved Domain in CART1, a Novel Member of the Tumor Necrosis Factor Receptor-associated Protein Family, Which Is Expressed in Breast Carcinoma. J. Biol. Chem. 1995, 270, 25715–25721. [CrossRef][PubMed] Int. J. Mol. Sci. 2021, 22, 6136 14 of 14

18. Kedinger, V.; Rio, M.-C. TRAF4, the Unique Family Member. Atherosclerosis 2007, 597, 60–71. 19. Li, W.; Peng, C.; Lee, M.-H.; Lim, D.; Zhu, F.; Fu, Y.; Yang, G.; Sheng, Y.; Xiao, L.; Dong, X.; et al. TRAF4 Is a Critical Molecule for Akt Activation in Lung Cancer. Cancer Res. 2013, 73, 6938–6950. [CrossRef][PubMed] 20. Zhang, L.; Zhou, F.F.; de Vinuesa, A.G.; de Kruijf, E.M.; Mesker, W.E.; Hui, L.; Drabsch, Y.; Li, Y.H.; Bauer, A.; Rousseau, A.; et al. TRAF4 Promotes TGF-beta Receptor Signaling and Drives Breast Cancer Metastasis. Mol. Cell 2013, 51, 559–572. [CrossRef] [PubMed] 21. Regnier, C.; Masson, R.; Kedinger, V.; Textoris, J.; Stoll, I.; Chenard, M.-P.; Dierich, A.; Tomasetto, C.; Rio, M.-C. Impaired neural tube closure, axial skeleton malformations, and tracheal ring disruption in TRAF4-deficient mice. Proc. Natl. Acad. Sci. USA 2002, 99, 5585–5590. [CrossRef] 22. Ye, X.; Mehlen, P.; Rabizadeh, S.; Van Arsdale, T.; Zhang, H.; Shin, H.; Wang, J.J.L.; Leo, E.; Zapata, J.; Hauser, C.A.; et al. TRAF Family Proteins Interact with the Common Neurotrophin Receptor and Modulate Apoptosis Induction. J. Biol. Chem. 1999, 274, 30202–30208. [CrossRef][PubMed] 23. Esparza, E.M.; Arch, R.H. TRAF4 functions as an intermediate of GITR-induced NF-kappaB activation. Cell. Mol. Life Sci. 2020, 61, 3087–3092. [CrossRef][PubMed] 24. Li, K.-M.; Li, M.; Wang, N.; Chen, Y.-D.; Xu, X.-W.; Xu, W.-T.; Wang, L.; Chen, S.-L. Genome-wide identification, characterization, and expression analysis of the TRAF gene family in Chinese tongue sole (Cynoglossus semilaevis). Fish Shellfish Immunol. 2020, 96, 13–25. [CrossRef] 25. Kim, W.L.; Kim, M.S.; Kim, K.H. Molecular cloning of rock bream’s (Oplegnathus fasciatus) tumor necrosis factor receptor-associated factor 2 and its role in NF-kappaB activation. Fish Shellfish Immunol. 2011, 30, 1178–1783. [CrossRef][PubMed] 26. Wei, J.; Guo, M.; Gao, P.; Ji, H.; Li, P.; Yan, Y.; Qin, Q. Isolation and characterization of tumor necrosis factor receptor-associated factor 6 (TRAF6) from grouper, Epinephelus tauvina. Fish Shellfish Immunol. 2014, 39, 61–68. [CrossRef] 27. Lv, H.; Dong, W.; Guo, K.; Jin, M.; Li, X.; Li, C.; Zhang, Y. Tumor Necrosis Factor Receptor-Associated Factor 5 Interacts with the NS3 Protein and Promotes Classical Swine Fever Virus Replication. Viruses 2018, 10, 305. [CrossRef][PubMed] 28. Li, C.; Wei, J.; Zhang, X.; Sun, M.; Wu, S.; Qin, Q. Fish TRAF2 promotes innate immune response to RGNNV infection. Fish Shellfish Immunol. 2020, 102, 108–116. [CrossRef] 29. Li, C.; Song, L.; Tan, F.; Su, B.; Zhang, D.; Zhao, H.; Peatman, E. Identification and mucosal expression analysis of cathepsin B in channel catfish (Ictalurus punctatus) following bacterial challenge. Fish Shellfish Immunol. 2015, 47, 751–757. [CrossRef] 30. Wei, T.; Sun, Y.; Shi, G.; Wang, R.; Xu, T. Characterization and SNP variation analysis of a HSP70 gene from miiuy croaker and its expression as related to bacterial challenge and heat shock. Fish Shellfish Immunol. 2012, 33, 632–640. [CrossRef][PubMed] 31. Khan, K.A.; Abbas, W.; Varin, A.; Kumar, A.; Di Martino, V.; Dichamp, I.; Herbein, G. HIV-1 Nef Interacts with HCV Core, Recruits TRAF2, TRAF5 and TRAF6, and Stimulates HIV-1 Replication in Macrophages. J. Innate Immun. 2013, 5, 639–656. [CrossRef] [PubMed] 32. Zhang, X.; Wen, Z.; Sun, L.; Wang, J.; Song, M.; Wang, E.; Mi, X. TRAF2 regulates the cytoplasmic/nuclear distribution of TRAF4 and its biological function in breast cancer cells. Biochem. Biophys. Res. Commun. 2013, 436, 344–348. [CrossRef][PubMed] 33. Kedinger, V.; Alpy, F.; Baguet, A.; Polette, M.; Stoll, I.; Chenard, M.P.; Tomasetto, C.; Rio, M.C. Tumor Necrosis Factor Receptor- Associated Factor 4 Is a Dynamic Tight Junction-Related Shuttle Protein Involved in Epithelium Homeostasis. PLoS ONE 2008, 3, e3518. [CrossRef] 34. Camilleri-Broet, S.; Cremer, I.; Marmey, B.; Comperat, E.; Viguié, F.; Audouin, J.; Rio, M.-C.; Fridman, W.-H.; Sautès-Fridman, C.; Régnier, C.H.; et al. TRAF4 overexpression is a common characteristic of human carcinomas. Oncogene 2006, 26, 142–147. [CrossRef][PubMed] 35. Dempsey, P.W.; Doyle, S.E.; He, J.Q.; Cheng, G. The signaling adaptors and pathways activated by TNF superfamily. Cytokine Growth Factor Rev. 2003, 14, 193–209. [CrossRef] 36. Yuan, S.; Liu, T.; Huang, S.; Wu, T.; Huang, L.; Liu, H.; Tao, X.; Yang, M.; Wu, K.; Yu, Y.; et al. Genomic and Functional Uniqueness of the TNF Receptor-Associated Factor Gene Family in Amphioxus, the Basal Chordate. J. Immunol. 2009, 183, 4560–4568. [CrossRef][PubMed] 37. Wei, J.; Li, C.; Ou, J.; Zhang, X.; Liu, Z.; Qin, Q. The roles of grouper TANK in innate immune defense against iridovirus and nodavirus infections. Fish Shellfish Immunol. 2020, 104, 506–516. [CrossRef] 38. Huang, X.H.; Huang, Y.H.; Sun, J.J.; Han, X.; Qin, Q. Characterization of two grouper Epinephelus akaara cell lines: Application to studies of Singapore grouper iridovirus (SGIV) propagation and virus-host interaction. Aquaculture 2009, 292, 172–179. [CrossRef] 39. Wei, J.; Zhang, X.; Zang, S.; Qin, Q. Expression and functional characterization of TRIF in orange-spotted grouper (Epinephelus coioides). Fish Shellfish Immunol. 2017, 71, 295–304. [CrossRef][PubMed] 40. Li, C.; Liu, J.; Zhang, X.; Wei, S.; Huang, X.; Huang, Y.; Wei, J.; Qin, Q. Fish Autophagy Protein 5 Exerts Negative Regulation on Antiviral Immune Response Against Iridovirus and Nodavirus. Front. Immunol. 2019, 10, 517. [CrossRef][PubMed]