Journal of Medicine and Life Editor-in-Chief: Dafin F. Mureşanu Volume 8 • Special Issue 3• 2015 Founding Editor: Florian Popa Editorial Board Adrian Streinu-Cercel, “Carol Davila” University of Medicine Ioanel Sinescu, “Carol Davila” University of Medicine and and Pharmacy, Bucharest, Romania Pharmacy, Bucharest, Romania Andy Petroianu, Federal University of Minas Gerais, Belo , King’s College Hospital, London, U.K. Horizonte, Brazil Kypros Nicolaides Bogdan Ovidiu Popescu, “Carol Davila” University of Medicine Ladislau Steiner, University of Virginia, Charlottesville, VA, and Pharmacy, Bucharest, Romania U.S.A. Brian T. Pickering, University of Bristol, U.K. Luigi Frati, “La Sapienza” University of Rome, Rome, Italy University of Athens, Greece Madjid Samii, Medical University of Hannover, Hannover, Christos Kittas, Germany Eliot Sorel, “George Washington” University School of Medicine, Miron Bogdan, “Carol Davila” University of Medicine and Washington D.C., U.S.A. Pharmacy, Bucharest, Romania Tudorel Ciurea, Craiova University of Medicine and Emil Toescu, University of Birmingham, Birmingham, U.K. Pharmacy, Craiova, Romania Executive Editor Victor Lorin Purcărea,"Carol Davila'' University of Medicine and Pharmacy, Bucharest, Romania Scientific Council Leon Wegnez, A.I.D.A. Brussels, Brussels, Belgium Marius Bojiţă, “Iuliu Haţieganu” University of Medicine and Pharmacy, Cluj, Romania Theodor Purcărea, Romanian-American University, Bucharest, Mircea Diculescu, “Carol Davila” University of Medicine and Romania Pharmacy, Bucharest, Romania Ion Ababii, “Nicolae Testemiţeanu” University of Medicine and Ion Fulga, “Carol Davila” University of Medicine and Pharmacy, Chişinău, Republic of Moldavia Pharmacy, Bucharest, Romania Valeriy Zaporozhan, Odessa State Medical University, Odessa, Ecaterina Ionescu, “Carol3_2015_draft Davila” University of Medicine and Ukraine Pharmacy, Bucharest, Romania Silviu Constantinoiu, “Carol Davila” University of Medicine and Ioan Lascăr, “Carol Davila” University of Medicine and Pharmacy, Bucharest, Romania Pharmacy, Bucharest, Romania Vlad Ciurea, “Carol Davila” University of Medicine and Mircea Penescuiss, “Carol Davila” University of Medicine and Pharmacy, Bucharest, Romania Pharmacy, Bucharest, Romania Gabriela Radulian, “Carol Davila” University of Medicine and Dan Andronescu, “Carol Davila” University of Medicine and Pharmacy, Bucharest, Romania Pharmacy, Bucharest, Romania Alexandru Ciocâlteu, “Carol Davila” University of Medicine and Mircea Beuran, “Carol Davila” University of Medicine and Pharmacy, Bucharest, Romania Pharmacy, Bucharest, Romania Victor Stoica, “Carol Davila” University of Medicine and Constantin Copotoiu, Tg. Mureş University of Medicine and Pharmacy, Bucharest, Romania Pharmacy, Tg. Mureş, Romania Petre Bordei, “Ovidius” University, Constanţa, Romania Adriana Sarah Nica, “Carol Davila” University of Medicine and Pharmacy, Bucharest, Romania Crina Sinescu, “Carol Davila” University of Medicine and Virgiliu Ancăr, “Carol Davila” University of Medicine and Pharmacy, Bucharest, Romania Pharmacy, Bucharest, Romania Dafin Mureşanu, “Iuliu Haţieganu” University of Medicine and Dan Mischianu, “Carol Davila” University of Medicine and Pharmacy, Cluj, Romania 8_specialPharmacy, Bucharest, Romania Dragoş Stanciu, “Carol Davila” University of Medicine and Dumitru Borţun, National School of Politic and Administrative Pharmacy, Bucharest, Romania Studies, Bucharest, Romania Constantin Zaharia, “Carol Davila” University of Medicine and Dana Mincă, “Carol Davila” University of Medicine and Pharmacy, Bucharest, Romania Pharmacy, Bucharest, Romania Mugurel Constantin Rusu, “Carol Davila” University of Gheorghe Orzan, Academy of Economic Studies, Bucharest, Medicine and Pharmacy, Bucharest, Romania Romania Virgiliu Arion, “Carol Davila” University of Medicine and Ion Sârbu, “Carol Davila” University of Medicine and Pharmacy, Bucharest, Romania Pharmacy, Bucharest, Romania Dumitru Lupuliasa, “Carol Davila” University of Medicine and Gelu Onose, “Carol Davila” University of Medicine and Pharmacy, Bucharest, Romania Pharmacy, Bucharest, Romania Ana Maria Vlădăreanu, “Carol Davila” University of Medicine Petrişor Geavlete, “Carol Davila” University of Medicine and and Pharmacy, Bucharest, Romania Pharmacy, Bucharest, Romania Doina Pleşca, “Carol Davila” University of Medicine and Nica Dan Aurel, “Carol Davila” University of Medicine and Pharmacy, Bucharest, Romania Pharmacy, Bucharest, Romania Editorial Members JML_VolumeAssistant Editors Publishing Editors C. Poiana G.D. Petrescu R. Costea P. Radu C.M. Gheorghe E.M. Pahontu Consulting Student Editors G.A. Sterian G.Bobîrnac C. Cazac Editorial Office www.medandlife.ro Print ISSN 1844-122x P.O.Box 35-59, 35 Bucharest, Romania. Phone/Fax: +40 21 318 07 59. E-mail: [email protected] www.medetvie.ro Online ISSN 1844 – 3117 Copyright © 2011 Journal of Medicine and Life, Bucharest, Romania Online ISSN 1844 – 3109 Printed at ''Carol Davila'' University Press, 8 Eroilor Sanitari Blvd., 050474 Bucharest, Romania Typesetting and cover graphic: P. Radu Journal of Medicine and Life Editor-in-Chief: Dafin F. Mureşanu Volume 8 • Special Issue 3• 2015 Founding Editor: Florian Popa

Table of contents

Reviews A review on considerations required to educate new doctors 1 Alavi A, Amjadi N Preventing medication errors in pediatric and neonatal patients 6 Izadpanah F, Haddad Kashani H, Sharif MR Assessment of the relationship between the output of the educational systems and the assumed effective factors in 13 Medical Education written in Data Banks and Ranking of Iran Medical Faculties book Mishmast Nehy GhA Original Articles Nurse-family conflict beyond the walls of Iranian homes who have the mechanical ventilation dependent patient: a 24 qualitative study Moradian ST, Nourozi K, Ebbadi A, Khankeh HR The effect of radiology services outsourcing on patients’ satisfaction in Tehran city hospitals 31 Mousavi H, Khodamoradi F, Rostami Zarinabadi CH, Mozafar Saadati H, Mohammadi M, Mahboubi M, Mousavi N An evaluation of high-risk behaviors among female drug users based on Health Belief Model 36 Ilika F, Jamshidimanesh M, Hoseini M, Saffari, M, Peyravi H Effect of neurofeedback in improving the deaf students’ reading after cochlear implantation 44 Soltani Kouhbanani S, Khosrorad R, Hashemian M, Nasehnezhad M 3_2015_draft The significance of chest ultrasound and chest X-ray in the diagnosis of children clinically suspected of pneumonia 50 Rahmati MB, Ahmadi M, Malekmohamadi, Hasanpur S, Zare SH, Jafari M Comparison of anti-Mullerian hormone level between uterine artery embolizationiss and myomectomy 54 in uterine fibroma Keshavarzi F, Salehi M, Mansouri A Predictors of slow and no-reflow as detected by Thrombolysis in Myocardial Infarction [TIMI] flow grade following 59 Primary Percutaneous Coronary Angioplasty Bahrehmand M, Sadeghi E, Shafiee A, Nozari Y Clinical results of MyoRing implantation in keratoconic eyes by using the Femtosecond laser technology 66 Nasrollahi K, Rezaei L, Ghoreishi M, Kashfi A, Mahboubi M A study of the effect of dexamethasone on lipid profile and enzyme lactate dehydrogenase 72 Arab Dolatabadi A, Mahboubi M Diagnostic accuracy of Cone Beam Computed Tomography, conventional and digital radiographs in 77 detecting interproximal caries 8_special Safi Y, Shamloo Mahmoudi N, Aghdasi MM, Eslami Manouchehri M, Rahimian R, Valizadeh S, Vasegh Z, Azizi Z Comparison of the diagnostic value of CBCT and Digital Panoramic Radiography with surgical findings to 83 determine the proximity of an impacted third mandibular molar to the inferior alveolar nerve canal Saraydar-Baser R, Dehgh ani-Tafti M, Navab-Azam A, Ezoddini-Ardakani F, Nayer S, Safi Y, Shamloo N Correlation between adequate nursing staff and the hospital performance: Case Study in Tehran University of 90 Medical Sciences Hospitals Azari S, Mokhtari S, Aliyari A, Mohammadi M, Afroozi M, Salimi M, Azari GH Protective effect of Jaft against carbendazim induced biochemical changes in male Wistar rats 96 Mirzaei A, Sepehri S, Sadeghi H, Alamdari A The effect of aerobic exercise and electrical stimulation on weight loss and reduction of body fat 101 Sekhavati E, Nikseresht A, Najafian M, Taheri S Importance of client orientation domains in non-clinical quality of care: A household survey in high and 107 JML_Volumelow-income districts of Mashhad Fazaeli S, Yousefi M, Banikazemi SH, Ghazizadeh Hashemi SAH , Khorsand A, Badiee Sh General Articles Evaluation of medical students of teacher-based and student-based teaching methods in 113 Infectious diseases course Ghasemzadeh I, Aghamolaei T, Hosseini-Parandar F Prevalence of Hepatitis C infection in Qeshm Island in 2013-2014, Iran 118 Ghasemzadeh I, Alavi-Nasr A, Khademi M, Kargar Kheirabad A, Gouklani H Relationship between personality traits and mental health among the staff in Kermanshah University of 122 Medical Sciences, 2015 Ziapour A, Kianipour N Relationship between ethical leadership and psychological empowerment: perspectives of hospital nurses 129 in Imam Reza (AS) Kermanshah, 2015 Cheraghi R, Mohammadi M, Mohammadi E, Esfandnia F, Bayat R, Esfandnia N, Esfandnia A A study of the relationship between personality traits and Employee Engagement 134 (A case study of nurses across Kermanshah, Iran in 2015) Ziapour A, Kianipour N Relationship between patient safety and accountability of nurses in Al-Zahra Gilangharb Hospital in 2015 141 Esfandnia F, Mohammadi E, Mohammadi M, Cheraghi R, Esfandnia N, Esfandnia A Evaluation of stress factors among the elderly in the nursing homes for the elderly (Eram and Mother) 146 in Kermanshah, in 2015 Moradi Z, Far Ajallah Bike Nouri M, Mohammadi M, Esfandnia F, Taovsi P, Esfandnia A Assessing the reasons for the choice of dentistry as a career by Iranian dental 151 students: A Questionnaire Survey Hamissi J, Bairami P,Hamissi Z Explaining the relation between self-controlling and child parenting styles and psychological welfare 156 of high school students Sekhavati E, Rahimian Boogar M, Khodadost M, Afkari R, Atefeh Raoufi Priorities of continuing education for general practitioners in Kashan University of Medical Sciences 2013 169 Aghajani M, Jahangir F, Saiedi Majd M, Jahangir N Case Presentations Prevalence of Hepatitis B infection among Qeshm Island population in 2013-2014, Iran3_2015_draft173 Kargar Kheirabad A, Elmira Jokari E, Sajjadi MJ, Gouklani H Relationship between learning styles and interpersonal communication skills of nursing student in Tehran 178 University of Medical Sciences in 2012 iss Azari S, Mokhtari S, Mousavi H, Mohammadi M, Aliyari A, Salimi M, Azari GH Epidemiologic and clinicopathologic evaluation ofpatients with breast cancer referred to Ghaem 184 Hospital from 2005 to 2014 Kadkhodayan S, Homaee Shandiz F Prevalence of HIV infection among Qeshm Island population in 2013-2014, Iran 190 Holakouie N, Kargar Kheirabad A, Sajjadi MJ, Gouklani H Old age satisfaction regarding geriatric home services in Erbil city 195 Sangar MA, Karem FA, Alireza NN, Muaf AK Effect of evidence-based approach on the customer orientation (Case study: Physicians Health Centers in Isfahan 199 province in 2014) Esfahani NG, Maharati Y 8_special Noise pollution effect in flour factory on workers’ hearing in Lamerd City 208 Mohammadizadeh M, Ahmadi SH, Sekhavati E, Ahani-Jegar K Population attributable risk of congenital heart defects. Risk factors among newborns in Yazd, Iran 212 Taheri M, Dehghani A, Noorishadkam M, Tabatabaei SM Special Articles Exploring the religious and spiritual coping experience of patients with cancer: A qualitative study in the Iranian 218 context Esmaeili R, Hesamzadeh A, Bagheri-Nesami M, Berger VL Young researchers area Prevalence of Methylenetetrahydrofolate Reductase C677T Polymorphism in women with Polycystic Ovary 226 Syndrome in southeast of Iran Naghavi A, Mozdarani H, Garshasbi M, Yaghmaei M Phenol degradation by Periodate in combination with Ultrasonic Irradiation 229 Seid-Mohamadi A, Asgari G, Shokoohi R, Adabi S JML_Volume

3_2015_draft iss

8_special

JML_Volume Journal of Medicine and Life Vol. 8, Special Issue 3, 2015, pp.1-5

A review on considerations required to educate new doctors

Alavi A*, Amjadi N** *Fertility and Infertility Research Center, Hormozgan University of Medical Sciences, Bandar Abbas, Iran, **Preventative Gynecology Research Center (PGRC), Shahid Beheshti University of Medical Sciences, Tehran, Iran

Correspondence to: N Amjadi, MD, Preventative Gynecology Research Center (PGRC), Shahid Beheshti University of Medical Sciences, Tehran, Iran, Valiasr Street, District 3, Code 1985717443, Tehran, Iran, Phone: +98-9032302458, E-mail: [email protected]

Received: March 14th, 2015 – Accepted: June 18th, 2015

Abstract The long process of medical education is one of the most crucial parts related to public health. This study was conducted to review the educational alternatives in teaching new physicians. The necessity for a revolution in the medical education is due to the increased number of medical students, constant number of patients, and their expectations, increased workload of professors and increased regulatory agent oversight, fewer clinical experiences occurring for medical students, interns and residents. Newer techniques have become available in improving education. Stimulation has been used before as an educational technique in military training, space programs, aviation industry, sports stimulation, nuclear power industry, teaching anatomy, anesthesiology, and resuscitation training. Physical models (in a skills lab or workshop), computer programs including (over the internet), standard patients, etc., can be used3_2015_draft for this technique. By reviewing the literature, we can conclude that several questions are required to be answered before education. Thus, in order to conduct an accurate program, these questions must be answered, appropriately.

Keywords: medical education, public health, educational issalternatives, physicians

Introduction understanding and recall, symptom resolution, treatment adherence, and patient satisfaction) and decreases Medical training is a long procedure that takes malpractice and medical errors [4,12-14] 1B. Also, fewer four to 12 years of education. It is a collection of lectures, malpractice claims occur after a good communication [15- tutorials, clinical experiences and night shifts and contains 17]. These skills are important parts of practice and are socialization experience, acquiring knowledge, attitudes, carefully evaluated before granting practice license in skills, values and sense of ethics [1-3]. many countries. Relying on few experiences that may or The scope, type, and timing of medical schools may not occur during rotations does not seem to be vary worldwide. Recently, health services8_special of many efficient and may lead to the unpreparedness of the future countries have felt the need to change their educational physicians [18]. system to better prepare future doctors for their role and There are many tasks required to master a provide the highest quality of care to patients and modify procedure; developing cognitive skills to know indications current methods which are known to be dehumanizing, and contraindications, expanding technical expertise, depressing, rigid and abusive [1,4-9]. learning to interpret the results, developing Due to the increased number of medical communicational skills and bedside manners, and how to students, the constant number of patients and their obtain an informed consent [19]. Studies have shown that expectations, and increased regulatory agent oversight, students have high anxiety and low levels of confidence fewer clinical experiences are occurring for medical performing various skills [11,20,21]. students, interns and residents [1,10]. Also, the increased These core skills can be taught to students. workload of professors reduces the opportunity to improve However, there are many challenges that are needed to education. Thus, the current model of “learning by doing” be defeated. The most important problem is the process has to change, especially because it involves real patients of teaching a large number of students in a limited period. [1,11]. Due to the crowded curriculum of medical schools, JML_VolumeEducation focused on specific skills or several medical skills have not received their requiring procedures can increase self-confidence and competence dedicated timing and the relying on current resources has of the students [11]. On the other hand, studies have not efficiently solved this problem. Time shortages on shown that specific skills such as an appropriate both ends (students and educators) are a challenging part communication between patients and their physician of the medical skill education [11,20]. Even among these increases health outcomes (such as patient skills, the personality development (including Journal of Medicine and Life Vol. 8, Special Issue 3, 2015

communicational skills, development of ethics sense, etc.) sports stimulation (such as chess, etc.), and nuclear has been undermined. Performing these skills and power industry are other samples of stimulation mastering them during clinical experiences and patients’ implementation. In medical education, teaching anatomy, exposures are the most often implemented teaching anesthesiology and resuscitation training have used methods. However, due to variable and sometimes, lack stimulation for some time and their experience has proven of supervision [19,22]. to be successful [34-36]. A study conducted by Wickstorm et al. showed Simulation can be conducted by using physical that residents had performed only 15.4 percent of the models (in a skills lab or workshop), computer programs required procedures frequently enough to be confident inclusion (over the internet), standard patients, etc. This during the procedures [23]. Wigton et al. also showed that method offers many benefits. It provides a planned less than half of the residency program directors believed exposure to clinical situations and realistic learning that their residences had mastered basic procedural skills environments. Students can repeat their experiences [24]. Other studies have shown that new residents should many times in a safe and controllable environment learn the procedural skills exactly as medical students. [11,18]. The use of this technique has previously been However, many institutions use their residents to teach proven in military training and for curing psychological these skills to medical students [19]. disorders [36-39]. Learners can practice infrequent clinical The time of the student teaching has never been conditions in a protected environment [40,41]. this brief. However, studies have shown that a short However, the limitation of information regarding course, even a one day course, can significantly increase this method might prevent many organizations from the students’ skills leading to a better health outcome and implementing this technique. a significant increase in the physicians’ job satisfaction Stevens et al. conducted a study to investigate [11,19-21,25]. the usage of virtual patients in teaching clinical and Previous studies have reported a reduced communicational skills to3_2015_draft medical students. They reported clinical experience for medical students and fewer case many problems in understanding the students’ queries encounters [1], which led to a lower proficiency on which can lead to the student becoming exhausted and implementing the required skills [26-28]. Another reason can result in isseducation failure [18]. They concluded that for fewer procedural experiences is that nurses, IV teams, using virtual patients can decrease the expenses phlebotomists and other hospital staff, routinely conduct compared to standardized patients and an endless basic skills [6,19]. Other than fewer clinical experiments repository of clinical scenarios can be made. They added for students, this leads to fewer opportunities for faculty that this method could comply with different educational members and many of them perform each procedure needs and provide a safe educational environment for fewer than ten times per year. Thus, they feel students. Participants of that study recognized the uncomfortable to teach them to the students [29]. In turn, implementation of virtual instructor as a powerful it results in fewer educational positions for the medical educational tool [18]. students since residents might lack the confidence or Meyers et al. conducted a study to investigate rather keep the experience for themselves. The the effects of teaching technical skills to medical students unpreparedness of students creates two other obstacles; during their surgery clerkship. They assigned third year it is unethical to learn the procedures on8_special real and actual students to a three-week program and taught knot tying, patients, and that patients are not willing to let trainees foley catheter and nasogastrial tube placement, suturing, perform procedures on them. Another obstacle can be I.V. placement and arterial puncture. They also used a that students might not be comfortable to perform these self-reported checklist to report their skill before and after tasks on patients [28,30,31]. the intervention. They showed that all skills were better Studies have shown that logging the number of performed after the intervention, however, the increase in procedures can improve proficiency and provide further NG tube insertion and removal were not significant. They opportunities for students to perform procedures [32]. concluded that introducing specific technical skills during Students should be assessed to have a level of clerkship could improve the skills of the students [11]. competence before performing procedures on patients. Stewart et al. conducted a study to determine the This assessment can be conducted by evaluating their outcomes of pre clinical skills course on the proficiency, ability to interpret the results of similar practice, ask the anxiety, and confidence of medical students while indications and contraindications to assess their performing these tasks. The skills included reading knowledge, and finally, conduct the experiment on animal electrocardiograph, abdominal and chest x-rays, obtaining models or stimulated patients [25,33]. bedside chart data and interpretation of them, knot tying, JML_Volume nasogastrial tube insertion and removing, suturing, sterile Stimulation as an educational technique technique, obtaining an informed consent, intravenous Stimulation has been used to teach various skills catheterization and foley catheter placement and removal. before. The first place that used stimulation for education A self-reporting checklist was distributed between the was the military. Also, space programs, aviation industry, participants, before and after intervention. They showed

2 Journal of Medicine and Life Vol. 8, Special Issue 3, 2015

that proficiency and self confidence of students 1. Which skills and procedures should be mastered by significantly increased in all taught areas after the four medical students or residents? hour course [20]. 2. When should they start to learn the procedures and skills? Use of workshops to teach procedural skills 3. Who should teach the procedures and required skills Many medical schools have developed to medical students? workshops that provide experiments [21]. These 4. Which method should be used to teach these skills? workshops are occasionally carried out for pre clinical 5. How many performances are needed for competency? students who are at their third or fourth year of medical 6. What items should be evaluated to see whether they school [42,43]. These centers can provide opportunities in have mastered the skills or not? an organized way and the teachers are not necessarily 7. How should this evaluation be performed? physicians [44]. However, non-physician trainers are The type of skills that are necessary to learn carefully assessed and their competency is certified. should be reassessed in different environments [50]. Before conducting the procedure on patients, students Even though anybody who can teach these skills must pass a relative quiz and perform the experiments on should be welcomed (such as fellow medical students, plastic models. After passing these steps, the student interns, residents, professors, etc.), it is best to train the must execute the procedure on actual patients while students using hospital personnel who are actually being supervised and after successful attempts, students involved with those specific procedures in a daily base; get authorized to perform those tasks [19]. nasogastric tube and urethral catheter insertion and removal can be taught by nurses, placing intravenous Use of standardized patients catheters can be educated by IV teams, arterial punctures Some universities and medical education can be taught by respiratory therapists, laboratory staff organizations use standardized patients to teach their can teach preparing specimens,3_2015_draft and residents and students and increase their clinical experience. This attending can teach more specialized procedures method has its own advantages compared to real [4,11,19,51,52]. However, as mentioned earlier, hospital patients. However, the use of this method is limited due to staff involved in the medical training must be carefully its high expense [18]. assessed andiss certified. McLeod et al. have suggested standards for Use of computer and internet to teach the required teaching educational skills [10,51]: 1. Assessing the skills needs and preparing the student, 2. Clearly performing Due to the rapid advancement of computer the techniques and providing educational commentaries, technology, computer and internet technology are 3. Asking the student to perform the procedure and considered for entering the main stream of health care carefully observing the learner and encouraging education. After the introduction and development of repetition, 4. Providing appropriate feedback, 5. Pointing internet, it has been considered as a powerful source of out the strengths and weaknesses while encouraging the information for many fields, including physicians [11,45]. students, 6. Developing various situations and scenarios Providing an interactive and multimedia experience that for the students to repeat the practice, 7. Understanding stimulates a real patient, lets the learner act as the that each learner’s abilities and characteristics are physician and submit his experience, 8_specialcan be useful to different and are prepared to modify the approach. students, residents and even graduated and licensed Using an appropriate evaluation method is doctors [46]. However, the use of internet to teach skills is crucial to assess student skills. Some studies have limited and is mostly used for CME learning and the suggested self-assessment as a tool for the evaluation of efficacy of teaching medical students and inexperienced the proficiency of students and it is recognized as an learners should be examined [47,48]. essential part of skill building. Especially since students A challenge in using this technology is that they can review and analyze their own skills [4], However, eliminate the non-verbal skills and the student might fail to various studies have shown that it is inefficient and recognize it as a crucial part of the communication [49]. students are prone to overestimate their abilities [52-56]. We reviewed few additional techniques that can Overall, since it allows faculty members to see what the help students and residents achieve competence in students observe and value and thus, provide invaluable required skills. However, it must be kept in mind that none feedback, self assessment is an important tool and must of them is enough and they can only replace very early not be forgotten [4]. stages of clinical education. Further studies are needed to Some studies suggest videotaped encounters evaluate the effects of teaching aids on patient care and with simulated or standard patients along with self- health care costs [44]. reporting tools to increase the precision and accuracy of JML_Volume the assessment [57-62]. Discussion The early introduction of additional methods to medical students can increase the chances of mastering Based on the reviewed literature, a number of the required skills. However, it is needed to carefully questions should be answered prior to clinical education: evaluate the concepts learned by these learning aids and

3 Journal of Medicine and Life Vol. 8, Special Issue 3, 2015

assess whether they are applied on actual clinical Conflicts of interest experiences or not [20,52,63]. The final thing to remember The authors of this article declare that they have is that despite the development of all these methods and no conflicts of interest. techniques, none of them are able to replace the actual clinical experience and all these methods are only Source of funding preparing students to achieve the maximum possible None experience possible [44].

References

1. McManus I, Richards P, Winder B, 13. Stewart MA. Effective physician-patient program directors. Annals of Internal Sproston K, Vincent C. The changing communication and health outcomes: a Medicine. 1989; 111(11):932-8. clinical experience of British medical review. CMAJ: Canadian Medical 25. Norris TE, Cullison SW, Fihn SD. students. The Lancet. 1993; Association Journal. 1995; 152(9):1423. Teaching procedural skills. Journal of 341(8850):941-4. 14. Epstein RM, Hundert EM. Defining and General Internal Medicine. 1997; 2. Makoul G. Contemporary issues in assessing professional competence. 12(s2):64-70. medicine: communication in medicine. Jama. 2002; 287(2):226-35. 26. Wu EH, Elnicki DM, Alper EJ, Bost JE, Association of American Medical Colleges 15. Levinson W. Physician-patient Corbett EC Jr., Fagan MJ et al. Medical school objectives project, Report communication: a key to malpractice Procedural and interpretive skills of III: Contemporary issues in medicine: prevention. Jama. 1994; 272(20):1619-20. medical students: experiences and Communication in medicine Washington, 16. Whang JS, Baker SR, Patel R, Luk L, attitudes of fourth-year students. DC: AAMC. 1999. Castro III A. The causes of medical Academic3_2015_draft medicine: Journal of the 3. Knight JA. Doctor-to-be: Coping with the malpractice suits against radiologists in Association of American Medical trials and triumphs of medical school: the United States. Radiology. 2013; Colleges. 2008; 83(10 Suppl):S63-7. Appleton-Century-Crofts. 1981. 266(2):548-54. 27. Wu EH, Elnicki DM, Alper EJ, Bost JE, 4. Zick A, Granieri M, Makoul G. First-year 17. Riess H, Kraft-Todd G. EMPATHY: a tool Corbett EC Jr., Fagan MJ et al. medical students’ assessment of their to enhance nonverbal communicationiss Procedural and interpretive skills of own communication skills: a video-based, between clinicians and their patients. medical students: experiences and open-ended approach. Patient Education Academic Medicine. 2014; 89(8):1108-12. attitudes of third-year students. Academic and Counseling. 2007; 68(2):161-6. 18. Stevens A, Hernandez J, Johnsen K, medicine: Journal of the Association of 5. Makoul G. Communication skills Dickerson R, Raij A, Harrison C et al. American Medical Colleges. 2006; 81(10 education in medical school and beyond. The use of virtual patients to teach Suppl):S48-51. Jama. 2003; 289(1):93-. medical students history taking and 28. Elnicki DM, Shumway JM, Halbritter 6. Bradley P, Postlethwaite K. Simulation communication skills. The American KA, Morris DK. Interpretive and in clinical learning. Medical Education. Journal of Surgery. 2006; 191(6):806-11. procedural skills of the internal medicine 2003; 37:1-5. 19. Elnicki DM, Fagan MJ. Medical students clerkship: performance and supervision. 7. Feher M, Harris-St John K, Lant A. and procedural skills. The American South Med J. 1996; 89(6):603-8. Blood pressure measurement by junior Journal of Medicine. 2003; 114(4):343-5. 29. Wickstrom GC, Kelley DK, Keyserling hospital doctors-a gap in medical 20. Stewart RA, Hauge LS, Stewart RD, TC, Kolar MM, Dixon JG, Xie SX et al. education?. Health Trends. 1992; Rosen RL, Charnot-Katsikas A, Prinz Confidence of academic general internists 24(2):59-61. 8_specialRA. A CRASH course in procedural skills and family physicians to teach ambulatory 8. Maroof Hassan TH, Ahmed SM, Fraz improves medical students’ self- procedures. Journal of General Internal TR, Rehmat Z. Perceived stress and assessment of proficiency, confidence, Medicine. 2000; 15(6):353-60. stressors among house officers. Indian and anxiety. The American Journal of 30. Hicks CM, Gonzales R, Morton MT, Journal of Occupational and Surgery. 2007; 193(6):771-3. Gibbons RV, Wigton RS, Anderson RJ. Environmental Medicine. 2014; 18(3):145. 21. Fincher R, Lewis LA. Learning, Procedural experience and comfort level 9. Wolf T, Balson P, Faucett J, Randall H. experience, and self-assessment of in internal medicine trainees. Journal of A retrospective study of attitude change competence of third-year medical General Internal Medicine. 2000; during medical education. Medical students in performing bedside 15(10):716-22. Education. 1989; 23(1):19-23. procedures. Academic Medicine. 1994; 31. Chapman DM, Cavanaugh SH. Using 10. Peyre SE, Peyre CG, Sullivan ME, 69(4):291-5. receiver operating characteristic (ROC) Towfigh S. A surgical skills elective can 22. Muller S. Physicians for the twenty-first analysis to establish the previous improve student confidence prior to century: report of the project panel on the experience threshold for critical-procedure internship. Journal of Surgical Research. general professional education of the competency. Academic Medicine. 1996; 2006; 133(1):11-5. physician and college preparation for 71(10):S7-9. 11. Kneebone R. Simulation in surgical medicine. J Med Educ. 1984; 59:1-208. 32. Hunskaar S, Seim S. The effect of a training: educational issues and practical 23. Wickstrom GC, Kolar MM, Keyserling checklist on medical students’ exposures implications. Medical Education. 2003; TC, Kelley DK, Xie SX, Bognar BA et al. to practical skills. Medical education. JML_Volume37(3):267-77. Confidence of graduating internal 1984; 18(6):439-42. 12. Horowitz SD. Evaluation of clinical medicine residents to perform ambulatory 33. Friedlich M, MacRae H, Oandasan I, competencies: basic certification, procedures. Journal of General Internal Tannenbaum D, Batty H, Reznick R et subspecialty certification, and Medicine. 2000; 15(6):361-5. al. Structured assessment of minor recertification. American Journal of 24. Wigton RS, Blank LL, Nicolas JA, Tape surgical skills [SAMSS] for family Physical Medicine & Rehabilitation. 2000; TG. Procedural skills training in internal medicine residents. Academic Medicine. 79(5):478-80. medicine residencies: a survey of 2001; 76(12):1241-6.

4 Journal of Medicine and Life Vol. 8, Special Issue 3, 2015

34. Burch V. Does simulation-based training continuing medical education. Medical 55. Leopold SS, Morgan HD, Kadel NJ, have a future in Africa?. African Journal of Education. 2005; 39(6):561-7. Gardner GC, Schaad DC, Wolf FM. Health Professions Education. 2014; 46. Sklar B. The current status of online Impact of educational intervention on 6(2):117-8. CME. Masters thesis, 2001, University of confidence and competence in the 35. Akaike M, Fukutomi M, Nagamune M, California, San Francisco. http://www. performance of a simple surgical task. Fujimoto A, Tsuji A, Ishida K et al. cmelist. com/mastersthesis/[last checked The Journal of Bone and Joint Surgery Simulation-based medical education in 25 June 2005]. American Volume. 2005; 87(5):1031-7. clinical skills laboratory. The Journal of 47. Richardson ML, Norris TE. On-line 56. Kruger J, Dunning D. Unskilled and Medical Investigation. 2012; 59(1,2):28- delivery of continuing medical education unaware of it: how difficulties in 35. over the World-Wide Web: an on-line recognizing one's own incompetence lead 36. Bradley P. The history of simulation in needs assessment. AJR American to inflated self-assessments. Journal of medical education and possible future Journal of Roentgenology. 1997; Personality and Social Psychology. 1999; directions. Medical Education. 2006; 168(5):1161-4. 77(6):1121-34. 40(3):254-62. 48. Sikorski R, Peters R. Tools for change: 57. Martin D, Regehr G, Hodges B, 37. Hill Jr RW, Gratch J, Marsella S, Rickel CME on the Internet. Jama. 1998; McNaughton N. Using videotaped J, Swartout WR, Traum DR. Virtual 280(11):1013-4. benchmarks to improve the self- Humans in the Mission Rehearsal 49. Haq C, Steele DJ, Marchand L, Seibert assessment ability of family practice Exercise System. KI. 2003; 17(4):5-. C, Brody D. Integrating the art and residents. Academic Medicine. 1998; 38. Bearman M, Cesnik B, Liddell M. science of medical practice: innovations in 73(11):1201-6. Random comparison of ‘virtual teaching medical communication skills. 58. Maguire P, Roe P, Goldberg D, Jones patient’models in the context of teaching Family Medicine-Kansas City. 2004; S, Hyde C, O'Dowd T. The value of clinical communication skills. Medical 36(1;SUPP):S43-S50. feedback in teaching interviewing skills to Education. 2001; 35(9):824-32. 50. Fagan M, Cece R. Using respiratory medical students. Psychological Medicine. 39. Pertaub DP, Slater M, Barker C. An therapists to teach arterial puncture for 1978; 8(04):695-704. experiment on public speaking anxiety in blood gas procedures to third-year 59. Hays RB. Self‐evaluation of videotaped response to three different types of virtual medical students. Academic Medicine. consultations. Teaching and Learning in audience. Presence: Teleoperators and 1999; 74(5):594-5. Medicine: An International Journal. 1990; virtual environments. 2002; 11(1):68-78. 51. McLeod PJ, Steinert Y, Trudel J, 2(4):232-6.3_2015_draft 40. Nuzhat A, Salem RO, Al Shehri FN, Al Gottesman R. Seven principles for 60. O'Meara P, Munro G, Williams B, Hamdan N. Role and challenges of teaching procedural and technical skills. Cooper S, Bogossian F, Ross L et al. simulation in undergraduate curriculum. Academic medicine: Journal of the Developing situation awareness amongst Medical teacher. 2014; 36(sup1):S69- Association of American Medicaliss nursing and paramedicine students S73. Colleges. 2001; 76(10):1080-. utilizing eye tracking technology and video 41. Colliver JA. Educational Theory and 52. Barrett SV, Zapka JG, Mazor KM, debriefing techniques: A proof of concept Medical Education Practice: A Cautionary Luckmann RS. Assessing Third‐year paper. International Emergency Nursing. Note for Medical School Faculty. Medical Students' Breast Cancer 2015; 23(2):94-9. Academic Medicine. 2002; 77(12, Part Screening Skills. Academic Medicine. 61. Mičetić Turk D. Communication teaching 1):1217-20. 2002; 77(9):905-10. in medical education. Slovenian Medical 42. Powers LR, Draeger SK. Using 53. Kim YM, Figueroa ME, Martin A, Silva Journal. 2013; 82(3). workshops to teach residents primary R, Acosta SF, Hurtado M et al. Impact of 62. Spandorfer J, Puklus T, Rose V, Vahedi care procedures. Academic Medicine. supervision and self-assessment on M, Collins L, Giordano C et al. Peer 1992; 67(11):743-5. doctor–patient communication in rural assessment among first year medical 43. Taylor L, Vergidis D, Lovasik A, Mexico. International Journal for Quality in students in anatomy. Anatomical Crockford P. A skills programme for Health Care. 2002; 14(5):359-67. Sciences Education. 2014; 7(2):144-52. preclinical medical students. Medical 54. Barnsley L, Lyon PM, Ralston SJ, 63. Sammann A, Tendick F, Ward D, Zaid education. 1992; 26(6):448-53. 8_specialHibbert EJ, Cunningham I, Gordon FC H, O’Sullivan P, Ascher N. A surgical 44. Bradley P, Bligh J. Clinical skills centres: et al. Clinical skills in junior medical skills elective to expose preclinical where are we going?. Medical Education. officers: a comparison of self-reported medical students to surgery. Journal of 2005; 39(7):649-50. confidence and observed competence. Surgical Research. 2007; 142(2):287-94. 45. Curran VR, Fleet L. A review of Med Educ. 2004; 38(4):358-67. evaluation outcomes of web‐based

JML_Volume

5 Journal of Medicine and Life Vol. 8, Special Issue 3, 2015, pp.6-12

Preventing medication errors in pediatric and neonatal patients

Izadpanah F*, Haddad Kashani H**, Sharif MR*** *Food and Drug Laboratory Research Center, Food and Drug Organization, Ministry of Health and Medical Education, Tehran, Iran, **Anatomical Sciences Research Center, Kashan University of Medical Sciences, Kashan, Iran, ***Department of Pediatrics, Kashan University of Medical Sciences, Kashan, Iran

Correspondence to: Mohammad Reza Sharif, MD, Department of Pediatrics, Kashan University of Medical Sciences, Kashan, Iran, Kashan, Isfahan, Iran, Mobile phone: +98 935 56 555, E-mail: [email protected]

Received: March 14th, 2015 – Accepted: June 18th, 2015

Abstract Medication errors are the most common that occur in hospital settings. Various factors make the pediatric population more susceptible to medication errors and potential complications resulting from medication administration. These include the availability of different dosage forms of the same medication, incorrect dosing, lack of standardized dosing regimen, and organ system maturity. Electronic databases such as MEDLINE, EMBASE, International Pharmaceutical Abstracts, ASSIA, PsycINFO, British Nursing Index, CINAHL, were searched between 1985 and December 2014. Study Selection Inclusion and exclusion criteria were applied to identify the eligible publications through title analysis followed by abstract and then full text examination3_2015_draft .Medication errors were most often reported in pediatric and neonatal patients. This was in consensus with literature data regarding the occurrences in other specialties. Fatal or life-threatening harm due to medication errors was not often reported. However, most studies reported that the potential for the patient’s impairment as a result of an error was a significant problem. Investigation of types and level of medication errors may lead to steps towards the prevention of these errors and the improvementiss in the quality of neonatal care and safety.

Keywords: Medication errors, pediatric and neonatal patients, fatal

Introduction errors. The medication stages process include ordering/ prescribing, transcribing/ verifying, dispensing/ delivering Medication errors are defined as any avoidable and administering; pediatric medication errors could occur event that may harm the patient as a result of at each stage of the process [5]. Nursing Interventions professionals or patients and potentially more dangerous Classification (NIC) define Medication administration as in the pediatric population than in the mature population preparing, giving and evaluating effectiveness of [1]. These errors may be related to professional8_special practice prescription and nonprescription medications [6]. A or to health care procedures or systems, including medication error is any preventable event that may lead to prescription failures, drug naming, preparation, patient impairment while the medication is in control of the dispensing, distribution, delivery, education, follow-up, health care professional or patients [4]. An adverse drug and use. Medication errors may or may not result in an event is a harm that appears as a consequence of a adverse effect; many errors do not cause damage or medication or of the lack of an intended medication [3]. It injury, but indicate a low level of safety in health should be noted that not all medication errors cause an assistance [2]. Deliberation of different literature sources adverse drug event. As previously mentioned, medication extended to which medication errors contribute to patient errors happen more commonly in the pediatric inpatient morbidity and mortality in the pediatric population, as and neonate population than in the mature population. much of the research has examined the adult population Studies indicated that medication errors in pediatrics were [3]. According to the National Coordinating Council for three times higher than in mature populations [7]. Medication Errors Reporting and Prevention no incidence According to the findings of Antonow, out of 200 rate for medication errors are acceptable, and for the consecutive prescribing errors in a medical care hospital, prevention of medication errors in health care systems it 69.5% were pediatric patients [5]. A different range of JML_Volumeshould be to constantly improve [4]. Therefore, to factors that could lead pediatric population more sensitive decrease medication errors and progress in patient to medication errors, and possible difficulties resulting welfare through safe medication practices, interventions from medication administration were also highlighted. are necessary. It is a vital part of innocuous patient care, Different dosage forms of the same medication are one of especially in the neonatal population avoiding medication the main reasons for potential error. Many medications for Journal of Medicine and Life Vol. 8, Special Issue 3, 2015

children are produced in different liquid concentrations, safer health system” states that 44,000 to 98,000 and multiple medication formulations may lead to dosing hospitalized Americans die each year from medical errors errors [8]. Improper dosing is the most commonly reported [10]. This landmark report galvanized professional, medication error in pediatrics [9]. One reason for the political and social forces into action. For adults, the mentioned problem is limited standardized dosing reported incidence of errors in treatment with medication regimens for children as compared to adults. ranges from 1-30% of all hospitalized admissions [10] or Furthermore, most pediatric medication dosing is based 5% of orders written. In pediatrics however, this number upon body weight, which requires a dosage calculation, has been reported as high as 1 in 6.4 orders [10]. Also and can lead to an error. This is believed to be the reason there is a significantly increased rate of medication error why children are at a greater risk for adverse drug events. resulting in harm or death in pediatric patients [11]. Drug Children vary in weight, body surface area, and organ errors associated with morbidity and mortality increased system maturity; all of which affect their ability to inpatient healthcare cost by an estimated $ 4700 per metabolize and excrete medications [9]. Moreover, hospital admission or approximately $2.8 million annually children are often unable to adequately communicate for a 700-bedded teaching hospital [12]. The economic when they are experiencing an adverse effect and have a burden for all areas of healthcare from drug limited internal physiologic capacity to buffer medication misadventures exceeds $100 billion annually in the United errors in comparison with adults [8]. Because literature States. The data regarding the incidence and economic suggests that medication errors occur more frequently impact of medication errors is lacking in the developing and are more concerning in the pediatric population, a world [13]. systematic review of medication administration errors and the pediatric population is warranted. The goal of the Classification of medication errors: systematic review is to search for practice-based articles, Medication errors3_2015_draft based on many classifications systematic reviews, and/ or research articles on according to different categories: medication errors in the inpatient pediatric population, A) Based on stage: ordering (unambiguous prescription: including frequency of occurrence, types of administration omission of drug name; drug formulation; route; dose; errors that occur and possible causes of medication errors iss in this age group. The purpose of the current review is the dosing regimen; date; signature; time), Transcription (an assessment of medication and nursing literature related to identical copy of the prescription in the medical record: medication administration errors in the pediatric and discrepancy in drug name; drug formulation; route; dose; neonatal patients. dosing regimen; omission of drug; unordered drug), dispensing medication is concordant with prescribed drug Methods for Review in nurse medication chart (Unordered drug (wrong drug); unordered dose; omission of dose; wrong dose; wrong Electronic databases; MEDLINE, EMBASE, drug formulation) administering the right medication to the International Pharmaceutical Abstracts, ASSIA, right patient in the right way and at the right time, PsycINFO, British Nursing Index, CINAHL data bases discharge summaries, Eligible prescriptions in medical were reviewed for articles published between8_special 1985 to record are identical to prescriptions in discharge December 2014. MeSH terms used initially for the summaries (Discrepancy in: drug name; drug formulation; systematic review were “medication errors” and the route; dose; regime; omission of drug; unordered drug). search was limited to English-language publications in B) Based on the onset: active which have an immediate nursing journals that were specific to the pediatric population. The rationale behind limiting the search to effect like what happens if you give the patient adrenaline nursing journals was that nurses are often the ones who instead of furosemide for blood transfusion and he administer medications, so it was believed that this would develops hypertension, tachycardia, latent error has a capture all articles related to medication errors that delayed effect and can be prevented before it recurs. For occurred during administration. The titles and abstracts example, if the pharmacist misread the prescription were reviewed for every article, and articles were omitted because it was poorly written, the prevention of the if they did not relate to medication safety, including recurrence of this type of error is to analyze future medication administration or medication errors, or if they prescriptions more carefully and verify the medication. did not pertain to administration of medication. C) Based on severity: Potentially serious errors that can JML_Volume cause permanent harm to patients and may increase Results hospitalization or the need for additional treatment like an overdose of potassium chloride in total parenteral Medical errors have become a major issue nutrition; clinically significant errors can increase the need among healthcare consumers in recent years. The 1999 Institute of Medicine report “To Error is Human: Building a for patient monitoring e.g. Tazobactam 4 gm twice daily to a septic obese patient; clinically non-significant error that 7 7 Journal of Medicine and Life Vol. 8, Special Issue 3, 2015

does not harm the patient, Pantoprazole IV in a patient administration. The dispensing of prescription medications who can swallow. at the pharmacy can have various errors. The wrong D) Based on medication error index: Circumstances or medication can be given, particularly when medications events that have the capacity to cause error, an error are named or packaged similarly. There are particular occurred but the medication did not reach the patient, an drugs that are known to have problems because their error occurred that reached the patient but did not cause names are very similar. The pharmacy can also give out harm to the patient, an error occurred that resulted in the the wrong dosage of the drug in some cases. Most need for increased patient monitoring, but no patient studies of medication errors only analyzed hospital harm, an error occurred that resulted in the need for medication usage, and there is a large volume of treatment or intervention and caused temporary harm to medications prescribed in the doctor’s offices and the patient, an error occurred that resulted in initial or dispensed by pharmacies [10]. There were nearly 2.5 prolonged hospitalization and caused temporary harm to billion prescriptions dispensed by pharmacies in 1998 in the patient, an error occurred that resulted in permanent the USA compared to an estimated 3.75 billion drug harm to the patient, an error occurred that resulted in administrations in hospitals. Errors in prescription and near-death event, and an error occurred that resulted in dispensing are known but difficult to quantify. For patient death [14,15]. example, the IOM report cites an Australian study for 1988-1996, which found that 2.4 to 3.6 percent of hospital Predisposing factors for medication errors admissions were due to medication events, of which 32 to Related statistics show that of the 25000 69% were preventable. The medications causing most medication error reports received by the FDA, 12.5% of problems were cytotoxics, cardiovascular drugs, the errors are related to names [11]. Furthermore, a antihypertensives, anticoagulants, and NSAIDs. recent FDA study of 400 deaths caused by medication [Huntley’s]. Children are not merely small adults; they errors found that 5% of deaths were attributed to have different pharmacokinetics3_2015_draft and pharmacodynamics, proprietary name confusion and 4% to generic name even among their population they vary according to their confusion [14]. It is reasonable to extrapolate these age groups which are classified as: preterm newborn statistics to predict that the incidence of medication errors infants < 37 weeks’iss gestation, term newborn infants 0–27 in Canada are similar to those of the U.S., especially days infants and toddlers 28 days to 23 months; children since many sponsors strive for global consistency in the 2–11 years, adolescents 12–16 or 18 years, vary branding of their products. Errors may also occur due to according to the region [3]. Children have an improper selection of administration devices [improper unpredictable oral absorption, week painful muscular selection of insulin syringes]. In general, the Institute of absorption, large surface area for skin absorption Safe Medicine Practices (ISMP) identifies the following increasing risk of toxicity, relatively impaired renal areas as potential causes of medication errors: failure in excretion, minimum liver capacity for drug metabolism; all communication [hand writing and oral communication], these lead to making drug handling most serious. Dosage drugs with similar names, missing or misplaced zero and adjustment according to age is a quick and safe method decimal points, use of non-standard abbreviations, poor for a drug with a wide therapeutic range like artesunate drug distribution practices, complex or 8_specialpoorly designed and some antibiotic to be given, however, not all children technology, access to drugs by non-pharmacy personnel, have the optimum weight for age, so weight based work place environmental problem that leads to an calculation is more perfect, some drugs being adjusted by increased job stress, dose miscalculations, lack of patient a different weight for each age groups, surface area information, and lack of patient understanding of their based dose is preserved for serious drugs (cytotoxic therapy [14]. drugs) taking into consideration the cardiac output, renal function, body fluid status, and child health. The majority Methods to detect medication errors of pediatrics medications do not result in harm. Blum et al. Several methods are employed to detect the [16] reported that only 0.2% of the errors could be occurrence of medication errors: Anonymous self-reports classified as potentially lethal, whereas Folli et al. [17] which were reported by the person himself or a witness, reported 5.6% as potentially lethal. Interestingly, no actual they have low cost but need realization; Incident reports - harm was reported to children in most of the a legal report documented by the hospital staff, critical epidemiological studies. This might be because the errors incident technique that involves an in-depth analysis of a were identified and rectified before any harm resulted, but large number of individual errors to identify common it could be due to the publication bias; some healthcare JML_Volumecausal factors, and direct observation of subjects or providers may be reluctant to publishing studies that interviewing people who have committed the error, report patients with serious harm. Cousins et al. [18] disguised-observation technique when the observer conducted an analysis of press reports highlighting the accompanies the person giving the medications and outcomes of 24 cases of pediatric medication errors. Most witnesses the administration of each dose, dispensing of the cases reported resulted in fatal consequences, error detection techniques detect the preparation before hence making the news headlines.

8 8 Journal of Medicine and Life Vol. 8, Special Issue 3, 2015

Types of error and undisguised, which may explain the vast differences The most common type of pediatric medication in observed medication administration error rates [10]. errors is dosing errors, especially the tenfold error. The Another study surveyed nurses and found that 40.3% of other pediatric medication errors that have been reported the respondents indicated they had observed a in the literature, include the following: wrong drug, wrong medication error in at least one stage of the process route of administration, wrong transcription or during the previous week [5]. While it would be ideal to documentation, incorrect or missing date, wrong give an exact incidence rate for medication administration frequency of administration, missed dose, wrong patient, errors in the inpatient pediatric population, that is difficult drugs given to patients with known allergies, drug due to differences in reporting. It was shown that some interaction, intravenous incompatibility, omission errors, incidence rates are reported per 100 admissions, per wrong rate of intravenous drug administration [19,20]. 1000 patient days, and even as percentages of total administrations. Incidence Rate of Medication Errors Many differences were found with regard to the Medication Error Reporting way the articles were obtained and reported the incidence One study found that pediatric nurses estimated rate of medication errors. Holdsworth and colleagues that only 67% of medication errors on their patient care designed a study to determine the incidence and causes units are actually reported [21]. This study asked for of ADEs and potential ADEs in hospitalized children, and reasons as to why medication errors were underreported, examined the consequences of those events. The and both individual/ personal and management-related reported ADE frequency was 6 per 100 admissions, and reasons were selected by the participants, suggesting the 7.5 per 1000 patient-days; the reported potential ADE need to develop a unit/ hospital culture supportive of error frequency was 8 per every 100 admissions, and 9.3 per reporting [21]. Another study compared survey results 1000 patient-days. Of the ADEs that occurred in this with written incident reports3_2015_draft and found that of the 89 study, 24% were judged to be serious or life threatening medication errors observed by the nurses, the [3]. Stratton and colleagues surveyed a convenience respondents indicated that only 17 of the medication sample of pediatric and adult hospital nurses regarding errors resultediss in completion of an incident report [5]. It their perceptions of the proportion of medication errors was also found that the likelihood of preventing a reported on their units [21]. The medication errors rates medication error from reaching the patient declined in the they found per 1000 patient-days were 14.8 on the later stages of the medication process as previously pediatric unit as compared to 5.66 on the adult unit. This mentioned, the likelihood of a formal written incident is higher than the results found by Holdsworth et al., and report increased in the later stages of the medication may be explained by the differences in their study design process [5]. It was found that out of the medication errors including their sampling method [3]. Ghaleb and that were not prevented and actually reached the patient, colleagues [10] conducted a systematic review that just 38% of the medication errors that occurred during the examined the incidence rate of medication errors and ordering/ prescribing phase were reported, 36% of the categorized their results according to whether the medication errors that occurred during the transcription/ incidence rate was obtained from chart review studies, verification phase were reported, 47% of the medication spontaneous reporting studies or observation8_special studies. Of errors that occurred during the dispensing/ delivery phase the three studies included that were obtained via chart were reported, and 65% of the medication errors that review that were specific to medication administration occurred during the administration phase were reported errors, the incidence rates were 0.15% doses [5]. A study by Ferranti and colleagues compared a administered were errant and 23.5% administration error voluntary safety reporting system and a computerized rate [10]. The third study reviewed found that 3.9% of the ADE surveillance system with regards to frequency of 10% of patients subjected to errors were subjected to rates of ADEs [22]. It was found that the incidence of medication administration errors [10]. Differences in study ADEs was comparable with an overall rate of 1.8 ADEs designs and reporting method makes it difficult to interpret per 1000 patient days with the voluntary reporting and 1.6 and compare the information obtained by Ghaleb et al., ADEs per 1000 patient days with the computerized which they also found to be true and discussed in their system. While the incidence of ADEs was not statistically review [10]. Of the two medication administration error significant between the two systems, the researchers studies included by that were obtained via spontaneous found that the voluntary system provided greater insight reporting, the incidence rates were 14.7 incidents per 100 into system failures, such as drug omission, admissions and 13.4 incidents per 1000 patient days [10]. administration errors, and lapses in clinical monitoring. JML_VolumeEight studies that used observation to detect drug These types of errors are not easily detected by administration errors were also included. The observation automated techniques, emphasizing the need for an studies found that reported drug administration error rates approach that incorporates the strengths of each method varied between 0.6% and 27% of administrations. This so that the detection of ADEs in the pediatric population included studies in which the observation was disguised can be maximized. A review of the literature suggested

9 9 Journal of Medicine and Life Vol. 8, Special Issue 3, 2015

that attention should be placed on “near miss” medication this study to examine the steps in the process required errors [23]. A near miss is an event that did not cause leaving a paper trail. The next year, Khaushal found that harm to a patient, but had the potential to cause harm. medication errors are common in pediatric inpatient Near misses have a high likelihood of happening again if settings, and further efforts are needed to reduce them, they are not reported, and if the cause of the near miss is the rate of potential ADEs was significantly higher in not corrected. It is suggested that near miss medication neonates in the neonatal intensive care unit. Most errors are reported in the same manner as medication potential ADEs occurred at the stage of drug ordering errors [23]. A culture of change is needed with regard to (79%) and involved incorrect dosing (34%), anti-infective reporting systems for medication errors [24]. Reporting drugs (28%), and intravenous medications (54%). systems need to be non-punitive so that individuals feel Physician reviewers judged that computerized physician comfortable reporting medication errors. Additionally, an order entry could potentially have prevented 93% and analysis of each reported error and potential errors needs ward-based clinical pharmacists 94% of potential ADEs. to occur so that the underlying cause of the error within The study was a prospective one done on a cohort, as the context of the entire system can be altered [24]. To mentioned by Kaushal et al., in 2001. The emergency summarize, this theme found that medication errors tend rooms present a high risk for errors and need a quick and to be under-reported, often due to fear of punishment. It right decision. At the same time, this may need expert was also found that voluntary reporting provided greater opinion. Keron et al., found this in 2002, and stated that in insight into system failures that lead to the error. the pediatric ED, trainees are more likely to commit Additionally, it is recommended that near misses are prescribing errors, and the most seriously ill patients are reported [24]. more likely to be subjected to prescribing errors. He found that prescribing errors were identified in 10.1% of the Interventions to prevent medication errors in children charts. The following variables were associated in During the last few years, professional unvaried analyses with an3_2015_draft increased proportion of errors: organizations, government, and researchers have patients seen between 4 AM and 8 AM (odds ratio (OR): published many different guidelines and 2.45; 95% confidence interval (CI): 1.10 –5.50), patients recommendations on prevention of medication errors. The with severe issdisease (OR: 2.53; 95% CI: 1.18 –5.41), following is a Summary of some important suggestions medication ordered by a trainee [OR: 1.48; 95% CI: 1.03– produced by the American Academy of Pediatrics 2.11], and patients seen during weekends [OR: 1.48; 95% Committee on Drugs and Committee on Hospital Cares, CI: 1.04 –2.11]. There was a higher rate of errors at the Institute for Safe Medication Practices and the Pediatric beginning of the academic year among trainees [OR: Pharmacy Advocacy Group [25-27]. Prescribers should 1.67; 95% CI: 1.06 –2.64). The logistic regression be familiar with the pediatric patients and their revealed an increased risk for errors when a medication medications, checking drug allergies, interactions and was ordered by a trainee [OR: 1.64; 95% CI: 1.06 –2.52 contraindications and note these on the drug chart, (and in seriously ill patients [OR: 1.55; 95% CI: 1.06 – confirming that the patient’s weight is correct and write the 2.26] it was a retrospective cohort study, which might weight on each drug chart; write legible prescriptions, not have preserved time, but it was only in summer, and this exceeding the recommended adult dose, calculation might have underestimated the errors because of the double checking by other staff is recommended,8_special checking small proportion of hospital admission, adding to the fact the drug, dose and patient identity before administration, that the retrospective design could not detect many errors unusual volumes or dosages verification, communication in drug administration. The other factors that could with patient and caregiver. An adequate number of influence the medication error rate, such as the interaction qualified staff and a suitable work environment for safe between parents, patients, nurses, aides, noise, and and effective use of medicines should be provided. concurrent events in the ED, were not analyzed because Equipment [e.g. infusion pump] and measurement they were not documented on the chart and could not be systems should be standardized to remove much of the measured accurately. Therefore, it only focused on risks of calculation errors as well as reduce the time prescribing errors and reducing prescribing errors; required for dose calculation. Barriers to medication error hospitals should train junior doctors regarding the reporting should be eliminated; hospitals should develop principles of drug dosing before they start prescribing, and and maintain a process to inform families of errors and enforce good practice in documentation. They should also send feedback information to staff. Children are more create a culture in which prescription writing is seen as vulnerable to medication errors than adults, but up to important, and formally review interventions made by date, there have been a few studies in this area. One of pharmacists, locum arrangements, and the workload of JML_Volumethe earliest studies was to determine the prevalence of junior doctors, and make doctors aware of situations in errors in the medication system of a pediatric teaching which they are likely to commit errors [28]. The problem of hospital, and to provide direction to efforts to error-proof prescribing drugs to a child is represented by the need of the system as a long-term goal, but the sample size was an accurate dosage adjustment, the younger the child, the too small to allow a further parceling; the methods used in most difficult the adjustment; that was evidenced by

10 Journal of Medicine and Life Vol. 8, Special Issue 3, 2015

Chappell and Newman. They found that one third of the reduction in the proportion of MEs and an improvement in intravenous drug prescriptions on a neonatal unit were for the overall patient outcome score (if intercepted errors doses of less than one tenth of a single drug vial [29]. were included). Moderate and major errors, however, Tenfold drug errors in prescribing are well documented remained a significant concern with COPE. It was the first and with the continued use of vials containing adult size to compare COPE and HWP in the ICU. It was doses, great potential exists for serious administration recommended that COPE was associated with a reduced errors. Another one was in the outpatient, finding that proportion of MEs compared with HWP and this lowered potential medication dosing errors frequently occur in over time. When intercepted and non-intercepted errors outpatient pediatrics. Studies on the clinical impact of were combined, COPE was associated with an these potential errors and effective error prevention improvement in the error outcome scoring compared to strategies are needed. From 3 health maintenance HWP; however, the three intercepted errors that could organizations, he found that approximately 15% of the have caused permanent harm or death, all occurred with children were dispensed a medication with a potential COPE. The introduction of COPE without a decision dosing error: 8% were potential overdoses and 7% were support eliminated many minor types of error but potential under doses. Among children weighing <35 kg, introduced new types of errors that might be more only 67% of the doses were dispensed within the serious. The safe prescription of medications to recommended dosing ranges, and more than 1% were hospitalized children requires additional specific dispensed at more than twice the recommended safeguards that are above and beyond those for adult maximum dose. Analgesics were most likely to be patients. potentially overdosed (15%), antiepileptic were most likely potentially under dosed (20%). Potential error rates were not lower at the site with an electronic prescription writer. Conclusion However, prescribing errors can be preventable; the 3_2015_draft Medication administration errors are a serious Common prescribing problems documented during chart concern for the pediatric population. This paper presented review including the areas of allergy documentation, an overview of medication errors and safe medication unsafe discontinuing, and alteration of prescriptions, administrationiss practices. Additional information regarding unclear writing, and signing of prescriptions. Drug the pediatric population and specific factors that make this administration was observed. The risk areas identified population susceptible to medication errors, were included failure to follow double-checking and patient presented. Errors in dosage were found as a common identity checking procedures, poor administration reason to why medication errors occur. There was a technique in the areas of inhaled/ nebulised therapy, IV discrepancy with regard to medication error reporting, as drugs and oral/ gastrostomy drugs and poor it was found that medication errors are underreported but documentation. The study was undergone in summer, on the extent of them varied. Systems used to report one hospital with a small sample size and the use of medication errors also varied. It was found that the more undisguised observational technique of drug the information reported on the medication error was administration. This may have potential effects on the detailed, the more it had a potential impact on leading to a behavior of the staff [30]. The physician may have a good system change to prevent such errors from occurring plan and calculate his dose accurately,8_special but nobody can again. It was recommended that reporting systems were read that, so using the computerized order, might help in non-punitive so that nurses were not afraid to report preventing errors covered by Khowaj et al. In Pakistan errors. Additionally, more emphasis should be placed on they found an error rate of 5.5 with 100% compliance of “near miss” medication errors, as these occur frequently computerized physician order entry, however, there was a but are rarely reported and may provide a greater insight delay in medicine delivery, they categorized the errors into system flaws. Lastly, interventions were found to according to the medical job, but there was no reduce medication administration errors, and were comparison between COPE an hand writing [31]. A near congruent with current recommendations for safe study, more interested in the ICU in a London teaching medication administration. hospital’s introduction of COPE, was associated with a

References

JML_Volume 1. The Joint Commission. Preventing 3. Holdsworth M, Fichtl R, Behta M, Raisch 4. National Coordinating Council for pediatric medication errors. Sentinel D, Mendez-Rico E, Adams A, Greifer M, Medication Error Reporting and Event Alert. May 4, 2009; 39. Bostwick S, Greenwald B. Incidence and Prevention .March 29, 2009; 2. Bestpractice. Strategies to reduce impact of adverse drug events in pediatric http://www.nccmerp.org. medication errors. Journal. 2005; 9, 4, 1- inpatients. Archives of Pediatrics and 5. Antonow J, Smith A, Silver M. Medication 6. Adolescent Medicine. 2003; 157, 60-65. error reporting: A survey of nursing staff.

11 Journal of Medicine and Life Vol. 8, Special Issue 3, 2015

Journal of Nursing Care Quality. 14. Kumar A, Chhetr K. Introduction to care. Journal of Perinatal and Neonatal 2000;15(1), 42-48. Medication Errors and the Error Nurses. 2002; 16(2), 73-84. 6. Bulecheck G, Butcher H, Dochterman J. Prevention Initiatives in a Teaching 24. Cadwell S. Pediatric medication safety in Nursing Interventions Classification (NIC). Hospital in Western Nepal. Pak. J. Pharm. the emergency department. Journal of 5th ed., 2008, St. Louis: Mosby/ Elsevier. Sci. 2006; 19 (3), 244-251. Emergency Nursing. 2008; 34(4), 375- 7. Ferranti J, Horvath M, Cozart H, 15. Otero P, Leyton A, Mariani G, Ceriani J. 377. Whitehurst J, Eckstrand J. Reevaluating Medication errors in pediatric inpatients: 25. Kozer, Scolnik, Macpherson, Keays, Shi the safety profile of pediatrics: A Prevalence and results of a prevention K, Luk, Koren. Variables Associated With comparison of computerized adverse drug program. Pediatrics. 2008; 22(3), 737- Medication Errors In Pediatric Emergency even surveillance and voluntary reporting 743. Medicine. Pediatrics. 2002; 737-742. in the pediatric environment. Pediatrics. 16. Blum KV, Abel SR, Urbanski CJ, Pierce 26. Levine SR, Cohen MR, Blanchard NR, 2008; 121(5), 1201-1207. JM. Medication error prevention by Federico NR, Magelli F et al. Guidelines 8. Payne C, Smith C, Newkirk L, Hicks R. pharmacists. American Journal of Hospital for preventing medication errors in Pediatric medication errors in the post Pharmacy. 1998; 45, 1902, 1903. paediatrics. J. Paediatr. Pharmacol. Ther. anesthesia care unit: Analysis of 17. Folli HL, Poole RL, Benitz WE, Russo JC. 2001; 6: 426-442. MEDMARX data. AORN Journal. 2007; Medication error prevention by clinical 27. Stucky ER. American Academy of 85(4), 731-740. pharmacists in two Children’s Hospitals. Paediatrics Committee, American 9. American Academy of Pediatrics. Pediatrics. 1987; 79, 718-722. Academy of Paediatrics Committee on Prevention of medication errors in the 18. Cousins D. Medication Errors in a Hospital Care. Prevention of medication pediatric inpatient setting. Pediatrics. Children’s Hospital. Paediatric and errors in the paediatric inpatient setting. 2003; 112, 431-436. Perinatal Drug Therapy. 2007; 18-25. Pediatrics. 2003; 112: 431-436. 10. Ghaleb M, Barber N, Franklin B, Yeung V, 19. Zeleke A, Chanie T, Woldie M. Medication 28. Dean B, Schachter M, Vincent C, Barber Khaki Z, Wong I. Systematic review of prescribing errors and associated factors N. Causes of prescribing errors in hospital medication errors in pediatric patients. at the pediatric wards of Dessie Referral inpatients: a prospective study. Lancet. The Annals of Pharmacotherapy. 2006; Hospital, Northeast Ethiopia. International 2002; 20; 359(9315):1373-8. 40, 1766-1776. Archives of Medicine. 2014; 7:18. 29. Chappell K, Newman C. Potential tenfold 11. Marino B. Prevalence of Errors in a 20. Honey BL, Bray WM, Gomez MR, drug overdoses on a neonatal unit. Arch Pediatric Hospital Medication System: Condren M. Frequency of Prescribing Dis3_2015_draft Child Fetal Neonatal Ed. 2004; Implications For Error Proofing. July/ Errors by Medical Residents in Various 89(6):F483-4. September 2000; 4(3), Lippincott Williams Training Programs. J Patient Saf. 2014; 8. 30. Conroy S, Appleby K, Bostock D, & Wilkins Inc., 129-135. 21. Stratton K, Blegen M, Pepper G, Vaughn Unsworth V, Cousins D. Medication Errors 12. Crowley E, Williams R, Cousins D. T. Reporting of medication errorsiss by in a Children’s Hospital, Pediatric and Medication errors in children: a descriptive pediatric nurses. Journal of Pediatric Perinatal Drug Therapy. 2007; 8 (1). summary of medication error reports Nursing, 2004; 19(6), 385-392. 31. Khowaja K, Nizar R, Merchant RJ, Dias J, submitted to the United States 22. Ferranti J, Horvath M, Cozart H, Bustamante-Gavino I, Malik A. A Pharmacopeia. Curr Ther Res. 2001; 26: Whitehurst J, Eckstrand J. Reevaluating systematic approach of tracking and 627–640. the safety profile of pediatrics: A reporting medication errors at a tertiary 13. Kaushal R, Bates DW, Landrigan C, comparison of computerized adverse drug care university hospital, Karachi, McKenna KJ, Clapp MD, Federico F, even surveillance and voluntary reporting Pakistan. Ther Clin Risk Manag. 2008; Goldmann DA. Medication errors and in the pediatric environment. Pediatrics. 4(4): 673–679. adverse drug events in pediatric 2008; 121(5), 1201-1207. inpatients. JAMA. 2001; 285(16): 2114- 23. Lefrak L. Moving towards safer practice: 2120. Reducing medication errors in neonatal

8_special

JML_Volume

12 Journal of Medicine and Life Vol. 8, Special Issue 3, 2015, pp.13-23

Assessment of the relationship between the output of the educational systems and the assumed effective factors in Medical Education written in Data Banks and Ranking of Iran Medical Faculties book

Mishmast Nehy GhA Department of Physiology, School of Medicine, Zahedan University of Medical Sciences. Zahedan, IR, Iran

Correspondence To: Ghasem Ali Mishmast Nehy, Ph.D., Faculty Member of School of Medicine, Zahedan University of Medical Sciences, Pardis Complex, Zahedan, IR, Iran, Hesabi Sq., P.O. Box: 98167-43175, Phone/ Fax: +985412443261, E-mail [email protected]

Received: March 14th, 2015 – Accepted: June 18th, 2015

Abstract Developing and expanding the universities and increasing the admission of medical students did resolve the physician shortage, but it brought down the educational quality in return. To face this problem, the administrates needed to promote the quality of education which in turn needed accurate up to date information of conditions in different universities. Information of these issues was collected by the Medical Education Council Secretariat and finally published as the Data Bank and Ranking of the Medical Faculties. Method: Although nowadays ranking is more qualitative rather than quantitative, the above ranking3_2015_draft was done by a statistical method. In this study, the intended statistic population consisted of the information contained in the database and the ranking of all 38 medical faculties. To perform this study, the ranking of faculties in the comprehensive entrance exam which indicated the input of educational system was considered the index at first, and then, the ranking of the faculties in the effective factors in education, was arranged according to the regulation of the input system; then outputs of the educationaliss system were arranged according to the input system and finally a comprehensive table from all the educational information was provided. Then, the correlation of various factors in education with outputs of educational system were discussed. Result: The correlations of each and all factors, which have an effective part on education were considered separately, collectively, and together, according to the information of the above book. No relation was found between the factors, which affected the process of education and the output in different universities. The only relation notable was the admission degree and the results of the national basic science exams. Since no meaningful relation was found between the present parameters, it seemed to be wrong to follow the path that the other parts of the world has taken in choosing the ranking factors.

Keywords: educational systems, medical education, assumed effective factors

Introduction 8_special bout the unification of the definition of the educational quality and its measurement methods [2] and it was With the increasing acceptance of medical necessary for each society to consider its own criteria and students, from 1323 people in 1978 to 5335 people in try to improve it, but generally it could be said that the 1986 (and after that) and an increase in the medical purpose of the educational quality was to have the faculties from 13 to 38, the problem of the shortage of educational situation matched with the pre-determined physicians was fortunately resolved in Iran. Following standards or to have the available situation matched with that, the authorities at various levels including the Ministry the mission, goals and expectations of the beneficiaries of Health and Medical Education thought about improving [3,4]. A quick look was taken at the studies that have the quality of education and even considered the been performed in that area. improvement of the quality of education as one of the Nili Ahmadabadi [5] knew several effective higher education goals, because improving the quality of factors of improving the quality of education including the education and research is one of the main concerns of the following: welfare and peace of mind of students and education systems in most of the countries of the world professors, emphasis on the teaching and research, [1]. change of rules and educational structures, the JML_VolumeHowever, various studies indicated that the establishment of the evaluation system and quality and improvement of education was a complex, encouragement of the students and professors to provide dynamic process, had several dimensions and its the facilities. dynamism caused the consistent striving to improvement In a research performed by Soleimani Motlagh from the educational planners in each country. Since it [6] with the subject of effective factors on the quality of had various dimensions, there was not any agreement academic education from the view point of the faculty Journal of Medicine and Life Vol. 8, Special Issue 3, 2015

members and students of Lorestan University, there was which led to an improvement in the quality of higher a significant relationship between the quality of education education, were considered. and the factors such as the content of the curriculum, the Also from UNESCO viewpoint, the quality in assessment methods of academic progress, teaching higher education is a multidimensional concept and it methods, knowledge and application of educational cannot be said that it follows or is obtained from a public technology. theory or a general pattern, but the quality of education Following a research regarding the improvement system is a special case, which meets particular needs of in the quality of education, Hoveida and Mulavi [7] society at a particular time and place [13]. indicated that it was essential to have educational plans In a research which was performed by Lagrosen appropriated with the needs of the target population and et al. [14], 11 aspects of effective factors in the quality of learners and pay more attention to the indicators of education were identified, as it follows: team cooperation, improving the quality instead of the emphasis on the information and accountability, proposed academic quantitative aspects. subjects, university facilities, the activities related to In another research with the subject of the teaching, internal assessments, computer facilities, comparison of effective factors on the quality of education cooperation and comparison of factors after the study and in the MA level of Shahid Beheshti University and Sharif library resources. The Research Association of America University of Technology, Yomni Douzi Sorkhabi [8] said [15] mentioned that the relationship of graduates, cost, that using the criteria which are applied in the selection of total quality management and performance of the faculty faculty members and students, teaching method, members were the most important factors in the organizing the educational content, organizing the improvement of the quality and efficiency of higher educational environment and the evaluation of classroom, education. had an effect on the quality of education. In another research by Lomas [16], it was shown The result of Khorshidi et al. [9] indicated that 13 that the quality culture,3_2015_draft importance of education, high factors were effective in the efficiency and improvement of quality of new teachers, their ongoing professional the quality of higher education as it follows: cost, development, careful review of the professors’ teaching, graduates, recruitment rate, total quality management, should be stressediss in order to improve the quality of performance of the Board, counseling of faculty members, education. space, research, benefits of faculty members, student Borden and Bottrill [17] mentioned the graduates’ distribution rate, professional growth, proportion of relationship, cost, and performance of faculty members, students with the society and participation of students in research, and participation of students in the university the university governance. governance as the effective factors in the improvement of Ferasatkhah [10] said that needs such as the the quality and efficiency of universities. development of necessary infrastructure for distance In their researches, Care and Hanney [18] found learning, diversity of funding sources, development of the that the following 14 factors were effective in improving quality of assessment and acceptance systems, quality of the quality and efficiency of higher education centers: the funding resources and faculty members, the input, process, output, research, evaluation, space, costs, institutionalization of evaluation and validation, becoming extracurricular services, discipline, hygiene, competitive of higher education, a three-way8_special interaction of communications, informing, press, and physical the university, different enterprises and government, are education. the factors which affect the qualitative and quantitative Morever, in a study, Harbour [19] found the improving of education in universities. following 20 factors which were effective in improving the In the study of Tabarsa et al. [11], which was quality and efficiency of higher education centers: student conducted while being based on the analytic hierarchy participation, recruitment rate, scientific resources, process, the provision of educational programs were graduates, performance of the faculty members, research weighing 0.338, which was known as having the greatest cost, benefits of the faculty members, space, libraries, impact on the improvement of the educational quality, student distribution rate, management, communication and, after that, faculty members were weighing 0.246, and with graduates, graduates’ welfare, career growth, the the support of students and professors were weighing proportion of students with the society. 0.122, in the next positions being infrastructures and In another study, Cabal [20] mentioned 14 facilities, library services and administrative services indicators as the ones to improve the quality and being the priority. efficiency in universities: teaching characteristics, the In the study of Kells [12] regarding the results of scores, the cost per student, value-added return JML_Volumedevelopment and application of performance indicators rate, academic failure rate, employment of graduates, and improvement in the quality of higher education evaluation by students, number of researcher students, performed in 11 countries, the creation and development number of publications, inventions and official documents, of programing in the area of performance indicators, the quality of research, research income, degree of

14 Journal of Medicine and Life Vol. 8, Special Issue 3, 2015

popularity and acceptance, evaluation by homogeneous process of medical education (Tables 1-3 to 1-20) was groups. proposed and analyzed in the ranking and database book Also, in another study, Raharjo et al. [21] on the outputs of the educational system (Tables 1-22 to indicated that the factors such as place, facilities, 1-25). educational programs, administrative services and communication with the outside world are the important factors in improving the quality of education, these being Method considered effective factors on the quality of higher In this study, the intended statistic population education. consisted of the information contained in the database In a study with the subject of evaluation of the and ranking of all 38 medical faculties across the country effective factors on the quality of education in universities, which have accepted medical students in the year 2000. which was conducted by Tsinidou et al. [22], with the use To do this study, the ranking of faculties in the of analytic hierarchy process, it was indicated that comprehensive entrance exam in accordance with the educational programs and faculty members have the Table 2-1 of the database and ranking indicating the input greatest impact on improving the quality of education. of the educational system was considered the index at In a study with use of analytic hierarchy process, first and then the ranking of the faculties in the effective Li et al. [23] evaluated the effective factors on the quality factors in education which was presented in the Tables 1- of higher education and found that financial support, 3 to 1-20 of the database, being arranged according to appropriate allocation of financial resources and up-dated the regulation in the Table 1-2. Then, the outputs of the resources were the effective factors on improving the education system which were presented in the Tables 1- quality of education. 22 to 1-25 were arranged, then the outputs of an The above-mentioned studies indicated that educational system which were presented in the Tables 1- different and various factors were effective on the 3_2015_draft 22 to 1-25 were arranged according to the Table 1-2 and education and its quality, and there was not any clearer finally a comprehensive table from all the educational way and shortcut for the improvement of the quality of information was provided (Table 2). Afterwards, the education. To achieve this goal rapidly by its performance correlations ofiss various factors in education, with outputs of and also to improve the quality of education at the educational system were discussed. Although nowadays, beginning, a detailed and accurate knowledge of the ranking is qualitative rather than quantitative, the above current state of education and in general knowledge and ranking was performed by a statistical method. In this identification of the strengths and weaknesses of the method, different standards and their values were defined current education system was essential and then its and at the end of the rank, each university was calculated improvement, information which were not available in the by a linear formula. These factors consisted of education educational system of Iran. So, in 1998, the authorities of (51%), research (23%) and equipment (26%). In the the Ministry of Health made the Secretariat of the Council present research, 51 percent of the educational institutes of Graduate Medical Education responsible for collecting were investigated. the data from all the medical faculties across the country In order to evaluate the relationship between the and finally, after two years, in 2000, led to the release of a above factors with outputs of the system, correlation very good and rich collected data database8_special of the medical coefficient and multiple regression were used. However, universities ranking of Iran (information bank and ranking) these concepts needed to be explained at first: the [24]. The criteria for the ranking of faculties were divided correlation between variables indicated the way changes into three main educational, research and facilities in one variable cause changes in other variables, the groups, weighing 51%, 23% and 26%, respectively, and statistical indicator showed the extent and scope of that according to these weights in Table 1-1 of the database correlation, being called Correlation coefficient and and ranking, a total ranking of different faculties in the determined the magnitude and direction of the correlation education criteria it was stated that only the educational between two variables, although these two were criteria were considered. independent. To calculate the correlation coefficient, As education consists of three main factors: a) Pearson’s correlation coefficient was used, which was system input b) the education process and its effective available in different statistic software. In the multiple factors and c) system output, in Table 1-2 of the database regression analysis, the correlation and relationship of a and ranking of faculties, ranks of different faculties in the dependent variable with various independent variables entrance exam were mentioned (system input) and in the were considered at first. For this purpose, the simple Tables 1-3 to 1-20, the effective factors on the education correlations of the dependent variable were calculated JML_Volumeprocess and in the Tables 1-22 to 1-25, the rate of with every single independent variable and then the graduation and assistant acceptance (Residency) and the factors that had the highest simple correlations were results of basic science comprehensive test and pre- entered into the multiple regression models to regression internship test were mentioned (system output). In this F being less than the F table. At that time, the multiple study, the effect of the assumed effective factors in the regression was stopped and the last acceptable step of

15 Journal of Medicine and Life Vol. 8, Special Issue 3, 2015

the multiple regression determined how many ranked as third and eighth respectively. In addition, it was percentages of the dependent variable’s changes were decided that different educational outputs of both influenced by the changes of independent variables universities should be evaluated to identify their effective entered to the model. factors, so, for this purpose, related factors to the system inputs including ranks of universities in the comprehensive entrance exam from the Table 1-2 Results database and ranking and outputs of educational system including basic science and pre-internship comprehensive According to the Table 1-1 database and ranking board exams, assistant reception and graduating rate of the universities that mentioned the ranks of different were extracted from Tables 1-22, 1-23, 1-24 and 1-25 of universities in the education criteria, the University of the database and ranking book for universities of Baghiyatallah, which was a newly established one, and Baghiyatallah and Tehran (Table 1). the University of Tehran, which was the oldest one were

Table 1. The comparison of the outputs with ranking in the entrance exam of two universities of Tehran and Baghiyattallah Ranking in the Basic science Pre-internship Graduating Residency entrance exam comprehensive test comprehensive test Tehran 2 5 4 3 11 Baghiyattallah 38 32 29 39 3

The results indicated that the University of coefficient presented in Table 3 indicated that there was a Tehran had an appropriate rank in all outputs to its inputs, significant and negative relationship between the except for the pre-internship comprehensive board exam, graduating rate (Table 1-22) with different factors, which became the eleventh, and the University of including density of basic3_2015_draft science and pathobiology Baghiyattallah had an appropriate rank in all outputs to its classes with the correlation coefficients of (- 0.61) with inputs and the rank in the entrance exam except for the P<0.001 and (- 0.65) with P<0.001, respectively, and it pre-internship comprehensive board exam which became also had a isssignificant relationship with the factors of the third. In addition, it was observed that the rank of the absolute and per capita of faculty members and per capita pre-internship comprehensive board exam of both of basic science and pathophysiology and clinical faculty universities was not appropriate for their inputs of the members with the correlation coefficients of (0.4) with educational system. Therefore, to evaluate more, we P<0.001 and (0.34) with P<0.001 and (0.32) with P<0.001 referred to Tables 1-2 and 1-25 of the database and and (0.44) with at least P<0.05 and the graduating rate ranking and evaluated the ranks of 1-10 universities of the had no relationship and correlation with the other entrance exam and 1-10 ranks of the pre-internship assumed effective factors such as the educational beds comprehensive exam. It was observed that the ranks of and training courses per capita, density of clinical class, the pre-internship comprehensive exam of the first to the educational facilities per capita, the way the curriculum tenth university in the comprehensive entrance exam presented, internal tests, clinical educational activities, were the one shown below (In parentheses):8_special University of inter-section training, clinical education, informing and the Tehran (11), Shahid Beheshti (16), Shiraz (14), Mashhad supervisor. (18), Iran (28), Isfahan (9), Tabriz (32), Gilan (20), Qazvin Residency for specialized courses (Table 1-23), (19) and the first to tenth ranked universities of pre- as one of the outputs of the education system had a internship comprehensive exam in the entrance exam had negative relationship with factors such as density of basic the ranks as the ones below (In parentheses): Universities science, pathophysiology and clinical classes with the of Yasouj (35), Baghiyattallah (38), Shahed (14), Semnan correlation coefficients (- 0.75) P<0.001 and (- 0.66) with (27), Lorestan (32), Yazd (16), Kordestan (36), Isfahan (7) P<0.001 and (- 0.47) with at least P<0.001 and had a and Bushehr (33). relationship with the factors of absolute per capita of As the second step and in order to evaluate the faculty members and per capita of basic science and effect of every single assumed factor in the process of pathophysiology and clinical faculty members, the way the education, the correlation of the effective factors of the curriculum presented and the inter-section training with education criteria mentioned in the database and the the coefficients of (0.74) with P<0.001 and (0.67) with ranking with different outputs of the educational system P<0.001 and (0.64) with P<0.001 and (0.76) with P<0.001 were assessed. For this purpose, Table 2, which was a and (0.50) with P<0.001 and (0.51) with P<0.001, JML_Volumecomplete table of the information related to the system respectively and did not have a significant relationship inputs, effective factors in the process of education and with the other factors. outputs of the system, was used and a correlation The correlation coefficients of the basic science coefficient of different assumed effective factors in comprehensive exam (Table 1-24) with different factors education was calculated with the system outputs and the showed that the results of that exam with the factors of results were presented in Table 3. The correlation density of basic science and pathophysiology classes and

16 Journal of Medicine and Life Vol. 8, Special Issue 3, 2015

informing and supervisor had a negative relationship with graduating rate was entered to the model and also the correlation coefficients of (- 0.75) with P<0.001 and (- pathophysiology faculty members and educational bed 0.51) with P<0.001 and (-0.49) with P<0.001 and (-0.41) per capita from the effective factors in residency were with P<0.001, respectively, and had a significant entered to the model. Also, the educational bed per capita relationship with the factors of absolute per capita of and the clinical faculty member per capita and supervisor faculty members and per capita of clinical faculty were entered to the model of basic science members with the coefficients of (0.33) and (0.45) with comprehensive test and the only effective factor which P<0.05 respectively and did not have any relationship with was entered to the model of pre-internship was the the other factors. educational bed per capita, which had a negative The pre-internship comprehensive test (Table 1- correlation with the coefficient (- 0.85). 25) with the educational facilities per capita had the In the third step and for the evaluation and correlation coefficient of (-0.62) with P<0.001 and had a quantitative assessment of weights of assumed effective negative relationship with the educational bed per capita, factors in education and the difference of different with (- 0.85) with P<0.001 and did not show any universities regarding these factors, the total weights of significant correlation with the other assumed factors. 19 educational factors within the first 5 universities in the The presented correlation coefficients in Table 3 input system and the entrance exam (Universities of indicated that the factors for educational facilities, Tehran, Shahid Beheshti, Shiraz, Mashhad and Iran) with educational bed per capita, the way the curriculum the last 5 universities in the input system and the entrance presented, inter-section education, informing, and exam (Universities of Yasouj, Kordestan, Zahedan, supervisor had a significant relationship with maximum Baghiyattallah and Military) were compared and the total one of the outputs of the educational system. weights of 19 educational factors were presented in the Also, these results indicated factors such as last column (Table 2), then mean and standard deviation training courses, internal tests, clinical educational of both groups of quintuple3_2015_draft universities were determined, activities, clinical education and educational rules did not the mean above the scores was registered in the first 5 have a significant relationship with any of the outputs of universities in the entrance exam 1110.4 ± 158 and in the the educational system. 5 last universitiesiss in the entrance exam 1101.3 ± 167, that To determine the simple correlation coefficients did not have a significant difference. Moreover, due to between different factors and system outputs, multiple different universities, some factors had higher scores, and regression of different factors with the outputs of some factors had fewer scores and totally there was not a educational system were calculated. Moreover, only the significant difference in the educational facilities. density of basic science class from the effective factors on

Table 2. General information related to the effective factors in education and outputs of 38 universities based on the tables in the database and the ranking book Universities 1-1 1-2 1-3 1-4 1-5 1-6 1-7 1-8 Tehran 67.05 100.00 10.00 8.70 6.61 62.37 47.69 70.93 Beheshti 73.39 96.06 8_special20.00 13.72 7.81 94.36 100.00 85.28 Shiraz 70.35 95.42 .00 11.06 7.81 93.86 99.34 76.25 Mashhad 71.06 94.68 43.50 16.64 27.89 86.89 84.37 100.00 Iran 61.87 94.05 .00 16.82 11.82 47.99 50.25 48.59 Isfahan 61.95 93.16 40.00 12.67 22.58 29.09 43.86 40.98 Tabriz 56.78 92.74 .00 9.55 53.12 44.01 55.34 26.37 Gilan 68.26 91.97 50.00 23.63 28.69 37.40 65.08 39.19 Qazvin 65.30 91.59 50.00 23.82 25.90 13.34 17.01 10.56 Mazandaran 57.29 91.19 55.00 31.95 27.62 18.94 12.42 24.63 Gorgan 58.21 90.86 90.00 35.35 41.43 7.75 7.79 6.70 Babol 56.10 90.38 50.00 28.92 21.38 14.62 12.90 21.42 Shahed 58.87 90.25 100.00 55.93 62.95 10.88 14.06 13.89 Birjand 56.26 91.11 95.00 42.72 28.29 8.04 6.99 8.87 Yazd 62.81 90.04 65.00 24.39 35.46 18.53 15.28 18.56 JML_VolumeKermanshah 64.66 89.93 30.00 20.79 12.62 37.00 51.36 17.55 Jahrom 54.90 89.72 100.00 57.66 .00 15.37 29.27 12.46 Fasa 50.48 89.31 95.00 69.00 44.22 7.46 16.10 0.00 Kashan 59.87 89.19 100.00 33.08 43.03 14.35 18.01 17.41 Uramia 57.68 89.12 66.50 41.40 26.43 26.70 32.36 26.21 Arak 57.28 88.94 50.00 32.08 35.46 7.77 6.51 8.11

17 Journal of Medicine and Life Vol. 8, Special Issue 3, 2015

Hamedan 68.05 88.71 45.00 37.24 36.52 13.67 21.78 11.84 Ardabil 59.24 88.52 100.00 47.26 33.20 14.06 10.31 12.71 Zanjan 59.11 88.46 50.00 30.62 33.07 11.23 15.69 10.85 Ahwaz 60.89 88.36 15.00 10.78 14.48 23.31 26.35 11.65 Semnan 59.70 87.98 100.00 47.26 89.11 10.34 18.94 7.54 Kerman 59.53 87.98 50.00 24.20 19.12 17.38 25.78 14.05 Shahr-e-Kord 59.12 87.59 100.00 68.62 58.96 16.62 18.12 16.24 Rafsanjan 49.68 86.85 100.00 100.00 32.01 8.49 8.22 17.09 Bandar Abbas 60.80 86.19 55.00 36.48 24.17 7.76 7.69 9.29 Lorestan 63.82 86.15 100.00 55.77 100.00 11.50 15.24 7.54 Bushehr 58.19 85.62 100.00 92.25 53.12 11.16 8.45 8.15 Ilam 59.10 85.48 100.00 89.41 83.00 16.32 10.92 9.98 Yasouj 56.92 85.43 100.00 54.44 39.58 11.30 7.90 11.51 Kordestan 62.01 85.03 100.00 68.62 52.72 11.32 12.61 10.95 Zahedan 62.87 84.68 50.00 29.11 10.36 12.56 15.87 5.11 Baqiyattallah 71.20 80.59 100.00 59.92 36.39 61.17 99.10 76.14 Military 59.91 72.12 100.00 69.38 84.86 17.84 5.12 32.76

Sequence of Table 2 Universities 1-9 1-10 1-11 1-12 1-13 1-14 1-15 1-16 1-17 Tehran 70.11 26.28 6.58 73.49 86.74 80.80 3_2015_draft67.16 74.77 58.91 Beheshti 95.53 35.42 13.85 73.10 76.57 87.15 71.67 73.44 69.76 Shiraz 100.00 34.90 23.83 46.14 35.95 82.56 69.15 98.24 37.65 Mashhad 81.22 32.64 17.99 80.99 71.58 85.71 66.23 78.00 53.47 Iran 46.07 32.57 15.66 71.66 78.05 iss81.57 58.49 63.86 52.67 Isfahan 34.65 26.66 8.92 76.49 45.05 91.49 57.35 61.28 53.10 Tabriz 46.04 33.05 15.92 39.52 13.27 85.08 43.71 49.98 36.92 Gilan 16.89 35.56 18.52 40.39 28.58 80.66 81.16 77.47 85.19 Qazvin 12.23 36.00 10.51 49.90 59.05 87.90 74.48 64.85 85.54 Mazandaran 20.30 40.58 31.60 39.80 28.58 87.08 54.94 50.84 59.39 Gorgan 8.32 29.13 10.62 51.03 61.58 84.26 74.20 55.22 94.75 Babol 11.96 40.47 9.13 41.07 23.58 74.76 51.17 58.01 43.75 Shahed 6.93 29.67 8.44 51.56 76.58 83.92 58.26 58.79 57.69 Birjand 8.31 33.08 9.24 38.48 23.58 86.23 64.14 52.37 75.79 Yazd 20.81 33.39 11.368_special 48.39 54.05 86.71 66.64 68.59 64.53 Kermanshah 37.93 39.23 21.34 52.15 33.58 83.89 77.18 92.39 60.69 Jahrom 7.23 21.17 8.76 37.87 30.95 88.42 47.02 52.13 41.49 Fasa 5.61 26.25 7.01 39.82 26.53 83.77 40.56 52.86 27.24 Kashan 10.05 29.31 17.04 52.99 61.58 88.84 66.60 53.07 81.25 Urumia 18.07 29.18 12.53 44.41 39.05 82.62 70.06 63.43 77.25 Arak 8.48 33.51 12.75 47.32 42.00 86.22 65.47 59.48 71.96 Hamedan 9.00 34.49 13.33 69.86 61.58 88.20 95.81 100.00 91.27 Ardabil 17.47 38.34 22.08 43.85 18.42 83.55 69.74 65.54 74.30 Zanjan 8.30 38.46 13.32 43.43 44.05 83.71 64.25 51.22 78.37 Ahwaz 27.80 32.88 14.92 38.76 18.42 82.33 75.09 96.99 51.36 Semnan 5.88 34.80 7.32 72.18 82.05 79.05 48.87 40.91 57.50 Kerman 13.35 33.83 20.97 78.36 86.74 89.88 44.10 48.90 38.89 Shahr-e-Kord 15.77 31.88 18.47 45.82 45.05 92.60 59.20 38.85 81.25 JML_VolumeRafsanjan 3.79 33.30 7.54 41.87 34.16 81.77 36.29 38.46 33.93 Bandar Abbas 6.93 34.72 12.90 44.14 44.05 87.25 68.55 64.80 72.60 Lorestan 11.11 36.36 16.14 39.52 28.42 85.34 66.06 52.64 80.58 Bushehr 14.79 55.65 22.19 36.79 27.58 85.32 49.89 39.32 61.19 Ilam 25.42 71.48 75.69 45.38 54.05 84.63 87.03 49.82 87.68 Yasouj 13.57 47.83 12.95 39.10 27.58 84.50 39.91 51.22 27.65 18 Journal of Medicine and Life Vol. 8, Special Issue 3, 2015

Kordestan 10.62 40.59 26.33 65.15 76.57 86.39 77.89 69.70 86.77 Zahedan 14.47 33.38 13.27 54.39 81.58 89.26 78.15 70.61 86.33 Baghiyattallah 25.95 49.32 14.44 51.27 66.42 90.39 87.93 76.79 100.00 Military 18.32 83.76 100.00 52.68 76.58 86.42 58.59 63.60 53.16 Total Universities 1-18 1-19 1-20 1-21 1-22 1-23 1-24 1-25 weights Tehran 65.70 0 81.25 94.20 91.43 90.71 97.92 96.04 1000.1 Beheshti 83.01 100.00 81.25 91.29 77.14 100.00 92.31 94.64 1278 Shiraz 85.16 100.00 100.00 88.09 77.14 82.34 95.08 95.31 1197.32 Mashhad 76.39 25.00 67.25 88.57 81.43 82.99 94.04 93.99 1190.44 Iran 57.99 0 67.25 84.88 45.71 99.44 100.00 91.72 896.28 Isfahan 69.49 0 67.25 77.16 52.86 54.92 97.48 96.60 Tabriz 66.11 0 56.25 87.23 91.43 71.35 94.61 90.33 Gilan 97.63 75.00 81.25 81.38 92.86 41.35 93.10 93.18 Qazvin 76.87 100.00 81.25 82.50 100.00 41.14 91.10 93.90 Mazandaran 71.99 25.00 67.25 70.07 87.14 0.00 94.80 90.96 Gorgan 66.14 50.00 54.75 61.10 17.14 30.82 93.87 91.82 Babol 89.76 100.00 81.25 64.65 40.00 31.35 84.04 93.48 Shahed 91.98 100.00 56.25 59.84 17.14 30.82 81.01 97.77 Birjand 91.02 75.00 67.25 50.89 2.86 0.00 94.59 91.80 Yazd 66.41 25.00 81.25 79.88 75.71 46.73 3_2015_draft94.06 97.12 Kermanshah 77.44 50.00 81.25 71.68 34.29 59.40 94.27 91.70 Jahrom 83.66 75.00 87.50 61.61 17.14 30.82 91.52 95.36 Fasa 53.11 25.00 67.25 59.61 17.14 30.82 90.15 89.88 Kashan 79.10 25.00 67.25 61.56 2.86 iss48.73 91.50 92.44 Urumia 65.05 0 56.25 62.11 21.43 37.61 90.61 89.28 Arak 91.54 75.00 43.75 65.56 82.86 0.00 81.82 89.40 Hamedan 72.43 25.00 81.25 64.95 21.43 40.75 91.13 95.89 Ardabil 78.05 25.00 57.75 61.01 17.14 30.82 91.33 93.52 Zanjan 72.38 25.00 81.25 67.65 47.14 39.72 88.56 88.07 Ahwaz 77.69 75.00 67.25 77.86 62.86 62.28 90.99 90.79 Semnan 65.51 0 70.25 69.87 50.00 30.82 91.64 97.56 Kerman 78.57 75.00 81.25 74.72 68.57 43.51 88.73 92.14 Shahr 85.17 50.00 87.25 60.01 47.14 .00 86.87 94.34 Rafsanjan 90.49 75.00 54.758_special 47.45 0.00 0.00 82.54 92.07 Bandar Abbas 76.11 25.00 81.25 71.96 50.00 42.61 92.28 95.16 Lorestan 84.35 100.00 81.25 70.46 90.00 .00 85.49 97.39 Bushehr 62.77 75.00 81.25 61.62 17.14 30.82 90.05 96.53 Ilam 70.02 25.00 67.25 32.72 17.14 30.82 91.26 0.00 Yasouj 81.88 75.00 87.50 65.98 67.14 0.00 85.43 100.00 898.87 Kordestan 69.77 75.00 54.75 54.32 17.14 0.00 88.51 97.06 1080.79 Zahedan 94.05 100.00 70.25 67.17 44.29 44.35 85.51 87.51 993.43 Baghiyattallah 78.81 75.00 87.50 59.93 17.14 30.82 78.71 99.86 1316.93 Military 85.14 75.00 81.25 30.99 17.14 30.82 90.50 0 1216.58

Table 3. Simple correlation coefficient of the effective factors in education with outputs of educational system Tables Pre-internship test Basic Science Residency Graduating Total output

1-1 - - 0.56 0.42 0.53 JML_Volume1-2 - 0.53 0.54 0.45 0.76 1-3 - -0.75 -0.75 -0.61 -0.77 1-4 - -0.5 -0.66 -0.65 -0.81 1-5 - - -0.47 -0.52 1-6 - 0.33 0.74 0.4 0.6

19 Journal of Medicine and Life Vol. 8, Special Issue 3, 2015

1-7 - - 0.67 0.34 0.59 1-8 - - 0.64 0.32 0.5 1-9 0.45 0.76 0.44 0.61 1-10 -0.62 - - -0.56 1-11 -0.85 - - -0.54 1-12 - - 0.5 - 0.35 1-13 - - - - 1-14 - - - - 1-15 - - - - 1-16 - - 0.51 - 0.39 1-17 - - - - - 1-18 - -0.49 - - - 1-19 - -0.41 - - - 1-20 - - - - -

Abbreviations contained in the database and Iran’s Table 1-21 = the results of universities comparison in the medical universities ranking: educational output index Table 1-1 = the results of universities comparison in Table 1-22 = the results of universities comparison in the educational index graduating index Table 1-2 = the results of universities comparison in index Table 1-23 = the results of universities comparison in the of comprehensive entrance exam residency index Table 1-3 = the results of universities comparison in index Table 1-24 = the results 3_2015_draftof universities comparison in the of density of basic science class index of basic science comprehensive test Table 1-4 = the results of universities comparison in index Table 1-25 = the results of universities comparison in the of density of pathophysiology class index of pre-internship comprehensive test Table 1-5 = the results of universities comparison in index iss of density of clinical class Table 1-6 = the results of universities comparison in index Discussion of faculty members per students Table 1-7 = the results of universities comparison in index The findings in Table 1 indicated that among the of basic science level different outputs of education system, only the score in Table 1-8 = the results of universities comparison in index the pre-internship comprehensive test with system inputs of pathophysiology level in two universities of Tehran and Baghiyattallah were not Table 1-9 = the results of universities comparison in index appropriate and if we refer to Table 1-2 (score in the of clinical level entrance exam) and Table 1-25 (score of pre-internship Table 1-10 = the results of universities comparison in test) databases and ranking, this disproportion was index of educational facilities capita observed and it was not unique for these two universities, Table 1-11 = the results of universities8_special comparison in being almost public. Moreover, all top universities in the index of educational bed capita entrance exam did not have a suitable rank in the pre- Table 1-12 = the results of universities comparison in internship comprehensive test and on the other hand, index of offering courses high ranked universities in the pre-internship Table 1-13 = the results of universities comparison in comprehensive test had low ranks in the entrance exam index of training courses and that disproportion between the ranks of the entrance Table 1-14 = the results of universities comparison in exam and the results of pre-internship comprehensive test index of internal tests could suggest that the training of medical students at the Table 1-15 = the results of universities comparison in index of clinical educational activities internship level in small medical universities was more Table 1-16 = the results of universities comparison in successful. This matter could have resulted from various index inter-section education reasons including the following: A: in the newly Table 1-17 = the results of universities comparison in established universities from the small cities, the ratio of index of clinical education patients per student in public and educational hospitals is Table 1-18 = the results of universities comparison in greater than in big cities, therefore they have educational index of informing facilities, more patients and a better education. B: in small JML_VolumeTable 1-19 = the results of universities comparison in cities in comparison with big cities, more full-time clinical index of supervisor faculty members serve at the universities and educate Table 1-20 = the results of universities comparison in students. For instance, in Yasouj, which has won the first index of educational rules place in the pre-internship exam, in 2004, its all faculty members (except for 1 person) served at the university

20 Journal of Medicine and Life Vol. 8, Special Issue 3, 2015

full-time. c: because of the expensive cost in these cities, considered the factors of basic science (1-7), private hospitals have a less percentage of patients and a pathophysiology (1-8) and clinical (1-9) in Table 2, it was higher percentage of patients who refer to the public and observed that the universities of Tehran, Shahid Beheshti, educational hospitals and therefore are available for Shiraz, Mashhad and Iran have obtained high percentage students. d: as private hospitals are less, experts spend of scores but the universities of Yasouj, Kordestan, more time in the educational hospitals and are available Zahedan, Baghiyattallah and Military had the minimum for students. e: due to the cultural level and low level of related scores. If we referred to the table of criteria related financial facilities in these cities, people generally do not to the educational issues in the database and ranking make any difference between the private and educational (page 47 of the related book), it was observed that the hospitals and their selection criteria is the low cost, so total weights of density of basic science and most of them prefer to go to the public and educational pathophysiology and clinical classes were 1.037 + 0.97 + hospitals. Maybe the above-mentioned reasons are part 1.26 = 3.6 and, in general, the weights of basic science of the important reasons of failure of large universities in and pathophysiology and clinical faculty members the pre-internship comprehensive tests, because capitations were 1.16 + 0.94 + 1.64 = 3.74, which did not obtaining mental and practical skills, which result from the have a significant difference with each other, indicating triple relationship between the professor, student and that different universities did not have a significant patient in the process of education, in large universities difference with each other from the viewpoint of the are weak due to a large number of students. weights of various reasons, although some of these In addition to the pre-internship comprehensive reasons, even with a low weight, play a decisive role in test, the simple regression of different factors indicated the success of students. that the graduating rate and residency, and the results of The correlation coefficients between the basic science comprehensive test generally had a assumed effective factors with the outputs of the significant and negative relationship with the factors of educational system including3_2015_draft the graduating rate (Table 1- density of basic science and pathophysiology classes, 22) and residency (1-23) and the basic science and also had a significant and positive relationship with comprehensive test (Table 1-24) and the pre-internship the factors of faculty members per capita and clinical, comprehensiveiss test (Table 1-25), indicated that: pathophysiology, and basic science faculty members per generally, some of the assumed effective factors had a capita, which indicated that the quantitative increase of significant but negative relationship with the outputs of the the universities took place without an increase in the educational system such as density of basic science (1-3) essential infrastructure including classrooms, faculty and pathophysiology (1-4) classes. The correlation members and related centers. The results of multiple coefficient of certain factors with the outputs is thinkable, regression indicated that, generally, in multiple for example the results of the pre-internship regression, the educational bed capitation, faculty comprehensive test with the educational facilities capita members capitation and class density have entered to and educational beds had a negative relationship with a different models and the other effective factors by coefficient of (-0.62) with P<0.001 and (-0.85) with P< association with the above factors have been removed 0.001, no justification for it could be suggested, since it from the model. In the next step and based on Table 2, a was expected that higher educational facilities, including trial was made to compare different effective8_special facilities on the educational beds, should lead to a better quality of education in the database and ranking among different education and it became reflected in the pre-internship universities including 5 first universities and 5 last comprehensive test. The only justification which could be universities in ranking of a comprehensive entrance suggested for this, was that the distribution of facilities exam, but the obtained results indicated that in general, between universities was not based on the requirements there was no significant difference between the mean of or at least were on the basis of non-educational criteria, facilities and weights of different criteria of the two groups therefore not only further facilities have not improved of universities and it could result from different universities education but also have had a negative effect on it. Some having a higher score in some proposed factors in the assumed proposed factors had no significant relationship database and ranking book and a lower score in some with the outputs of the educational system like training factors and finally the total scores related to the courses, internal tests, educational activities, clinical educational criteria in different universities were almost education and educational rules which had the weights of the same. For instance, if we looked at the last column of around 13% from 51% of the total weight of the Table 2 in the related rows to the density of basic science educational criteria, based on the table of the educational (1-3) and pathophysiology (1-4) and clinical (1-5) classes, criteria in the database and ranking book (page 48), which JML_Volumeit could be observed that all universities of Yasouj, indicated that some of the assumed educational criteria Kordestan, Zahedan, Baghiyattallah and Military have were not matched with the reality of medical universities obtained a high percentage of related score, while all of Iran. The identification of the lack of connection universities of Tehran, Shahid Beheshti, Shiraz, Mashhad between the assumed factors and the quality of education and Iran have obtained lower scores. Likewise, if we of medical students caused that the Secretariat Council of

21 Journal of Medicine and Life Vol. 8, Special Issue 3, 2015

Graduate Medical Education of the Ministry of Health Cabal [20] and Raharjo et al. [21] knew that the proportion evaluated and ranked again with the new standards. In of educational programs with the needs of society and the recent ranking in 2011, realized by the educational being accountable to it, was considered one of the most deputy of the Ministry of Health [25], new factors of important factors in improving the quality of education. effective reasons in improving the quality of education Khorshidi et al. [9], Farasatkhah [10], Research were proposed and considered, which showed that the Society of America [15], Borden and Bottrill [17], Care and last assumed effective factors did not work and did not Hanney [18], Cabal [20] and Li et al. [23] knew that the match the realities of the scientific centers of Iran. The financial supports and variety of resources and costs were new proposed effective factors in 5 different educational effective in improving the quality of education. areas are the following: 1- The area of educational Nili Ahmadabadi [5], Soleimani Motlagh [6], development (including removed courses, available Yamani [8], Farasatkhah [10], Lagrosen et al. [14], and courses and the newly established courses), 2- Care and Hanney [18] knew that evaluation was Management of education (including admission to higher considered an important factor in improving the quality of education, clearing of information in the website of the education. educational deputy of the university and internal validity of Nili Ahmadabadi [5], Soleimani Motlagh [6], the students’ test scores). 3- Qualitative development Yamani [8], Lagrosen et al. [14], Lomas [16] and Cabal (including the key activities of the development center of [20] mentioned the teaching method and performance of the university for qualitative improvement, continuing the faculty members as an effective factor in improving education, the managers’ view points, special events and the quality of education. holding Shahid Motahari’s Festival). 4- Attention to the Nili Ahmadabadi [5], Tabarsa et al [11], Harbour goals of comprehensive scientific map (including [19], Raharjo et al. [21] and Li et al. [23] said that the programming, performance of purposes, attention to the professors’ and students’ welfare was one of the most professional ethics and meeting the needs of society), 5- effective factors in improving3_2015_draft the quality of education. Governance (including planning and report of the Yamani [8], Khorshidi et al. [9], Care and Hanney activities, the activity of the university council, Councils of [18], Harbour [19], Raharjo et al. [21] knew that the Education, meetings of the educational deputy, physical facilitiesiss and space and educational environment distribution of the budget, management stability and were the most effective factors in education. management of recruiting of the faculty [25]. But, the Khorshidi et al. [9], Borden and Bottrill [17] and comments and conclusions of different researchers Harbour [19] knew that the students’ participation in the regarding the effective factors on the education were not university governance, were effective in the quality of used in the new evaluation and the review too. education. Soleimani Motlagh [6] and Howeida and Mulavi However, from the UNESCO’s viewpoint, the [7] and Yamani [8] studies of Tabarsa et al. [11], Kells quality in education is a multidimensional concept and it [12], Raharjo et al. [21], Tsinidou et al. [22] knew that cannot be said that it follows or it is obtained from a public providing the educational programs is considered the theory or a general pattern, but the quality of the most important effective factors in improving the quality of education system is a special case that meets the education. particular needs of society at a particular time and place Nili Ahmadabadi [5], Khorshidi8_special et al. [9], [13]. Since the quality of education is a very complex case Farasatkhah [10], studies of Tabarsa et al. [11], Lomas and has various dimensions, it is great for the educational [16], Borden and Bottrill [17], Harbour [19] and Tsinidou et planners to constantly try to improve it and use the results al. [22] knew that the role of faculty members was of other researches to finally identify the effective factors effective in improving the quality of education. on the education in their society and do their best to Huweida and Mulavi [7], Khorshidi et al. [9], improve it. Farasatkhah [10], Bowden and Marton [13], Harbour [19],

Reference

1. Twigg CA. Quality Assurance for whom?. 4. Barmiani AGh, Salehi M, Sadeghi MR. Lorestan universities: A comparison 2001, New York: Center for Academic The evaluation of effective factors on according to the scale. AQIP- Iranian JML_VolumeTransformation. improving the quality of higher education Journal of Education in Medical Science. 2. Voss R, Gruber T, Szmigin I. Service in post-graduate educations from the 1992; 8,132-141. quality in higher education: The role of students’ viewpoints. Quarterly Journal of 6. Soleimani Motlagh Kh. Evaluation of the student expectations. Journal of Business Educational Management Research. educational effective factors on the Research. 2007; 60,949-959. Summer of 2011; 2,4. quality of academic education from the 3. Halsey R. Quality in Higher Education, 5. Nili Ahmadabadi MR. A comparative viewpoint of faculty members and 2007, http://www.ERIC.com. survey of faculty members of Isfahan and students of Lorestan University, Master

22 Journal of Medicine and Life Vol. 8, Special Issue 3, 2015

thesis of Shahid Beheshti University, Interdiscipinary Studies in the Humanities. 20. Cabal AB. The University as an Institution 1384. Autumn 2012; 4,4,53-74. Today. 2006, UNESCO Press. 7. Howeida R, Mulavi H. The process of 12. Kells HR. The Inadequacy of 21. Raharjo H, Xie M, Goh TN, Brombacher improving the quality of education from performance Indicators for higher A. A methodology to improve higher the viewpoint of the universities of Isfahan Education. The need for 4 more education quality using the quality province. Iranian Journal of Education in comprehensive and development function deployment and analytic Medical Sciences. 2008; 8,99,132-141. construct. 1990, Jossy Bass Publishers. hierarchy process. 2007. 8. Yamani Douzi S, Bahadori Hozari M, 13. Bowden J, Marton F. The –beyond 22. Tsinidou M, Vassilis G, Panos F. Bahadori Hozari M. The comparison of quality and Competence in University of Evaluation of the factors that determine some of the effective factors on the Learning, 1998, Kogan Page. quality in higher education: an empirical quality of Master education in the 14. Lagrosen S, Seyyed Hashemi R, study. Quality Assurance in Education. University of Shahid Beheshti and Sharif Leitner M. Examination of the dimensions 2010; 18,3,227-244. University of Technology. Quarterly of quality in higher education. Quality 23. Li J, Xie J, Li J, Wang H. The Application Journal of the Higher Education Forum of Assurance in Education. 2004; 12(2):61- of Analytic Hierarchy process in higher Iran. 2008; 1,57. 9. Education Tuition Model. 2010, 9. Khorshidi A, Mahdavi M, Salmani 15. Research Association. Inflation Measures http://ieee.org/stamp.jsp?Arnumber= Ghahbazi A. The effective factors and for Schools and Colleges. 2004, 05563590. indicators on the efficiency of universities Http://www.ERTC.com. 24. Mohammadi A, Mojtahedzade R. and higher education centers. Quarterly 16. Lomas L. Embedding quality: the Database and ranking of medical Journal in Medical Education System. challenges for higher education. Quality universities in Iran, Publication of the Autumn and Winter of 2008; 2,5,75-99. Assurance in education. 2004; 12(4):157- Ministry of Health and Medical Education 10. Farasatkhah M. The evaluation of how 65. in 2000, 2000. qualitative and quantitative improvement 17. Borden VM, Bottrill KV. Appendix: 25. Haghdoost AA, Ranjbar H, Shoghi F, in access to the higher education in Iran. Examples Performance indicators to Aria Sh, Mohagheghi MA, Momtaz Quarterly Journal of higher education Guide Strategic Decision making. 2005, Manesh N. Educational ranking of council in Iran. 2008; 1,2,95. San Francisco: Jossey-Bass. medical universities of Iran, Publication of 11. Tabarsa GhA, Hasanvand Mofrad M, 18. Care M, Hanney S. Indicators of higher the Ministry of Health and Medical Arefnejad M. Analysis and ranking of the Education, 2006, http://www.ERIC.com. Education3_2015_draft in 2014, 2014. effective factors in improving the 19. Harbour JL. Performance Environment. educational quality. Quarterly Journal of 2007, Http://www.ERIC.com.

iss

8_special

JML_Volume

23 Journal of Medicine and Life Vol. 8, Special Issue 3, 2015, pp.24-30

Nurse-family conflict beyond the walls of Iranian homes who have the mechanical ventilation dependent patient: a qualitative study

Moradian ST*, Nourozi K*, Ebbadi A**, Khankeh HR*, *Department of Nursing, University of Social Welfare and Rehabilitation Sciences, Tehran, Iran, **Behavioral Sciences Research Center (BSRC), Nursing Faculty of Baqiyatallah University of Medical Sciences, Tehran, IR Iran

Correspondence to: Hamid Reza Khankeh, Postdoct, Associate professor, Department of Nursing, University of Social Welfare and Rehabilitation Sciences, Tehran, Iran, Address: Kodakyar Alley, Daneshjou Blvd, Evin, Tehran, Iran, PO Box: 1985713834 Phone: +982122180036, E-mail: [email protected]

Received: March 14th, 2015 – Accepted: June 18th, 2015

Abstract Rationale. Home health care (HHC) has been developed more than any other industry in the past decade. Conflict between nurse and family can diminish the service provided to the home care patients. Objective. This study was conducted to explore the nature of conflicts between the client’s families and nurses in homes of critical care patients, in an Iranian context. 3_2015_draft Methods and results. Using the qualitative content analysis method and the purposive sampling, 15 participants including 7 nurses (4 males and 3 females) working in homes and 8 family members who had a patient receiving mechanical ventilation at home, were interviewed during 2013 and 2014. The main sources of conflict were due to nurse expectations, family expectations, and special characteristics of nurses. The team leader tried to prevent the conflict by different issmeasures, but in some cases, the conflict arose. Both family members and nurses accepted the team leader as the judge. At first, he tried to keep the situation stable and gave some notification to the nurse and some explanations to the family members. In some cases, that the family could not adapt to the situation and efforts to solve the conflict were unsuccessful, the team relation with the family being cut. Conclusion. Home care situation is prone to conflict due to various factors. The mentioned sources of conflict in home care were different from the ones of the hospital. Based on these results appropriate interventions suitable for home conditions should be implemented.

Keywords: home care services, conflict, conflict resolution, communication, nursing

Introduction colleagues and clients. If two people are viewing the 8_specialsituations from a different perspective, the conflict can Direction of health services is shifting from the compromise their relationship [12]. The home care setting facility based to community based [1] because of various is prone to conflict, because the nurses and clients’ changes in the health system such as the increase of families have different values, expectations, perceptions, more than 300 percent in the elderly population, and backgrounds [13,14]. Home care nurses are exposed increasing health care costs, as well as specialist nursing to a variety of conflicts. Some of them are from the shortage [1-3]. Recent Technological advancement request for additional visits or family members who expect helped in the provision of the medical services to the services more than usual, physicians who do not give complex patients at home [3]. Based on these changes, orders in a timely manner [15]. the numbers of complex patients, including the intensive The conflict with the client’s families is an care patients who are being cared for at home are important indicator of depersonalization and emotional increasing [4,5]. The transmission of such patients at exhaustion in home care workers [16]. Conflict outcomes home, usually occurs in situations when the patient is are not always negative; if the conflict is managed already receiving different drugs, is disoriented regarding skillfully, it can be a positive experience. If it is not the time and place, has sleep deprivation, malnutrition, as managed well, it can lead to a reduced quality of care and well as stress and fear of death [6,7]. Also, the client’s escalate to violence and abuse [17-19]. JML_Volumefamilies are experiencing stress, anxiety, fear and uncertainty [8-10]. Objective Some of the ICU patients need continuous care provided by health care professionals at home [11]. Based on our knowledge, little attention was paid Nurses are the main care providers at home. Nursing to the interpersonal relationship at home. Also, as it was profession is based on a collaborative relationship with Journal of Medicine and Life Vol. 8, Special Issue 3, 2015

already mentioned, the home care situation is prone to of the participant words. Then, by using the MAXQDA 10 conflict, so nurses should know how to manage these software, the data was divided in meaning units, then conditions. However, how this special type of conflict is coded, and arranged in different subcategories and experienced by nurses and families and how they can categories based on their similarities and differences. The manage it, is not being addressed well. Thus, by using a underlying meanings of the study were expressed in qualitative approach we wanted to underline the nature of conflicts between the client’s families and nurses in an themes based on the principle of latent content analysis. Iranian context. Lincoln and Guba criteria for rigor and trustworthiness were used in this study [21]. The researcher had a long-term engagement with the data Materials and methods and research field. Member checking was done by giving To understand the nature of relationship a summary of the primary result of each interview and the between the nurses and the client’s families and conflicts final results with 3 nurses and 3 family members checked between them in an Iranian context, the qualitative as well. Also the analysis process was done by the content analysis method was used. Qualitative content agreement of two members of the research team and was analysis simplifies data and provides structure and audited by two external supervisors. In cases of discipline. The content analysis also explores the real disagreement, the discussion was continued until meaning behind the raw data [20]. In this study, 6 nurses reaching an agreement. Furthermore, the quotes of (4 males and 2 females) from the purposive sampling, participants were presented in the finding section. working at homes, and 6 family members who had a The Ethical and Research Committee of the patient receiving mechanical ventilation at home were University of Social Welfare3_2015_draft and Rehabilitation Sciences interviewed during 2013 and 2014. Sampling was in Tehran approved this study. The aim and objective of continued until the data saturation. Nurses who were the study were clarified for participants. Then, the written working at home more than two years and had a thick and informed consentiss was obtained from participants. rich firsthand experience in caring for the ICU patients at Moreover, their permission for recording the interviews home were included. In order to enhance the maximum was obtained. One participant refused the recording, so, variation, nurses of both genders, with different work the interview was done without a voice recorder. The time experiences and different educational levels were and place of the interviews was determined by selected. Moreover, family members from different participants and they were able to stop it, if they were cultures and socioeconomic levels, providing care for the exhausted or distressed.

patients with different levels of complexity were asked to Findings participate. In addition, family members with different In our study, sixteen interviews with 15 durations of involvement in home care were interviewed. participants were done. 7 nurses participated in this study, Semi-structured interviews were8_special used for data including 4 males and 3 females, whose age ranged from collection and each lasted from 30 to 70 minutes. 32 to 45 years, their working experience at home was Interviews were done in a quiet place, which was offered between 3 and 12 years. One of nurses was interviewed by study participants. Most of interviews with the health two times. In addition, 8 family members, of whom 5 were care professions were done in their workplace and male and 3 were female, participated in our study. All of interviews with family members were done at their homes. them were close relatives of the clients. Two of them were One of the nurses was interviewed two times. the client’s wife, 2 mothers, 2 sons, and 2 were fathers. The first author of this article did the interviews. Their ages ranged between 29 and 65 years and provided After several warm-up questions, the interviews were care for their patients between 1 month to 5 years (Table 1,2). The data analysis explored 552 initial/ open codes. started with an open-ended question, which they were After reviewing and integrating the repetitive codes, 293 asked to narrate their experiences in as much details as initial codes were derived. Then codes were clustered in possible. When needed, the probing and explanatory subcategories and categories based on similarities and questions were used for additional clarification of the differences, so that, at the end of this process, five main answers given by participants. themes emerged: (a) conflict due to nurses’ expectations; JML_VolumeThe data analysis was done by using a (b) conflict due to the client’s family expectations; (c) qualitative content analysis method. Immediately after special characteristics of nurses; (d) conflict prevention each interview, it was transcribed verbatim and then it and (e) conflict resolution (Table 3). was read several times in order to obtain a general sense

25 Journal of Medicine and Life Vol. 8, Special Issue 3, 2015

Table 1. Characteristics of the client’s family members age gender Relationship with Duration of Patient’s diagnosis Marital status Duration of the patient involvement in care interview

65 female client’s wife 6 months CVA* married 30 44 male son 3 months CVA married 45 52 female mother 8 months Head trauma married 38

44 female mother 18 months poisoning married 53 31 male father 6 months ALS** married 52 56 male son 5 years Brain ischemia married 55

44 female client’s wife 8 months COPD*** married 48 29 male father 1 year ALS married 39 Abbreviations: *Cerebral vascular accident, ** Amyotrophic lateral sclerosis, *** Chronic Obstructive Pulmonary Disease

Table 2. Characteristics of professional health care workers age gender position Experience in home care Duration of interview (minute) (year)

40 male team leader 12 3_2015_draft70 37 male nurse 10 45 and 62 45 male nurse 5 52 33 female nursing assistant 3 iss 32 41 male nurse 11 68 36 female nurse 6 41 32 female nurse 4 43

Table 3. List of codes and categories category subcategory Code (examples) Expecting the nurse to clean the patient’s room Mismatch between the job and nurse Not seeing the nurse as a professional staff Conflict due to position nurses’ Physical works done by nurses expectations 8_special Inappropriate behavior of family Behavior with the nurse such as a laborer members Direct order of family members to the nurses Expectation of fast healing of the patient Painful stillness Conflict due to Lack of improvement is painful the client’s Expectation of nurse behavior Dissatisfaction of nurse sleeping during the night shift family according to family desire expectations Nurse should cook the patient’s food Giving the drugs without prescription by family members Family interference in the treatment Interference in the procedures Fatigue and exhaustion due to hospital work Home care as the second job Special The hospital work is more important for the nurse characteristics Poor management of an irritable family of nurses Poor communication skills JML_Volume Unwillingness to hear critique Determination of headlines of duties A meeting with the family members on the first day Preventing the by the team leader Clearing the mutual expectations of nurse and family conflict Family education and informing by Highlighting the process of coming days the team leader Explaining the family expectation

26 Journal of Medicine and Life Vol. 8, Special Issue 3, 2015

Communication management courses Preparing the nurses Communication management based on family stability Team leader is the reference Team leader as a judge All agree with the team leader Considering the financial benefit of the team The customer is always right Conflict Giving notification to the nurse resolution Explaining the situation to the family Notification to the parties Notifying the families Continuing the care providing to the extent possible Stop working with family Cutting the relation in unsuccessful tries

Conflict due to nurses expectations expectations that are sometimes not met. In some Most of the nurses working at homes and examples, the family members have different ideas providing care for intensive care patients are experienced, regarding the way work should be followed up. Also they skilled, and proficient. Because of their background, they are not familiar with the nursing profession, so the expect respect from the client’s family members and tend expectations of these two major groups are not matched to have a special condition at their work place. However, and may be a source of conflict. Otherwise, there is a the home and its special conditions, sometimes does not close relationship between nurse and family; sometimes match their expectations. As a professional person, the the domains of duties being mixed. nurse expects to manage the care plans with nobody’s A family member3_2015_draft said, “Who’s paying expects interference. In some situations, the family interference is the healing and improvement. Our patient’s situation did more than what is expected and can lead to conflict. not change during the past weeks. Stagnation is painful For example, a nurse said, “what I got during for the client’s family. Our expectations are not met.” those years was that, the behavior of women with nurses (Participant 12iss who has been caring for her husband for 8 at home is bad. When they want a work to be done by the months). nurse, they command the nurse. They behave with the Another participant said, “We do not have a nurse, as with an illiterate person who cleans the rooms special organization for home work. All the persons who for them. The nurse is a specialist and provides the are here, also work in hospital. The home care is their special type of care there. This can lead to conflict. second job. Someone who is beside the patient should be Basically, the nurse-family conflict occurs frequently” responsible full time, but most of them have to go to the (Participant 2, a 12 years experienced nurse). hospital early in the morning, so they sleep at the patients’ Another nurse says, “The level of the works done homes.” (Participant 9 who has been caring for his son for at home is not suitable for expert nurses. When we are 5 years). working in hospital, the nursing assistant8_special cleans the patient; hence, it is hard for us to do it at home. Some Special characteristics of nurses families have some expectations such as the nurse In Iran, nurses almost see the home care as a should clean the floor. Is it possible that the nurse also second job. Therefore, they are spending most of their prepares the foods? Could the nurse change the bed time and energy in the hospital. Due to the lack of a good sheet? However, the nurse does not accept these issues. communication skill, as well as fatigue and exhaustion, These can be sources of conflict.” (Participant 3, a 4 they may experience a bad communication with the family years experienced nurse). members. Another reason is that, most of them work in Conflict due to the client’s family expectations the controlled situation of ICU and cannot tolerate the full The client’s family experiences a high level of time presence of a family member. Therefore, the stress, fear, and uncertainty due to the client’s complex presence of a family member and the inappropriate situation. The family is not ready for the situation in which communication skills of a nurse could be a source of a complex patient with a team is present at home full time. conflict. Therefore, the family member is excitable and unstable. In A family member said, “Every nurse who comes addition, the family pays money and expects high quality here has a unique style and behavior. Each of them does JML_Volumeservices. The family has the direct responsibility of the suction, gavage, and change position in a special following up and supervising the treatment and care manner. Therefore, we have to adapt to different work process. However, they are not familiar with the domains styles and behaviors. It made the situation a little hard for of the work, standards, as well as the steps of any us.” (Participant 7 who has been caring for his father for 1 procedure. As a result of these responsibilities, they have year).

27 Journal of Medicine and Life Vol. 8, Special Issue 3, 2015

Another family member said, “Most of them work unsuccessful, in addition, the team relation with the family for subsistence and have physical and mental fatigue. will be cut. Moreover, they are impatient and cannot tolerate critique. One of the team leaders said, “I try to prevent They communicate badly. Some of them do not know how the conflict. Usually, I talk to the nurse to get shorter, and, to respond to our requests.” (Participant 6 who has been after that, I speak to the family members and warn them caring for his father for 6 months). about their behavior. In most cases, this can prevent severe conflict. For example, one of the nurses was going Preventing the conflict out of the patients’ room much. The client’s daughter told In most cases, team members have some me he works well, but he is going out of the room much conflict prevention strategies. They believe that the family and watches TV. I reported him. The problem was is placed in a conflicting and new situation. They are solved.” (Participant 8, a 10 years experienced team exposed to a situation to which they do not have any leader). previous experience, and, as a result, they do not know Another nurse said, “The patients’ daughter and how to manage this new situation. Most of the teams have mother were intervening very much. We reported the a meeting with the family members on the first day of the situation to the team leader. He spoke to them. At transfer of the patient home and offer some explanations present, the situation is better.” (Participant 8, a 3 years about the situation and headlines of the duties. Also the experienced nurse). communication rules and mutual expectations are cleared. The teams also have some communication Discussion management courses for nurses. Team leaders teach them how to manage the unstable families. They also Our findings showed that due to various factors, teach them how to work in a stable manner so that the the home environment is3_2015_draft prone to conflict. Conflict could family does not abuse them. arise from the nurse’s expectation, family members’ For example, a team leader said, ”before expectation or related to the special characteristics of transferring the patient home, we have a meeting with our nurses. The main themes or concepts of this study were team members. We talk about the patient’s situation, the related to conflictiss due to the family’s expectations, the needed care plan, and also the behavioral situation of the nurse’s expectations, special characteristics of nurses, family. Based on these comments we have a preventing the conflict and conflict resolution. Most of communication plan for every family. Also we have a studies about conflict are done in hospital setting and only session with the family members in the first hours after little attention is paid to the home based conflicts. These the patient’s transfer. We talk to them about their patient’s studies indicated that poor communication skills is the situation and works that the nurse should do. In addition, most important factor in conflicts between the client’s their duties are defined. This act could prevent the conflict family and the nurse [22,23]. Some of these conflicts are in most cases.” (Participant 6, an 11 years experienced also seen in home setting, but it seems that the types of team leader). conflicts in home setting are different. In the hospital, the family members are outsiders and have some problems in Conflict resolution 8_specialentering the treatment circumstance, but at home, the The disagreement between the family members nurse is an outsider [24]. Hence, he should try to enter the and the nurse increases gradually and reaches to a limit home environment and adopt this new situation. that cannot be solved between them. Therefore, they The first theme extracted from the data analysis search for a reference for judgment between them. was the conflict due to the nurse’s expectations. As a Usually, the private team leader is the first reference for professional member of the health team, the nurse has the problem solving. The conflict is reported and the some expectations that may not be achieved at home. situation is completely assessed by the team leader. One of the reasons for this phenomenon is different Different problem solving methods are used. Based on between the viewpoint of the nurse and the one of the the situation, in this step, the team leader decides to use client’s family. The difference in values, goals and one of the possible solutions. At first, he considers the believes could lead to conflict [25]. It is possible that the financial situations of the team and gives the right to the family members are not able to understand the situation family members. Therefore, in this first step he gives well. some notifications to the nurse. In more complex cases, The second theme of this study was the unmet the team leader gives some reminders to the family expectations of the client’s family members. The client’s JML_Volumemembers as well as to the nurse. In severe conflicts, the family members did not receive any financial support from incompatible person is withdrawn from the care program. the insurances and paid all the costs from their pocket. The team leader tries to continue the care providing to the Therefore, they expected high quality care and good extent possible. In some cases, the family cannot adapt to outcomes. Sometimes this viewpoint leads to a severe the situation and efforts to solve the conflict are conflict with nurses. Families are anxious about the money and their patient’s outcome. Other studies mention

28 Journal of Medicine and Life Vol. 8, Special Issue 3, 2015

the financial problems as a source of conflict [22]. Nurse confrontation with conflict including avoidance, could give timely and enough information about the cost competition, accommodation, compromise and of interventions and help the family choose between collaboration [29]. Each strategy is useful for its different possible treatments. This intervention could appropriate situation and nurses should learn to judge prevent the conflict. which strategy is useful for each situation. In this study, In addition, the family members are not well the avoidance was the most frequently used strategy. prepared for this stressful and hard situation. Therefore, Because of the financial benefit of the team, the nurse maybe they are irritable and prone to conflict. Education is managers usually neglect the value and rights of nurses. a communication bridge [22]. Giving the proper Others also report that avoidance is the most commonly information to the family members about the client’s used strategy [23]. In this strategy, the person neglects situation and the treatment process is helpful [26]. Also his own goals, values and concerns [19]. It is also called a empathy with family members could reduce the anxiety lose-lose strategy and has the worse outcome for nurses. [27]. The collaboration is described as the best way for conflict Special characteristics of nurses were one of the management. Collaboration results in a resolution with important predictors of conflict. Nurses described the poor desirable outcomes, so, this strategy is the win-win [36]. communication skills as an important factor resulting in conflict. Effective nurse-family relationship is considered Study limitations central to quality nursing and emotional support [28]. Because of the cultural barriers, the entrance in Nurses can mitigate the conflict effects by improving their the homes for doing the interviews was one of the hardest communication skills [29]. In Iran, we do not have a parts of this study. The families refused that the comprehensive framework for home care. Most of the researcher enters their home. Since the team leaders had qualified nurses work at home as a second job. So, they a close relationship with the family members and in most are stressed, frustrated and angry [30]. Many of other cases were respected 3_2015_draftby them, we wanted the team formal caregivers are unprofessional and have poor leaders to coordinate the time of interviews. communication skills. The studies published in our The other problem was regarding the voice country show the nurse-family relationship inappropriate recorder. Someiss family members did not accept the voice and ripe to conflict [31,32]. Inappropriate relationship recording. Therefore, one of the interviews was done could cause stress, temper, lack of confidence, violence without sound recorder and in other cases, sound and dissatisfaction [22]. recording was stopped whenever the participants Poor communication is described as a conflict requested. building factor, but the friendship and calm relationship between nurse and family members could lead to interest [33]. So, fulltime professional nurses with good Conclusion communication skills are needed in our country. Stress is Home care situation is prone to conflict due to seen in family members, the nurses should see this need various factors. The mentioned sources of conflict in and use a collegial relationship instead of coercion [17]. home care are different from the hospital. Based on these Conflict prevention is very important in the field results, appropriate interventions suitable for home of home health care. Before discussing8_special about the conditions should be implemented. intervention for conflict resolution, it is better to prevent it.

The home has a different circumstance compared to the Acknowledgement hospital and has unique challenges, so, the nature of This study is part of a PhD thesis supported by conflict is different. Most of the existing articles suggest The Deputy of Research of The University of Social the ways of conflict resolution [12,34]. The prevention of Welfare and Rehabilitation Sciences in Tehran. The conflict in home care setting is not well addressed in authors would like to thank all the nurses and the client’s literature. Most of the teams have a meeting with the family members for their cooperation and participation in family members on the first day of transferring the client the study. home in order to specify the headlines of duties.

Nurses who know the way the conflict is Financial Disclosure escalated, it is possible to prevent it and improve care The authors have no conflict of interests. providing [12]. Client centered care is one of the methods

that give information to the patient and participate in Funding/ Support decision making [35]. This strategy could prevent the This article has been derived from a thesis JML_Volumeconflict. research project and was funded by the Deputy of Despite the preventive strategies, the conflict Research, University of Social Welfare and Rehabilitation may happen and lead to critical incidents. Various Sciences, Tehran, Iran. methods of conflict resolution are used based on cultural

diversities. In most references, there are five styles of

29 Journal of Medicine and Life Vol. 8, Special Issue 3, 2015 References

1. Glazer NY. The home as workshop: 12. College of Nurses of Ontario. Conflict problems and sexual misconduct in the Women as amateur nurses and medical Prevention and Management: practice psychotherapy relationship. FOCUS: The care providers. Gender & Society. 1990; guideline. 2009. Journal of Lifelong Learning in Psychiatry. 4(4):479-99. http://www.cno.org/Global/docs/prac/4700 2007; 5(4):476-82. 2. Scheepmans K, de Casterlé BD, 4_conflict_prev.pdf. 26. Pytel C, Fielden NM, Meyer KH, Albert Paquay L, Van Gansbeke H, Boonen S, 13. Conerly K, Tripathi A. What is Your N. Nurse-patient/ visitor communication in Milisen K. Restraint use in home care: a Conflict Style?. Journal for Quality and the emergency department. Journal of qualitative study from a nursing Participation. 2004; 27(2). Emergency Nursing. 2009; 35(5):406-11. perspective. BMC Geriatrics. 2014; 14. Marquis BL, Huston CJ. Leadership 27. McAdam JL, Puntillo K. Symptoms 14(1):17. roles and management functions in experienced by family members of 3. Eustis NN, Fischer LR. Relationships nursing: Theory and application. 2009, patients in intensive care units. American between home care clients and their Lippincott Williams & Wilkins. Journal of Critical Care. 2009; 18(3):200- workers: Implications for quality of care. 15. Askew R, Williams PR, Rachel M, 9. The Gerontologist. 1991; 31(4):447-56. Martin O. Resolving Conflict in the Home 28. Irurita V. Factors affecting the quality of 4. Smith H, Hilliard T. Organizing home Care Setting. Home Healthcare Nurse. nursing care: the patient’s perspective. ventilation. Paediatrics and Child Health. 2008; 26(10):589-93. International Journal of Nursing Practice. 2011; 21(5):224-9. 16. Fujiwara K, Tsukishima E, Tsutsumi A, 1999; 5(2):86-94. 5. Laub M, Berg S, Midgren B. Home Kawakami N, Kishi R. Interpersonal 29. Marshall P. Conflict resolution: what mechanical ventilation in Sweden— conflict, social support, and burnout nurses need to know. inequalities within a homogenous health among home care workers in Japan. http://www.mediatecalm.ca/pdfs/what%20 care system. Respiratory Medicine. 2004; Journal of Occupational Health. 2003; nurses%20need%20to%20know.pdf; 98(1):38-42. 45(5):313-20. 2006. 6. Nelson JE, Cox CE, Hope AA, Carson 17. Gerardi D. Using mediation techniques to 30. Robinson B, Thurnher M. Taking care of SS. Chronic critical illness. American manage conflict and create healthy work aged parents: A family cycle transition. Journal of Respiratory and Critical Care environments. AACN Advanced Critical The3_2015_draft Gerontologist. 1979; 19(6):586-93. Medicine. 2010; 182(4):446-54. Care. 2004; 15(2):182-95. 31. Aein F, Elhani F, Mohammadi I. 7. Desai SV, Law TJ, Needham DM. Long- 18. Freshwater D. Crosscurrents: against Marginating the interpersonal relationship: term complications of critical care. Critical cultural narration in nursing. Journal of Nurses and parent's experiences of Care Medicine. 2011; 39(2):371-9. Advanced Nursing. 2000; 32(2):481-4.iss communication in pediatric wards. Iranian 8. Azoulay E, Pochard F, Kentish-Barnes 19. Kelly J. An overview of conflict. Journal of Nursing Research. 2008. N, Chevret S, Aboab J, Adrie C et al. Dimensions of Critical Care Nursing. 32. Abedi H, Alavi M, Aseman Rafat N, Risk of post-traumatic stress symptoms in 2006; 25(1):22-8. Yazdani M. Nurse-elderly patients family members of intensive care unit 20. Chreier M. Qualitative content analysis in relationship experiences in hospital patients. American Journal of Respiratory practice. 2012, Sage Publications. wards-a qualitative study. Iranian Journal and Critical Care Medicine. 2005; 21. Lincoln Y, Guba E. Naturalistic Inquiry. of Nursing and Midwifery Research. 2005; 171(9):987-94. Snyder L, Bowman S. 1985, Beverly Hills, 5(29):5-16. 9. Chaboyer W, Kendall E, Kendall M, CA, Sage Publications, 117. 33. O'Brien ME. Navy Nurse: A call to lay Foster M. Transfer out of intensive care: 22. Loghmani L, Borhani F, Abbaszadeh A. down my life. Journal of Christian Nursing. a qualitative exploration of patient and Factors Affecting the Nurse-Patients’ 2003; 20(4):32-3. family perceptions. Australian Critical Family Communication in Intensive Care 34. Hiemer A. Conflict Resolution. Journal of Care. 2005; 18(4):138-45. Unit of Kerman: a Qualitative Study. Nursing. rnjournal.com/journal-of- 10. Mitchell ML, Courtney M, Coyer F. Journal of Caring Sciences. 2014; nursing/conflict-resolutiona. Understanding uncertainty and minimizing 8_special3(1):67-82. 35. Registered Nurses Association of families’ anxiety at the time of transfer 23. Mahon MM, Nicotera AM. Nursing and Ontario. Nursing best practice guideline from intensive care. Nursing & Health conflict communication: avoidance as Client-centred care. 2002. available in Sciences. 2003; 5(3):207-17. preferred strategy. Nursing Administration http://rnao.ca/sites/rnao- 11. Terol E, Hamby EF, Sacristán A, Sanz Quarterly. 2011; 35(2):152-63. ca/files/Client_Centred_Care_0.pdf. F, Minué S, Gil D et al. An organizational 24. Coffman S. Home-care nurses as 36. Pepper JM, Leddy S, Leddy P. model for a primary care program of strangers in the family. Western Journal Conceptual bases of professional nursing. home health care in Spain: a description of Nursing Research. 1997; 19(1):82-96. 1998, Lippincott Williams & Wilkins. of the program. The Health Care 25. Norris DM, Gutheil TG, Strasburger LH. Manager. 2001; 20(2):18&hyhen. This couldn't happen to me: boundary

JML_Volume

30 Journal of Medicine and Life Vol. 8, Special Issue 3, 2015, pp.31-35

The effect of radiology services outsourcing on patients’ satisfaction in Tehran city hospitals

Mousavi H*, Khodamoradi F**, Rostami Zarinabadi CH***, Mozafar Saadati H****, Mohammadi M*, Mahboubi M*****, Mousavi N****** *Kermanshah University of Medical Sciences, Kermanshah, Iran, **Tehran University of Medical Sciences, Tehran, Iran, ***Ilam University of Medical Sciences, Ilam Iran, ****Shahid Beheshti University of Medical Sciences, Tehran, Iran, *****Abadan School of Medical Sciences, Abadan, Iran, ******School of Engineering, Science and Research Branch, Islamic Azad University, Tehran, Iran

Correspondence to: Neda Mousavi, MSc student of Mechatronic Engineering, School of Engineering, Science and Research Branch, Islamic Azad University, Tehran, Iran, Tehran, Hesarak, Daneshgah Blvd, Iran, Phone: +98 21 4486 5179, E-mail: [email protected]

Received: March 14th, 2015 – Accepted: June 18th, 2015

Abstract Background: In order to have a developed society we should have healthy, active, and happy individuals3_2015_draft and present that extended healthcare services play an important role in increasing the society’s health level. Health in a society includes the society’s and people satisfaction with the condition and an assuring the situation that they can live healthy. On the other hand, considering the self- governing plan of hospitals from 1995, the hospital authorities should choose a method of presenting services, and, the hospital is able to present those activities during its own activities from an economic point of view.iss The present research was done while aiming to determine the effect of the Outsourcing of the Radiology Unit on the patients’ satisfaction in hospitals of Tehran. Method: The present research was done in a case-evidence and sectional study. Considering the weight of a month’s references to the Radiology Unit, which included around 1200 individuals, the volume of samples for measuring the rate of the patients’ satisfaction with the means of Morgan table was equal to 291 individuals. In order to decrease the error percentage in each hospital we questioned 300 individuals. (n+10) were questioned and the gathered data were analyzed by means of SPSS software version 21 and were then studied by climagraph – Smirnoph, Du Whitman – Vitney K tests. Findings: the median of the patients’ satisfaction of turned over and non-turned over Radiology Unit services were 41.46 and 45, respectively (from the maximum score of 60). A significant difference was observed between the patients’ satisfaction in the two hospitals from the statistical point of view (p-value<0.001) and there was also a significant difference between the patients’ waiting time (p-value<0.001). The research’s findings showed that the outsourcing has a negative effect on the patients’ satisfaction and the duration of their waiting time. Conclusion: most of the times, managers8_special do the outsourcing without considering human and organizational dimensions and characteristics by just justifying it based on decreasing the expenses. Therefore, it is essential for authorities to consider not only the financial aspects but also the individual and human aspects while setting the outsourcing contracts and arrangements.

Keywords: outsourcing, hospital, efficiency, effectiveness

Introduction decreasing the resources is always increasing and the gap between the achievable and required resources is Hospitals have a special importance as the developing on a daily basis. What is more, is that the biggest and most expensive operational unit of healthcare private hospitals, especially in developing countries, and treatment systems. Hospitals use 50-80 percent of all which are directly governed by the state authorities, have the expenses in the whole healthcare section and have a weak performances, and efforts to improve their great share of educated and highest level of personnel performance were not very efficient by applying internal [1]. management modifications [3]. During recent years, Iran JML_VolumeThe authority of government places a lot of has turned over a part of the healthcare services to the pressure on the policymaking, execution, and observation private section aiming to improve the quality of healthcare of this section and leads the hospital system to turn over and treatment services, increasing the patients’ some of its administrative activities to the non- satisfaction and decreasing expenses [4]. Outsourcing governmental section, in order to improve its efficiency includes the act of transferring some of the internal [2]. However, the process of changing the expenses and activities of an organization to its supplier outside of the Journal of Medicine and Life Vol. 8, Special Issue 3, 2015

organization and transferring the decision making right to mentioned issues confirmed that we should select a the outside of the organization based on a contract. In method that the present services to the patients should fact, the outsourcing does not only imply activities but also work with, having the lowest expense and highest quality, manufacturing agents (human resources, equipments, so that the hospital’s expenses could be minimized on facilities, technologies and other assets) and the authority one hand and the hospital should be enabled to continue of decision making in most cases is transferred [5]. working and present the highest quality services to the Organizations try to turn over the internal affairs patients on the other hand. This way, not only their of the organization and make their body as small as expenses decrease but they also achieve their possible due to various reasons [6]. Alvani believes that satisfaction. Therefore, the present research was benefits resulted by outsourcing are factors such as executed while aiming to study the effect of outsourcing decreasing expenses, organization’s concentration on its on the efficiency and affectivity of Radiology Unit services main activities, saving the time for doing the internal in Hospitals of Tehran City. affairs of the organization, decreasing the risk by entering in partnership with another unit in an unsafe business environment, improving consumer service, decreasing the Method company’s employees, creating the sense of competition The present research was an analytical and in various sections of the organization [7]. Outsourcing witness based study, its results being applicative, and its was used in order to lead to an efficient management of time duration being periodic, during the time period of the resources and increasing the quality and satisfaction June until January 2013. The present research was done of various parties. Considering the existence of the in the Educational-Medical Hospitals of Tehran. The possibility of outsourcing in so many sections of the statistical society included all the patients during a month hospital, we could benefit from it in governing the hospital in the Radiology Unit3_2015_draft in both hospitals (N=1200). and we could evaluate the success rate by defining Considering the fact that a load of people coming to the specific indexes [8]. The patients’ satisfaction is an Radiology Unit was around 1200 individuals in each important scale to evaluate services or received product hospital, the sample volume to measure the patients’ because satisfied patients are more eager to continue iss satisfaction rate was calculated to be equal to 291 using medical and healthcare services, keeping their individuals by means of Morgan table. 300 individuals contact with the service supplier and following the medical (n+10) were questioned in each hospital to lower the error and control regimes [9]. Con Vikticle et al. defined the percentage and the simple accidental sampling method care quality as the satisfying of physical needs with was used for sampling. The method to gather data for the providing professional care, social-mental support, study of the radiology patients’ satisfaction was the field satisfaction with care [10] and ensuring the presence of method and its tool was a questionnaire. This general and multi-dimensional cares to the patient [10,11]. questionnaire included 12 questions about the condition Many expertises consider the patients’ rate of satisfaction of the unit, 2 related to the waiting duration. The from the hospital services as one of the most important mentioned questionnaire was scaled by means of Likert indexes of efficiency and service quality in various scale from 1 to 5 in such a manner that number 1 was sections [12]. It seems that studying8_special the patients’ related to the lowest level of satisfaction and number 5 satisfaction is one of the most important outputs of the was related to the highest rate of satisfaction, the healthcare systems [13,14] and evaluating the care by the maximum point being 60 points. Questions related to the patient is also one of the major methods to measure and waiting time duration were divided into two sections. The scale the quality of medical and healthcare services [15]. first question was related to the time between the Moreover, Peiravi also mentioned in his research that in entrance and admission of the patients and the second Iran, the Ministry of Health has obligated all hospitals to question was related to the time between the admission do periodic evaluations regarding the patients’ satisfaction and receiving radiology services. The questionnaire was and also required interventions to increase the patients’ designed by Medical University lecturers and its satisfaction, since 2011, so that it can comply with its admissibility–stability was also confirmed by lecturers and main mission [16]. Considering the mentioned issues also hospitals clinical governance committee. To confirm about the patients’ satisfaction, we should also point out the credibility and admissibility, the questionnaire was the important issue that although nowadays companies analyzed and confirmed by 10 experts. What is more, is move toward outsourcing, it represents a part of their the fact that in order to determine the stability of the responsibilities in the whole world, so that they can JML_Volume questionnaire, Cronbach alpha was applied. After achieve benefits such as decreasing expenses to get hold gathering the research data, finally, the gathered data of advanced technology. Nevertheless, the difference in were analyzed by SPSS version 21 and, to analyze data, organizational cultures and complexity of managing descriptive statistics was used in redundancy, median, created relations means that outsourcing could lead to standard deviation tables, and deductive statistics failure or lack of satisfaction [17]. Therefore, all the above-

32 Journal of Medicine and Life Vol. 8, Special Issue 3, 2015

including Kelmogroph–Smirnoph test, Uman–Whitney test In order to determine the norm of distributing and K2. data related to the patients’ satisfaction the climagraph- Smirnoph test was used. By means of this test, it was Findings determined that the distribution score of the patients’ Findings of the present research indicated that satisfaction was abnormal (p-value=0.000). Therefore, in the median of the patients’ satisfaction in the turned over order to compare the median scores in the two units, unit was equal to 41/ 46 (7/ 3±) from the maximum 60 nonparametric Uman-Vitney test for the patients’ points, equal to (69%) and the median of the patients’ satisfaction score was used. A significant difference was satisfaction in the non-turned over unit was equal to 45 (6/ observed between the patients in these two hospitals (p- 94±) from the maximum score of 60 points (75%). This value=0.000) and since the p-value was so small, it fact indicated a lower satisfaction of pointers in the turned clearly showed the severity of differences among over section in comparison with the public section, and, medians. Therefore, it was obvious that the outsourcing the minimum medians among all aspects, was related to had a great impact on the patients’ satisfaction. the patients’ satisfaction in turned over Radiology Units, Also, the results indicated that most patients also being related to giving turns to the system with the were accepted in a time duration of 16 to 20 minutes after lowest median of 3.11, satisfaction of the existing entering the unit in turned over units, while in non-turned comforting equipments in the unit with a median of 3.36, over units, most of the patients (42%) were accepted in 5 and personnel behavior while getting accepted, 3.41. to 10 minutes. Findings also showed that most patients (42%) of turned over units, were X-rayed in a 16-20 minutes time period, after they were settled, while in non- turned over units, most patients (33.3%) were X-rayed 5- 10 minutes after they were received. Time duration patients waited for to be3_2015_draft received in two units, showed a significant difference based on K2-test (p-value-0.000) and the waiting time in-between, and the X-ray in both units was lessiss significant based on K2-test (p-value - 0.000). Since the p-value was so small in both cases, it indicated that the outsourcing had a great influence on the patients’ waiting time duration since they entered, were received, and were X-rayed. Patients’ waiting time duration is presented in Table 1. Results also indicated that 225 individuals among patients of turned over unit (75%) and 277 individuals among the patients of the non-turned over unit (92.3%) category suggested these units to others and this Fig. 1 Median comparison of each dimension of the difference was significant based on the J2-test (p-value- patients’ satisfaction in two hospitals 0.000). Therefore, the outsourcing had a great impact on

8_specialsuggesting the Radiology Unit to other patients.

Table 1. Redundancy percentage of waiting time duration between the patients’ entrance and being received Time duration between entrance and being received More Total 10 -5 15 -11 20 -16 30 -21 45 -31 than 45 number 25 73 129 60 12 1 300 Firuzgar percentage 8.3% 24.3% 43.0% 20.0% 0.4% 0.3% 100.0% Hospital number 126 104 54 11 2 3 300 Valiasr JML_Volumepercentage 42.0% 34.7% 18.0% 3.7% 0.7% 1.0% 100.0% number 151 177 183 71 14 4 600 Total percentage 25.2% 29.5% 30.5% 11.8% 2.3% 0.7% 100.0%

33 Journal of Medicine and Life Vol. 8, Special Issue 3, 2015

Table 2. Redundancy percentage of time duration between being received and radiography Time duration between being received and radiography More than Total 10 -5 15 -11 20 -16 30-21 45 -31 45 Number 19 58 121 66 23 13 300 Firozgar Hospital percentage 6.3% 19.3% 40.3% 22.0% 7.7% 4.3% 100.0% s number 100 91 63 28 9 9 300 Valiasr percentage 33.3% 30.3% 21.0% 9.3% 3.0% 3.0% 100.0% number 119 149 184 94 32 22 600 Total percentage 19.8% 24.8% 30.7% 15.7% 5.3% 3.7% 100.0%

Findings resulted in the present research, The second factor, which had the lowest rate of showed that the median of other sectors authorities’ satisfaction, was related to the welfare equipments, which satisfaction with the turned over unit of 29.26 (5.65±) had was observed in both turned over and non-turned over the maximum score of 70 points and the median of other units. The mentioned median was equal to (3.36) in non- sectors authorities’ satisfaction of 28.97 (5.1±) had a turned over unit and this was more due to the lack of work maximum score of 70 points. The authorities’ satisfaction force to move the wheelchair, while this median was with the turned over section and non-turned over section equal to (3.54) in the turned over unit due to the lack of was almost equal. The lowest median observed among equipments inside the unit. items related to the authorities’ satisfaction with a turn The third factor that showed the lowest median over radiology unit was related to question number 3 in in comparison with the other factors in turned over units relation with on time access to portable radiology devices was the personnel’s behavior while receiving the patient, with the minimum median of (2.72) and accepting with a median equal to (3.41)3_2015_draft and such a claim could be suggestions and also applying them by the median of justified by the reception of the personnel’s high work load (3.05). and their exhaustion. Therefore, to fix this problem, not only should we decrease workload but it is also essential to educate theiss critical communication skills to turned over Discussion units’ personnel. The results of the present research also The present research was done aiming to indicated that most of the patients (43%) were received in determine the effect of outsourcing on the efficiency and a time duration of 16-20 minutes while the receiving time effectiveness of hospitals Radiology Unit. Results showed duration in non-turned over for most of the patients (42%) that the weight media of patients’ satisfaction score in turn was equal to 5-10 minutes after entering the unit, which over radiology units was (41.46) and in non-turned over showed a significant statistical difference. Badroldin was (45), being significant from the difference statistical concluded in a research entitled “Patients’ satisfaction point of view. Results indicated that the patients’ with medical services in educational hospitals of Saudi satisfaction was higher with non-turned over radiology Arabia” that the most important factor expressed by units and therefore the outsourcing had a negative effect patients about their dissatisfaction with medical services on the patients’ satisfaction which was 8_specialsimilar to studies was the long time duration of waiting to receive their of Baderaldin, Amerion and Mohaghegh and in contrast medications [18]. Moreover, Amerion found out a study with primarily expectancy of executing outsourcing entitled “Outpatients and inpatients’ satisfaction of army procedure. The most extended rate of dissatisfaction hospitals” that the greatest dissatisfaction (19.2%) in the among patients in analyzing the major factors of pharmaceutical sector, was the long waiting time to dissatisfaction was the long time duration of waiting [18]. receive medication, and the minimum rate of Amerion considered the lack of sufficient explanation in dissatisfaction (19.2) in clinic, was related to the fact that order to get ready for radiology the reason for the doctors made patients wait and generally, the most minimum rate of satisfaction (7.8%) [14], while important reason of dissatisfaction in this research, was Mohaghegh et al. presented the insufficient time related to the waiting time to receive medication (19.2%) investment of pharmacy employees for consulting [4] as [14]. being a reason. Meanwhile, the present research believed Taking into account the present research, we that lack of satisfaction in turned over unit was the result could consider that increasing the time duration to receive of giving the turn system the minimum median of (3.11) a patient is due to a lack of enough workforce in the and, to confirm this, we could mention the lack of devoting reception and, increasing the waiting time to be scanned JML_Volumeenough work force for recipient part in turned over unit, is due to the lack of enough workforce in the scanning existence of 5 secretaries in 3 working shifts for the whole section. Therefore, obtained results indicated a negative unit, which included radiology, MRI, bone accumulation effect of outsourcing on the patients’ waiting time and other services, led to the increase in work load, and, duration. as a result, caused problems in the system of giving turns.

34 Journal of Medicine and Life Vol. 8, Special Issue 3, 2015

What is more important is the fact that based on over services without any consideration related to human obtained results, 225 individuals among the patients who and organizational characteristics and dimensions, went to turned over radiology (75%) and 277 individuals justifying it by decreasing costs. Therefore, it is essential among the patients who went to non-turned over and critical for authorities to consider not only the financial radiology (92.3%) recommended these hospitals to others aspects but also the individual and human aspects of the and the higher percentage of non-turned over radiology process while settling an outsourcing contract. indicated the higher rate of patients’ satisfaction with these types of units. Acknowledgements This article is the result of project as “The effect of radiology services outsourcing on patients’ Conclusion satisfaction in Tehran city hospitals” approved by the Student Research Committee, Kermanshah University of The present research showed that the rate of Medical Sciences in 1394 with the code 94027. patient’s satisfaction with radiology services was decreased and this showed that managers usually turn

References

1. Jacobs P. The economics of health and service outsourcers. Tehran: Ghaside- care. Payesh Health Monitor. 2002 ; medical care. Third ed., 1991, Aspen Sara, 2004. 3,1:55-63. Publishers, INC. 8. Mousazadeh Y, Jabaribeirami H, Janati 14. Amerion3_2015_draft A, Ebrahimnia M, Zarchi AK, 2. Ferdosi M, Farahabadi M, Rejalian F, A, Asghari Jafarabadi M. Identifying and Tofighi S, Zaboli R, Rafati H. Inpatient Haghighat P. Outsourcing of medical Prioritizing Hospital’s Units for Outsourcing and outpatient satisfaction of a military records unit services: case study of Based on Related Indicators: a Qualitative hospital Military medicine. Military Isfahan Kashani hospital. Health Inform Study. Journal of Health. 2012; 4(2):122- Medicine. 2009; 11(1)):37-77. Manage. 2010; 38,12:658-68. 33. iss15. Rubin H. Patients’ ratings of outpatient 3. Gholamzadehnikjo R. Designing a model 9. Schommer J, Kucukarslan SN. visits in different practice settings: results of public-private partnership in Measuring patient satisfaction with from the Medical Outcomes Study. JAMA. governmental hospitals. (Dissertation). pharmaceutical services. Am J Health 1993; 270:835-40. Tabriz: Tabriz University of Medical Syst Pharm. 1997; 1:2721-32. 16. Peyrovi H, Bahadori A, Ashghali- Sciences. 2012; 23. 10. Kunaviktikul W, Anders R, Srisuphan Farahani M, Haghani H. Comparison of 4. Mohaghegh B, Asadbaygi M, Marnani W, Chontawan R, Nuntasupawat R, in-patients' satisfaction with different AB, Birjandi M. The impact of outsourcing Pumarporn O. Development of quality of domains of nursing care. Journal of the pharmaceutical services on nursing care in Thailand. Journal of Nursing Management. 2013; 2(1):59-66. outpatients' satisfaction in Lorestan rural Advanced Nuring. 2001; 36(6):776-84. 17. Rezayi M, Aghayi MS, Mozdgir A. Effects health centers. Journal of Hospital. 2011; 11. Ghafari S, Mohammadi F. Concept of organizational culture on outsourcing. 10 (3). analysis of nursing care: a Hybrid Model. Promotion of domestic potency with 5. Khodaverdi R, Zohre E. Outsourcing Journal Mazandaran University Medical Approach to domestic. 2010. strategy; benefits, problems and 8_specialSciences. 2012; 22,1:153-64. 18. Mohamed BA, Al-Dogaither AH. challenges. Expertise Journal of Parks and 12. Rad AM. The evaluation of the degree of Patients' Satisfaction With Pharmaceutical Growing Center. 2010; 25(7l):65-72. satisfaction of patients from admission Services At Teaching Hospitals, Riyadh, 6. Tanhaie A. Outsourcing. Tadbir. 2002; services in Razi Hospital. Qazvin Health Saudi Arabia. Saudi Pharmaceutical 124:37-40. Inf Manage. 2004; 1(1):28-32. Journal. 2004; 12(1):35-41. 7. Alvani M, Ashrafzade F. Outsourcing 13. Sadjadian AS, Kaviani A, Yunesian M, guidance for manager's decision making in Fateh A. Satisfaction with breast clinical

JML_Volume

35 Journal of Medicine and Life Vol. 8, Special Issue 3, 2015, pp.36-43

An evaluation of high-risk behaviors among female drug users based on Health Belief Model

Ilika F*, Jamshidimanesh M**, Hoseini M***, Saffari, M****, Peyravi H***** *School of Nursing and Midwifery, Tehran University of Medical Sciences, Tehran, Iran **School of Nursing and Midwifery, Shahroud University of Medical Sciences, Shahroud, Iran, ***Epidemiology and Biostatistics Department, School of Public Health, Tehran University of Medical Sciences, Tehran, Iran, ****Education Health Department, Baghiat Allah University, Tehran, Iran, *****Center for Nursing Care Research, Iran University of Medical Sciences, Tehran, Iran

Correspondence to: Jamshidimanesh Mansoureh School of Nursing and Midwifery, Shahroud University of Medical Sciences, Shahroud, Iran, Shahrud, Semnan, Iran, Mobile phone: +98 9192266207, E-mail: [email protected]

Received: March 14th, 2015 – Accepted: June 18th, 2015

Abstract Objectives. Due to the physiological nature of female reproductive system, women are susceptible to infectious diseases, especially STD and AIDS. Addiction and high-risk behaviors also increase the risk of these diseases. The purpose of this study was to investigate high-risk behaviors among female drug users based on the Health Belief Model. 3_2015_draft Methods. Participants of this cross-sectional study were 106 female drug users aged 18 years and older; with the lowest level of literacy skills and been involved in sexual relationships. They came to Drop-In-Centers (DIC) in Tehran, capital of Iran. Data analysis was conducted by using a logistic regression analysis and Pearson correlation analysis. Results. The results indicated that women’s overall awareness was moderate.iss There were significant correlations between awareness and age (p=0.006), awareness and education (p< 0.0001), and awareness and marital status (p=0.062). Perceived sensitivity and severity were significantly associated with education level (p=0.007) and (p=0.014), respectively. Mean scores of perceived benefits and perceived severity for high-risk behaviors were estimated to be higher than other components. Conclusion. Awareness and perceived susceptibility must be raised regarding the educational schedule, which is based on the health belief model in the addiction field, to reduce perceived barriers in risky behavior prevention of women who use drugs.

Keywords: risky behavior, health belief model, drug or substance using women

Introduction The United Nations Office on Drugs and Crime 8_special(UNODC) reported that 11-21 million people in the world Drug abuse as a serious global problem would use injectable drugs. Up to 2008, approximately 250,000 lead to irreparable damages to each society with regard to injecting drug users had been identified in Iran. Statistics the individual and social characteristics of persons in that indicated that the rate of injecting drug use was 33 society [1]. Drug users’ interaction with the environment percent over the last 30 years and it has had an increase and their adaptive mechanisms as well as their behaviors of almost 10 percent over each decade [6]. are psychologically regarded as topics of paramount It is commonly thought that drug abuse and importance. In some cases, these topics are considered addiction are primarily attributable to men and that women as the cause and effect of addiction. High-risk behaviors are less likely to use drugs. Although there is no accurate are those that bring about very unpleasant consequences statistics on the population of female drug users in the for addicts or other people [2]. Statistics showed that 7.4 country, according to some research, female population percent of the world’s population aged 15 years or older include 6.9 percent of addicts of the country. The Ministry are drug users [3]. Iran has the highest per capita rate of of Health also reported that there is one female drug user heroin and opium addiction in the world. According to the besides each eight male drug users [7]. There is an 2006 Census, the number of drug users was estimated at increase in the likelihood of developing viral infections 1.2 million, i.e. almost one out of every 2.2 people from such as hepatitis B, C, AIDS, among injecting drug users JML_Volumeadult population [4]. It is estimated that 10 percent of [8]. Women make up 3-5 percent of injecting drug users women in Asian countries and 40 percent of them in [5]. The numbers of female drug users are less than their European countries are drug users. Therefore, the male counterparts; however, the destructive effects and number (16 to 38 million) of female drug abusers in the the severity of addictions as well as the risks are higher world is significant [5]. for women [9]. The results of research carried out in Iran indicated that about 5-17 percent of female drug abusers Journal of Medicine and Life Vol. 8, Special Issue 3, 2015

have unprotected sexual relations [10]. Injecting female submitting it to the relevant agencies and departments, drug users have a disproportionately higher prevalence of the researcher thoroughly described the purpose of the HIV than men [11]. Compared to men, sharing syringes study. The selection criteria for female drug users and needles is higher for women who live with partners participating in the study were being 18 years or older and due to the fact that the availability of injection tools is having sexual relations. After checking the eligibility of determined and controlled by their sexual partner [12]. participants and having their consent and written Women share needles and syringes with partners who permission, they were ensured of the confidentiality of all have high-risk sexual behaviors [13]. Methamphetamine information submitted. The questionnaire consisted of increases sexual activity and the use of this material is seven parts as it follows. Data in this questionnaire-based associated with the use of syringes and needles [14]. HIV study were collected through spatial databases, books, infection for this population is twice as much as others [12]. Because of sharing needles, 2-4 million people in and articles. The tool consisted of seven parts as it developing countries have been infected with hepatitis C follows: that can be spread to other people. Reviewing the a) Demographic information containing three parts; literature reveals that the prevalence of hepatitis C among personal information with 13 items, 14 items on the injecting drug users ranges from 1.9 to 100% [15]. The history of drug use and sexual behavior background with possibility of women prostitution for the sake of money 16 items, b) Awareness (18 items), c) Perceived and drugs increases the risk of HIV infection [16]. Tattoos sensitivity of high-risk behaviors (9 items), d) Perceived are created by 35.7 percent of female drug users and the severity of the high-risk behavior consequences (9 items), use of shared needles to perform the operation is e) Perceived benefits and Perceived barriers of preventive estimated in about 45 percent of cases [17]. A lot of behaviors, each containing 6 and 13 items, f). Validity of research has shown that the incidence of sexually the questionnaire was tested by using content validity. transmitted diseases in injecting and non-injecting drug Next, after developing the items, 10 faculty members who users are more prevalent, as syphilis is reported to be of 3_2015_draft had expertise and experience in fields of high-risk 1-6 percent, Chlamydia 1-5 percent, and herpes type II 38-61 percent and HPV types 16 and 18 among female behaviors, behavior change models in health education, addicts 38 and 42 percent, respectively [18]. HBM is one and researching drug users were asked to confirm the of the first models which uses behavioral science theories suitability of issthe questionnaire for the objectives of the for the assessment of health-related problems and it is current study and for testing hypotheses. Receiving their widely used to explain preventive behaviors [19]. This comments, they were applied and reliability was model is comprehensive, further contributes to the approved. The reliability of the questionnaire was disease prevention, and shows the relationship between determined through distributing the questionnaires beliefs and behavior. It is founded on the assumption that completed by 10 eligible samples. Two weeks later, the the preventive behaviors are decreasing an individual’s same individuals took a retest. It is worth noting that the vulnerability to diseases and the impact of illness on participants in this part of the study were excluded from individual lives. They also include hygiene measures in subsequent phases. The values of Cronbach’ alpha reducing the severity of diseases [20]. In fact, it reliability coefficient for awareness was highlighted. The investigates the psychological and probable factors affecting the persons’ decisions. Studies have seconded reliability coefficients of perceived sensitivity, perceived that this model has been proven useful 8_specialin predicting why severity, perceived benefits, and perceived barriers were people accept or reject various health behaviors. HBM is also calculated. Finally, based on results obtained through used as a theoretical framework to study and identify the retest and a statistic counselor’s opinion, the reliability of impact of health beliefs on healthy behaviors [21]. The the questionnaire was estimated. The researcher components included in this model contain barriers, assigned 2 marks for the correct answers, while perceived benefits, perceived susceptibility, and evaluating the answers to each item in the awareness perceived severity. These can satisfy the objective of section, 1 for incorrect answers, and 0 for an uncertain investigating high-risk behaviors associated with female answer. Other sections of the questionnaire were drug users. evaluated based on a 5-point Likert Scale (completely agree, agree, neutral, disagree, and completely disagree). Material and Method Completely agree scored 5 and completely disagree scored 0. For data extraction, data were analyzed by Participants in this cross-sectional study included using SPSS Software version 16 and descriptive/ 106 women with drug-use disorders who came to two analytical tests including t-test, logistic regression Drop-In-Centers (DIC) affiliated to the State Welfare analysis, and Pearson correlation analysis. JML_VolumeOrganization and Family Health Association of Iran in Tehran. After obtaining approval from the ethics Results committee of Tehran University of Medical Sciences along Demographic characteristics of the 106 with getting a referral from the health departments and participants revealed a mean age score of 35.7 ± 7.9 37 Journal of Medicine and Life Vol. 8, Special Issue 3, 2015

years and a standard deviation of the highest frequency of status, most of them (n= 43; 40.6%) were divorced or 67% for the age group 30 years and older. A majority of widowed (Table 1). these participants (n=69; 65.1%) had elementary and secondary levels of education. With regard to their marital

Table 1. Characteristic descriptive statistics (n=106) Demographic characteristic N % 20-29 25 24.0 Age group 30-39 45 34.3 40> 34 32.7 illiterate 5 4.7 Level of Education Elementary and middle school 69 65.1 Diploma and above 32 30.2 Permanent marriage 29 27.4 Temporary marriage 31 29.2 Marital status Divorced and Widow 43 40.6 single 3 5.8

The most common drugs used were glass (81%), Dividing the perceived sensitivity into three opiates (66.7%), heroin (41.9%), methadone (43.8%) and groups (namely low, medium, and high), the majority of cannabis (26.7%). The most common ways of using drugs participants (55.6%) were located in a moderate group. It were non-injection (85%) and intravenous drug injection was in the case that 61.5 percent of participants obtained (15%). As it was noted, they first experienced drugs used a high score regarding the perceived severity of the with their husbands (47.1%) and then with their friends consequences of high-risk3_2015_draft behaviors. That is, the mean (32.1%). score of perceived severity with the lowest and highest The mean score observed for women’s scores of 11 and 100, was 76.5 ± 17.2. The mean score awareness with SD ±21.3 was 61 as the lowest and of the perceivediss benefits of preventive behaviors with the highest scores were 25 and 100, respectively. The scores lowest and highest scores of 25 and 100 was 79.2 ± 19, were divided into three levels: low, medium, and high. and 73.6 percent of the participants obtained a high score Subsequently, the results showed that most of the in this section. It is worth noting that the highest mean participants (42.1 percent) had moderate awareness score was obtained for this section. The majority of about high-risk behaviors. The mean score of perceived women also recognized small obstacles in performing sensitivity to high-risk behaviors was 65.2± 17 with the high-risk behaviors (mean = 44.5± 19.9; Refer to Table lowest and highest scores of 28.1 and 100. 2).

Table 2. Women's knowledge based on health believe model Variable Low Moderate High Mean (SD) Min Max N (%) N (%) N (%) knowledge 61 (21.3) 8_special25.0 100 21 (19.8) 52 (42.1) 33 (31.1) susceptibility 65.2 (17.) 28.1 100 4 (3.8) 59 (55.6) 43 (40.6) severity 76.5 (17.2) 11.1 100 3 (2.9) 37 (35.6) 64 (61.5) benefits 79.2 (19.) 25.0 100 4 (3.8) 24 (22.6) 78 (73.6) barrier 44/5 (19.9) 0 100 21 (19.8) 52 (42.1) 33 (31.1)

Using the Spearman correlation test, the results between awareness and marital status. Logistic showed that the awareness had a significant correlation regression analysis was also carried out to simultaneously with age (p=0.006), education (P< 0.0001) and marital investigate the effect of age, education level, and marital status (P=0.062). This means that awareness increased status on awareness. It was observed that the marital with the increasing in age and levels of education. A status had no significant relationship in the presence of significant relationship (α= 0.10) was also observed the other two variables (Table 3).

Table 3. Correlation of Knowledge, Aga, Level of Education and Marital Status Knowledge Sum Low Moderate High P value JML_Volume N(%) N (%) N(%) N(%) 3 10 12 25 20-29 (12.) (40.0) (48.0) (100) Age group *0.006 9 19 17 45 30-39 (20.0) (42.2) (37.8) (100)

38 Journal of Medicine and Life Vol. 8, Special Issue 3, 2015

8 22 4 34 40> (23.5) (64.7) (11.8) (100) 3 2 0 5 illiterate (60.0) (40.0) (0) (100) Elementary and Middle 14 41 14 69 Level of Education *<0.0001 school (20.3) (59.4) (20.3) (100) 4 9 19 32 Diploma and Above (12.5) (28.1) (59.4) (100) 9 11 9 29 Permanent Marriage (31.0) (37.9) (31.0) (100) 9 14 8 31 Temporary Marriage (29.0) (45.2) (25.8) (100) Marital Status **0.062 3 26 14 43 Divorced and Widow (7.0) (60.5) (32.6) (100) 0 1 2 3 Single (0)0 (33.3) (66.7) (100) * Spearman’s Rho Correlation ** Fisher’s Exact

Perceived sensitivity was not significantly no significant relationship with age, education level, or associated with age and marital status; however, it had a marital status. It was in the case that a significant significant correlation with the education level (P=0.007). relationship was observed between perceived barriers The higher the education level was, the greater the and education levels (p=0.014) (Table 4,5). perceived sensitivity. Perceived severity and benefits had 3_2015_draft

Table 4. Correlation of Perceived Susceptibility, Perceived Severity, Aga, level of Education and Marital Status Perceived Susceptibility Perceived Severity Demographic Sum P Sum P Low Moderate High Low Moderate High Characteristics N (%) value iss N (%) value N (%) N(%) N (%) N (%) N (%) N (%) 13 25 9 14 24

Age group 20-29 1 (4.0) 11 (44.0) 1 (4.2) (52.0) (100) (37.5) (58.3) (100) 15 45 27 45 30-39 1 (2.2) 29 (64.4) *0.735 0 (0) 18 (40.0) *0.752 (33.3) (100) (60.0) (100) 15 34 21 33 40> 1 (2.9) 18 (52.9) 2 (6.1) 10 (30.3) (44.1) (100) (63.6) (100) 1 1 5 1 4 5

Education illiterate 3 (60.0) 0 (0) Level of (20.0) (20.0) (100) (20.0) (80.0) (100) Elementary and 23 69 42 68 2 (2.9) 44 (63.8) *0.007 2 (2.9) 24 (35.3) *0.484 Middle school (33.3) (100) (61.8) (100) Diploma and 19 32 18 31 1 (3.1) 12 (37.5) 1 (3.2) 12 (38.7) Above 8_special(59.4) (100) (58.1) (100) Permanent 11 29 11 18 29 1 (3.4) 17 (58.6) 0 (0)

Marital Status Marriage (37.9) (100) (37.9) (62.1) (100) Temporary 12 31 17 30 0 19 (61.3) 2 (6.7) 11 (36.7) Marriage (38.7) (100) (56.7) (100) **0.728 **0.781 Divorced and 18 43 27 43 3 (7.0) 22 (51.2) 1 (2.3) 15 (34.9) Widow (41.9) (100) (62.8) (100) 2 3 2 2 Single 0 1 (33.3) 0 (0) 0 (0) (66.7) (100) (100) (100) * Spearman’s Rho Correlation ** Fisher’s Exact Test

Table 5. Correlation of Perceived Benefits, Perceived Barriers, Aga, level of Education and Marital Status Perceived Benefits Perceived Barriers Demographic Sum P Low Moderate High P value Low Moderate High Characteristics N (%) value N (%) N (%) N (%) N (%) N (%) N (%) 1 10 14 25 6 1 25

Age Group 20-29 18 (72.0) JML_Volume(4.0) (40.0) (56.0) (100) (24) (40) (100) 0 7 38 45 16 6 45 30-39 *0.313 23 (51.1) /*0.233 (0) (15.9) (84.4) (100) (35.6) (13.3) (100) 3 6 25 34 16 4 34 40> 14 (41.2) (8.8) (17.6) (73.5) (100) (47.1) (11.8) (100) E f illiterate 0 1 4 5 *0.467 4 1 (20.0) 0 5 *0.014

39 Journal of Medicine and Life Vol. 8, Special Issue 3, 2015

(0) (20.0) (80.0) (100) (80.0) (0) (100) Elementary and 3 14 52 69 29 7 69 33 (47.8) Middle school (4.3) (20.3) (75.4) (100) (42.0) (10.1) (100) Diploma and 1 9 22 32 7 4 32 21 (65.6) Above (3.1) (28.1) (68.8) (100) (21.9) (12.5) (100) Marital

Status Permanent 0 6 23 29 12 3 29 14 (48.3) Marriage (0) (20.7) (79.3) (100) (41.4) (10.3) (100) **0.562 **0.904 Temporary 1 10 20 31 9 3 31 19 (61.3) Marriage (3.2) (32.3) (64.5) (100) (29.0) (9.7) (100) * Spearman’s Rho Correlation ** Fisher’s Exact Test

Discussion however, adolescents with high levels of education are more likely than others to finance more risky sexual The results obtained showed that the mean age behavior [25]. Age mostly affects high-risk behaviors that score of participants was 35.7 ± 7.9 years. Also a mean occur in adolescence. Tenkorang claimed that age is a age of 34.5 ±11.2 years was reported, which is in line with predictor of high-risk behaviors, especially sexual that of the present study. In this study, the main drugs behavior in adolescents since they do not see themselves used were reported first to be glass and then methadone exposed to major risks such as AIDS and are more likely and heroin, and hashish. The reported order of these to attempt risky behavior [25]. In his study, Hanton found commonly used drugs was as it follows: opium, crack, no link between awareness and education/ age, whereas glass, ecstasy, and heroin [22]. Comparing the results, it a high level of awareness in this study was reported. This can be concluded that changes in drug users’ attitudes reflects the young age of the participants ranging 15- 24 are due to the fact that glass is of lower cost and easily years [26]. 3_2015_draft accessible. Most participants had first experienced using In the present study, the HBM constructs of drugs with their husbands. They stated that men shared perceived sensitivity to high-risk behaviors had a drugs with their wives in order to avoid their objections significant relationshipiss with education level. However, and to have a companion in using drugs. there was no significant relationship between perceived The mean score of women’s awareness of high- sensitivity and age/ marital status. The present study is in risk behaviors was moderate. Behaviors such as tattooing consensus with Solhi’s [24]. Perceived sensitivity has a (49.5%) and lack of condom use in each 10 sexual strong cognitive component and is somewhat dependent relationships (45.9%) were also reported over the last on individual knowledge [27]. three months. The experience of shared use of syringes It can be concluded that more sensitivity is and needles and symptoms of sexually transmitted probably due to training classes in drop-in centers and diseases were respectively reported; 17.9% and 34% shelters or to regular and periodic examinations in order during the past three months. Karimi’s research on male to detect new cases of HIV and hepatitis. Rahmati also drug users indicated that 52.8 percent of them had a high obtained the same results based on the above-mentioned awareness, while 39.5 percent of them8_special did not perform model. The researcher introduced media as its cause well and had not taken preventive measures. They also [20]. In studies conducted by Vakili, Aser, and Soldi, had a background of high-risk behaviors such as constructs of perceived sensitivity were met in a lowest unprotected sex and drug injection [3]. rate. It is perhaps because the participants in this study The two studies reviewed above led to a saw themselves at no risk. For example, women who conclusion that women are less aware than men, perhaps participated in Vakili’s study served as health liaisons. due to gender differences, lower employment, lower Monogamous women participating in Aser’s study ignored education levels, and less social interactions. Women’s the risk of HIV infection. Participants of Solhi’s study awareness level in the current study was significantly included barbers who did not know themselves associated with age, education level, and marital status. susceptible to hepatitis and AIDS [21,24,28]. Increasing age was also associated with higher Participants who are less sensitive to being awareness in the Sabooteh’s study [23]. In this study, infected with HIV are more susceptible. This reduced women having diploma or higher education levels were sensitivity leads to a decrease in accuracy of prudent more cognizant. It is clear that individuals with higher behaviors and exposes many people to the risk of HIV/ education levels possess higher awareness levels and AIDS as well [29]. Perceived sensitivity has the prime role JML_Volumeobserve themselves more susceptible to damages. in understanding the behavior. If a person is sensitive to Education and awareness play a key role in maintaining health problems and recognizes that symptoms cannot health. Illiteracy can cause lack of responsibility for health only be due to certain diseases, this sensitivity then leads and treatments issues [24]. Another study found that to the prevention of high-risk behavior and HIV infection teenagers with higher levels of education were more [24]. High-perceived sensitivity is necessary to enhance cognizant and saw themselves as more vulnerable; the motivation of participants in preventive health

40 Journal of Medicine and Life Vol. 8, Special Issue 3, 2015

behaviors [21]. Compared to men, women considered because of paying more attention to removing barriers in themselves more susceptible to AIDS and would choose adopting a behavior. Perceived barriers play a vital role in protective behavior such as using condom and having predicting protective health behaviors [3]. Namdar also fewer sexual partners [26]. The perceived severity of the confirmed a significant relationship between perceived present study was high. It seems that people perceive barriers and education level of women aged 20-65 years diseases such as AIDS and Hepatitis as diseases with [33]. Volk’s findings indicated that perceived barriers severe consequences and consider themselves at risk. among men and women are only a part of the Health This is because the women participating in our study Belief Model and are effective on the behavior of condom observed the risk of illness or death in their family due to use [34]. People who perceived fewer barriers have more AIDS and hepatitis. preventive behaviors [32]. Zaho et al. showed that Tenkorang mentioned that experiences and perceived barriers to condom use in prostitutes were consequences surrounding the death of families could more than the perceived benefits. Thus, reducing barriers have a more positive effect on perceived severity and to condom use is more effective than raising awareness feeling higher risk than others [25]. Like sensitivity, [35]. severity also has a strong cognitive component and is dependent upon individual knowledge [27]. The results showed that age, education level, and marital status have Conclusion no significant relationship with perceived severity. These Due to the fact that the high perceived sensitivity results are in a similar vein with other studies [20,24,30]. to enhance the motivation of individuals to adopt A high score means that the variables are not associated preventive health behaviors and that perceived benefits with perceived severity. Tenkorang, albeit, found a are one of the most important structural aspects of the correlation between education level and perceived Health Belief Model, and that awareness and perceived severity and 62.5 percent of the participants in his study 3_2015_draft barriers are predicted to account for strong acquired with high school education level perceived no risk of high- behaviors, it seems that educational planning should be risk behaviors. He also mentioned that the high education provided and executed based on behavior change models level is associated with the rejection of traditional and like the HBM issin order to prevent high-risk behaviors in this religious teachings [25]. Zack found out that students group of vulnerable women and to reduce barriers and have had little perceived severity of STD and have taken increase their awareness of other structures and models. less preventive behaviors about it [31], which may be due One of the limitations of this study is the participants’ self- to the above reason. The perceived benefits of the reporting. The goal was set out to reach the highest present study were high and the highest mean score was accurate data from the participants through their ensuring related to this component. of the confidentiality of the questionnaires and gift giving. It can be concluded that participants who Another limitation is that the participants of this study received a service in these centers took preventive were just those women coming to drop-in centers. As a actions. Perceived benefits had no significant relationship result, the findings of this study cannot be generalized to with any of the variables (namely age, education level, those women not coming to these centers, attending drug and marital status). Vakili argued that fairly individuals’ rehab camps, and homeless women. Hence, mobile high levels of perceived benefits 8_specialrepresent their treatment teams are required to investigate their high-risk understanding of the potential preventive behaviors [21]. behaviors. Lin et al. reported that the above-mentioned perceived

benefits about one preventive factor lead to performing Ethical considerations more preventive behaviors than other constructs [32]. The study was approved by the ethics committee According to the health belief model, when an of the Iran University. The researcher obtained approval individual reaches an appropriate understanding level of from the participants. All women were informed regarding beliefs about sensitivity and severity, he does not accept the confidential nature of the data. All participants were health recommendations unless the potential benefits informed that they would be voluntary in refusing to versus the obstacles of that behavior are well-understood answer any questions. All participants were informed that [30]. they would be free to withdraw from the study at any time. Aser et al. introduced perceived benefits of All participants were encouraged to ask any questions or condom use as one of the most important structural concerns about their participation. aspects of the health belief model. This study showed that

the relationship between benefits and the use of condoms Acknowledgement JML_Volumeexist as a preventive behavior [28 ]. The majority of Author would like to thank all of the women who women in this study scored medium for perceived participated in the study. barriers. Perceived barriers had no significant relationship

with age and marital status, while they had a significant Funding Support relationship with the education level. Perhaps, it is

41 Journal of Medicine and Life Vol. 8, Special Issue 3, 2015

The research was funded by the Research Vice Medical Sciences, Tehran. We kindly express our Chancellor of Tehran University of Medical Sciences and appreciation to Tehran and Iran University of Medical Center for Nursing Care Research, Iran University of Sciences.

References

1. Motazakker M, Naghadeh M, Anosheh and alcohol dependence. 2012; 1231(1- Zanjan health volunteers (2010-11). M. The frequency of high-risk behaviors in 2):95-107. ZUMS Journal. 2011; 19(77):78-93. drug addicted patients referring to 12. Wagner KD, Jackson Bloom J, Hathazi 22. Ataei B, Khorvash F, Azadeh M, methadone treatment centre in urmia, SD, Sanders B, Lankenau SE. Control Nokhodian Z, Kassaian N, Babak A. west-azerbaijan. Urmia Medical Journal. over drug acquisition, preparation, and The prevalence of high-risk behaviors 2012; 22(6). injection: implications for HIV and HCV among women prisoners in Isfahan, Iran. 2. Dastjerdi G, Ebrahimi Dehshiri V, risk among young female injection drug Journal of Isfahan Medical School. 2011; KHolasezadeh G, Ehsani F. Methadone users. International Scholarly Research 29(150):1070-1077. in reduction of high risk behaviors in Notices. 2013. 23. Sabooteh S, SHarifirad GH, clients of MMT center. Journal of Shahid 13. Unger JB, Kipke MD, De Rosa CJ, Hyde Hassanzadeh A. The survey of health Sadoughi University of Medical Sciences J, Ritt-Olson A, Montgomery S. Needle- belief model (HBM) constructs regarding High Risk Behavior Conference. 2010; sharing among young IV drug users and pregnancy anxiety in nuliparous women. J 18(3), 215-219. their social network members: The Health System Research (HSR) Special 3. Karimy M, Niknamy SH. Efficacy, influence of the injection partner's Issue on Health Education. 2014; 1156- perceived benefits and barriers to characteristics on HIV risk behavior. 716. preventive behaviors of AIDS among drug Addictive Behaviors. 2006; 31(9):1607-18. 24. Solhi M, Haghighi M, Najarkolaei FR, users Zarandieh. Journal of Kermanshoh 14. Molitor F, Ruiz JD, Flynn N, Mikanda Kashani3_2015_draft HA, Zemestani AR. HIV University of Medical Sciences. 2011; JN, Sun RK, Anderson R. prevention perception among barbers 11:5. Methamphetamine use and sexual and according to Health Belief Model. Journal 4. Jafari S, Rahimi Movaghar A, Baharlou injection risk behaviors among out-of- of American College Health. 2010; S, Spittal P. Trends of Substance Use in treatment injection drug users. The 52(5):229-239. Southern Iran: a qualitative study. The American Journal of Drug and Alcoholiss 25. Tenkorang EY. A multilevel path analysis Internet Journal of Epidemiology. 2008; Abuse. 1999; 25(3):475-93. of risk perception and risky sexual 6(1):14-7. 15. Nokhodian Z, Meshkati M, Adibi P, behavior under the framework of health 5. Rahimi Movaghar A, Malayerikhah Ataei B, Kassaian N, Yaran M et al. belief model journal of HIV/ AIDS & Social Langroodi Z, Delbarpour Ahmadi S, Hepatitis C among intravenous drug users Services. 2013; 12:125-45. Amin Esmaeili M. A qualitative study of in Isfahan, Iran: a study of seroprevalence 26. Hounton SH, Carabin H, Henderson NJ. specific needs of women for treatment of and risk factors. International Journal of Towards an understanding of barriers to addiction. Iranian Journal of Psychiatry Preventive Medicine. 2012; condom use in rural Benin using the and Clinical Psychology. 2011; 17(2):116- 3(Suppl1):S131. Health Belief Model: A cross sectional 25. 16. Gu J, Lau JT, Chen X, Liu C, Liu J, survey. BMC Public Health. 2005; 5(1):8- 6. Abiona TC, Balogun JA, Adefuye AS, Chen H et al. Using the Theory of 24. Sloan PE. Body art practices among Planned Behavior to investigate condom 27. Saffari M, Shojaeizadeh D, inmates: Implications for transmission of use behaviors among female injecting Ghofranipour F, Heydarnia A, Pakpour bloodborne infections. American Journal drug users who are also sex workers in A. Health Education & Promotion- of Infection Control. 2010; 38(2):121-9. 8_specialChina. AIDS care. 2009; 21(8):967-75. Theories, Models & Methods. 2009, 7. Khajedalue M, Dadgar M. Maternal 17. Jafari S, Copes R, Baharlou S, Etminan Tehran, Iran: Sobhan Publication, 55-7. substance abuse and the child’s addiction M, Buxton J. Tattooing and the risk of 28. Asare M, Sharma M, Bernard AL, during adolescence and young adult. transmission of hepatitis C: a systematic Rojas-Guyler L, Wang LL. Using the Obstetrics, Gynecology and Infertitlity. review and meta-analysis. International Health Belief Model to Determine Safer 2013; 16(52)P 1-7. Journal of Infectious Diseases. 2010; Sexual Behavior among African 8. Ataei B, Salehi M, Javadi A, KHorvash 14(11):e928-e40. Immigrants. Journal of Health Care for the F, Mortazavi AS, Kasaeian N et al. The 18. Center for disease and prevention Poor and Underserved. 2013; 24(1):120- Frequency of High-risk Behaviors in women and addiction. 2010. 34. Intravenous Drug Abusers Referred to 19. Taghdisi M, Nejadsadeghi E. Evaluation 29. Karimy M, Abedi AR, Amin-Shokravi F, Addiction Prohibition Centers in Isfahan. of knowledge, attitude and health Tavafian SS. Preventing HIV 2010. Journal of Isfahan Medical School. behaviour of the pregnant women Transmission among the Opiate- 2011; 28(114) P 837-842. consulted in Behbahan Health Centers in Dependent Population in Zarandieh: 9. Dolan K, Salimi S, Nassirimanesh B, the field of urinary infections based on the Evaluation of the HBM-Based Educational Mohsenifar S, Mokri A. The health belief model (hbm)(2010). Modern Programs. Health Education & Health establishment of a methadone treatment Care Journal. 2011; 8(3):143-51. Promotion. 2013; 1(1):21-31. clinic for women in Tehran, Iran. Journal 20. Rahmaty Nejarcolai F, Niknamy SH, 30. Karimy M, Shamsi M, Araban M. Pap of Public Health Policy. 2011; 32(2):219- Amin Shokravy F, Ahmady F, Gafary M, Smear Test Structures for Measuring JML_Volume30. Rahnama P. Towards designing and Health Belief Model and Factors Affecting 10. Ministry of Health and Medical Education evaluating of an educational model for Women in Urban Centers Covered Centre for Disease Control. 2008. youth HIV/ AIDS behavioral prevention. Zarandieh. Qom University of Medical 11. Des Darbis D et al. Are female who inject 2008; 8(4):349-59. Sciences Journal. 2012; 6,3. drug at higher risk for HIV infection then 21. Vakili MM, Niknamy SH. Effect of 31. Zak-Place J, Stern M. Health belief males of high sero prevalence areas drug communication skills training on health factors and dispositional optimism as belief model constructs about AIDS in predictors of STD and HIV preventive

42 Journal of Medicine and Life Vol. 8, Special Issue 3, 2015

behavior. Journal of American College 33. Namdar A, Bigizadeh S, Naghizadeh health belief model. AIDS education and Health. 2004; 52(5):229-36. MM. Measuring Health Belief Model prevention. 2001; 13(6):495-508. 32. Lin P, Simoni JM, Zemon V. The health components in adopting preventive 35. Zhao J et al. Predictors of condom use belief model, sexual behaviors, and HIV behaviors of cervical cancer. Journal of behaviors based on the health belief risk among Taiwanese immigrants. AIDS Fasa University of Medical Sciences. model among female sex worker :Across- Education & Prevention. 2005; 17(5):469- 2012; 2(1):34-44. sectional study in Hubei province china. 83. 34. Volk JE, Koopman C. Factors associated PBS. 2012; 17(11). with condom use in Kenya: a test of the

3_2015_draft

iss

8_special

JML_Volume

43 Journal of Medicine and Life Vol. 8, Special Issue 3, 2015, pp.44-49

Effect of neurofeedback in improving the deaf students’ reading after cochlear implantation

Soltani Kouhbanani S*, Khosrorad R**, Hashemian M***, Nasehnezhad M**** *Faculty of Education and Psychology, Ferdowsi University Of Mashhad, Mashhad, Iran, **Department of Education Development Center, Sabzevar University of Medical Sciences, Sabzevar, Iran, ***Department of Health Education, School of Health, Sabzevar University of Medical Sciences, Sabzevar, Iran, ****Health Education and Health Promotion, Mashhad University of Medical Sciences Mashhad, Iran

Correspondence to: Razieh Khosrorad, PhD In Educational Psychology, Department of Education Development Center, Sabzevar University of Medical Sciences, Sabzevar, Iran, Mobile phone: +98 9306681173, E-mail: [email protected]

Received: March 14th, 2015 – Accepted: June 18th, 2015

Abstract The aim of this study was to evaluate the effectiveness of neurofeedback in improving reading in deaf children after cochlear implantation. This study was a statistical sample of 8 children (5 boys and 3 girls) aged 8-14 years with an IQ of 80, according to Wechsler test listed in the student’s file. After identifying the students based on certain criteria, they and their parents participated in the study, which took place in Ava center in Ilam, and, afterwards3_2015_draft heard the explanations about the way they could run the business themselves. No history of seizure disorders, epilepsy and brain trauma was recorded. The cochlear implant was performed at 18 months and at maximum 24 months. The participants were randomly divided into an experimental group and a control group. The experimental group received neurofeedback treatment for 20 sessions of 40 minutes each (three sessions per week).iss The instruments used in this study were a demographic questionnaire (which included information such as age, grade, and IQ), a reading disorder test, and the neurofeedback devices. The ability to read the neurofeedback group showed that the reading difficulties in the experimental group were lower. In addition, the functional groups, relocation, replacement and reverse readings improved.

Keywords: deaf, cochlear implant, problems with reading, neurofeedback

Introduction reality throughout the world, which dates back in the literature on exceptional Children. Factors, which have Normal hearing implies 8_specialthe ability to been discussed in the area of deaf children, include understand the spoken words of others without any need discussion and exchange of ideas about sensorineural to treatment aids or special procedures [1]. According to hearing loss, oral methods, oral method with finger this definition, a person whose hearing has been movements, oral (lip-reading) method, both sensory and damaged needs special procedures to understand the multi-sensory methods, single sensory methods. Each of spoken words of others. The Education act has defined the proposed educational procedures for deaf children hearing disability as a hearing impairment, which goes had reasonable evidence, thus we could witness diversity beyond so that the student will not be able to process the in the educational styles in working with deaf children, others’ verbal information without a hearing aid. Hearing where hopeful outcomes concerning efforts made to date impairment has been reported among 28 million could be observed [3]. About 30%-40% of deaf or hard-of- Americans, of whom, 1% has been seen with severe hearing babies have been seen with nerve growth status hearing impairment [1]. With regard to the investigations or mental retardation. According to the statistics research undergone by practitioners of the education center, in board, the most common statuses in hearing impairment average, about 50% of the children require an education include mental retardation, learning disabilities, and program and people with a hearing handicap require attention problems. Further, some disabilities might not JML_Volumespecial aids. In this area, the main problem lies in how to emerge until childhood or adolescence, resulting in an train individuals who face limitation. Children with a increase of these figures. Despite the exposure with hearing impairment cannot set relationships with others, some similarities with mentally retarded children and thus the feelings such as isolation, failure and loneliness children without mental retardation, in investigating will dominate them, whereby this problem will complicate general issues related to deafness in children, it could be the issue of education for them [2]. Hearing loss is a observed that deaf children pass cognitive and linguistic Journal of Medicine and Life Vol. 8, Special Issue 3, 2015

stages similar to normal children, who repeated mistakes Most of the people with a reading disorder have been the same as mistakes by normal children at certain stages seen with a lack of progress in their brain cells, and of evolution of language. Almost 30% of the children with expanding problems in their reading derived from visual a hearing impairment, in addition to hearing loss, also and auditory problems. This derives from problems in have other disabilities including mental retardation, neurons, which have developed a network in brain, significant vision impairment, learning disabilities, and deemed allocating for time changes. Reading, as one of attention deficit disorder. Furthermore, emotional or the skills and abilities acquired in school, plays a major behavioral problems, cerebral palsy, bone problems might role in the personal growth of a person and his also occur with hearing loss. Looking into the previous attendance in society. Reading is a cognitive and experiences at the area of fostering children with newly linguistic process, which has a close relationship with diagnosed hearing impairment indicated that the early other linguistic processes including speaking, writing, diagnosis of hearing impairment and use of intervention listening, which the child acquires. Notably, children with a programs could be the best way to help for progress. To hearing impairment face problems in their subjective use the advantage of ductility of the central nervous activities such as processing, storage, and retrieval of system, maximize treatment, and reduce functional data. A variety of studies have been conducted in the defects, the intervention must be started, followed by the area of problems of reading comprehension among deaf diagnosis. Children with an early hearing-loss detection children. In 1916, two English scholars [5] formulated a and intervention compared to the children with late test to evaluate the reading skill, in which deaf students in hearing-loss detection have better cognitive, social, and the age group 14-16 years were asked to read some linguistic skills and all these factors help the children sentences and apply the instructions to the read the text, attend in conjunctive normal classes and open whereby the results indicated that the deaf students in the environments. In recent decades, intervention programs age group 14-16 years had the same function as the 7 have been increasingly expanded to prevent behavioral years old students. In the3_2015_draft process of understanding the disorders and mental health problems of deaf children. reading comprehension input that was the text, finally, the Some of these programs could train the children with the semantic output was produced, whereby the meaning of required skills such as response inhibition, knowledge of the text was issunderstood; thereby, the ability of reading impulsive behavior, emotion regulation. The council of without understanding the concept of terms was not exceptional children and the council of deaf children have accounted as a complete process to achieve the ultimate had some standards for teachers of deaf children for over aim of reading, that was, the understanding of the one decade, in which all the needs required for deaf meaning of the text. The linguistic processing must be children were considered. Studies have shown that the fulfilled during special stages at different levels including children who attended training courses for executive syntactic, phonological, and morphological words, thus functions one or two years earlier, presented a huge the required ability for reading implies phonological progress in their social skills, skill of problem solving and awareness, reading comprehension and dominance on cognitive performance, such that all these progresses reading the words [6]. Due to deficits in working the related to executive functions [4]. memory, deaf students have a poorer comprehension and Learning subjective subjects and theoretical reading [7]. contexts cannot be practicable, which 8_specialis difficult for the The results of the study quoted by person with a hearing impairment and the reason for this KakuJoybari [8] indicated that 0.95 of the deaf students is the impairment in speaking, thinking, and visualizing. who graduated from school, were deemed as 7 years old Hence, it can be said that hearing impairment causes students in terms of reading comprehension. pseudo-academia and laziness. The studies on academic Other studies showed that the deaf students achievement of children with hearing impairment indicated face substantial problems in their life in terms of verbal the lack of academic achievement of these children. In communication skills, such as understanding the this regard, Peter Rimmer quoted from Saeedi in his meanings of words, speaking, reading comprehension, studies, stating that he had perceived these children and writing [8]. Deaf education is the education of under their education level for 5 years. Using the Stanford students with a variety of hearing levels, which dates back Achievement Test (SAT.HT), which was standardized in to a long time ago; teaching reading and writing is an 1972 on 6871 children with hearing impairment, unavoidable necessity to increase communication skills of Kretschmer found disorders of reading in these students. hearing-impaired children. Reading is one of the cognitive Reading is one of the most important education skills; it skills that was developed as the result of the interaction can be said that learning, understanding, comprehension, between the nervous system and cultural experience [9]. JML_Volumeand success in all the educational courses rely on the skill Reading comprehension is a complicated procedure that of reading. Reading, in all age groups, is one of the most requires coordination and combination of skills of word efficient methods of enriching language and expanding recognition and understanding the meanings [10]. words, syntax, semantics, and language use. Reading Reading is one of the most important skills for children in disorder is one of the most common disorders in learning. learning courses. Proficiency in reading through speaking

45 Journal of Medicine and Life Vol. 8, Special Issue 3, 2015

and listening or reading and writing comes to be realized performances. It can be understood why early pioneers in by the use of signs and symptoms [11]. the neurofeedback area have started the education Studies in the context of deaf children’s process during the sensorimotor cortex. reading comprehension have had disappointing results. It Further, Ratey [14] mentioned that brain must be noted that these results do not indicate an circuits that are used to regulate a subjective practice are intellectual disability of deaf children, but the weakness in those used to regulate a physical practice, i.e. The the reading comprehension in this group derives from the sensorimotor cortex works out in conducting physical and factors with cognitive nature. Reading comprehension is mental processes, and this cortex is more likely used for both a cognitive and linguistic process, which has a close sensorimotor functions. Hence, the clients who have relationship with the other linguistic processes including difficulties in understanding their cognitive tasks can use speaking, writing, listening, which the child acquires. the neurofeedback education in their treatment process. Notably, the children with a hearing impairment face Neurofeedback education using the systems which deal problems in their subjective activities such as processing, with emotion, feeling, attention and working memory, storage, and retrieval of data. Since reading develops the energy source, movement, reasoning and comprehension and learning reading skill require the thinking. Regarding the SMR area, in another explanation acquisition of visual recognition of linguistic elements for finding of this research, it can be said that the including letters, words and sentences, thus identifying activation of neuronal circuits involved in cognitive strengths and weaknesses in both cognitive and linguistic processes comes to be realized. Previous studies have areas, it seems that essential brain waves depending on shown that the working memory is based on a neuronal the frequency are classified into four groups: Delta (1 to 3 circuit, which is acquired from the interaction between the Hz), theta (4 to 7 Hz), alpha (8 to 13 Hz) and beta (14 to attention control system 3_2015_draftin the prefrontal cortex and the 30 Hz). We can witness alpha activity when a person is sensory information storage in the relaxed, but alert. Yet, when a person involves in a dorsal prefrontal association area. In this study, a part of cognitive activity or problem resolving, we can witness the protocol wasiss used for the suppression of theta waves, beta waves. Delta waves are observed when individuals and the related works indicated that theta relates to poor are in deep sleep or in a coma, and theta waves are seen performance, and the results indicated that the when the person is in light sleep [12]. Neurofeedback is a suppression of theta waves caused a better cognitive treatment model for changing or modifying cognitive, performance. In other words, neurofeedback education emotional, and physiological processes in patients. The has positive effects on the individuals’ subjective results of studies indicated that neurofeedback fosters the performance and cognitive processing, confirming the brain for activity or proper pattern during various sessions. findings of this research. However, a variety of studies on treatments for learning Another explanation for the effect of disabilities concerning neurofeedback have been neurofeedback thalamus, regarding the early changes in conducted; in a study it was indicated 8_specialthat children with the activity, more likely occurring via neurofeedback, learning difficulties are different from other children in mentioned that these changes might modify EEG through terms of EEG indicators. One of the methods for the thalamocortical circuits. Hence, changes in the EEG were normalization of the brainwave of children with learning deemed as the result of complex reorganization of disabled (LD) can use Valproate Sodium. Neurofeedback neuronal activity. A variety of studies have been therapy is another technique that normalizes brainwaves. conducted in the area of effectiveness of neurofeedback Neurofeedback refers to the process of factor conditioning in improving the students’ reading difficulties, whereby in which the individuals learn to change the electrical significant results have been obtained [15,16]. To date, activity of their brain [13]. Neurofeedback aims to treat this method has not been used to improve the reading EEG abnormalities, whereby improvement of cognitive or comprehension in deaf children. In this study, the behavioral performances will result. Neurofeedback is researcher tried to find an approach to increase the inhibited as a form of conditioning the electrical activity of reading comprehension of deaf children so that to help the brain. It is believed that neurofeedback recalls growth improving the educational, communicative, and social JML_Volumeand brings about changes in brain cell surfaces, which abilities of deaf children, besides other educational supports the brain function and the cognitive/ behavioral approaches of deaf children. performance [12]. The sensorimotor cortex helps the cerebral Research method cortex in the simultaneous performance of physical and A semi-experimental study was used in this cognitive tasks, and this comes out of executive study. After the cochlear implantation, the deaf students

46 Journal of Medicine and Life Vol. 8, Special Issue 3, 2015

who have accomplished their auditory training made in Canada, with its sensitivity of sampling equal to therapies or treatments such as auditory and linguistic 256 Hz. In this study, two treatment protocols were used processing in the Ava Center in Ilam were selected as the for the purpose of treatment by using the neurofeedback sample group. The inclusion criteria include DSM-IV therapy in children with reading difficulties.

diagnosis of the reading disorder and inclusion tests to Neurofeedback therapy measure the reading disorder. 8 students (5 boys and 3 Neurofeedback therapy is the first treatment girls) in the age group of 8-14 years old with an IQ of 80 protocol used for the suppression of alpha/ theta in the regarding the Wechsler test, were involved in the study. Cz, aiming at increasing alpha and reducing theta. After identifying the students with the inclusion criteria, The second protocol: the SMR protocol was their parents participated in the Ava Center in Ilam and implemented in C3, C4 areas. In this protocol, SMR after hearing the explanations, they tried to run the (subset of beta) was strengthened for 12 to 15 Hz, and business themselves. The inclusion criteria included the theta was suppressed for 4 to 7 Hz. These two protocols following: not having any medical history of diseases of were repeated during all 20 education sessions. Since session seven, any student seen with progress, received epilepsy, seizures, and brain damage. About 18-24 a CD box. They also received a CD in the thirteenth and months must have passed since the cochlear nineteenth sessions. The rational reason for the treatment implantation, and the age of participants had to be used in this study relied on the factors below: in between 8 and 14 years old. At first, participants filled in comparing EEG in normal and LD children, the highest the demographic questionnaire with the help of their amount of EEG frequency was in LD children by teachers and parents, and then the reading test took increasing the theta activity [18-20]. In the second place, the researcher taking them in a calm room. The protocol, theta (407) and hyper-beta (22-30), suppression voice recorder was used to record contents, and timer of SMR (subset of beta)3_2015_draft in encoding physical and was used to record the reading time in the tasks relating cognitive tasks helped the cerebral cortex, adding that the encoding of physical and cognitive tasks helped the to speed of calling and reading. Then, the participants cerebral cortexiss in brain circuits. Brain circuits which were were divided into two test and control groups; the test used to regulate a subjective practice, were those used to group received neurofeedback in 20 sessions during 40 regulate a physical practice. Hence, the clients who had minutes, and the control group just stared at purposeless difficulties in understanding the logical sequence of images on the screen of a computer. At the end of the cognitive tasks could use the neurofeedback therapy in course, the groups participated in a post-test of reading their sensorimotor cortex of the right hemisphere (C4) to disorder, and then the results were considered after one recall their emotions and feelings. Education in midpoint month. or Cz facilitated a mixed response. In other words, increasing the activity at the central cortex was followed The instruments used in this research by increasing the activity in skills of both hemispheres as Demographic questionnaire (information on age, a precondition for a successful learning and acquisition of education level, and IQ) 8_specialthe reading skills. Neurofeedback sessions were Reading disorder test organized until the twelfth session during three sessions The reading disorder test developed and in a week, and sessions of 12 to 19 were organized normalized by Nesfat et al. [17] was used to diagnose during two sessions in a week. Treatment processes: the children with reading difficulties. According to this test, participant was sat on a chair in front of a computer three clinical characteristics including mistakes in reading, screen in a room in a total silence; he prepared tulip ear- speed of reading and reading comprehension of students tips and areas C4, C3, Cz by using alcohol and gel, for were measured. According to this test, a score was given which Alpha-theta protocol was performed. For this, the to each participant per any error, and the sum of scores of active electrode was transferred to point Cz. Feedback of the participant was considered as his total errors; further, alpha-theta protocol was in the form of voice (sound of a score was given to each participant per any response to waves in ocean - River), that the participant used to listen the reading comprehension questions. Finally, the time to the sound with his eyes closed, and if he fell asleep, spent by the participant from the start to the end of the device had to be alerted. In this protocol, the person reading the text, was considered as the index of speed of found the ability to establish a balance and coordination reading; further, coefficients of reading validity of 0.56, between alpha and theta, where this protocol was JML_Volume0.61 and 0.68 at third, fourth and fifth grades were performed in any session during 20 minutes. The next 20 obtained [17]. minutes were considered for training protocol SMR, where Neurofeedback device: the neurofeedback theta waves of 4-7 Hz and beta waves of 22-30 Hz were device was used for two purposes: 1-to register brain suppressed, and SMR waves were strengthened. At the waves, 2- to present feedback. The device used in this end of each session, the threshold was written down for research included five channels named ProComp 5.5 the next session.

47 Journal of Medicine and Life Vol. 8, Special Issue 3, 2015, pp.44-49

Findings

Table 1. The characteristics of the experimental and control groups The experimental group (n = 4) The control group (n = 4) Mean Standard deviation Mean Standard deviation Significant level Age 11.23 11.23 11.9 14.12 0 IQ 94.8 8.48 89.6 7.6 0

Table 1 shows the coordinated characteristics of students in both groups. The T test shows no significant differences between the experimental and control groups.

Table 2. The results of London Tower test in control and experimental groups The experimental group The control group Significant Elimination pre post deviation errors pre post deviation Errors level add 2/ 53 0/ 98 2/ 0 1/ 08 2/ 09 1/ 99 0/ 48 0/ 54 0/ 05 relocation 4/ 82 3/ 39 1/ 11 1/ 43 4/ 64 4/ 14 0/ 78 0/ 90 0/ 05 replacement 10/ 53 5/ 4 0/ 92 1/ 33 7/ 65 10/ 15 9/ 48 1/ 52 0/ 05 mirror reading 12/ 34 7/ 6 1/ 35 1/ 19 12/ 71 11/ 11 1/ 17 0/ 65 0/ 05

Table 2 represented the results of impairment [8], who believes that reading comprehension neurofeedback therapy on the reading comprehension of in deaf children is poorer compared to normal children. two test and control groups in pre-test and post-test. The The studies in3_2015_draft the two recent decades have results indicated that the reading comprehension of the given use of more absolute responses, the responses that test group went beyond the control group, where that have confused the teachers and have obliged them to difference lied on adding. The results indicated that the have a revisioniss on their methods about fostering deaf displacement in the test group went beyond the control children. By studying brain injuries and their complications group, and that difference was significant in adding. on reading, some researchers called important brain Further, the displacement in the test group went beyond activities involved in brain injuries. A special the control group, and that difference was significant. The electroencephalogram (EEG) pattern has been observed reading inversion in the test group went beyond the in children detected with dyslexia [19]. It was revealed control group, and that difference was significant. that there is a significant difference between normal children and children affected by a reading disorder concerning EEG waves. Neurofeedback seeks to train the Discussion and conclusion individuals to normalize their brain waves reaction to the stimulants. Neurofeedback can be used to stimulate or Besides all the studies on exceptional regulate the activity of the brain. Neurofeedback is also individuals, on linguistic, cognitive and 8_specialverbal abilities of used for normal individuals’ neurofeedback causes deaf individuals and their comparison with normal increasing the capacity of working memory and attention individuals to investigate the differences, have been more to education performance, and besides, neurofeedback likely drawn into attention in scientific communities. With had significant results in LD treatment. The therapists regard to the ability of deaf individuals concerning the enabled to indicate that training neurofeedback could achievement of life skills, attention to training these cause an improvement of the cognitive functions. These individuals is important. Deaf children often cannot foster results are relevant and similar with the results of the the terms and concepts relating to language in them. If study by Vernon et al [5]. A part of the protocol used in hearing impairment occurs at the early childhood, the deaf this study was regarded as the increase of Cz. To define child might find some of the different types of learning this finding, it can be said that neurofeedback education impossible. As the early experiences of the children are affects three sensorimotor cortexes. Therefore, it can be often visual and tactile, their first dialogues are generally assumed that neurofeedback facilitates information through sign language and gestures. The children who processing, because SMR reduces the voluntary control have hearing difficulties, learn in their early childhood how of the motor system interference in Cognitive Information to talk with so much difficulty, because proper dialogue Processing. JML_Volumerelies on copying from others’ speech. Hearing impairment affects formation of concept. Progress in References reading has a slow trend in the person with a hearing

1. Heward WL, Wood CL. Exceptional education (8th ed.), 2006, Upper Saddle 2. Afrooz A. An introduction into children: An introduction to special River, NJ: Merrill/ Prentice Hall. Psychology and Education of Exceptional Journal of Medicine and Life Vol. 8, Special Issue 3, 2015

Children. 1997, Tehran: Tehran levels. Journal of Rehabilitation. 2010; Psychophysiol Biofeedback. 2007; University. (3),11,8-14. 32,169–183. 3. Ibrahami AA. An overview on the history 9. Cohen D. Word identification in adults. 16. Walker JE, Norman CA. The of deaf education. Education of Handbook of (Central) Auditory neurophysiology of dyslexia: A selective Exceptional Children. 2009; 91:49-56. Processing Disorder. 2001. review with implications for 4. Curtis C, Norgate R. An evaluation of the 10. Landi N. An examination of the neurofeedback remediation and results of promoting alternative thinking strategies relationship between reading treatment in twelve consecutive patients. curriculum at key stage 1. Educational comprehension, higher-level and lower- Journal of Neurotherapy. 2006; 10,45–55. Psychology in practice. 2007; 23(1),33- level reading sub-skills in adults. Reading 17. Nesfat M. Diagnostic tests of reading 44. and Writing, 2010; 23,701-717. disorder. Project Final Report. 2004, 5. Vernon D, Frick A, Gruzelier J. 11. Karimi AA.The framework of Tehran University Research. Neurofeedback as a treatment for ADHD: characteristics of an international study of 18. Harmony T, Hinojosa G, Marosi E, A methodological review with implications reading literacy development PIRLS, Becquer J, Fernández-Harmony T, for future research. Journal of TIMSS and PIRLS International Study Rodríguez M, Reyes A, Rocha C. Neurotherap. 2004; 8,53–82. Center. National. 2007. Correlation between EE spectral 6. Blankenship K. Reading instruction for 12. Demos JN. Getting Started with parameters and an educational students with visual Impairments. Whose Neurofeedback. 2005, New York: WW evaluation. Int J Neurosci. 1990; 54,147- job is it?. Journal of Visual Impairment & Norton & Company Inc. 155. Blindness. 2008:191-200. 13. Thatcher RW. Normative EEG databases 19. Chabot R, Merkin R, Wood L, 7. Swanson HL. Individual differences in and EEG biofeedback. J. Neurother. Davenport T, Serfontein G. Sensitivity working memory: A model testing and 1998; 2,8-39. and specificity of QEEG in children with subgroup analysis of learning-disabled 14. Ratey JJ. A user’s guide to the brain: attention deficit or specific developmental and skilled readers. Inteligence. 1993; Perception, attention and the four theatres learning disorders. Clin 17(3):285-332. the brain. 2001, New York: Vintage. Electroencephalog. 1999; 27,26-34. 8. Kakujoybari AA, Sarmadi M, Sharifi A. 15. Fernandez T et al. Changes in EEG 20. Gasser T, Rousson V, Scheiter Gasser An overview on progress in reading Current Sources Induced by U. EEG power and coherence in children literacy in individuals with hearing Neurofeedback in Learning Disabled with educational problems. Clin difficulties and Comparison of their Children. An Exploratory Study. Appl Neurophysiol.3_2015_draft 2003; 20,273-282. reading knowledge in three education

iss

8_special

JML_Volume

49 Journal of Medicine and Life Vol. 8, Special Issue 3, 2015, pp.50-53

The significance of chest ultrasound and chest X-ray in the diagnosis of children clinically suspected of pneumonia

Rahmati MB*, Ahmadi M*, Malekmohamadi**, Hasanpur S**, Zare SH***, Jafari M**** *Department of Infectious Diseases, Children’s Clinical Research Development Center, Hormozgan University, School of Medical Sciences, Bandar Abbas, Iran, **Radiology Department, Hormozgan University of Medical Science, Iran, ***Epidemiology Department, Hormozgan University of Medical Science, Iran, ****Department of Pediatrics, Hormozgan University of Medical Sciences, Bandar Abbas, Iran

Correspondence to: M Jafari, MD, Department of Pediatrics, Hormozgan University of Medical Sciences, Bandar Abbas, Iran Shahid Chamran Boulevard, Bandar-Abbas, Iran Phone: +98 (761) 333 7190, Fax: +98 (761) 333 5009, E-mail: [email protected]

Received: March 14th, 2015 – Accepted: June 18th, 2015

Abstract Background. Community-acquired pneumonia (CAP) is one of the most common diseases and an important cause of morbidity and mortality worldwide. This study intended to compare and evaluate the benefits and significance of chest X-ray and chest ultrasound in the diagnosis of CAP in children. 3_2015_draft Methods Study Population. One hundred children of one-month to five-years of age who referred to the Children’s Hospital in Bandar Abbas for pneumonia were evaluated by chest ultrasound and chest X-ray by different radiologists. Results. Evidence of involvement was observed in 96% of the chest X-rays of those children, and also in 9% of the chest ultra- ultrasounds (6% opacity, 3% effusion). Pleural effusion was observed in 3 of the childreniss only by ultrasound. Conclusion. The use of ultrasound is an appropriate method to evaluate the complication of pneumonia.

Keywords: pneumonia, chest X-ray, ultrasound

Background bacterial pneumonia are were usually the result of the direct invasion of bacteria of the chest cavity. These Pneumonia is one of the most common include pleural effusion and empyema. The correct infectious diseases of the lower respiratory tract in diagnosis, appropriate and timely treatment, and children and an important cause of morbidity and mortality identification of complications are considerably important. worldwide, affecting over 150 million children8_special and leading Diagnosis is based on clinical symptoms in most parts of to 3 million deaths of children under 5 years old annually the world. The diagnosis is confirmed with a chest X-ray. [1]. Community Acquired Pneumonia (CAP) is one Ultrasound is a method used for the early diagnosis of common type of pneumonia. This disease is often pneumonia complications such as pleural effusion. In a accompanied by fever, cough, pleuritic chest pain, and recent study, ultrasound was used for the diagnosis of dyspnea. If untreated, pneumonia can lead to respiratory pneumonia. Will Bogus showed 93.4% sensitivity and failure, cardiac arrhythmia, and renal failure. The 97.7% specificity of ultrasound in the diagnosis of prevalence of this disease is of 12 in 1000 individuals [2]. pneumonia [5,6]. Therefore, we attempted to examine the Viral and bacterial pneumonias are often associated with patients with clinical signs of pneumonia and compare the infection of the upper respiratory tract, lasting for their chest X-ray and ultrasound results to confirm their several days with runny nose and cough. Viral pneumonia diagnosis in order to reduce exposure to radiation, which is typically associated with fever, which is milder than can be problematic especially in children. In addition, we bacterial pneumonia. Tachypnea is the most common attempted to use ultrasound in suspicious cases and even clinical persistent symptom of pneumonia [3]. Difficulty in diagnosed some symptoms in early stages. breathing, intercostal and subcostal retraction, JML_Volumesuprasternal retraction, and using accessory muscles of Methods respiration are also common in pneumonia. Severe infections were associated with cyanosis, weakness, and This prospective observational study was

respiratory fatigue especially in infants [4]. In patients with conducted on 100 patients aged from one-month to five- clinical signs of pneumonia, chest X-ray was highly year children who were brought to Bandar Abbas effective in the diagnosis of pneumonia. Symptoms of Journal of Medicine and Life Vol. 8, Special Issue 3, 2015 Children’s Hospital and were hospitalized for pneumonia in 2012 and 2013. In addition to chest X-ray, on the third Vomiting 16 day, the children underwent an ultrasound evaluation. Diarrhea 7 Clinical data along with age and sex from the patients’ records and the data from chest X-ray and ultrasound Otitis 2 results were added to the questionnaires. Criteria for Rale 58 inclusion in the study were: 1- Age, which was between one-month to five- Wheezing 26 years. Dyspnea 30 2- Pneumonia symptoms such as fever, cough, rale lung sounds, respiratory distress symptoms Nasal blade vibration 40 (increased respiratory rate based on age: infants > 50 per minute, 1 to 5 years > 40 per minute, Cyanosis 13 over 5 years > 30 per minute) with chest X-ray Chest pain 6 results changes [1]. The exclusion criteria were the lack of Abdominal distension 1 cooperation of parents or unwillingness to participate in History of hospitalization 15 the study after the explanation. The data was entered into the questionnaire, encoded, and entered into the statistical software SPSS version 19, and the t-test was Discussion used to analyze the data. The acute infection of the lower airways (mainly pneumonia) is the leading3_2015_draft cause of death in children in Results developing countries. The prevalence of this infection is of 1.9 million children annually. The accurate diagnosis of In this study, 100 patients were examined, which pneumonia largely depends on clinical examination and included 53 males, and 47 females. The mean age of precise imagingiss [7]. subjects was 26.3 months. The difference between the Confirming lung disease especially in children is mean age of males and females was significant (p-value = considerably important. There is a balance between the 0.019). Chest X-ray and ultrasound findings are displayed high dosage of harmful potential rays in chest X-ray and in Table 1, and the clinical data are given in Table 2. the accurate diagnosis. Chest ultrasound is an alternative diagnostic method to evaluate pleura and pulmonary Table 1. Ultrasound and chest X-Ray findings in children lesions and anterior mediastinum [8]. hospitalized for pneumonia Ultrasound probably gives us a better image of Chest X- Pulmonary the status of the lungs in the diagnosis of pneumonia due Chest Ultrasound ray involvement to the thinning of chest thoracic walls and large volume of the lungs in children compared to adults. 20 6 Consolidation8_specialChest X-ray requires cooperation to undergo a - 3 Effusion high dose of radiation and willingness to be transferred to the radiology department. However, ultrasound was highly 31 - Unilateral Reticular accessible and was performed at the patients’ bedside in 45 - Bilateral Reticular most cases, and since the results were instantly available, they were highly beneficial. Unfortunately, the ultrasound Table 2. Clinical symptoms of the children hospitalized due to was problematic due to its higher cost and inaccessibility the diagnosis of pneumonia of skilled ultrasound operators, and burden of transferring Clinical Symptoms % with the symptoms patients out of the hospital to another facility. It was decided that ultrasound was the main Fever 80 diagnostic tool, due to its benefits mentioned above, and Cough 97 due to the fact that it was performed at the patient’s bedside, along with the proper diagnosis of pulmonary Rhinorrhea, and nasal 65 infections. If the diagnostic procedures showed a high congestion degree of accuracy, they were used. As a result, the JML_Volume patients did not experience a high dosage of radiation; Conjunctivitis 5 moreover, they were no longer required to be transferred Tachypnea 92 outside the hospital. Pulmonary lesions spread to the pleura up to Retraction 64 98.5% in adults, which can easily be observed in

51 Journal of Medicine and Life Vol. 8, Special Issue 3, 2015

ultrasound. However, children have smaller pulmonary parasagittal, transverse, coronal, mid-clavicle, anterior, tissue and there is a little chance for the lesion to spread posterior, mid-axillary chest lines) [7,8]. to the pleura. Therefore, ultrasound is a suitable Community Acquired Pneumonia can affect alternative to X-ray in the evaluation and follow-up of interstitial and pleural pulmonary tissues. Based on similar children with pneumonia. studies, ultrasound had a high sensitivity and specificity in In this study, 100 children between one month the diagnosis of pleural effusion and peripheral lesions. and 5 years, who were hospitalized for pneumonia in However, only 9% of the positive ultrasound findings Bandar Abbas hospital, were evaluated with chest X-ray confirming pneumonia was found in the present study due and ultrasound. Evidence of involvement supporting the to the involvement of central and unilateral reticular zones diagnosis of pneumonia was observed in 96% of their (31%) bilateral reticular zones (45%) in chest X-ray. It chest X-rays while the findings supporting pneumonia should be noted that there was no synchronization were observed in 9% of the cases in chest ultrasound. between chest X-ray and ultrasound in most cases. In our The latter was also consistent with X-ray results. Pleural study, the patients were sent for an ultrasound on the effusion was observed in 3 patients who were diagnosed third day. Prior to the ultrasound, patients were under by ultrasound while no effusion was found in the X-ray antibiotic and other therapeutic measures. However, they results. This was similar to the other studies, which would have been if the ultrasound had been performed at showed the importance of ultrasound in the diagnosis of first. Then, X-rays would have been performed on the pneumonia and extra pulmonary involvement. third day due to the risk of X-ray findings in sync with the In contrast to our findings, the findings in other clinical symptoms. studies confirmed the usefulness and high consistency One of the controversial issues was that the between chest X-ray and ultrasound. Shebl showed that reason for the insufficient3_2015_draft detection in pneumonia patients ultrasound could be used for the diagnosis of pneumonia. through ultrasound was that they entered the study They had 17 positive ultrasound criteria [7,8]. On the without considering the reason for their viral or bacterial other hand, there was no finding confirming pneumonia in infections, sinceiss turbidity was more likely to be observed chest X-ray results. Ressing showed that ultrasound in the bacterial cases which counted for the majority of the acted 10 times stronger in the diagnosis of pneumonia in cases in the intensive care units [11,12]. the German department compared to our study. The In this study, 97% cough, 96% tachypnea, 80% follow-up of patients was done by using ultrasound in fever, and retraction were observed in 64% of the order to diagnose pneumonia. Finally, the results revealed patients. These cases were consistent with those findings that chest ultrasound had a high sensitivity and specificity. in other studies. This represented a major role of the Only 8% of the cases of pneumonia were not diagnosed clinical examination in the diagnosis of pneumonia, by ultrasound while they were diagnosed by using chest especially in developing countries. This also indicated the X-ray [9]. Jean Eudes et al. showed that ultrasound was 9 importance of the precise examination of the patients with times more sensitive than chest X-ray in the diagnosis of 8_specialcough, fever and tachypnea symptoms in early and pneumonia compared to our study. Jean Eudes et al. immediate diagnosis [8]. recommended that ultrasound is used as the first diagnostic method compared to chest X-ray. Since the subjects had a mean age of 26 Conclusion months, younger infants had to be diagnosed with the The present study indicated the lack of accuracy ultrasound. The ultrasound device and probe specific to of ultrasound in the diagnosis of pneumonia and the children that were used, differed from the device and detection of complications such as pleura. probe used in similar studies. The ultrasound device used in this study was the same as that used for adults. This Recommendations device was also used on children’s chest, which lowered Due to the small sample size as well as the the sensitivity of the method. Another reason for the inconsistent results with those in similar studies, it is difference between these results and similar studies was recommended that further studies with a larger sample the restlessness and lack of cooperation of children in size and assessment of patients under 3 months old and JML_Volumeevaluating all thoracic directions by the sonographer. In thin chest walls (which shows usefulness of ultrasound) are conducted in order to confirm the application of similar studies, the ultrasound technique with a specific ultrasound in the diagnosis of pneumonia. It is also probe and the waves within the range of 7.5 to 10 MHZ recommended that the subjects are divided into three were used to examine all directions of the lungs (including groups including healthy subjects such as the ones in the

52 Journal of Medicine and Life Vol. 8, Special Issue 3, 2015 control group, bacterial infections and viral infections, in outside sources in order to conduct ultrasound by a order to compare and evaluate the ultrasound results. radiologist, which prolonged the study in order to collect the patients. Limitations This study had several limitations. One was the Acknowledgment reluctance of some parents to giving the consent for X-ray This article is extracted from the thesis, and removing their children from the hospital 3 days Hereby, the authors appreciated to Children’s before the treatment, which led to the exclusion of several Clinical Research Development Center, Hormozgan patients from the study. Another limitation was the lack of University. cooperation of the hospital staff in transferring patients to

References

1. Nelson textbook of pediatric. 19th ed., 6. Shah VP, Tunik MG, Tsung JW. pulmonary embolism from pneumonia. 2011, Philadelphia, Saunders, 1474-1479. Prospective Evaluation of Point-of-Care Egypt J. Chest Dis. Tuberc. 2012; 61(2). 2. Ostapchuk M, Roberts DM, Haddy R. Ultrasonography for the Diagnosis of 10. Cortellaro F. Emerg Med J. 2012; Community-acquired pneumonia in infants Pneumonia in Children and Young Adults. 29:19e23. doi:10.1136/emj.2010.10158. and children. American Family Physician. Arch Pediatr Adolesc Med. Dec 10, 2012; 11. Glasier CM, Leithiser RE, Williamson SL, 2004; 70:899-908. 1-7. Seibert JJ. Extra Cardiac Chest 3. Korppi M. Mixed microbial etiology of 7. Williams BG, Gouws E, Boschi-Pinto C, Ultrasonography in Infants and Children: community‐acquired pneumonia in Bryce J, Dye C. Estimates of Worldwide Radiographic3_2015_draft and Clinical Implications. children. Apmis. 2002; 110 (7‐8):515 -22. Distribution of Child Deaths from Acute Pediatr J. 1989; 114:540–4. 4. Kabra SK, Lodha R, Pandey RM. Respiratory Infections. Lancet Infect Dis. 12. Haller JO, Schneider M, Kassner EG, Antibiotics for community acquired 2002; 2:25–32. Friedman AP, Waldroup LD. Sonographic pneumonia in children. Cochrane Database 8. The Egyptian Journal of Radiologyiss and Evaluation of the Chest in Infants and Systemic Reviews, 2006; 3:CD004874. Nuclear Medicine. 2013; 44:339-347. Children. AJR Am J Roentgenol. 1980; 5. Boggs W. Point-of-care ultrasound 9. Aliae AR, Mohamed H, Agmy GR, Safaa 134:1019-27. diagnoses pneumonia in children. M, Mafy et al. Value of transthoracic Medscape Medical News. January 9, 2013. ultrasonography in differentiating

8_special

JML_Volume

53 Journal of Medicine and Life Vol. 8, Special Issue 3, 2015, pp.54-58

Comparison of anti-Mullerian hormone level between uterine artery embolization and myomectomy in uterine fibroma

Keshavarzi F*, Salehi M**, Mansouri A*** *Department of Radiology, Imam Reza Hospital, Kermanshah University of Medical Sciences, Kermanshah, Iran, **Department of Gynecology and Obstetrics, Imam Reza Hospital, Kermanshah University of Medical Sciences, Kermanshah, Iran, ***Kermanshah University of Medical Sciences, Kermanshah, Iran

Correspondence to: Mohammadgharib Salehi, MD, Department of Radiology, Imam Reza Hospital, Kermanshah University of Medical Sciences, Baghe-Abrisham Blvd., Kermanshah, 6714673159, Iran, Phone: 98-831-836-2022, E-mail: [email protected]

Received: March 14th, 2015 – Accepted: June 18th, 2015

Abstract Background: Uterine fibroma is a common gynecologic condition. When pharmacological therapies fail, surgical interventions such as myomectomy, hysterectomy, or uterine artery embolization (UAE) are used for this condition. This study aimed to compare anti- Mullerian hormone level between two methods of UAE and myomectomy in the treatment of uterine fibroma. Material and Method: In this clinical trial held in Imam Reza Hospital of Kermanshah, 40 patients3_2015_draft with uterine fibroma were entered into the UAE group (20 cases) and myomectomy (20 cases). Anti-Mullerian hormone levels were measured twice (before and after therapeutic interventions) using the Monobinal kit. The data were analyzed by the SPSS (ver. 20.0) software by applying the Leven’s test, paired and independent t-test, Wilcoxon, and Mann-Whitney tests. Results: There was no significant difference regarding age between two groups (P>iss 0.05). No significant difference was observed in terms of anti-Mullerian hormone level before and six months after the medical intervention in either group (P> 0.05). Also, no significant difference was detected between the two groups regarding the anti-Mullerian hormone level (P= 0.58). Conclusion: The results obtained demonstrated that there was no statistically significant difference between UAE and myomectomy with regard to anti-Mullerian hormone, which reflects ovarian capacity. Therefore, UAE, which is a less invasive method, can be a suitable substitute for surgical methods in the treatment of symptomatic uterine fibroids among females of reproductive age.

Keywords: Anti-Mullerian hormone, uterine artery embolization, myomectomy, uterine fibroma

Introduction Several randomized clinical trials have 8_specialdemonstrated that at 24-months follow-up, UAE was Uterine fibroid (fibroma) is a non-cancerous associated with comparable outcome with hysterectomy tissue growth with elastic property in the uterine wall. It is and myomectomy in treatment of uterine fibroids [4]. one of the most common gynecologic disorders. However, ovarian failure, as a complication of UAE, has Symptomatic uterine fibroids are associated with created some concern about UAE [4]. Therefore, studies considerable complications and affect 20-40% of have targeted this complication of UAE. childbearing age women [1]. The most common symptom, The real rate of ovarian failure after UAE is not which necessitates treatment of fibroids, comprises known. But, in some studies it has been reported at less menorrhagia, which can potentially lead to iron deficiency than two percent [5]. One of the diagnostic methods for anemia [2]. persistent ovarian failure is raised serum LH and FSH When symptoms of fibroids progress and levels [6]. Mara et al. (2008) showed that the FSH level medical treatments fail, it may become necessary to was significantly higher in those treated by UAE when implement the intervention. Considering the location of compared to myomectomy group [7]. In contrast, some fibroids, surgical methods such as myomectomy or studies advocated that UAE did not result in premature hysterectomy were performed in the past. However, in ovarian failure [8]. For instance, the reports made by recent years less invasive methods like uterine artery Rashid et al. (2010) as well as Hovsepian et al. (2006) did JML_Volumeembolization (UAE) have been used. In the past decade, not mention a significant difference in this regard at UAE has been used as an alternative to surgical methods follow-up period after UAE and surgical intervention [8,9]. to reduce the abnormal uterine bleeding. As the best non- Another diagnostic method to diagnose ovarian surgical method, UAE was first introduced by Ravina in failure is the measurement of anti-Mullerian hormone 1995 [3]. (AMH) level [7]. This hormone has an important role in the Journal of Medicine and Life Vol. 8, Special Issue 3, 2015

ovarian function after birth and is involved in primary years and were matched in the two groups. Demographic follicle development; in fact, AMH level is related to the and background information (age, hospitalization duration, number of ovarian follicles [7]. This hormone reaches its pain severity after one week, re-intervention, the cost, and peak level after puberty and gradually decreases during time elapsed for the patient to return to work) as well as ovulation periods [10]. Diminished ovarian reserve could clinical and laboratory findings were gathered by the be determined better and more precisely with the resident and documented in a checklist. AMH measurement of AMH. AMH has been recognized as a measurement was done by the Monobinal kit and all reliable marker for ovarian reserve, in particular antral laboratory tests were done at Razi Laboratory. AMH level follicles [11]. In contrast to LH and FSH, it is not was measured before the interventions. Pain severity was necessary to do an AMH measurement on the third day of determined on the third post-intervention day. The the menstrual period. In limited former studies, most hospitalization duration was documented. The phone studied subjects were at pre-menopausal age and the number of the resident was delivered to all patients to probability of premature ovarian failure was emphasized. contact her in case of facing any problem after discharge In much limited studies, the ovarian capacity in younger from hospital. patients has been assessed. In addition, ovarian capacity Six months later, the patients were contacted by was determined by measuring LH and FSH, not AMH. the resident and were asked to present to the hospital for Since the results of studies about ovarian capacity after a free consultation and physical examination. At that visit, UAE and myomectomy is controversial and there is the AMH level as well as serum hemoglobin levels were limited knowledge about the comparison of ovarian measured. Also, the patients were asked about pain, capacity between UAE and myomectomy with 6-months additional treatments such as hormonal agents, re- follow-up, this study was performed with the objective of intervention, re-presentation to hospital, and time period comparing AMH between UAE and myomectomy in the required to return to work. treatment of uterine fibroma. The gathered data3_2015_draft were entered in SPSS (ver. 20.0) software. The descriptive indices including mean Material and Method and standard deviation (SD) were used to report the results. The issanalyses were accomplished by employing the Leven’s test, paired and independent t-test, Wilcoxon, This was a clinical trial, which, after being and Mann-Whitney U test. The significance level was set verified by the Ethics Committee of Kermanshah at 0.05. University of Medical Sciences, was done in the Gynecology Department of Imam Reza Hospital. Using a confidence of 99% and power of 95% and mean (±SD) of Results AMH in myomectomy and UAE groups of 8.9 (±0.7) and 9.9 (±0.1), the minimum sample size was calculated as The sample studied included 40 women with the having 20 persons in each group. age range of 27-40 years. They were divided into two Measures were undertaken to keep the names of groups: UAE (20 cases) and myomectomy (20 cases). As patients confidentially and to avoid any cost on them. shown in Table 1, the mean age of the myomectomy Also, at the start of the study, the8_special details of the group was 35.5 years and in UAE group this was 34.55 interventions were explained by the gynecologist and years, with no significant difference (P= 0.968). Pain resident to the patients. Then the patients voluntarily score in myomectomy group was 6.3 and in UAE, it was decided to receive UAE or myomectomy, while 7.2. Hospitalization duration was significantly higher in the considering the required criteria for receiving the myomectomy group (P< 0.001). However, the cost of UAE treatments. In addition, the patients were categorized in was higher than the myomectomy (Table 1). four age groups including 20-25, 25-30, 30-35, and 35-40

Table 1. Mean (SD) of background variables in uterine artery embolization (UAE) and myomectomy groups Myomectomy UAE P value Age Mean (SD) 35.50 (3.88) 34.55 (3.94) 0.968 Pain Mean (SD) 6.35 (2.03) 7.20 (1.70) 0.160 Hospitalization (day) Mean (SD) 3.25 (0.444) 2.05 (0.394) < 0.001 Treatment costs Mean (minimum-maximum) 297,500 (180,000- 270,000 < 0.001 (Rials) 500,000) (500,000- 5,000,000) JML_VolumeTime taken to return Mean (minimum-maximum) 10 (5-20) 8.05 (2-12) 0.289 to work

Regarding the need for re-intervention, follow-up The Wilcoxon test results about the difference in at six months showed that no patient required re- AMH level before and six months after the interventions intervention. showed no significant difference in either group (P= 55 Journal of Medicine and Life Vol. 8, Special Issue 3, 2015

0.070). Also, regarding the the Kolmogorov–Smirnov test, Also, the analyses showed that no significant AMH level before and after six months had a normal difference existed between UAE and myomectomy groups distribution and no statistically significant difference was regarding AMH level (Table 2). seen (P= 0.839).

Table 2. Anti-Mullerian hormone (AMH) level before and after six months in uterine artery embolization (UAE) and myomectomy groups Treatment group AMH level Minimum Maximum Mean Standard P value P value deviation Myomectomy Before 0.12 2.20 2.91 4.42 (N= 20) intervention After intervention 0.1 21 3.05 4.62 0.070 UAE (N= 20) Before 0.1 7.11 2.24 2.97 intervention 0.58 After intervention 0.1 20.8 2.14 2.14 0.839

Discussion al. study (2003), the hospitalization time in UAE was shorter [16]. This study was done with the objective of In the current study, no significant difference was comparing AMH level between UAE and myomectomy observed about the time needed to return to work. But, in groups in treatment of uterine fibroma. Myomectomy is a Razavi et al. (2003) and Hehenkamp et al. (2006) studies, standard surgical option for women with symptomatic the return to work and other normal daily routine was uterine fibroma who desire to preserve fertility and do not shorter in the UAE group3_2015_draft [8,16], which contradicted what respond to medical treatment. UAE is a less invasive we observed. method in the treatment of this condition. Since there is In the current study, costs related to UAE were limited evidence about the ovarian capacity at 6-months higher than those of the myomectomy group. This is in follow-up after UAE and myomectomy, this study was agreement withiss reports by Pourrat et al. (2003) who done at Imam Reza Hospital of Kermanshah. reported that UAE costs were higher than trans-vaginal In this clinical trial, the two groups did not have a hysterectomy costs [17]. significant difference regarding age. The two groups were According to most studies, a main disadvantage matched regarding age, which was an advantage of this of UAE is the need to re-intervention after five years; Van- study. This variable has not been assessed in other Rooij et al. (2005) and Moss et al. (2010) reported the studies. need for re-intervention in UAE group compared to the No significant difference was seen regarding hysterectomy group and this was mostly in the first two- pain score between the two groups, though patients in years period after embolization [11,18]. However, in the UAE experienced more severe pain. Hehenkamp et al. current study, no difference was seen between the two (2006) and Edwards et al. (2007) stated that pain in the groups regarding the need for re-intervention. first 24-hours after the intervention was8_special significantly less AMH level before and after 6 months post- severe in UAE than in the hysterectomy group [12,13], intervention was studied in the current study. No which was not in agreement with our results. However, difference was seen in this regard in either group. When generally speaking, pain severity was comparable comparing the two groups, also no significant difference between the two groups. According to Mara et al. (2008), was seen in the AMH level, as a marker for ovarian pain and nausea were not mentioned as main problems capacity. This was in agreement with most studies. In the after the intervention and these two issues were clinical trial of Hehenkamp et al. (2007), no significant comparable in UAE and surgery groups, but bleeding, difference was seen regarding the FSH level between pain, and pelvic pressure were more common in the UAE UAE and hysterectomy groups. After 24 months of follow- group than in the hysterectomy group [7]. In Volker et al. up, a significant increase in the FSH level was seen in the (2007) study, severe hemorrhage was more prominent in UAE group. It is to be noted than women in the mentioned UAE than in hysterectomy, but no significant difference study entered menopause after the intervention [4]. Also was observed regarding other complication such as pain in the latter study, the AMH level was measured, which and pelvic pressure [14]. was revealed to decrease in all period times, which were In terms of hospitalization, a significant anticipated considering the fact that women aged. The JML_Volumedifference was seen between the two studied groups. This results of the study showed that both UAE and time was shorter in UAE than in the myomectomy group. hysterectomy affected the ovarian capacity [4]. Rashid et Likewise, the hospitalization period was shorter in UAE al. (2010) and Mara et al. (2008) measured FSH as a compared to myomectomy and hysterectomy groups marker for ovarian capacity [7,8]. The first study reported according to Hehenkamp et al. (2006), Edwards et al. that among women with FSH levels higher than 40 IU/ L, (2007), Pinto et al. (2003) studies [4,13,15]. In Razavi et no difference was seen between UAE and myomectomy,

56 Journal of Medicine and Life Vol. 8, Special Issue 3, 2015 which was compatible with our results [8]. In contrast, Conclusion Mara et al. (2008) who used the cut-off point of 10 IU/ L for FSH, reported that most patients of the UAE group In general, the results of this study showed that had FSH levels of more than 10 IU/ mL, which was no significant differences existed between UAE and significantly higher when compared to the myomectomy myomectomy regarding the hospitalization period, and the group [7]. Kahn et al. (2011) also showed that the FSH time elapsed to return to work which were in agreement level was higher in the UAE group compared to with the former studies. Also, it was highlighted that no myomectomy [19], which were not in agreement with our significant difference was seen between the two groups results. regarding the AMH level, which is a marker for ovarian Gupta et al. (2012) reported that myomectomy is capacity. Therefore, UAE can be used for childbearing associated with a better fertility outcome compared to age females as a less invasive method. A disadvantage of UAE, but this was not significant. No significant this method is its high costs. differences were seen between these two methods Considering the low sample size we had, it is regarding major complications. Ovarian failure and recommended that further studies employ more sample intervention failure was also comparable between the two size and apply AMH levels, an accurate marker for methods [20]. In Hovsepian et al. (2006) study, even ovarian capacity. Also, it is better to follow patients for though a gradual increase in the FSH level was seen as a longer periods of time. marker for ovarian capacity, no significant difference was seen regarding the FSH between UAE, myomectomy, and Acknowledgments hysterectomy groups at 1, 3, and 6 months follow-up [9]. This article was based on a thesis submitted to the In a similar way, no difference was seen regarding the graduate studies office in partial fulfillment of ovarian failure in the 12-months follow-up period between requirements for the degree of specialist of gynecology UAE and surgery, in Rashid et al. study (2010) [8]. and obstetrics by Afsaneh3_2015_draft Mansouri in Kermanshah The damage to the ovarian reserve in the two University of Medical Sciences, Faculty of Medicine. methods of treatment is hard to diagnose since a single reliable test has not been defined yet. However, regarding Conflict of Interestiss: the findings of this study and similar ones it seems that The authors have no conflict of interest to there was no significant difference between UAE and the declare. surgical methods regarding ovarian capacity.

References

1. Van der Kooij SM, Hehenkamp WJ, treatment of uterine leiomyomata midterm ovarian function. J Vasc Interv Radiol. Volkers NA, Birnie E, Ankum WM, results. J Vasc Interv Radiol. 1999 Oct; 2006 Jul; 17(7):1111-5. Reekers JA. Uterine artery embolization 8_special10(9):1159-65. 10. De Vet A, Laven JS, de Jong FH, vs hysterectomy in the treatment of 6. Speroff L, Fritz MA. Clinical Gynecologic Themmen AP, Fauser BC. Antimullerian symptomatic uterine fibroids: 5-year Endocrinology and Infertility, 7thedn., hormone serum levels: a putative marker outcome from the randomized EMMY 2005, Philadelphia: Lippincott Williams & for ovarian aging. Fertil Steril. 2002 Feb; trial. Am J Obstet Gynecol. 2010 Aug; Wilkins. 77(2):357-62. 203(2):105,e1-13. 11. Van Rooij IA, Broekmans FJ, Scheffer 2. David M, Ebert AD. Treatment of uterine 7. Mara M, Maskova J, Fucikova Z, Kuzel GJ, Looman CW, Habbema JD, de fibroids by embolization-advantages, D, Belsan T, Sosna O. Midterm clinical Jong FH et al. Serum antimullerian disadvantages, and pitfalls. Eur J Obstet and first reproductive results of a Gynecol Reprod Biol. 2005 Dec 1; hormone levels best reflect the randomized controlled trial comparing reproductive decline with age in normal 123(2):131-8. uterine fibroid embolization and 3. Ravina JH, Herbreteau D, Ciraru- women with proven fertility: a longitudinal Vigneron N, Bouret JM, Houdart E, myomectomy. Cardiovasc Intervent study. Fertil Steril. 2005 Apr; 83(4):979- Aymard A et al. Arterial embolisation to Radiol. 2008 Jan-Feb; 31(1):73-85. 87. treat uterine myomata. Lancet. 1995 Sep 8. Rashid S, Khaund A, Murray LS, Moss 12. Hehenkamp WJK, Volkers NA, Birnie 9; 346(8976):671-2. JG, Cooper K, Lyons D et al. The E, Reekers JA, Ankum WA. Pain and 4. Hehenkamp WJ, Volkers NA, effects of uterine artery embolisation and return to daily activities after uterine Broekmans FJ, de Jong FH, Themmen surgical treatment on ovarian function in artery embolization and hysterectomy in AP, Birnie E et al. Loss of ovarian women with uterine fibroids. BJOG. 2010 the treatment of symptomatic uterine JML_Volumereserve after uterine artery embolization: fibroids: results from the randomized Jul; 117(8):985-9. a randomized comparison with EMMY trial. Cardiovasc Intervent Radiol. hysterectomy. Hum Reprod. 2007 Jul; 9. Hovsepian DM, Ratts VS, Rodriguez M, Huang JS, Aubuchon MG, Pilgram TK. 2006; 29:179-87. 22(7):1996-2005. 13. Edwards RD, Moss JG, Lumsden MA, 5. Goodwin SC, McLucas B, Lee M, Chen A prospective comparison of the impact of uterine artery embolization, Wu O, Murray LS, Twaddle S et al. G, Perrella R, Vedantham S et al. Uterine-artery embolization versus Uterine artery embolization for the myomectomy, and hysterectomy on

57 Journal of Medicine and Life Vol. 8, Special Issue 3, 2015

surgery for symptomatic uterine fibroids. clinical trial. Radiology. 2003; 226:425– hysterectomy. Eur J Obstet Gynecol The New England Journal of Medicine. 31. Reprod Biol. 2003; 111:59–64. 2007; 356(4):360. 16. Razavi MK, Hwang G, Jahed A, 18. Moss JG, Cooper K, Khaund A et al. 14. Volkers NA, Hehenkamp WJK, Birnie Modanloo S, Chen B. Abdominal The REST Trial: randomized controlled E, Ankum WA, Reekers JA. Uterine myomectomy versus uterine fibroid trial of embolization versus surgical artery embolizationversus hysterectomy embolization in the treatment of treatment for fibroids; 5 year outcomes. in the treatment of symptomatic uterine symptomatic uterine leiomyomas. Am J Abstractbook. CIRSE. 2010. fibroids: 2 years’ outcome from the Roentgenol. 2003; 180:1571–5. 19. Kahn V, Fohlen A, Pelage JP. Role of randomized EMMY trial. Am J Obstet 17. Pourrat XJL, Fourquet F, Guerif F, embolization in the management of Gynecol. 2007; 196:519,e1-11. Viratelle N, Herbreteau, Marret H. uterine fibroids. J Gynecol Obstet Biol 15. Pinto I, Chimeno P, Romo A et al. Medico-economic approach to the Reprod. 2011 Dec; 40(8):918-27. Uterine fibroids: uterine artery management of uterine myomas: a 6- 20. Gupta JK, Sinha A, Lumsden MA, embolization versus abdominal month cost-effectiveness study of pelvic Hickey M. Uterine artery embolization for hysterectomy for treatment – a embolization versus vaginal symptomatic uterine fibroids. Cochrane prospective, randomized and controlled Database Syst Rev. 2012; 5:CD005073.

3_2015_draft

iss

8_special

JML_Volume

58 Journal of Medicine and Life Vol. 8, Special Issue 3, 2015, pp.59-65

Predictors of slow and no-reflow as detected by Thrombolysis in Myocardial Infarction [TIMI] flow grade following Primary Percutaneous Coronary Angioplasty

Bahrehmand M*, Sadeghi E**, Shafiee A***, Nozari Y*** *Department of Cardiology, Kermanshah University of Medical Sciences, Kermanshah, Iran, **Department of Surgery, Kermanshah University of Medical Sciences, Kermanshah, Iran, ***Tehran Heart Center, Tehran University of Medical Sciences, Tehran, Iran

Correspondence to: E Sadeghi, MD, Department of Surgery, Kermanshah University of Medical Sciences, Kermanshah, Iran, Kermanshah, Iran, Phone: +989126079747, E-mail: [email protected]

Received: March 14th, 2015 – Accepted: June 18th, 2015

Abstract Background: Primary percutaneous coronary intervention (PCI) is still associated with a noticeable incidence of suboptimal coronary flow thrombolysis in myocardial infarction (TIMI). The predictors of slow and no-reflow in patients who underwent primary PCI in our institute was searched for and the relationship of these parameters with major adverse cardiovascular events (MACE) was assessed. 3_2015_draft Material and Method: 397 patients with AMI presenting within 24 hours from the symptom onset were retrospectively enrolled and underwent primary PCI between March 2006 and March 2012. Demographic, clinical, and procedural data were retrieved from our institutional databank. The baseline and post-PCI blood flow in the revascularized artery was graded according to the TIMI grading system. The follow-up visits were performed after 1, 6 and 12 months from hospitalization.iss All the mortalities and complications were recorded within this period to assess the MACE. Results: The frequency of diabetes mellitus and renal failure were significantly higher in patients with a TIMI flow of 0-1 (p=0.03 and p=0.01, respectively). Similarly, serum levels of creatine were significantly higher in patients with a TIMI flow of 0-1. The predictors for TIMI flow included the use of Adenosin or Integrilin, diabetes mellitus, POIT, long tubular lesion, and lesion in the LAD territory. The incidence of MACE was significantly higher in patients with a TIMI flow of 0-1 (P=0.001) and the survival in this subgroup was significantly poorer (Hazard ratio=4.96; P<0.001). Conclusion: A low TIMI flow is accompanied by a poorer survival and a higher MACE and is influenced by some clinical and vascular characteristics.

Abbreviations ACE = Angiotensin converting enzyme, ARB = Angiotensinogen receptor blocker, BMI = Body mass index, DBP = Diastolic blood pressure, EF = Ejection fraction, FBS = Fasting blood sugar, Hb = Hemoglobin, HDL = high density lipoprotein, LDL = Low density lipoprotein, MPV = Mean platelet volume, SBP8_special = Systolic blood pressure, STEMI = ST-elevation myocardial infarction, WBC = White blood cell, AHA = American Heart Association, LAD = Left Anterior Descending, LCX = Left circumflex, LM = Left main, PCI = Percutaneous coronary intervention, RCA = Right coronary artery, SVG = Saphenous vein graft, CI = Confidence interval, LAD = Left anterior descending artery, CABG = Coronary artery bypass graft, MACE = Major adverse cardiac events, MI = Myocardial infarction, TLR = Target lesion revascularization, TVR = Target vessel revascularization

Keywords: TIMI Flow, myocardial infarction, no reflow, Percutaneous Coronary Intervention

Introduction predictor for the outcome in patients with AMI, patients with a TIMI flow of up to grade 2 had a poor prognosis [7- Primary percutaneous coronary intervention 8]. (PCI) has become the treatment of choice for acute No-reflow was defined as suboptimal myocardial myocardial infarction (AMI). In spite of the advances in the reperfusion through a part of coronary circulation without stenting and angioplasty procedures, primary PCI is still angiographically proving a mechanical vessel obstruction associated with 4–11% incidence of suboptimal coronary [9]. Several factors, including age, infarct localization, the JML_Volumeflow thrombolysis in myocardial infarction (TIMI) [1-4]. extent of the initial AMI area, the lack of residual blood Current evidence shows that the AMI patients with flow in the infarct-related artery, previous AMI, elevated angiographic suboptimal reflow have a weak functional levels of C-reactive protein can increase the risk of poor recovery and a higher rate of post-AMI complications final coronary blood flow [8,10]. Although several methods compared to the patients with an optimal reflow [3,5,6]. have been utilized to increase the success of PCI and While the TIMI 3 flow following PCI is an important reduce the mortality and morbidity [11], the recognition of Journal of Medicine and Life Vol. 8, Special Issue 3, 2015 the predictors of reperfusion failure can help increase the reopening the occluded coronary artery and the quality of the procedure and thereby, its rate of success. successful stent placement with no evidence of flow- In the present study, we aimed to find out the limiting residual stenosis (<50%), spasm, dissection, or predictors of slow and no-reflow in patients who apparent thrombus and [2] angiographic evidence of a underwent primary PCI in our institute. Moreover, we TIMI flow grade ≤2, at least 10 minutes after the end of assessed the relationship of these parameters with major the PCI procedure. adverse cardiovascular events (MACE). The post-PCI antiplatelet therapy consisted of clopidogrel (75 mg/ d for at least 1 to 6 months) and aspirin (80 mg/ d administered orally). The other cardiac Material and Method conditions were treated based on the judgment of the responsible physician. The follow-up visits were routinely In this cohort study, we retrospectively enrolled performed after 1, 6, and 12 months from hospitalization 397 patients with AMI presenting within 24 hours from the in our center. All the mortalities and cardiac related symptom onset and underwent primary PCI between complications were recorded within this period and were March 2006 and March 2012 in Tehran Heart Center. used to assess the MACE. MACE was defined as in- Tehran Heart Center is a 460-bed tertiary center for hospital mortality, cardiac death, nonfatal myocardial cardiovascular diseases, affiliated to Tehran University of infarction (MI), or target vessel revascularization. In- Medical Sciences, Tehran, Iran. Patients who were hospital MI was diagnosed within the first seven days treated via thrombolysis or coronary artery bypass graft following the procedure if new abnormal Q waves were (CABG) surgery were not included. Data of the enrolled observed with an increase in serum creatine kinase-MB patients, including the demographic, clinical and (CK-MB) isoenzyme or just an increase in CK-MB more procedural parameters, were retrieved from the than threefold in the case of absence of the Q waves [17- angioplasty databank of our center [12]. 18]. All the recruited patients had signed a written 3_2015_draft informed consent at the time of admission, declaring that Statistical Analysis their clinical data could be used anonymously for The mean ± standard deviation or median with research. The study protocol was approved by the quartiles, and frequency (percentage) were used to Research Board of Tehran Heart Center, and the describe theiss continuous and categorical variables, Committee of Medical Ethics of Tehran University of respectively. The continuous variables were compared Medical Sciences. between the TIMI groups by using the student’s t or The ST-segment elevation acute myocardial Mann-Whitney U test. Categorical variables were infarction was diagnosed in the presence of chest pain compared between the mentioned groups by using chi- lasting for more than 20 minutes associated with the square or the Fisher’s exact test. A multivariate logistic electrocardiographic changes (ST-segment elevation of regression analysis was performed to determine the more than 1 mm in at least 2 extremity clinical and angiographic variables that could electrocardiographic leads or more than 2 mm in at least independently predict the poor post-interventional 2 contiguous precordial leads or new onset left bundle coronary reflow. All data were processed with the PASW, branch block). The diagnosis was confirmed by coronary version 18.0 (Chicago, Illinois, USA). P-values less than angiography in all patients. or equal to 0.05 were considered statistically significant. The angiography and PCI was 8_specialperformed in the catheterization laboratory of Tehran Heart Center under local anesthesia. All angioplasty procedures were Results performed according to current standard guidelines [13- 15]. All the patients received 325 mg Aspirin orally, 600 The present study consisted of 397 patients mg Clopidogrel, 80 mg statin and a weight adapted bolus (mean age = 56.57 ± 12.43 years), male gender = 312 of intravenous heparin (100 IE/ kg) prior to PCI. Stenting (78.6%) whose data were reviewed and who underwent was performed in more than 90% of the cases, bare metal an elective coronary angiography in our center. Slow/ no- stents being mostly used. The angiography videos were reflow occurred in 18 (4.5%) patients. Baseline revised by a cardiologist, who was unaware of the study characteristics of the study subjects were compared protocol, in order to increase the intra- and inter-observer based on the final TIMI flow grade subgroups as shown in reliability. The baseline and post-PCI blood flow in the Table 1. Regarding this comparison, the frequency of revascularized artery was graded according to the TIMI diabetes mellitus and renal failure were significantly grading system [16]. In fact, grade 0 perfusion higher in patients with a TIMI flow grade of 0-1 (p=0.03 represented no antegrade flow beyond the occlusion; and p=0.01, respectively). Similarly, serum levels of grade 1 was a minimal incomplete perfusion of contrast creatine were significantly higher in patients with TIMI flow JML_Volumemedium around the clot; grade 2 (partial perfusion) was a grade = 0-1. The use of aspirin, beta-blockers, nitrates complete but delayed perfusion of the distal coronary bed and clopidogrel was significantly higher in patients with a with contrast material; and grade 3 (complete perfusion) TIMI flow of 2 (p=0.001, p=0.02, p=0.004, and p=0.004, was an antegrade flow to the entire distal vessel at a respectively). Also, the use of adenosine and integrilin normal rate. The diagnosis of no-reflow was made based was significantly higher in patients with TIMI flow grade 2 on the following criteria: [1] angiographic evidence of 60 Journal of Medicine and Life Vol. 8, Special Issue 3, 2015 (p<0.001 for both). On the other hand, the use of lipid flow grade of 0-1. lowering agents was more frequent in patients with a TIMI

Table 1. Baseline characteristics of the study population Characteristics TIMI = 0,1 (n=18) TIMI = 2 (n=151) TIMI = 3 (n=228) P-value* Age 57.94 ± 16.78 56.69 ± 11.67 56.39 ± 12.58 0.86 Male gender 11 (61.1) 123 (81.5) 178 (78.1) 0.13 BMI 28.62 ± 4.05 27.30 ± 3.76 26.85 ± 4.20 0.31 Abdominal circumference 107.5 (97.0, 113.5) 99.0 (93.5, 105.5) 99.0 (93.0, 106.0) 0.11 Medical history Family history of CAD 2 (11.1) 25 (16.6) 49 (21.5) 0.33 Diabetes mellitus 9 (50.0) 50 (33.6) 54 (23.8) 0.01 Hypertension 9 (50.0) 67 (45.0) 102 (44.9) 0.91 Dyslipidemia 10 (55.6) 106 (71.6) 150 (66.7) 0.3 Smoking 0.3 Current 3 (16.7) 49 (32.9) 77 (33.9) Former 1 (5.6) 19 (12.8) 20 (8.8) Stable angina 0 (0) 10 (6.6) 23 (10.1) 0.2 Unstable angina 1 (5.6) 19 (12.6) 33 (14.5) 0.53 Angina pectoris 9 (50.0) 76 (50.3) 123 (53.9) 0.62 STEMI 16 (88.9) 143 (94.7) 211 (92.5) 0.54 Non-STEMI 3 (16.7) 12 (7.9) 20 (8.8) 0.46 CVA 0 (0) 2 (1.3) 6 (2.6) 0.64 Renal failure 1 (5.6) 1 (0.7) 0 (0) 0.03 Drug history 3_2015_draft Aspirin 15 (83.3) 132 (87.4) 164 (71.9) 0.001 ACE inhibitor 11 (61.1) 98 (64.9) 126 (55.2) 0.16 ARB 1 (5.6) 9 (6.0) 6 (2.6) 0.25 Beta-blocker 13 (72.2) 120 (79.4) iss153 (67.1) 0.02 Nitrate 12 (66.7) 122 (80.7) 150 (65.7) 0.004 Calcium channel blocker 0 (0) 8 (5.2) 14 (6.1) 0.53 Plavix 12 (66.7) 105 (69.5) 121 (53.0) 0.004 Lipid lowering agent 7 (38.9) 57 (37.7) 56 (24.5) 0.01 Statin 6 (33.3) 58 (38.4) 76 (33.3) 0.59 Glucose lowering agent 6 (33.3) 21 (13.9) 36 (15.7) 0.11 Insulin 2 (11.1) 4 (2.7) 5 (2.1) 0.13 Warfarin 1 (5.6) 1 (0.7) 1 (0.5) 0.18 Verapamil 0 (0) 5 (3.3) 7 (3.0) 1 Adenosine 4 (22.2) 43 (28.4) 18 (7.8) <0.001 Integrilin 10 (55.5) 8_special86 (56.9) 60 (26.3) <0.001 SBP 135.0 (119.0, 155.0) 131.0 (120.0, 150.5) 130.0 (120.0, 150.0) 0.99 DBP 77.0 (70.0, 80.0) 85.0 (70.0, 100.0) 81.0 (75.0, 97.5) 0.09 Heart rate 72.0 (60.0, 95.5) 78.5 (68.7, 90.0) 78.0 (65.0, 86.0) 0.71 Hb 14.57 ± 1.57 14.61 ± 1.64 14.76 ± 1.79 0.71 Hematocrit 42.30 ± 3.68 43.04 ± 4.06 43.44 ± 5.44 0.82 WBC 11054.55 ± 3488.94 10261.22 ± 3178.09 10610.40 ± 3681.88 0.56 Platelets 212000 (167550, 261000) 215000 (174000, 264000) 223000 (189750, 257250) 0.51 MPV 10.43 ± 0.85 9.77 ± 1.06 9.85 ± 0.90 0.18 FBS 169.0 (100.0, 228.0) 119.0 (102.0, 158.0) 116.0 (97.0, 156.7) BS 186.0 (138.7, 348.0) 144.0 (113.0, 199.0) 141.0 (114.5, 205.0) 0.18 HbA1c 9.54 ± 1.43 8.36 ± 2.46 8.45 ± 2.04 0.54 Total Cholesterol 176.80 ± 47.93 184.00 ± 46.10 183.39 ± 41.02 0.82 Triglyceride 139.0 (83.0, 177.0) 129.0 (90.0, 176.0) 138.0 (99.0, 178.0) 0.56 LDL 106.13 ± 37.97 114.55 ± 38.85 113.90 ± 35.27 0.7 HDL 42.0 (26.0, 53.0) 41.0 (35.0, 47.0) 41.0 (36.0, 47.0) 0.91 JML_VolumeCreatinine 1.1 (1.0, 1.2) 1.0 (0.8, 1.1) 1.1 (0.9, 1.2) 0.004 Global EF 50.0 (35.0, 50.0) 45.0 (37.75, 50.0) 45.0 (35.0, 55.0) 0.78 right ventricular diameter 3.25 (3.0, 4.0) 3.2 (2.9, 3.5) 3.0 (3.0, 3.5) 0.21 * P-value ≤ 0.05 was considered as statistically significant ACE = Angiotensin converting enzyme, ARB = Angiotensinogen receptor blocker, BMI = Body mass index, DBP = Diastolic blood pressure, EF = Ejection fraction, FBS = Fasting blood sugar, Hb = Hemoglobin, HDL = high density lipoprotein, LDL = Low density lipoprotein, MPV = Mean platelet volume, SBP = Systolic blood pressure, STEMI = ST-elevation myocardial infarction, WBC = White blood cell

61 Journal of Medicine and Life Vol. 8, Special Issue 3, 2015

The comparison of the procedural parameters grade 0-1 subgroup (P<0.001 for both variables). The showed that the rate of angioplasty in the TIMI flow grade- long tubular lesion was significantly more observed in the 3 subgroup was significantly less than the one in other TIMI flow grade 3 subgroup (P=0.004) while the diffuse groups while right coronary artery had a more frequency lesion was more prevalent in the TIMI flow grade 0-1 in this group. Post dilatation maximum balloon inflation subgroup (P=0.008). The total occlusion and dissection pressure was significantly higher in the TIMI-3 subgroup. was more observed in the TIMI flow grade 0-1 subgroup On the other hand, thrombosis migration and ostial (P=0.03). The details of the procedural variables are dilatation was significantly more observed in the TIMI flow depicted and summarized in Table 2.

Table 2. Comparing the angiographic parameters between the TIMI subgroups Parameter TIMI = 0,1 (n=18) TIMI = 2 (n=151) TIMI = 3 (n=228) P-value* Reperfusion time 6.70 ± 3.75 8.16 ± 6.98 7.42 ± 7.52 0.22 Target vessel 0.001 LAD 13 (72.2) 110 (72.8) 125 (54.8) LCX 1 (5.6) 9 (5.9) 36 (15.8) RCA 3 (16.7) 32 (21.2) 66 (28.9) SVG 1 (5.6) 0 (0) 1 (0.4) AHA grade (B2, C) 14 (77.7) 127 (86.4) 193 (84.6) 0.88 Number of lesions 2.0 (2.0, 2.0) 2.0 (2.0, 2.0) 2.0 (2.0, 2.0) 0.4 Lesion length 20.0 (15.2, 25.7) 21.5 (16.0, 28.5) 20.0 (15.0, 27.5) 0.07 Stent diameter 3.5 (2.7, 3.5) 3.0 (3.0, 3.5) 3.0 (2.7, 3.5) 0.18 Stent length 18.0 (12.0, 24.0) 23.0 (18.0, 28.0) 20.0 (18.0, 28.0) 0.09 Stent inflation pressure 12.0 [(9.0, 14.0) 12.0 (12.0, 14.0) 3_2015_draft12.0 (11.0, 14.0) 0.46 Post dilatation Maximum balloon inflation 11.0 (7.0, 12.0) 16.0 (14.0, 19.5) 18.0 (14.0, 20.0) 0.008 pressure Maximal inflation pressure 10.0 (8.0, 11.0) 10.0 (8.0, 12.0) 10.0 (8.0, 12.0) 0.72 New thrombectomy 4 (22.2) 31 (21.2) iss 21 (9.7) 0.005 Persistent dye stasis distal to occlusion 4 (22.2) 19 (11.1) 16 (6.1) 0.04 Thrombosis migration 8 (44.4) 23 (15.2) 13 (5.7) <0.001 Ostial lesion 4 (22.2) 7 (4.6) 5 (2.2) <0.001 Proximal lesion 6 (33.3) 78 (51.7) 100 (43.9) 0.17 Non-proximal 8 (44.4) 62 (41.1) 111 (48.7) 0.34 Long tubular 4 (22.2) 41 (27.2) 97 (42.5) 0.004 Diffuse lesion 13 (72.2) 94 (62.3) 110 (48.2) 0.008 Calcified lesion 0 (0) 4 (2.6) 13 (5.7) 0.23 Bifurcation 0 (0) 12 (7.9) 8 (3.5) 0.09 Eccentric 0 (0) 18 (11.9) 49 (21.5) 0.008 Tortuous or angulated lesion 7 (38.9) 68 (45.4) 78 (34.2) 0.1 Proximal segment tortuosity 8_special 0.77 Mild 11 (61.1) 101 (98.1) 124 (96.9) Severe 0 (0) 2 (1.9) 4 (3.1) Angulated segment 0 (0) 7 (6.7) 10 (7.8) 0.62 Thrombus 7 (38.9) 46 (30.5) 54 (23.7) 0.17 Total occlusion 15 (83.3) 107 (70.9) 139 (61.0) 0.03 Degenerated vein graft 1 (5.6) 0 (0) 1 (0.4) 0.08 Procedure 0.01 Direct stenting 1 (5.6) 21 (13.9) 28 (12.3) Primary stenting 11 (61.1) 108 (71.5) 173 (75.9) Secondary stenting 3 (16.7) 6 (4.0) 18 (7.9) Ballooning 3 (16.7) 16 (10.6) 9 (3.9) Stent type 0.69 Bare metal stent 14 (77.7) 110 (81.5) 178 (81.3) First generation drug eluting stent 1 (5.6) 11 (8.1) 22 (10.0) Second generation drug eluting stent 0 (0) 14 (10.4) 19 (8.7) Side branch occlusion 0 (0) 3 (2.0) 0 (0) 0.12 JML_VolumeDissection 1 (5.6) 0 (0) 5 (2.2) 0.06 Result 0.001 Successful 15 (83.3) 145 (96.0) 227 (99.5) Acceptable 3 (16.7) 6 (4.0) 1 (0.4) Type of PCI 0.9 Single vessel 15 (83.3) 130 (86.1) 198 (86.8)

62 Journal of Medicine and Life Vol. 8, Special Issue 3, 2015

Multivessel 3 (16.7) 21 (13.9) 30 (13.2) Territory 0.61 Single territory 16 (88.9) 139 (92.1) 203 (89.0) Multi territory 2 (11.1) 12 (7.9) 25 (11.0) LAD territory 12 (66.7) 113 (74.8) 135 (59.2) 0.007 RCA territory 4 (22.2) 36 (23.8) 78 (34.2) 0.07 LCX territory 18 (100) 151 227 * P-value ≤ 0.05 was considered as statistically significant AHA = American Heart Association, LAD = Left Anterior Descending, LCX = Left circumflex, LM = Left main, PCI = Percutaneous coronary intervention, RCA = Right coronary artery, SVG = Saphenous vein graft

In the regression analysis, the predictors for TIMI in the LAD territory. Predictors of TIMI flow grade are flow grade were the use of adenosine or Integrilin, history listed in Table 3. of diabetes mellitus, POIT, long tubular lesion, and lesion

Table 3. Independent predictors of TIMI flow score Predictor Odds ratio CI 95% P-value* Adenosine 2.45 1.32-4.52 0.004 Integrilin 3.05 1.89-4.90 <0.001 Diabetes mellitus 1.73 1.04-2.85 0.03 POIT 0.37 0.22-0.63 <0.001 Long tubular lesion 0.55 0.33-0.91 0.02 LAD territory 2.07 1.25-3.46 0.004 CI = Confidence interval, LAD = Left anterior descending artery 3_2015_draft

The incidence of the 12-months MACE in the within each TIMI flow grade subgroup and the comparison study population was 14.1%. However, the incidence of between these subgroups are listed in Table 4. Similarly, MACE was significantly higher in patients with a TIMI flow the survival ofiss the patients with a TIMI flow grade of 0-1 grade of 0-1 (P=0.001). There was no non-cardiac were significantly poorer than the ones of the other two mortality in any of the subgroups but the frequency of subgroups (Hazard ratio =4.96; 95% confidence interval: cardiac mortality was significantly higher in the TIMI flow 2.25-10.94; P<0.001) (Fig. 1). grade of 0-1 subgroup (P<0.001). The frequency of MACE

Table 4. Comparing the frequency of the 12-months MACE between the TIMI subgroups Parameter TIMI = 0-1 (n=18) TIMI = 2 (n=151) TIMI = 3 (n=228) P-value* In-hospital mortality 4 (21.1) 10 (6.6) 5 (2.2) 0.007 TVR 0 (0) 7 (4.6) 16 (7.0) 0.34 TLR 0 (0) 2 (1.3) 5 (2.2) 0.69 Non-fatal MI 1 (5.6) 8_special5 (3.3) 8 (3.5) 0.88 CABG 0 (0) 5 (3.3) 10 (4.4) 0.59 Cardiac death 8 (44.4) 11 (7.3) 7 (3.1) <0.001 Mortality 8 (44.4) 11 (7.3) 7 (3.1) <0.001 Total MACE 8 (44.4) 21 (13.9) 27 (11.8) 0.001 CABG = Coronary artery bypass graft, MACE = Major adverse cardiac events, MI = Myocardial infarction, TLR = Target lesion revascularization, TVR = Target vessel revascularization

Discussion

In this study, the rate of slow/ no-reflow was 4.5%, which is comparable to previous reports [19-20]. It was observed that the TIMI flow grade is influenced by the use of adenosine or Integrilin, history of diabetes mellitus, POIT, long tubular lesion, and lesion in the LAD territory. Moreover, patients with a low TIMI grade have a high risk for MACE and thereby a poor survival. JML_Volume The no reflow phenomenon, or marked impairment of the coronary flow without evident obstruction or distal embolization, is seen in about 2%- 11% of all coronary procedures, depending of the indication and type of intervention [21]. Therefore, the Fig. 1 The survival of the patients with a TIMI TIMI flow grade is a useful tool for the direct 63 Journal of Medicine and Life Vol. 8, Special Issue 3, 2015 measurement of coronary blood flow and the stratification undergo primary PCI. We also presumed that patients of the patients after the procedure. with persistent no-flow might be proper candidates for Several different predictors for slow/ no-reflow pharmacomechanical treatment strategies, such as the phenomenon, such as the C-reactive protein, atrial treatment with glycoprotein IIb/ IIIa inhibitors. natriuretic peptide [22], endothelin-1 [23], thromboxane A2 [24], intraplatelet melatonin [25], white blood cell count Study limitations [26], or plasma glucose level at admission [27], and There are some limitations to our study. First, composition of the culprit plaques in intracoronary this was a single-center, retrospective study. Secondly, ultrasound [28,29], have been identified in previous glycoprotein IIb/ IIIa inhibitors were used in limited cases studies. It should be noted that not all of these factors can be evaluated in routine practice and more applicable due to their price in Iran and our current guidelines. The factors are needed to be implemented. Therefore, in the follow up period of the patients was of 12 months and present study, the clinical factors that are routinely used in longer durations may help in better evaluating the the management of PCI patients were evaluated and it predictors of the TIMI flow. Diabetes mellitus was was found out that the use of adenosine or Integrilin, diagnosed based on the patient’s history or the use of history of diabetes mellitus, POIT, long tubular lesion, and glucose lowering agents and we did not evaluate the lesion in the LAD territory were the independent patients for glucose intolerance. predictors for slow/ no-reflow. Although diabetes mellitus was identified as a predictor for no-flow [30], old age was not a predictor in our study despite the previous report Conclusion [31]. Clinical factors that can be assessed before the Briefly, the use of adenosine or Integrilin, history procedure are more important as they provide a prospect of diabetes mellitus, POIT, long tubular lesion, and lesion for the clinicians to consider all the necessary measures in the LAD territory can be used as predictors for the for preventing slow/ no-reflow during the procedure 3_2015_draft beforehand. These measures can include the control of lower TIMI grade. Moreover, patients with a lower TIMI blood glucose in diabetic patients [32] or the use of grade have a higher MACE and a lower survival. glycoprotein IIb/ IIIa inhibitors [33,34]. In the present study, TIMI flow was significantly Acknowledgmentsiss associated with MACE. This was consistent with previous This work was supported by the Tehran Heart studies that suggested the TIMI flow grade as a predictor Center and Tehran University of Medical Sciences. for MACE [35,36]. Moreover, PCI have been shown as an effective method in the treatment of patient with chronic Conflict of Interest total occlusion [37]. Hence, it seems that the final TIMI The authors have no conflict of interest to flow grade is the main predictor for MACE rather than the declare. initial coronary flow state. Considering the literature and our findings, the final TIMI flow grade can be suggested as a useful predictor for the survival in AMI patients who

References 8_special

1. Grines CL, Browne KF, Marco J et al. A angiography. Heart and vessels. 2011; myocardial infarction. Journal of the comparison of immediate angioplasty with 26(4):363-369. American College of Cardiology. 2010; thrombolytic therapy for acute myocardial 5. Rezkalla SH, Dharmashankar KC, 55(21):2383-2389. infarction. New England Journal of Abdalrahman IB, Kloner RA. No-reflow 8. Kammler J, Kypta A, Hofmann R et al. Medicine. 1993; 328(10):673-679. phenomenon following percutaneous TIMI 3 flow after primary angioplasty is an 2. Zijlstra F, de Boer MJ, Hoorntje J, coronary intervention for acute myocardial important predictor for outcome in patients Reiffers S, Reiber J, Suryapranata H. A infarction: incidence, outcome, and effect with acute myocardial infarction. Clinical comparison of immediate coronary of pharmacologic therapy. Journal of Research in Cardiology. 2009; 98(3):165- angioplasty with intravenous Interventional Cardiology. 2010; 170. streptokinase in acute myocardial 23(5):429-436. 9. Kloner RA, Ganote CE, Jennings RB. infarction. New England Journal of 6. Ito H, Okamura A, Iwakura K et al. The “no-reflow” phenomenon after Medicine. 1993; 328(10):680-684. Myocardial perfusion patterns related to temporary coronary occlusion in the dog. 3. Nielsen PH, Maeng M, Busk M et al. thrombolysis in myocardial infarction Journal of Clinical Investigation. 1974; Primary angioplasty versus fibrinolysis in perfusion grades after coronary 54(6):1496. acute myocardial infarction. Circulation. angioplasty in patients with acute anterior 10. Ndrepepa G, Tiroch K, Keta D et al. JML_Volume2010; 121(13):1484-1491. wall myocardial infarction. Circulation. Jun Predictive Factors and Impact of No 4. Harigaya H, Motoyama S, Sarai M et al. 1 1996; 93(11):1993-1999. Reflow After Primary Percutaneous Prediction of the no-reflow phenomenon 7. Ndrepepa G, Tiroch K, Fusaro M et al. Coronary Intervention in Patients With during percutaneous coronary intervention 5-year prognostic value of no-reflow Acute Myocardial Infarction. Clinical using coronary computed tomography phenomenon after percutaneous coronary Perspective. Circulation: Cardiovascular intervention in patients with acute Interventions. 2010; 3(1):27-33.

64 Journal of Medicine and Life Vol. 8, Special Issue 3, 2015

11. Nafasi L, Rahmani R, Shafiee A, Salari Myocardial Infarction. Clinical Cardiology. patients with impaired glucose tolerance A, Abdollahi A, Meysamie A. High 2010; 33(12):E7-E12. and type 2 diabetes. Diabetes and Reloading Dose of Atorvastatin Prior to 20. Reffelmann T, Kloner RA. The “no- Vascular Disease Research. 2005; Percutaneous Coronary Intervention Can reflow” phenomenon: basic science and 2(3):136-143. Reduce Periprocedural Myocardial clinical correlates. Heart. 2002; 87(2):162- 31. Gagliardi J, Szarfer J, Travetto C et al. Infarction. Current Medical Research and 168. Clinical Predictors of No-Reflow in Opinion. 2013; (0):1-24. 21. Piana RN, Paik GY, Moscucci M et al. Percutaneous Coronary Intervention for 12. Salarifar M, Kassaian SE, Alidoosti M et Incidence and treatment of "no-reflow" Acute Myocardial Infarction. Argentine al. One-Year Clinical Outcomes of Ultra after percutaneous coronary intervention. Journal of Cardiology. 2013; 81(3):240- Long Apollo Polymer-Based Paclitaxel- Circulation. 1994; 89(6):2514-2518. 245. Eluting Stents in Patients with Complex, 22. Jeong YH, Kim WJ, Park DW et al. 32. Lazar HL, Chipkin SR, Fitzgerald CA, Long Coronary Artery Lesions. The Serum B-type natriuretic peptide on Bao Y, Cabral H, Apstein CS. Tight Journal of Tehran Heart Center. 2011; admission can predict the "no-reflow" glycemic control in diabetic coronary 6(3):138. phenomenon after primary drug-eluting artery bypass graft patients improves 13. Kushner FG, Hand M, Smith SC et al. stent implantation for ST-segment perioperative outcomes and decreases 2009 focused updates: ACC/ AHA elevation myocardial infarction. recurrent ischemic events. Circulation. guidelines for the management of patients International Journal of Cardiology. 2010; 2004; 109(12):1497-1502. with ST-elevation myocardial infarction 141(2):175-181. 33. Thiele H, Schindler K, Friedenberger J (updating the 2004 guideline and 2007 23. Eitel I, Nowak M, Stehl C et al. et al. Intracoronary Compared With focused update) and ACC/AHA/SCAI Endothelin-1 release in acute myocardial Intravenous Bolus Abciximab Application guidelines on percutaneous coronary infarction as a predictor of long-term in Patients With ST-Elevation Myocardial intervention (updating the 2005 guideline prognosis and no-reflow assessed by Infarction Undergoing Primary and 2007 focused update) a report of the contrast-enhanced magnetic resonance Percutaneous Coronary Intervention The American College of Cardiology imaging. American Heart Journal. 2010; Randomized Leipzig Immediate Foundation/ American Heart Association 159(5):882-890. Percutaneous Coronary Intervention Task Force on Practice Guidelines. 24. Niccoli G, Giubilato S, Russo E et al. Abciximab IV Versus IC in ST-Elevation Journal of the American College of Plasma levels of thromboxane A2 on Myocardial Infarction Trial. Circulation. Cardiology. 2009; 54(23):2205-2241. admission are associated with no-reflow 2008;3_2015_draft 118(1):49-57. 14. Deckers J, Burgos EF, Lekakis J et al. after primary percutaneous coronary 34. Eitel I, Wöhrle J, Suenkel H et al. Guidelines for percutaneous coronary intervention. European Heart Journal. Intracoronary compared with intravenous interventions. European Heart Journal. 2008; 29(15):1843-1850. bolus abciximab application during 2005; 26:804-847. 25. Dominguez-Rodriguez A, Abreu-iss primary percutaneous coronary 15. Smith SC, Feldman TE, Hirshfeld JW et Gonzalez P, Jimenez-Sosa A, Avanzas intervention in ST-segment elevation al. ACC/AHA/SCAI 2005 Guideline P, Bosa-Ojeda F, Kaski JC. Usefulness myocardial infarction: cardiac magnetic Update for Percutaneous Coronary of intraplatelet melatonin levels to predict resonance substudy of the AIDA STEMI InterventionA Report of the American angiographic no-reflow after primary trial. Journal of the American College of College of Cardiology/ American Heart percutaneous coronary intervention in Cardiology. 2013; 61(13):1447-1454. Association Task Force on Practice patients with ST-segment elevation 35. Stone GW, Cox D, Garcia E et al. Guidelines (ACC/AHA/SCAI Writing myocardial infarction. The American Normal flow (TIMI-3) before mechanical Committee to Update the 2001 Guidelines Journal of Cardiology. 2010; reperfusion therapy is an independent for Percutaneous Coronary Intervention). 106(11):1540-1544. determinant of survival in acute Journal of the American College of 26. Kojima S, Sakamoto T, Ishihara M et al. myocardial infarction analysis from the Cardiology. 2006; 47(1):e1-e121. The white blood cell count is an primary angioplasty in myocardial 16. TIMI Study Group. Definitions used in independent predictor of no-reflow and infarction trials. Circulation. 2001; TIMI trials. http://www.timi.org. mortality following acute myocardial 104(6):636-641. 17. Smith SC Jr., Dove JT, Jacobs AK et al. 8_specialinfarction in the coronary interventional 36. Valgimigli M, Campo G, Malagutti P et ACC/ AHA guidelines for percutaneous era. Annals of Medicine. 2004; 36(2):153- al. Persistent coronary no flow after wire coronary intervention (revision of the 1993 160. insertion is an early and readily available PTCA guidelines) - executive summary: a 27. Iwakura K, Ito H, Ikushima M et al. mortality risk factor despite successful report of the American College of Association between hyperglycemia and mechanical intervention in acute Cardiology/ American Heart Association the no-reflow phenomenon in patients myocardial infarction: a pooled analysis task force on practice guidelines with acute myocardial infarction. J Am Coll from the STRATEGY (Single High-Dose (Committee to revise the 1993 guidelines Cardiol. Jan 1 2003; 41(1):1-7. Bolus Tirofiban and Sirolimus-Eluting for percutaneous transluminal coronary 28. Higashikuni Y, Tanabe K, Tanimoto S Stent Versus Abciximab and Bare-Metal angioplasty) endorsed by the Society for et al. Impact of culprit plaque composition Stent in Acute Myocardial Infarction) and Cardiac Angiography and Interventions. on the no-reflow phenomenon in patients MULTISTRATEGY (Multicenter Circulation. Jun 19 2001;103(24):3019- with acute coronary syndrome: an Evaluation of Single High-Dose Bolus 3041. intravascular ultrasound radiofrequency Tirofiban Versus Abciximab With 18. Silber S, Albertsson P, Aviles FF et al. analysis. Circulation Journal: Official Sirolimus-Eluting Stent or Bare-Metal Guidelines for percutaneous coronary Journal of the Japanese Circulation Stent in Acute Myocardial Infarction interventions. The Task Force for Society. 2008; 72(8):1235-1241. Study) trials. JACC: Cardiovascular Percutaneous Coronary Interventions of 29. Hong YJ, Jeong MH, Choi YH et al. Interventions. 2011; 4(1):51-62. the European Society of Cardiology. Eur Impact of plaque components on no- 37. Salarifar M, Mousavi MR, Saroukhani S JML_VolumeHeart J. Apr 2005; 26(8):804-847. reflow phenomenon after stent et al. Percutaneous Coronary Intervention 19. Dong‐Bao L, Qi H, Zhi L, Shan W, deployment in patients with acute to Treat Chronic Total Occlusion: Wei‐Ying J. Predictors and Long‐term coronary syndrome: a virtual histology- Predictors of Technical Success and One- Prognosis of Angiographic Slow/ intravascular ultrasound analysis. Eur Year Clinical Outcome. Texas Heart No‐Reflow Phenomenon During Heart J. Aug 2011; 32(16):2059-2066. Institute Journal. 2014; 41(1):40-47. Emergency Percutaneous Coronary 30. Collet JP, Montalescot G. The acute Intervention for ST‐Elevated Acute reperfusion management of STEMI in

65 Journal of Medicine and Life Vol. 8, Special Issue 3, 2015, pp.66-71

Clinical results of MyoRing implantation in keratoconic eyes by using the Femtosecond laser technology

Nasrollahi K*, Rezaei L**, Ghoreishi M*, Kashfi A*, Mahboubi M *** *Isfahan University of Medical Sciences, Isfahan, Iran, **Kermanshah University of Medical Sciences, Kermanshah, Iran, ***Abadan School of Medical Sciences, Abadan, Iran

Correspondence to: M Ghoreishi, MD, Associated Professor of Ophthalmology, Isfahan University of Medical Sciences, Isfahan, Iran, Hezar Jerib Avenue, P.O. Box 313, Isfahan, Iran, Phone: 00983134452031, E-mail: [email protected]

Received: March 14th, 2015 – Accepted: June 18th, 2015

Abstract Purpose:To evaluate the clinical results after the implantation of the MyoRing (DIOPTEX, GMBH, Linz, Austria) by using femtosecond laser technology in eyes with keratoconus. Methods:A prospective, nonrandomized, clinical trial was conducted. Twenty-seven eyes of 15 patients with stable keratoconus (6 females and 9 males), with ages ranging from 14 to 49 years were included. All cases presented with reduced best-corrected visual acuity, contact lens intolerance or discomfort, and central corneal thickness of more than 3503_2015_draft μm. MyoRing inserts of 320 μm in thickness and 5 mm in diameter were implanted in all cases into an intrastromal corneal pocket created by using femtosecond technology. Visual, refractive errors, corneal topography, and pachymetry changes were evaluated during a 6-months follow-up period. Results:The mean UDVA (uncorrected distance visual acuity) significantly improvediss from 1.73 ± 0.53 log MAR preoperatively to 0.54 ± 0.40 log MAR postoperatively. The mean CDVA (corrected distance visual acuity) significantly improved from 0.59 ± 0.47 log MAR preoperatively to 0.27 ± 0.16 log MAR postoperatively. The change in the mean UDVA and CDVA was statistically significant (P< 0.000). The mean decrease in the mean keratometry from preoperatively to 6 months postoperatively was -6.41 ± 3.62 D. This change was statistically significant (P< 0.000). The mean minimum and maximum keratometry values were also statistically significant at less than 6 months preoperatively. A significant improvement in UDVA and CDVA was observed 6 months after surgery, which was consistent with the significant reduction in sphere and cylinder. Furthermore, a significant corneal flattening with a mean value of -6.41 ± 3.62 diopters (D) was found. Conclusion:MyoRing implantation using femtosecond technology would be a safe, effective, and predictable method to treat selected cases of keratoconus, being a useful option for the treatment of keratoconus.

Keywords: MyoRing, keratoconus, femtosecond laser 8_special

Introduction The use of full-ring implants has also been purposed as a potential solution for the treatment of irregularly shaped Keratoconus is a non-inflammatory progressive keratoconic corneas [5-6]. corneal thinning, characterized by inferior nasal A new surgical option referred to as the “corneal steepening. The corneal thinning induces high regular and intrastromal implantation system” (CISIS), in which the irregular astigmatism, often with myopia, resulting in mild MyoRing flexible full-ring implant (DIOPTEX GMBH, Linz, to marked impairment in the quality of vision. This Austria) is inserted into a corneal pocket, and has recently disorder is usually bilateral, although one eye may be been developed and proven to be effective in keratoconus affected initially [1-3]. In most cases, the cornea remains [7]. clear and the refractive defect is managed with rigid A mechanical specified device developed for contact lenses or spectacles. In advanced keratoconus CISIS, the Pocket Maker (DIOPTEX GmbH), has been with corneal opacities and scarring, penetrating used until now for the creation of this intrastromal pocket. keratoplasty (PK) is an accepted surgical plane. In MyoRing implantation by using this mechanically JML_Volumepatients who are intolerant to spectacles or rigid contact procedure has been proven to be safe and effective in lens when the cornea remains clear [1-3]. decreasing myopia, corneal steepness, and decentration Corneal modeling by inserting intrastromal of the corneal apex. [5-8]. However, it is well known that implants has been purposed and investigated as an femtosecond laser technology may allow the surgeon to alternative of treatment option in corneal keratoconus [4]. program a corneal stromal dissection at a predetermined Journal of Medicine and Life Vol. 8, Special Issue 3, 2015

depth with an extremely high degree of accuracy [9], discomfort and central corneal thickness of more than which avoids the potential inaccuracies of a mechanical 350µm. The exclusion criteria were, pregnancy, active dissection. In a previous work of a research group [4], it ocular disease (cataract, glaucoma and diabetic was demonstrated that the intrastromal ring segment retinopathy), history of herpes keratitis, previous ocular implantation by using both mechanical and femtosecond surgery, diagnosed autoimmune disease, systemic laser-assisted procedures provided similar visual and connective tissue disease and any previous corneal refractive outcomes. However, a more limited aberometric surgery, concurrent corneal infections, patients with poor correction was present in eyes with mechanical compliance, then an informed consent was obtained from implantation [4]. all the subjects. A complete ocular examination including The present study evaluates the visual, slit lamp examination, fundoscopic examination, manifest refractive, corneal topography and, pachymetry outcomes refraction, uncorrected distance visual acuity (UDVA), after MyoRing implantation in eyes with corneal corrected distance visual acuity (CDVA), spherical and keratoconus by using the femtosecond laser technology cylindrical components of the manifest refraction, for the creation of the intrastromal pocket required for the spherical equivalent (SE), keratometry values and corneal complete ring insertion. thickness, were calculated by pentacam HRS system The purpose of this study was to prospectively (Oculus, Optikgerate GmbH, Germany) one month and 6 evaluate the visual outcome of MyoRing implantation by months after MyoRing implantation. The UCVA and BCVA using femtosecond laser technology in the eyes with were obtained in decimal scaling and transformed into log keratoconus in an Isfahan for the evaluation of results in MAR for the statistical analysis. another Iranian population. Surgical procedures Surgical procedures were performed under Patients and Methods topical anesthesia (Tetracaine3_2015_draft 0.5% ophthalmic drops, Darou Pakhsh Phama Co., Iran) by the same experienced In this prospective nonrandomized, clinical trial surgeon (M. Gh). study we evaluated eyes with keratoconus that were All MyoRings were implanted into intrastromal treated by the implantation of MyoRing (Dioptex GmbH, iss corneal pockets. Pocket reaction was performed with Linz, Austria) in a corneal pocket created by using femtolaser (Zeimer Ophthalmic System Group, Port, femtosecond technology. The study included 27 eyes of Switzerland). 15 patients with ages ranging from 14 to 49 years. An The pocket diameter was of 8mm with 300µ informed consent was obtained from all the patients. The depth. Pocket entrance was selected at supratemporal institutional ethical review board approval was obtained position and the size was 5 or 6 mm according to for the procedures and the tenets of the Helsinki MyoRing size. Ring was inserted into the pocket and was Declaration were followed. All the cases were diagnosed centered based on the pupil with mild decentration with corneal keratoconus according to the standard according to cone center. criteria. Keratoconus diagnosis was based on corneal The antibiotic eye drop (Ciplex, Ciprofloxacin topography and slit-lamp examination: asymmetric bowtie HCl 0.3% Sinadarou, Tehran, Iran) was instilled and pattern with or without skewed axis and the presence of 8_specialbandage contact lens was inserted. stromal thinning, conical protrusion of the cornea at the

apex vogt striae [10]. Postoperative management The severity of Keratoconus was graded All the patients were given topical Ciplex eye according to Amsler Krumeich classification [11]. drops (Ciprofloxacin HCL 0.30% Sina Daro, Tehran, Iran) - Stage 1: eccentric steeping; myopia or induced and Betasonate eye drops (Betamethadone 0.1%, Sina astigmatism of less than 5.00 D, or both; and mean Daro, Tehran, Iran) 4 times a day for seven days. central k readings of less than 48.00 D. The postoperative visit was scheduled for the - Stage 2: myopia or induced astigmatism from 5.00 D to first postoperative day, the first week, 1 month and 6 8.00 D, or both; and mean central k readings of less than months after surgery. The first and seventh day after the 53.00 D; absence of scarring; and minimum corneal procedure, the patients were examined for survey thickness of more than 400 um. epithelial healing, postoperative infection, MyoRing - stage 3: myopia or induced astigmatism from 8.00 D to position, and corneal integrity. In the remaining 10.00 D, or both; mean central k readings of more than postoperative visits, the same clinical examinations as 53.00 D; absence of scarring; and minimum corneal preoperatively were performed. thickness of 300 to 400 um. JML_Volume - Stage 4: no measurable refraction, mean central k Statistical analysis readings of more than 55.00 D; central corneal scarring; Data were analyzed by using SPSS software (v and minimum corneal thickness of 200 um. 18; SPSS, Inc., Chicago, IL). Statistical comparisons of The inclusion criteria were keratoconus, reduced preoperative and postoperative values were performed by best corrected visual acuity, contact lens intolerance or

67 Journal of Medicine and Life Vol. 8, Special Issue 3, 2015

using t-student test for UCVA, BCVA, mean refractive SE, improvement in all parameters from preoperatively to and mean K-values. Statistical data are presented as postoperatively (Table 1). mean ± SD. The changes in data were considered statistically significant when the P value was less than Visual acuity 0.05. Uncorrected visual acuities, best corrected distance preoperatively and 6 months postoperatively are shown in Table 1. The mean UDVA significantly improved Results from 1.73 ± 0.53 log MAR preoperatively to 0.54 ± 0.40 log MAR postoperatively. The mean CDVA significantly MyoRing segments were successfully implanted improved from 0.59 ± 0.47 log MAR preoperatively to in all eyes without any intraoperative complication. All the 0.27 ± 0.16 log MAR postoperatively. The change in the patients completed the 6-months postoperative follow-up. mean UDVA and CDVA during the follow-up period was A total of 27 eyes of 15 patients were included. The mean statistically significant (P< 0.000). age of the 6 women (40%) and 9 men (60%) was 28.35 ± Preoperatively, the UDCA, was 0.1 (20/ 200) or 8.29 years (ranging between 14 and 49 years). The mean worse in 23 (0.85%) eyes and postoperatively, it was 0.5 central corneal thickness was 422.42 ± 36.96 (20/ 40) or better in 9 (33%) eyes. preoperatively and postoperatively it was 445.08 ± 28.00

(p=0.020). There was a statistically significant

Table 1. The means and standard deviations for all data (preoperative and postoperative) Parameter Preoperative Postoperative Mean Difference* UDVA (log MAR) 1.73 ± 0.53 0.54 ± 0.40 -1.19 ± 0.59 CDVA (log MAR) 0.59 ± 0.47 0.27 ± 0.16 3_2015_draft-0.32 ± 0.49 Sphere (D) -7.86 ± 3.70 -0.94 ± 2.50 6.92 ± 3.67 Cylinder (D) -4.25 ± 2.39 -1.87 ± 1.24 2.55 ± 2.00 SE (D) -9.99 ± 3.83 -1.88 ± 2.83 8.11 ± 3.48 kMIN (D) 49.78 ± 3.57 44.78 ± 2.99 -5.08 ± 3.58 K MAX (D) 53.81 ± 4.15 47.60iss ± 3.58 -6.42 ± 4.24 Average k (D) 51.97 ± 3.43 45.24 ± 2.61 -6.41 ± 3.62 UDVA= uncorrected distance visual acuity; CDVA= corrected distance visual acuity; SE= spherical equivalent; K= keratometry

* Mean Difference from the preoperative period to 6-months postoperatively **P value for the difference between Preoperative and 6-months postoperative values

The mean efficacy index (ratio of postoperative Refraction UDVA and preoperative CDVA) was 1.36 ± 1.51 (range Preoperative and 6-months postoperative 0.2 to 8). refraction values are shown in Table 1. The mean Sphere As shown in Fig. 1, the safety graph, of the 27 equivalent (SE) refraction decreased significantly from - eyes, 2 eyes (8%) lost lines of CDVA and8_special 16 eyes (59%) 9.99 ± 3.83 D preoperatively to -1.88 ± 2.83 D at 6 gained 2 lines or more at the last follow-up (mean safety months. The mean reduction was 8.11 ± 3.48 D. All index was 2.01 ± 1.66). changes in the mean SE, sphere, and cylinder refraction were statistically significant [P< 0.00].

Corneal curvature (K min, K max) The mean decrease in the mean keratometry from the preoperative period to 6 months postoperatively was -6.41 ± 3.62 D. This change was statistically significant (P< 0.00). The mean minimum and maximum keratometry values were also statistically significant at less than 6 months preoperatively (Table 1). Patients were divided into 3 groups based on their preoperative keratometry (group 1, keratometry ≤48 D); group 2, keratometry 48-53 D; group 3, keratometry >53 D) and compared the outcomes between the 3 JML_Volume groups (Table 2,3). Table 2 shows the mean visual acuity and Table 3 the mean refractive outcomes over the time based on Fig. 1 Safety distance visual acuity graph (% of eyes with preoperative keratometry. In eyes with a preoperative gain/ less in snellen lines), at 6 months visit. keratometry of 48.0 D or less and of 48.0 to 53.0 D, the

68 Journal of Medicine and Life Vol. 8, Special Issue 3, 2015

improvement in UDVA and CDVA and reduction in SE In eyes with a preoperative keratometry of 53.0 and refractive cylinder were statistically significant (Table D or more, the improvement in UDVA and reduction in se 2,3). were statistically significant; however, the changes in CDVA were not significant.

Table 2. Mean visual acuity outcomes by preoperative mean keratometry Preop. Keratometry Mean UDVA ± SD Mean CDVA ± SD p. value p. value (n=27) Preop. Postop. Preop. Postop. ≤48 (5) 1.80 ± 0.45 0.38 ± 0.23 0.001 0.50 ± 0.08 0.49 ± 0.32 0.98 48-53 (10) 1.49 ± 0.67 0.39 ± 0.30 0.000 0.58 ± 0.57 0.26 ± 0.21 0.094 >53 (12) 1.89 ± 0.37 0.68 ± 0.47 0.000 0.64 ± 0.49 0.28 ± 0.13 0.051

Although we had good results in UDVA outcomes in 3 groups, the improvements in CDVA were more significant in group 1 [keratometry ≤48 D] compared to the 2 other groups.

Table 3. Mean refractive outcomes by preoperative mean keratometry Mean SE ± SD Mean cylinder ± SD Preop. keratometry p. value p. value Preop. Postop. Preop. Postop. ≤48 -10.5 ± 5.46 -3.57 ± 5.15 0.001 -6.10 ± 1.77 -2.25 ± 1.66 0.002 48-53 -8.22 ± 2.28 -1.21 ± 1.09 0.000 -3.50 ± 1.65 -1.63 ± 1.03 0.010 >53 -11.24 ± 3.87 -1.72 ± 2.58 0.000 -4.40 ± 2.60 -1.87 ± 1.32 0.003

In spite of the significant improvement in the visual acuity outcomes for all 3_2015_draftcases, there was not significant improvement between them for eyes with central corneal thickness of less than 400 µm (Table 4).

Table 4. Mean visual acuity outcomes by preoperative mean central corneal thickness Preop. central Mean UDVA ± SD Mean CDVA ± SD P. value iss P. value corneal thickness Preop. Postop. Preop. Postop. <400 1.35 ± 0.75 0.43 ± 0.25 0.094 0.29 ± 0.15 0.25 ± 0.13 0.47 ≥400 2.00 ± 0.00 0.47 ± 0.27 0.000 0.61 ± 0.50 0.24 ± 0.14 0.012

Complications accuracy, thus avoiding the potential inaccuracies of a There were no serious postoperative mechanical dissection that is dependent on the surgeon’s complications. Mild glare was reported in most cases, manual skills [14,15]. especially in the initial postoperative period. No MyoRing The current study evaluated the visual, was removed for side effects or complications. refractive, pachymetry and keratometry outcomes after MyoRing implantation in eyes with Keratoconus by using the femtosecond laser technology for the creation of Discussion 8_specialintrastromal pocket in an Iranian population. In this present study, at one month after surgery, Keratoconus is an ectatic corneal disorder with a statistically significant reduction in myopia and cylinder progressive steepening and corneal thinning, especially in was observed, with no significant changes during the the inferior part of the cornea. By inserting intrastromal remaining follow-up. At 6 months, the mean reduction in implants, corneal remodeling can improve the visual sphere was 6.92 ± 3.67 D and the mean reduction in acuity, changing the curvature of the ectatic cornea [4]. refractive cylinder was 2.55 ± 2.00 D. These levels of Incomplete rings available on the market are Intacs, refractive change were consistent with those previously Ferrara ring, and Keraring. The implanting of a complete reported after MyoRing implantation [8-9]. intrastromal ring, MyoRing (Dioptex GmbH, Austria), is an In Alio et al. study, a total of 12 eyes of 11 alternative technique, which has been safe and effective patients with ages ranging from 17 to 50 years were in the previous studies in the treatment of keratoconus [5- included. All cases presented with reduced CDVA, 7,11-13]. contact lens intolerance or discomfort, and central corneal The main advantages of a complete ring are thickness of more than 350 μm. MyoRing inserted of 280 easy implantation, good centration, and the postoperative μm in thickness and 5 mm in diameter were implanted in all cases into an intrastromal corneal pocket created by possibility of changing the ring position, if necessary [6]. JML_Volume means of femtosecond technology. A significant A mechanical device was specifically developed improvement in UDVA was observed which was for the creation of this intrastromal pocket [9]. consistent with the significant reduction in sphere and Femtosecond laser technology may allow a cylinder. There was a mean change in sphere of 4.62 D surgeon to perform a corneal stromal dissection at a and a mean change in cylinder of 4.47 D [11]. predetermined depth with an extremely high degree of

69 Journal of Medicine and Life Vol. 8, Special Issue 3, 2015

As expected, the significant reduction of there was no significant improvement between them for refractive errors achieved with MyoRing implants in our eyes with central corneal thickness of less than 400 µm. study was associated with a significant increase of UCVA. Our finding was near to Jabbarvand et al. study that a The mean UDVA significantly improved from 1.73 ± 0.53 significant increase in central corneal thickness [439.4 ± log MAR preoperatively to 0.54 ± 0.40 log MAR 19 to 452.2 ± 20 μm] was observed during the 1-month postoperatively. The mean CDVA significantly improved postoperative period [17]. from 0.59 ± 0.47 log MAR preoperatively to 0.27 ± 0.16 The other interesting study was performed by log MAR postoperatively. The change in the mean UDVA Jabbarvand et al. MyoRing was implanted in 15 eyes of and CDVA during the follow-up period was statistically 14 patients with ectasia after LASIK by using a significant (P< 0.000). The mean efficacy index (ratio of femtosecond laser. UDVA (1.02 ± 0.48 to 0.30 ± 0.18 log postoperative UDVA and preoperative CDVA) was 1.36 ± MAR), maximum keratometry (50.14 ± 1.82 to 43.80 ± 1.51 (ranging from 0.2 to 8). Daxer A et al. showed the 1.21 diopters), and sphere (-4.4 ± 4.8 to +1.50 ± 0.61 mean UDVA improved by almost 10 lines, from 0.07 log diopters) were significantly improved from the MAR to 0.56 log MAR, and the mean CDVA improved by preoperative values at 1 month after surgery. A significant almost 3 lines, from 0.42 log MAR to 0.77 log MAR [6]. improvement in CDVA (0.30 ± 0.1 to 0.17 ± 0.13 log UCVA improvement in Mahmood et al., Daxer et MAR) was observed [17]. al. and Alio et al. studies were 7, 10 and 7 lines, An intrastromal corneal ring was implanted in respectively. With regard to CDVA, we observed an stromal depths of 300-μm by using femtosecond laser improvement by 2 lines of log MAR in 16 eyes (59%), technology for all patients. Jabbarvand et al. evaluated which was consistent with the previous study results [5,6- the clinical outcomes of intrastromal MyoRing 11]. implantation at 2 different depths of 250 and 300 μm by It seems that the MyoRing implants have a using femtosecond laser. No differences were observed in greater potential of myopic and astigmatic correction in keratometry, visual and refractive outcomes; in the 2 Keratoconus than ICRS probably because of the more study groups. According3_2015_draft to Jabbarvand et al. study, the significant arc-shortening effect achieved with a conclusion was that an implantation depth of 250 μm has completely circular mid-peripheral implant [13]. comparable outcomes with the previously applied 300-μm A significant central flattening was observed after implantation depth and it may be appropriate for the surgery, which was consistent with the induced refractive selected casesiss of keratoconus with lower pachymetry change. The mean decrease in the mean keratometry [18]. from the preoperative period to 6 months postoperatively In our study, no MyoRing was removed for side was 6.41 ± 3.62 D. In Hosny et al. study, the mean effects or complications but in Alio et al. study, the change in Km was 6.13 D (standard deviation, 4.37 D). MyoRing explanation was performed in a very advanced This flattening effect was comparable to that reported by keratoconus because of the extremely poor visual (mean change in maximum keratometry of 9.60 D) after outcome [11] and in Jabbarvand et al. study, MyoRing Ferrara ring segment implantation in severe keratoconus explanation was performed in (4%) 4 eyes, after a [16]. It was also comparable to those reported by mechanical implantation of a MyoRing (Dioptex GmbH) Mahmood et al., Daxer et al., and Alio et al. who also [12]. used the MyoRing in keratoconus [5-11]. The keratoconic patients were divided into 3 groups based on their preoperative8_special keratometry Conclusion (keratometry ≤48 D, 48-53 D, >53 D) and compared the outcomes between the 3 groups. In eyes with a In conclusion, we found that the implantation of preoperative keratometry of 48.0 D or less and of 48.0 to MyoRings by using femtosecond technology in cases of 53.0 D, the improvement in UDVA and CDVA and keratoconus significantly reduced the spherocylindrical reduction in SE and refractive cylinder were statistically error. We demonstrated a reduction in the mean corneal significant. Good results were obtained in UDVA keratometry and spherical power was more significant outcomes in all groups, but the improvement in CDVA than cylindrical power reduction. As seen from the clinical was more significant in group 1 (keratometry ≤48 D) data, this technique has the potential to correct significant compared to 2 other groups. Therefore, it might be myopic and astigmatic refractive errors. It appears that concluded that the MyoRing is a good option for this MyoRing implantation is a safe and effective procedure subgroup of Keratoconus patients. Furthermore, Alio et al. for the management of keratoconic cases. found a significant corneal flattening of a mean value of 8.03 diopters (D) [11] and a significant corneal flattening Further studies with larger groups of patients, of a mean value of 9.78 D was found in Jabbarvand et al. longer follow-up are needed to report more reliable JML_Volumestudy [12]. The mean K reading decreased by 5.76 D, outcomes with this implant. from 48.96 D to 43.20 D in Daxer A study [6]. In our study, the mean central corneal thickness Acknowledgements was 422.42 ± 36.96 preoperatively and postoperatively it The authors wish to thank all the colleagues who was 445.08 ± 28.00 (p= 0.020). Significant improvements supported the research, especially Shahla Rezaei for the were shown in the visual acuity outcomes of all cases, assistance with the editing of the article.

70 Journal of Medicine and Life Vol. 8, Special Issue 3, 2015

References

1. Rabinowitz YS. Keratoconus. Surv moderate and high myopia. J Cataract 14. Pokroy R, Levinger S. Intacs adjustment Ophthalmol. 1998; 42:297-319. Refract Surg. 2008; 34:194-8. surgery for keratoconus. J Cataract 2. Krashmer JH, Feder RS, Belin MW. 9. Sugar A. Ultrafast (femtosecond) laser Refract Surg. 2006; 36(6):986–992. Keratoconus and related non- refractive surgery. Curr Opin Ophthalmol. 15. Buratto L, Belloni S, Valeri R. Excimer inflammatory corneal thinning disorders. 2002; 13:246-9. laser lamellar keratoplasty of augmented Surv Ophthalmol. 1984; 28:293-322. 10. Ralbinowitz YS. Keratoconus. Surv thickness for keratoconus. J Refract Surg. 3. Timodokoro A, Oshika T, Amano S et Ophthalmol. 1998; 42:297-319. 1998; 14:517–525. al. changes in anterior and posterior 11. Alio JL, Piero DP, Daxer A. Clinical 16. Hosny M, El-Mayah E, Sidky MK, Anis corneal curvatures in keratoconus. outcomes after complete ring implantation M. Femtosecond laser-assisted Ophthalmology. 2000; 107:1328-1337. in corneal ectasia using the femtosecond implantation of complete versus 4. Pinero DP, Alio JL. lntracorncal ring technology: a pilot study. Ophthalmology. incomplete rings for keratoconus segments in ecstatic corneal disease--a 2011; 118,7:1282–1290. treatment. Clin Ophthalmol. 2015 Jan 20; review. Clin Experiment Ophthalmol. 12. Jabbarvand M, Salamatrad A, 9:121-7. doi: 10.2147/OPTH.S73855. 2010; 38:154-67. Hashemian H, Khodaparast M. 17. Jabbarvand M, Hashemian M, 5. Mahmood H, Venkateswaran RS, Daxer Continuous corneal intrastromal ring Hashemian H, Bazvand F, Khodaparast A. Implantation of a complete corneal ring implantation for treatment of keratoconus M. Femtosecond laser-assisted MyoRing in an intrastromal pocket for keratoconus. in an Iranian population. American implantation in postoperative LASIK J Refract Surg. 2011; 27:63-8. Journal of Ophthalmology. 2013; 155, ectasia. J Refract Surg. 2014 Jul; 6. Daxer A, Mahmoud H, Venkateswaran 5:837–842. 30(7):462-6. doi: 10.3928/1081597X- RS. Intracorneal continuous ring 13. Jabbarvand M, Salamatrad A, 20140521-02. implantation for keratoconus: one-year Hashemian H, Mazloumi M, 18. Jabbarvand M, Hashemi H, follow-up. J Cataract Refract Surg. 2010; Khodaparast M, Aldave A. Continuous Mohammadpour M, Khojasteh H, 36:1296-302. intracorneal ring implantation for Khodaparast M, Hashemian H. 7. Daxer A. Adjustable intracorneal ring in a keratoconus using a femtosecond laser. Implantation3_2015_draft of a complete intrastromal lamellar pocket for keratoconus. J Refract Journal of Cataract and Refractive corneal ring at 2 different stromal depths Surg. 2010; 261:217-21. Surgery. 2013; 39,7:1081–1087. in keratoconus. Cornea. 2014 Feb; 8. Daxer A. Corneal intrasttromal 33(2):141-4. doi: implantation surgery for the treatment of 10.1097/ICO.0000000000000026. iss

8_special

JML_Volume

71 Journal of Medicine and Life Vol. 8, Special Issue 3, 2015, pp.72-76

A study of the effect of dexamethasone on lipid profile and enzyme lactate dehydrogenase

Arab Dolatabadi A*, Mahboubi M** *Department of Biology, Payame Noor University, I.R. of Iran. **Abadan School of Medical Sciences, Abadan, Iran

Correspondence to: M Mahboubi, Ph.D. Abadan School of Medical Sciences, Abadan, Iran, Abadan, Iran, Phone: +989126809526, E-mail: [email protected].

Received: March 14th, 2015 – Accepted: June 18th, 2015

Abstract Dexamethasone is a highly used glucocorticoid unfortunately prescribed too much. This drug is attached to its receptors in cytoplasm by going through the cell membrane, and enters the cell nucleus by drug-receptor complex, being ultimately responsible for systematic effects of corticosteroids. This study was conducted to explore the effect of dexamethasone on serum level of some biochemical parameters in adult male rats. 40 adult male rats were put into 4 experimental and control groups. The control group only received saline and the experimental group received dexamethasone of 0.4, 0.7, and 1 mg/ kg doses daily in the form of intraperitoneal injection of 1 mL/ day. After serum separation, the serum value of cholesterol, triglycerides (TG), low-density lipoprotein (LDL), 3_2015_drafthigh-density lipoprotein (HDL) and lactate dehydrogenase were measured and the results were analyzed by using SPSS and Dunnett software. The test of lipid profile and lactate dehydrogenase was done by using the biochemistry kit and the groups were compared. In this study, significant changes in the concentration of the above hormones were not observed up to 0.7 mg/ kg dose. However, significant changes were seen in higher doses i.e. 1mg/ kg in the experimental groupiss compared with the control group (P<0.05). The final result was that the injection of dexamethasone resulted in the increase of cholesterol and bad lipid and it could cause tissue damage by increasing lactate dehydrogenase.

Keywords: dexamethasone, lipid profile, lactate dehydrogenase, rat

Introduction parts of the body such as back of the neck, increase of hypertension, blood sugar and excessive hairs in different Corticosteroids refer to steroids that are parts of the body such as face, especially in females, produced in the cortical section of the adrenal gland. Due being among the other adverse effects of inappropriate to the important role of glucocorticoids 8_specialin mitigating the and excessive use of this ampule [2]. It should be noted immune responses, a high number of drugs have been that systemic corticosteroids (dexamethasone) as an made based on this structural skeleton with similar initial treatment for resolving simple and chronic allergies chemical formulas that are called steroid or corticosteroid. and the symptoms, could be controlled by drugs having Corticosteroid drugs include betamethasone, less adverse effects, such as antihistamines. dexamethasone, hydrocortisone, triamcinolone, Dexamethasone can result in adverse effects and one methylprednisolone, prednisone, clobetasol, should visit the doctor if the signs of adverse effects do beclomethasone, fludrocortisone, fluocinolone, not disappear or continue for a long time. Its side effects fluticasone, etc. [1]. Dexamethasone ampoule is the most include irritability and stomach pains, vomiting, headache, prescribed drug among injectable drugs in Iran. insomnia, depression, anxiety, acne and pimple, increase Dexamethasone belongs to the group of synthetic of hair growth, irregular menstrual periods, weakening of corticosteroids that has significant anti-inflammatory and the immune system, delay in wound healing, creation of anti-allergic effects and results in the pain of inflammatory complications such as hallucination and mental disorders processes, especially in joints. Also, dexamethasone and emergence of maniac attacks, the effect on the results in the suppression of the immune system and balance of body fluids and electrolytes that results in the JML_Volumethese effects can often influence different systems of the retention of salt and water in the body, effect on the body. Delaying the healing of wounds, affliction with distribution of lipids in the body and consequently the diabetes, the effect on the balance of body fluids and accumulation of lipids in specific parts of the body such as electrolytes that results in retention of salt and water in back of the neck, increase of hypertension, blood sugar the body, the effect on the distribution of lipids in the body (hyperglycemia), diabetes and increase of blood lipids and consequently the accumulation of lipids in specific which are all known as strong factors in the occurrence of Journal of Medicine and Life Vol. 8, Special Issue 3, 2015

cardiovascular diseases and strokes [3]. The decrease of cholesterol is transferred to liver by high-density bone density, osteoporosis, and higher dose of it results lipoprotein and is eliminated from the body there in the in tendon rupture or injury [4]. The increase of the form of free cholesterol or after turning into bile acids. pressure inside the eyeball and the occurrence of Hyperlipidemia is abnormal high level of blood lipid. Types glaucoma especially in old people and also the of hyperlipidemia (types iv, iii, ii, I, and v) are defined occurrence of cataracts, reduction and weakening of based on the level of lipid in the blood and their higher mucosal layers of the gastrointestinal tract especially levels than the normal level [8]. Therefore, considering the stomach, which results in the emergence and aggravation increase in the use of glucocorticoids, paying more of peptic ulcers. Glucocorticoids rapidly spread in the attention to the adverse effects of these drugs is important circulatory system and cause the regulation of and thus the effect of dexamethasone on lactate transcription of some genes when passing the cell dehydrogenase and lipid profile was explored in this membrane by attaching to cytoplasmic receptors. study. Glucocorticoids make the genes that have a major role in inflammation such as cytokines and inflammatory enzymes such as nitric oxide synthase, inactive [5]. NO Methods has a dual conflicting biological activity which means that Devices has both cellular toxicity effects and protective effects [6]. Centrifuge device (eppendorf), AutoAnalyzer NO has inherently cellular toxicity effects and participates device. The biochemical tests were done by biochemical in the formation of a strong oxidant such as pentoxi nitrite AutoAnalyzer BT plus 3000 made by the Italian company, during a series of reactions with superoxide anion [7]. Biotecnica that can do biochemical, immunology, Dexamethasone is a highly used glucocorticoid serology, and drug level tests. Ketamine was used for unfortunately prescribed too much. This drug is attached anesthetizing rats. The laboratory kits triglycerides, to its receptors in cytoplasm by passing through cell 3_2015_draft cholesterol, LDL, HDL, and lactate dehydrogenase have membrane and enters the cell nucleus by the drug- been bought from Pars Azmoon Company that has a receptor complex. By attaching to specific areas of DNA, reference laboratory verification. this complex results in the stimulation of mRNA iss transcription and then the creation of enzymes that are ultimately responsible for systematic effects of Materials corticosteroids. Dexamethasone applies its anti- inflammatory effects by preventing the accumulation of Adult male Wistar rats were used for the tests. inflammatory cells in the inflammation area, phagocytosis 40 rats aged 8 weeks and weighting 250-350 g in for 10- inhibition and release of enzymes that are responsible for membered groups (1 control group and 4 experimental inflammation and inhibition of production and release of groups) were bought from Pasteur Institute of Iran. The chemical mediators of inflammation [7]. The high level of rats were kept in polypropylene cages whose floor was triglycerides also increases the risk of metabolic covered with sawdust and the cage had an appropriate syndrome. Cholesterol is a material made of lipid that water container in the controlled condition at the belongs to a group of lipids called steroids. Carrier temperature of 22 ± 1⁰C and humidity of 60 ± 10% and molecules made of protein called apoproteins8_special are turned light of 12 hours per day and 12 hours per night with into lipoprotein when they are combined with cholesterol access to water and complete food (concentrate). All the and triglycerides. The increase of its level increases the rats were placed into an animal nest in the same risk of cardiovascular diseases. LDL deposits cholesterol environmental conditions for two weeks before the tests, on artery walls, which in turn, results in the formation of a so that they were accustomed to the environment in terms thick and hard material called plaque. Over time, this of adaptation, familiarity, and diet. All the animal tests plaque becomes thicker and results in the narrowing of were done according to the moral committee. The rats in blood vessels or the plaque, being ruptured and each group were specified by some marks and they were separated from the artery wall, which results in blood fed intraperitoneally for 10 days. clotting and blockage of the artery in the place of rupture or the clot may be carried to other parts of the body; this Measuring temperature and humidity of the process being called atherosclerosis. Cholesterol exists in environment tissues and plasma in the form of free cholesterol or in the Temperature and humidity were controlled in form of storage of it, which means attached to fatty acids order to provide a favorable temperature and humidity in or in a long chain in the form of cholesterol ester. the environment and to maintain the temperature at 22 ± JML_VolumeCholesterol is an amphipathic lipid and is an essential 1⁰C and humidity at 60%. structural component of membranes and external layers of plasma lipoproteins. Cholesterol and ester cholesterol Taking blood from the rats and preparing serum are carried to body tissues by low-density lipoprotein After 10 days of injection, blood was taken to (LDL). During a process called reverse transfer, perform biochemical tests. Serum was separated by using

73 Journal of Medicine and Life Vol. 8, Special Issue 3, 2015

a centrifuge device with 3000 RPM rotation for 10 minutes. In addition, it was given to AutoAnalyzer device to measure the concentration of LDH, TG, HDL, LDL and cholesterol and the concentrations of the enzymes were calculated based on the international unit per liter. This device can be used for biochemical and enzyme tests. This device has high effectiveness and can do 200 tests per hour.

Statistical analysis The data obtained from AutoAnalyzer device was saved by using SPSS software and then it was transferred to EXCELL and necessary edits were Fig. 2 Comparison of the mean of the serum’s cholesterol in performed. Then, its parameters (tissue damage and the the experimental groups activity of enzyme LDH) were extracted in the two methods of injection and contact and the data resulted As it can be seen in Fig. 3, the serum’s HDL from the ANOVA table was extracted from the SPSS level was reduced in all the experimental groups programs and were recorded and used in SPSS. The compared with the control group, but this reduction was results were expressed in the form of mean and standard significant in the group receiving 1 mg/ kg. deviation. Considering the normalness of data distribution, ANOVA tests with repeated measurements were used for the comparison of the results of enzyme in each group before and after the experiment. Moreover, ANOVA and 3_2015_draft Dunnett tests were used to compare the groups with each other in each period. In addition, the frequency table was delineated for tissues. The significance level was iss considered lower than 0.05.

Results

As it can be seen in Fig. 1, the lactate dehydrogenase level was increased in all the

experimental groups compared with the control group, but Fig. 3 Comparison of the mean of the serum’s HDL in the this increase was significant in the group receiving 1 mg/ experimental groups kg.

8_specialAs it can be seen in Fig. 4, the serum’s triglyceride level was increased in all the experimental groups compared with the control group, but this increase was significant in the group receiving 1 mg/ kg.

Fig. 1 Comparison of the mean of serum’s lactate dehydrogenase in the experimental groups

JML_Volume As it can be seen in Fig. 2, serum’s cholesterol level was increased in all the experimental groups Fig. 4 Comparison of the mean of the serum’s triglyceride in compared with the control group, but this increase was the experimental groups significant in the group receiving 1mg/ kg.

74 Journal of Medicine and Life Vol. 8, Special Issue 3, 2015

As it can be seen in Fig. 5, the serum’s LDL level mechanism responsible for the increase of glucocorticoid was increased in all the experimental groups compared is due to the increase of HDL and HDL-cholesterol but with the control group, but this increase was significant in most probably it will result in the decrease of cholesterol the group receiving 1 mg/ kg. ester transferase protein and increase of the secretion of Apo- A-1 (the main protein of HDL particles) from liver [12]. In a study that was conducted by VrdoljokA (2015), the effect of dexamethasone on lipids and lipoproteins of plasma was explored and the results indicated that triglyceride, cholesterol and HDL-cholesterol are increased and the LDL cholesterol concentration is decreased [13]. In addition, in the present study too, exactly the levels of triglyceride, cholesterol and LDL were increased and the level of the serum’s HDLL was reduced, and, with the increase of dose, these changes were increased and they were statistically significant (P<0.05). LDL has been mentioned as a carrier of drug for specific places in different studies because LDL is incorporated in cells through the LDL receptor system Fig. 5 Comparison of the mean of the serum’s LDL in the experimental groups [14]. In most studies, LDL acts as the carrier of anti- cancer drug to cancer cells because many cancer cells Discussion have more LDL receptors compared with natural cells. Asai et al. pointed out that in a laboratory model, In this study, the effect of dexamethasone in dexamethasone prevents3_2015_draft the incorporation of modified different doses resulted in the reduction of HDL and the LDL in macrophages in vitro [15]. In a study by increase of CT, LDL, TG, and LDH and the changes were Mahendran (2005) on the effect of dexamethasone on significant in high doses, which indicated a glucocorticoid lipoproteins, issthe results indicated that administration of impact lipid profile and secretion of enzymes from body dexamethasone results in the increase of the levels of tissues. A study conducted in 2012, highlighted that the triglycerides, cholesterol, and fatty acids in plasma and effect of the metabolic administration of glucocorticoid liver tissue. The level of phospholipids was increased in (dexamethasone) on plasma HDL and LDL and found out plasma but it was significantly reduced in liver tissue after that dexamethasone results in low but significant increase the administration of dexamethasone in the experimental of the body weight and increase of high-density group compared with the control group. The activities of lipoprotein and cholesterol but it did not have a significant lecithin cholesterol transferase and liver lipoprotein lipase impact on triglyceride and VLDL-apoB [9]; which was were reduced after the administration of dexamethasone. consistent with the results of the present study. Also in the The levels of HDL- triglyceride and HDL-cholesterol did present study, plasma LDL level was increased and the not change, while the levels of LDL and VLDL were HDL level was decreased with the 8_specialincrease of the significantly increased. The levels of lipids were injective dose of dexamethasone. Glucocorticoids act as maintained at the normal level [16]. In the present study anti-inflammatory and immunosuppressant in patients too, dexamethasone resulted in significant changes in with rheumatism and pulmonary diseases, which indicates lipid profile. In a study that was conducted by Kumar that glucocorticoids result in the increase of HDL- (2001), the results indicated that dexamethasone results cholesterol concentration [10]. As it was shown in Fig. 2 in the increase of cholesterol and triglyceride levels [17], and 3, if dexamethasone is injected frequently, it can which is consistent with the results of the present study. result in the increase of total cholesterol and HDL of As it was shown in Fig. 2 and 4, in this study, the serum plasma, and cholesterol is similar to other lipids and oils levels of cholesterol and triglyceride were increased. The and is not soluble in water (blood), being transmitted in increase of cholesterol can result in fatty liver and the blood with the help of a specific type of protein called consequently the levels of beta hydroxysteroid butyrate, lipoproteins and combination with them. After the non-esterified fatty acids, the ratio of non-esterified fatty absorption from intestines, cholesterol and triglycerides acids to cholesterol, total bilirubin, aspartate are packaged in a protein cover called chylomicron. In aminotransferase, lactate dehydrogenase and bile acids fact, the collection of triglycerides and cholesterol that are will be higher than the normal levels [18]. Also in this JML_Volumesurrounded by Lipoprotein cover are called chylomicron, study, as dexamethasone increased the level of and 90 percent of it consists of triglycerides and only 10 cholesterol in serum in rats, a higher level of lactate percent of it consists of cholesterol. Carrier molecules dehydrogenase was produced in serum. One of the formed of proteins, called Apo proteins, are turned into tissues produced by lactate dehydrogenase is liver tissue lipoproteins when they are combined with cholesterol and and hyperlipidemia can cause serious damages to the triglycerides which include LDL, HDL and VLDL [11]. The liver tissue and the result in the secretion of liver enzymes

75 Journal of Medicine and Life Vol. 8, Special Issue 3, 2015

[19]. In this study too, more lactate dehydrogenase tissues to liver and is eliminated from the body there in entered the blood with the increase of cholesterol in 1 mg/ the form of free cholesterol or after turning into bile acids kg dose. and with the increase of cholesterol synthesis, a serious damage occurring to the liver tissue and the results in the secretion of liver enzyme. Conclusion Authors Contribution The results of the present study indicated that This work was carried out in collaboration the injection of dexamethasone results in the increase of between all authors and assistants. cholesterol, LDL, triglyceride and reduction of HDL of

blood serum. And, as LDL of plasma is the means by Conflict of Interest which cholesterol and ester cholesterol are carried to Authors declared that there is no conflict of different tissues, during a process called reverse transfer, interest. LDL free cholesterol of plasma is transferred to liver from

References

1. Miller RD, Eriksson LI et al. Anesthesia: 2- Atherogenic Properties and Exposure of In vitro and in vivo studies of a drug- Volume Set, 2009, Elsevier Health Sciences. Acrylamide Induces Acute Hyperlipidemia lipoprotein complex. British Journal of 2. Xue Q, Patterson AJ et al. Glucocorticoid and Fatty Liver Changes in Zebrafish. Cancer. 1990; 62(5):724. Modulates Angiotensin II Receptor Cardiovascular Toxicology. 2014; 1-9. 15. Asai K, Funaki C et al. Dexamethasone- Expression Patterns and Protects the Heart 9. Wang X, Magkos F et al. Low-dose induced3_2015_draft suppression of aortic from Ischemia and Reperfusion Injury. PloS dexamethasone administration for 3 weeks atherosclerosis in cholesterol-fed rabbits. one. 2014; 9(9):e106827. favorably affects plasma HDL concentration Possible mechanisms. Arteriosclerosis, 3. Anagnostis P, Athyros VG et al. The and composition but does not affect very Thrombosis, and Vascular Biology. 1993; pathogenetic role of cortisol in the metabolic low-density lipoprotein kinetics. European 13(6):892-899. syndrome: a hypothesis. The Journal of Journal of Endocrinology. 2012; 167(2):217-iss16. Mahendran P, Devi CS. Effect of Garcinia Clinical Endocrinology & Metabolism. 2009; 223. cambogia extract on lipids and lipoprotein 94(8):2692-2701. 10. Choi HK, Seeger JD. Glucocorticoid use composition in dexamethasone administered 4. Macfarlane DP, Forbes S et al. and serum lipid levels in US adults: the Third rats. Indian Journal of Physiology and Glucocorticoids and fatty acid metabolism in National Health and Nutrition Examination Pharmacology. 2001; 45(3):345-350. humans: fuelling fat redistribution in the Survey. Arthritis Care & Research. 2005; 17. Kumar VS, Inamdar MN et al. Protective metabolic syndrome. Journal of 53(4):528-535. effect of lemongrass oil against Endocrinology. 2008; 197(2):189-204. 11. Griffin BA. Nonpharmacological dexamethasone induced hyperlipidemia in 5. Barnes P. Corticosteroid effects on cell approaches for reducing serum low-density rats: possible role of decreased lecithin signalling. European Respiratory Journal. lipoprotein cholesterol. Current opinion in cholesterol acetyl transferase activity. Asian 2006; 27(2):413-426. cardiology. 2014; 29(4):360-365. Pacific Journal of Tropical Medicine. 2011; 6. Kelly C, Creagh T et al. Regional 12. Staels B, van Tol A et al. Variable effects 4(8):658-660. hypothermia protects against tourniquet of different corticosteroids on plasma lipids, 18.Yasuda JSB, Too K, Ohfuji S. Lactate neuropathy. European Journal of Vascular 8_specialapolipoproteins, and hepatic apolipoprotein dehydrogenase isoenzyme patterns in Surgery. 1992; 6(3):288-292. mRNA levels in rats. Arterioscler Thromb. bovine liver tissue. Nihon Juigaku Zasshi. 7. Beckman JS, Beckman TW et al. Apparent 1991; 11(3):760-769. 1989; 51(4):733-739. hydroxyl radical production by peroxynitrite: 13. Vrdoljak L, Bradamante AV et al. 19. Dudka J, Burdan F et al. Effect of selected implications for endothelial injury from nitric Butyrylcholinesterase activity and plasma alcohol dehydrogenase inhibitors on human oxide and superoxide. Proceedings of the lipids in dexamethasone treated rats. Acta hepatic lactate dehydrogenase activity—an National Academy of Sciences. 1990; Pharmaceutica. 2005; 55(2):177-185. in vitro study. Journal of Applied Toxicology. 87(4):1620-1624. 14. Vitols S, Söderberg-Reid K et al. Low 2005; 25(6):549-553. 8. Kim SM, Baek JM et al. Modified density lipoprotein for delivery of a water- Lipoproteins by Acrylamide Showed More insoluble alkylating agent to malignant cells.

JML_Volume

76 Journal of Medicine and Life Vol. 8, Special Issue 3, 2015, pp.77-82

Diagnostic accuracy of Cone Beam Computed Tomography, conventional and digital radiographs in detecting interproximal caries

Safi Y*, Shamloo Mahmoudi N*, Aghdasi MM*, Eslami Manouchehri M*, Rahimian R**, Valizadeh S*, Vasegh Z*, Azizi Z** *Department of Oral and Maxillofacial Radiology, School of Dentistry, Shahid Beheshti University of Medical Sciences, Tehran, Iran, **Department of Oral and Maxillofacial Radiology, School of Dentistry, International branch of Shahid Beheshti University of Medical Sciences, Tehran, Iran

Correspondence to: Sepideh Rahimian, Assistant Professor, Department of Oral and Maxillofacial Radiology, School of Dentistry, International branch of Shahid Beheshti University of Medical Sciences, Tehran, Iran. Phone: 00989352134924, E-mail: [email protected]

Received: March 14th, 2015 – Accepted: June 18th, 2015

Abstract Statement of the problem: Presently, different imaging modalities are available for the detection of proximal caries. Several studies in recent years have sought to determine the diagnostic accuracy of available modalities, but they have shown variable results. Purpose: This study was performed to determine and compare the accuracy of cone beam3_2015_draft computed tomography (CBCT), conventional radiographs and the indirect digital system in the detection of interproximal caries. Materials and Method: In this experimental trial study, forty-two extracted non-cavitated, unrestored human molar and premolar teeth were mounted in the blocks with proximal surfaces in contact. Then they were evaluated by CBCT, conventional radiographs and the indirect digital system for the detection of interproximal caries. Four oral andiss maxillofacial radiologists used a 4-point scale to evaluate the images for the presence or absence of proximal caries. Caries depth was specified by histological examination. The collected data were assessed by SPSS software by means of Weighted Kappa and Friedman test. Results: Statistics illustrated that the accuracy of the indirect digital system was slightly better than conventional systems. The accuracy of the indirect digital system was better than cone beam system and this difference was statistically significant. Conclusion: The digital system was superior to CBCT in the detection of proximal caries. The conventional radiography fell in between the two other systems without statistically significant difference in detecting caries. Thus, CBCT is not suggested in order to detect proximal caries because of the higher radiation dose.

Keywords: Cone Beam CT, dental caries, diagnosis, digital, radiography

8_special Introduction in several dental fields such as implant treatment, craniofacial anomalies, endodontics, orthodontics, Detection of caries in the proximal surfaces of periodontology, as well as other dental disciplines [9]. teeth has always been challenging [1]. Dental clinicians It has been demonstrated that without use visual examination and intraoral radiography to radiographic assessment, 25-42% of proximal caries may diagnose caries [2]. Conventional intraoral film not be detected by clinical examination [10,11]. radiography is a confirmed method for the detection of Conventional intraoral radiographs and photo stimulable proximal caries that cannot be easily identified by visual phosphor (PSP) plates are the most commonly used inspection [3]. An alternative method is digital intraoral image receptors [12,13]. Cone beam computed radiography [4,5]. Digital and conventional radiography tomography (CBCT) is a newly developed technique that has similar accuracy for the detection of caries. But, they provides three-dimensional data at a lower radiation dose both lack in diagnostic accuracy for the identification of than the conventional CT [14]. The application of CBCT in incipient proximal caries [6,7]. Intraoral radiographs are a dental practice has some benefits compared to JML_Volume2-dimensional (2D) imaging method that records 3- conventional imaging modalities, such as higher image dimensional (3D) structures. A number of studies have accuracy (in endodontic [15] and periodontic [16,17] assessed the use of 3D imaging modalities to avoid the application), fewer artifacts and higher cost-effectiveness

overlap of 3D anatomic structures [8]. The cone beam [18]. computed tomography (CBCT) technique can be applied Journal of Medicine and Life Vol. 8, Special Issue 3, 2015

The aim of this study was to consider the differences in the diagnostic accuracy of different modalities and contradictions in previous surveys, the present study surveyed the in-vitro diagnostic ability of radiographs, PSP sensors and CBCT in the detection of proximal caries in posterior teeth.

Materials and Method

The experimental trial study was performed on 42 non-cavitated extracted human premolar and molar teeth. The clinical appearances of the tooth surfaces ranged from sound to discoloured. Surfaces with fillings were excluded. The teeth were stored in normal saline Fig. 2 Conventional Radiograph solution. The study plan was approved by the Ethical Committee of Shahid Beheshti University Dental School. The image of the teeth was also recorded by Four teeth were mounted in a row with the proximal using CBCT system (Fig. 3) Newtom VGI [Quantitative surfaces in contact. Each row consisted of three test teeth Radiology, Verna, Italy] in selected FOV 6×6cm, high and one non-test tooth in silicone blocks. The proximal resolution at a fixed 110 kvp setting and auto-adjusted caries were detected by using radiographs, PSP and milliamperes. The blocks were scanned for 36 s. CBCT images. The samples were radiographed by two intraoral 3_2015_draft modalities: 1) Digora-fmx with blue plates [Sordex, Helsinki, Finland] and 2) Kodak (Espeed) Insight film (size2) [Eastman Kodak Company, Rochester, NY, USA]. iss The digital images (Fig. 1) were taken at 70 kvp, 8 mA but the exposure time was reduced to 0.08 s. The focus-tooth and tooth-receptor distances were 32 and 2 cm, respectively. The software used for processing PSPs was

Digora for windows 2.8. The conventional images (Fig. 2) were exposed with an X-ray unit operated at 70 kvp, 8 mA Fig. 3 CBCT Image and exposure time of 0.16 s. The focus-tooth distance was 32 cm and the tooth - receptor distance was 2 cm. Radiographs were processed after exposure, by using an In the use of intraoral modalities, a 12 mm acrylic automatic processing machine [Gendex, Clarimat, plate was applied as fake soft tissue [9] between the tube Milwaukee, WI, USA] and chemicals8_special (X-ray Iran and the mounted tooth. During the CBCT exposures, a Company, Tehran, Iran) based on the manufacturer’s water phantom [3] was placed around the blocks to simulate soft tissue. instruction. The images were evaluated separately by four expert oral radiologists. All the images were analyzed twice. The use of enhancement facilities to adjust contrast, brightness, and magnification was allowed. Parasagittal slices were reconstructed with 0.1 mm steps and 0.1 mm slice thickness in CBCT images for caries detection. Additionally, the observers could assess CBCT images in the axial, coronal or sagittal sections, in which the lesion was best discerned. The observers recorded caries by using a 4-point confidence rating scale: 0: Definitely no caries 1: Enamel caries (radiolucency in enamel) 2: Dentine caries (radiolucency in dentine) JML_Volume 3: Deep dentine caries (radiolucency extending to pulp) The teeth were sectioned by Grand section unit [a Buehler Isomet low speed saw, Germany] in the mesiodistal direction into 0.1 mm thick sections. The Fig. 1 Digital Radiograph sections were fixed on a glass slide. An experienced maxillofacial pathologist inspected the tooth sections by a 78 Journal of Medicine and Life Vol. 8, Special Issue 3, 2015 light microscope (Eclipse E400, Nikon, Japan) and Chart 1. Diagnostic accuracy for each method for observers classified each tooth surface into one of four categories: on mesial surface 0: No defects in the proximal surface 1: Proximal defects in enamel

2: Proximal defects in the outer half of the dentine The specificity value of PSP was 94.9%; which 3: Proximal defects in the inner half of the dentine The differences between the observers were means that most surfaces were assessed caries free by assessed with Friedman test and differences in sensitivity PSP (the specificity value of the radiographs and CBCT and specificity were analyzed by using the Weighted were 95.4% and 83.8%, respectively) and its positive Kappa test. The SPSS v.16 software was used in predictive value was 50%.The enamel caries sensitivity statistical analysis. value was 56.8% for PSP, 31.8% for conventional film radiography and 30.2%, for CBCT; whereas the negative predictive value of PSP, CBCT and conventional Results radiography was 89.9% 83.8% and 82.4%, respectively.

The histological examination revealed that out of 84 proximal surfaces, 54 (64%) were sound, 11 (13%) had enamel caries, 15 (18%) had caries in the outer half of the dentin and 4 (5%) had dentine caries, reaching the inner half of the dentin. Four observers independently compared the caries diagnostic accuracy of three modalities [CBCT, digital radiography (PSP) and film radiography]. Chart 1 and 2 show the diagnostic accuracy of each method for observers on mesial and distal 3_2015_draft surfaces, respectively.

iss Chart 2. Diagnostic accuracy for each method for observers on distal surface

No differences were found for any parameter between PSP and radiographs, and between radiographs and CBCT. Table 1-3 present obtained parameters of each method by observers.

8_special Table 1. Conventional Technique parameters Conventional Technique Radiolucency

None In enamel In the inner half of dentin In the outer half of dentin Total Golden Standard

None 95.4%(206) 1.9% (4) 2.3% (5) 0.5% (1) 100%(216)

Caries In enamel 61.4%(27) 31.8%(14) 6.8% (3) 0% (0) 100% (44) Lesions In the inner half 30.8%(16) 9.67% (5) 57.7%(30) 1.9% (1) 100% (52) of dentin In the outer half 4.2% (1) 0% (0) 66.7%(16) 29.2% (7) 100% (24) of dentin

JML_Volume Total 74.4% (250) 6.8% (23) 16.1% (54) 2.7% (9) 100% (336)

There was no statistically significant difference among observers but the results showed differences among the different methods of caries detection. P<0.05 was considered statistically significant.

79 Journal of Medicine and Life Vol. 8, Special Issue 3, 2015

Table 2. PSP Technique parameters PSP Radiolucency

None In enamel In the inner half of dentin In the outer half of dentin Total Golden Standard

None 94.9% (205) 4.6% (10) 0.5% (1) 0% (0) 100%(216) In enamel Caries In the inner half 40.9% (18) 56.8% (25) 2.3% (1) 0% (0) 100% (44) lesions of dentin In the outer half 9.6% (5) 28.8% (15) 59.6% (31) 1.9% (1) 100% (52) Of dentin 0% (0) 0% (0) 37.5% (9) 62.5% (15) 100% (24)

Total 67.9% (228) 14.9% (50) 12.5% (42) 4.8% (16) 100% (336) PSP: Photostimulable Phosphor Plate

Table 3. CBCT Technique parameters CBCT Radiolucency

None In enamel In the inner half of dentin In the outer half of dentin Total Golden Standard

None 83.8% (181) 7.9% (17) 8.3% (18) 0% (0) 100%(216) 3_2015_draft Caries In enamel lesions 58.1% (25) 30.2%(13) 11.7% (6) 0% (0) 100% (44) In the inner half of dentin iss 17.5% (9) 17.5% (9) 61% (32) 4% (2) 100% (52) In the outer half of dentin

4.2% (1) 16.7% (4) 45.8%(11) 33.3% (8) 100% (24)

Total 64.2% (216) 13% (43) 19.8%(66) 3% (10) 100% (336) CBCT: Cone Beam Computed Tomography

Discussion respectively. Considering the difficulty in detecting incipient enamel defects, conventional radiographs and This study was performed on non-cavitated teeth CBCT were both similar in accuracy while their accuracy to determine and compare the accuracy8_special of cone beam was less than that of a PSP. The use of image computed tomography, conventional radiograph and the enhancement facilities may justify the higher accuracy of indirect digital system in detecting interproximal caries. digital systems. CBCT is a newly developed dental imaging Because of the simplicity of determining defects technique with unclear diagnostic potential for some in the outer half of the dentin, all surveyed techniques tasks. This new imaging modality may be appealing to showed the same results. The sensitivity value of PSP in clinicians for caries detection purposes. In order to detecting radiolucency in the inner half of dentin was confirm the accuracy of a new diagnostic modality, it has 62.5%; whereas this rate was 29.2% and 33.3% for the to be tested and compared with the available well- radiographs and CBCT, respectively. The higher documented imaging systems. In the present in vitro sensitivity of digital systems versus radiographs was study, proximal caries detection accuracy was evaluated attributed to using extra adjustment of brightness and by one of the well-known CBCT imaging systems. contrast. CBCT images have a lower spatial resolution Additionally, radiographs and the PSP were included in [19], which results in lower diagnostic accuracy. this study as common detectors for the determination of Based on the results of the current study, no the depth of proximal caries. statistically significant difference in non-cavitated proximal JML_VolumeOur study was performed on non-cavitated teeth caries detection accuracy was found between the PSP with small clinical demineralization. The sensitivity values and radiographs (p>0.05) or CBCT and radiographs for the detection of incipient enamel lesions in proximal (p>0.05). Nevertheless, a statistically significant difference surfaces were 56.8%, 31.8% and 30.2% for PSP, in the diagnostic accuracy between CBCT and PSP conventional radiographs and CBCT modalities, (p<0.05) was found. The results were in agreement with earlier studies comparing proximal caries detection in

80 Journal of Medicine and Life Vol. 8, Special Issue 3, 2015

conventional radiographs, digital, and CBCT images [20- Based on these results, digital intraoral techniques are 22]. The radiographs, digital, and CBCT imaging systems recommended over radiographs because of their lower used in those studies were similar to the ones levels of radiation dose. investigated herein. A number of studies have assessed the Although some studies have found that the diagnostic potential of CBCT systems. Menegalet al. CBCT is superior for the diagnosis of dentin caries [29,30] used the Accuitomo CBCT system to evaluate [23,24], it should be kept in mind that CBCT images are periodontal and peri-implant defects in comparison with very accurate in detecting the presence of cavity in a intraoral radiography, panoramic radiography and CT. Furthermore, Misch et al. [31] assessed interproximal proximal tooth surface [25]. This study found no periodontal defects by using the i-CAT CBCT, intraoral F- advantage of CBCT over radiographs or PSP for the speed film and CT and demonstrated that CBCT was detection of caries. Based on Akdeniz et al. study, some better than the other systems. types of CBCT systems such as Accuitomo are useful Considering these results, the Newtom CBCT tools for the diagnosis and monitoring of proximal caries system has a lower diagnostic accuracy than the intraoral [23]. In contrast to Akdeniz et al. study, our study found modalities for caries detection. Due to high patient dose, it no differences between CBCT and conventional intraoral was not reasonable to do this study on human samples. radiographs and even Newtom CBCT system had a Restorated teeth were excluded because of metal significantly lower diagnostic accuracy than the PSP. The artifacts result from metallic restoration that may compromise image quality and diagnostic accuracy. differences in these studies may be due to the type of factory devices. Studies have reported that the CBCT had a Conclusion higher radiation dose compared to a typical intraoral 3_2015_draft radiograph [26]. Therefore, taking a CBCT only for the In this study, undertaken to compare the detection of proximal caries is not recommended. diagnostic accuracy of CBCT, conventional radiography Other studies have demonstrated that the and PSP for the detection of proximal caries, differences detection accuracy of proximal caries in CBCT, digital among theseiss modalities were insignificant with no radiography and conventional radiography are alike advantages of CBCT imaging. Thus, CBCT is not [3,27,28]. Differences between these studies may be suggested in order to detect proximal caries because of explained by a number of factors. Firstly, different groups the higher radiation dose. of observers were used (Zhi-ling Zhang et al. used students as observers [3]). Secondly, the observers in the Acknowledgment current study used the image enhancement facilities as This article was based on a postgraduate thesis by Dr. they pleased and thirdly, the CBCT systems used in these Rahimian, which was successfully completed under studies were not the same. supervision of Dr. Safi with the close cooperation of the Fewer false positive diagnoses occurred with the Pathology Department of the Dental School of Shahid radiographs and Digora-fmx (4.7% and 5.1%, Beheshti University of Medical Sciences. The authors respectively) than with the CBCT (16.2%).8_special No significant express their sincere appreciations to all observers who differences were found between radiographs and PSP. assessed the test radiographs.

References

1. Kalathingal SM, Mol A, Tyndall DA, tomography, film, and phosphor plates. conventional film and direct digital Caplan DJ. In vitro assessment of cone Oral Surgery, Oral Medicine, Oral imaging in the detection of approximal beam local computed tomography for Pathology, Oral Radiology, and caries. In vitro. 2007; 36. proximal caries detection. Oral Surgery, Endodontology. 2011; 111: 103-8. 7. Kamburoğlu K, Kolsuz E, Murat S, Oral Medicine, Oral Pathology, Oral 4. Cheng JG, Zhang ZL, Wang XY, Zhang Yüksel S, Özen T. Proximal caries Radiology, and Endodontology. 2007; ZY, Ma XC, Li G. Detection accuracy of detection accuracy using intraoral 104: 699-704. proximal caries by phosphor plate and bitewing radiography, extraoral bitewing 2. Schneiderman A, Elbaum M, Shultz T, cone-beam computerized tomography radiography and panoramic radiography. Keem S, Greenebaum M, Driller J. images scanned with different resolutions. 2014. JML_VolumeAssessment of dental caries with digital Clinical oral investigations. 2012; 16: 8. Young S, Lee J, Hodges R, Chang T, imaging fiber-optic translllumination 1015-21. Elashoff D, White S. A comparative study (DIFOTITM): in vitro Study. Caries 5. Wenzel A. Digital radiography and caries of high-resolution cone beam computed Research. 1997; 31: 103-10. diagnosis. Dentomaxillofacial Radiology. tomography and charge-coupled device 3. Zhang Zl, Qu XM, Li G, Zhang ZY, Ma 1998; 27: 3-11. sensors for detecting caries. 2014. XC. The detection accuracies for proximal 6. Castro V, Katz J, Hardman P, Glaros A, 9. Haiter-Neto F, Wenzel A, Gotfredsen E. caries by cone-beam computerized Spencer P. In vitro comparison of Diagnostic accuracy of cone beam

81 Journal of Medicine and Life Vol. 8, Special Issue 3, 2015

computed tomography scans compared 17. Mengel R, Kruse B, Flores-de-Jacoby compared with film and digital bitewing with intraoral image modalities for L. Digital volume tomography in the radiography for proximal caries detection. detection of caries lesions. 2014. diagnosis of peri-implant defects: an in Dento maxillo facial radiology. 2007; 36: 10. Haak R, Wicht MJ, Noack MJ. vitro study on native pig mandibles. 495-9. Conventional, Digital and Contrast– Journal of periodontology. 2006; 77: 25. White SC, Pharoah MJ. Oral radiology: Enhanced Bitewing Radiographs in the 1234-41. principles and interpretation, 7th ed, 2013, Decision to Restore Approximal Carious 18. Scarfe WC, Farman AG. What is cone- Elsevier Health Sciences, 292. Lesions. Caries research. 2001; 35: 193- beam CT and how does it work?. Dental 26. White SC, Pharoah MJ. Oral radiology: 9. Clinics of North America. 2008; 52: 707- principles and interpretation, 7th ed, 2013, 11. Tam LE, McComb D. Diagnosis of 30. Elsevier Health Sciences, 32. occlusal caries: Part II. Recent diagnostic 19. White SC, Pharoah MJ. Oral radiology: 27. Senel B, Kamburoglu K, Ucok O, technologies. Journal of the Canadian principles and interpretation, 7th ed, 2013, Yuksel SP, Ozen T, Avsever H. Dental Association. 2001; 67: 459-64. Elsevier Health Sciences, 264. Diagnostic accuracy of different imaging 12. Ludlow JB, Mol A. Resolution of digitized 20. Haiter-Neto F, Wenzel A, Gotfredsen E. modalities in detection of proximal caries. intraoral dental films. Dentomaxillofacial Diagnostic accuracy of cone beam Dento maxillo facial radiology. 2010; 39: Radiology. 2004; 33: 208-. computed tomography scans compared 501-11. 13. Minston W, Li G, Wennberg R, with intraoral image modalities for 28. Krzyżostaniak J, Kulczyk T, Czarnecka Näsström K, Shi XQ. Comparison of detection of caries lesions. Dento maxillo B, Surdacka A. A comparative study of diagnostic performance on approximal facial radiology. 2008; 37: 18-22. the diagnostic accuracy of cone beam caries detection among Swedish and 21. Valizadeh S, Tavakkoli MA, Karimi computed tomography and intraoral Chinese senior dental students using Vasigh H, Azizi Z, Zarrabian T. radiographic modalities for the detection analogue and digital radiographs. Evaluation of Cone Beam Computed of noncavitated caries. Clinical oral Swedish dental journal. 2001; 25: 79-85. Tomography (CBCT) System: investigations. 2014; 1-6. 14. Şenel B, Kamburoğlu K, Üçok Ö, Comparison with Intraoral Periapical 29. Mengel R, Candir M, Shiratori K, Yüksel S, Özen T, Avsever H. Diagnostic Radiography in Proximal Caries Flores-de-Jacoby L. Digital volume accuracy of different imaging modalities in Detection. Journal of dental research, tomography in the diagnosis of detection of proximal caries. 2014. dental clinics, dental prospects. 2012; 6: periodontal defects: an in vitro study on 15. Tyndall DA, Rathore S. Cone-beam CT 1-5. native3_2015_draft pig and human mandibles. Journal diagnostic applications: caries, 22. Wenzel A, Haiter-Neto F, Gotfredsen E. of periodontology. 2005; 76: 665-73. periodontal bone assessment, and Detection of Caries Lesions with Cone- 30. Mengel R, Kruse B, Flores-de-Jacoby endodontic applications. Dental Clinics of Beam CT and Intraoral Receptors. 2006. L. Digital volume tomography in the North America. 2008; 52: 825-41. 23. Akdeniz BG, Gröndahl HG, Magnussoniss diagnosis of peri-implant defects: an in 16. Mengel R, Candir M, Shiratori K, B. Accuracy of proximal caries depth vitro study on native pig mandibles. Flores-de-Jacoby L. Digital volume measurements: comparison between Journal of periodontology. 2006; 77: tomography in the diagnosis of limited cone beam computed tomography, 1234-41. periodontal defects: an in vitro study on storage phosphor and film radiography. 31. Misch KA, Yi ES, Sarment DP. Accuracy native pig and human mandibles. Journal Caries research. 2006; 40: 202-7. of cone beam computed tomography for of periodontology. 2005; 76: 665-73. 24. Peker I, Toraman Alkurt M, periodontal defect measurements. Journal Altunkaynak B. Film tomography of periodontology. 2006; 77: 1261-6.

8_special

JML_Volume

82 Journal of Medicine and Life Vol. 8, Special Issue 3, 2015, pp.83-89

Comparison of the diagnostic value of CBCT and Digital Panoramic Radiography with surgical findings to determine the proximity of an impacted third mandibular molar to the inferior alveolar nerve canal

Saraydar-Baser R*, Dehghani-Tafti M**, Navab-Azam A**, Ezoddini-Ardakani F**, Nayer S***, Safi Y**, Shamloo N** *Department of Oral and Maxillofacial Radiology, Faculty of Dentistry, Ardabil University of Medical Sciences, Ardabil, Iran **Department of Oral and Maxillofacial Radiology, Faculty of Dentistry, Shahid Sadoughi University of Medical Sciences, Yazd, Iran ***Department of Oral and Maxillofacial Radiology, Faculty of Dentistry, Alborz University of Medical Sciences, Karaj, Iran

Correspondence to: Yaser Safi, Assistant Professor, Department of Oral and Maxillofacial Radiology, Faculty of Dentistry, Shahid Beheshti University of Medical Sciences, Tehran, Iran, Tehran, Iran, Phone: 00989123061831, E-mail: [email protected]

Received: March 14th, 2015 – Accepted: June 18th, 2015

Abstract Background: This study evaluated and determined the proximity of an impacted third mandibular molar to the inferior alveolar nerve canal by using CBCT and digital panoramic radiography. Materials and Methods: This descriptive-analytic study used CBCT and panoramic radiographs for 60 subjects (28 men, 32 women). Subjects selected showed a close proximity of the third mandibular molar to the 3_2015_draftinferior nerve canal on panoramic radiographs; these subjects then received CBCT radiographs. The CBCT findings for the proximity of the third mandibular molar to inferior nerve canal used the results of surgical findings as the standard of comparison. Results: Eight cases showed positive surgical findings indicating proximity of the third molar and the mandibular nerve canal. Only 13.3% of the cases in which panoramic views showed proximity of the third mandibulariss molar and the inferior alveolar canal were confirmed during surgery. The result for CBCT radiographic diagnosis was 95%. Conclusion: It can be concluded that CBCT is preferred over panoramic radiography to determine the proximity of the impacted third mandibular molar to the inferior alveolar nerve canal. Narrowing of the mandibular canal or root canal, disconnection of root borders in panoramic radiography, and the inferior-lingual proximity of the tooth to the root in CBCT strongly indicated the close proximity of the impacted third mandibular molar to the inferior alveolar nerve canal.

Keywords: digital radiography, panoramic radiography, CBCT, mandibular canal, mandibular molar

Introduction The close proximity of the impacted third molar to inferior alveolar nerve increases the danger of numbness up The removal of an impacted 8_specialthird mandibular to 30% and may result in psychological and social disorders molar is a common minor surgery in the maxillofacial for the patients [11,12]. This is also the cause of one of the region. Like other surgeries, this type can have the side most common complaints against maxillofacial surgeons in effect of malfunction of the inferior alveolar nerve. It is the coroner’s court and increases belief by the public that necessary to precisely predict the proximity of the third molar surgical negligence has occurred during surgery [3]. An to the inferior alveolar nerve [1,2]. Although panoramic extensive survey of the proximity of the impacted third imaging offers comprehensive coverage and easy access, mandible molar to the inferior alveolar nerve is necessary identifying the exact proximity of the impacted third before surgery. Panoramic radiography is the most common mandibular molar to the inferior alveolar canal in patients is equipment used for pre-surgery evaluation of impacted third not possible; hence, it is essential to augment diagnosis molars (Fig. 1). using cone beam computed tomography (CBCT) [3,4]. One side effect of impacted third molar tooth surgery is malfunction of the inferior alveolar nerve [5]. Such damage may cause paresthesia, hypoesthesia and anesthesia of the lower lip. Its prevalence has been reported JML_Volumeto be 4% to 8%; in less than 1% of cases, patients experience permanent numbness in that area [6-9]. This occurs because the surgery in the area around the impacted molar root and the inferior alveolar canal results in exposure of or damage to the canal [10]. Fig. 1 Panoramic radiograph Journal of Medicine and Life Vol. 8, Special Issue 3, 2015

Although this technique has gained prominence in panoramic radiographies were provided by third molar surgeries because it involves a low dose of PlanmecaProMax (Helsinki, Finland) and were carried out radiation, comprehensive coverage, and ease of under similar conditions (80 Kvp,12 mA,18 s). The 60 interpretation and access, it has drawbacks. These include patients selected received panoramic radiographies that low sensitivity, 2D views, inability to distinguish bone showed the existence of one or more signs of proximity of thickness, distortion of dimensions and magnification of both the root of the impacted tooth to the inferior alveolar canal. the perpendicular and horizontal dimensions, and creation of These signs were classified in terms of their sensitivity as: ghost images on the reverse side. Sensitivity values of 24% 1. Darkening of the tooth root to 64% and specificity values of 74% to 98% have been 2. Narrowing of the tooth root reported for panoramic radiography [3-5]. This technique is 3. Interruption of the white cortical line of the inferior gradually being replaced by CBCT, which allows 3D views of alveolar canal the anatomy with the least distortion at different angles [11]. 4. Diversion or bending of the inferior alveolar canal The advantages of CBCT over CT include a decrease in the 5. Dark and bifid root apex radiation surface, high-quality images, low scanning period, 6. Island-shaped apex decrease in radiation dosage to patient, and the decrease in 7. Deflection of the root metal artifacts in images [2]. 8. Narrowing of the inferior alveolar canal Studies show that nerve damage is the most Patients who showed a gap between the tooth root common side effect of surgery for the removal of the third and canal, for whom the root of the impacted tooth was not molar (4.4% to 8.1%). Paresthesias reported in 1.3% to 5.3% fully formed or who had lesions at the end of the apex were of the cases because of the proximity of the impacted tooth excluded from the study. Patients who had one or more to nerves [3]. radiographic signs were selected for the study and were sent Atsuko et al. surveyed the positions of the lower jaw to obtain CBCTs. molars and the mandible canal by using CBCT. They Before beginning,3_2015_draft the reason behind the study and concluded that data on the distance between the canal and the advantages and disadvantages of the procedure were the tooth provided by CBCT are effective for the evaluation of explained to the subjects and written informed consent forms potential damage to the inferior alveolar nerve. The high were obtainediss from each. All subjects were scanned to resolution and low radiation dosage allows the use of these observe and survey the condition of the tooth and inferior images for third mandibular molars. CBCT images in specific alveolar canal in 3D format. The 3D scans were taken by and standard conditions and the evaluation of a sufficient using CBCT (PromaxPlanmeca; Finland, Helsinki) under number of samples are listed as the advantages in the study identical conditions for exposure and resolution (80Kvp, 12 [12]. mA, 17 s). An observer surveyed the 3D radiographies by Chu et al. studied the position of the mandibular using 1 mm cuts of the image for axial, cross-sectional, and canal relative to an impacted third molar of the lower jaw by panoramic views. The criteria used to evaluate the CBCT using CBCT. Their results were based on panoramic radiographies are as it follows (Fig. 2): evaluations and indicated the increased prevalence of  Lingual position of root to canal proximity of the mandibular canal to roots of third molars in  Buccal position of root to canal cases showing deep latency, narrow mandible8_special canals, and  Inter-radicular position of root to canal samples showing white line radiopacity in the canal. They  Inferior position of root to canal reported that the use of CBCT made it possible to carefully specify the position of the mandible canal and the root of the tooth. The present study compared the accuracy of panoramic radiography and CBCT with the surgical findings specifying the position of the impacted third mandibular molars to the inferior alveolar nerve.

Materials and Methods

This descriptive-experimental study was carried out by using a cross-sectional method. The subjects were Fig. 2 Schematic of CBCT assessment of proximity of selected from patients awaiting surgery for removal of their impacted third mandibular molars to inferior alveolar canal JML_Volumethird molars in the Department of Maxillofacial Surgery of the Dental School of Shahid Sadoughi University of Medical Sciences in Yazd, Iran. It is common to prescribe panoramic CBCT images were taken by a maxillofacial radiography for patients requiring impacted third mandibular radiologist (Fig. 3). Three checklists were prepared for molar surgery. All subjects chosen were patients at the same each patient addressing the results of panoramic radiology center to provide a homogeneous sample. The radiography, CBCT, and surgery. After scrutinizing the

84 Journal of Medicine and Life Vol. 8, Special Issue 3, 2015

panoramic radiography and CBCT separately and at The surgeon completed his checklists by using different times, the radiologist recorded his findings about the radiological results and from personal observation the proximity of the tooth and nerve canal in the checklists during surgery. The surgeon made the following (7 cases for panoramic radiography and 4 cases for observations during surgery: CBCT). The radiologist was unable to consult with or 1. Close proximity of root and nerve were observed compare his responses for the panoramic checklist while he was reviewing the CBCT images. The patients were as evidenced by a curve in the root or a nerve examined during surgery for signs of nerve involvement, bundle near the root bleeding, nerve exposure, and postoperative paresthesia. 2. No proximity of root to canal 3. Uncertainty about exposed area, which was obscured by bleeding The present study compared the positive predictive value of panoramic radiography and CBCT and the diagnostic value of CBCT in specifying the proximity of the impacted third mandibular molar to the inferior alveolar nerve. The results of surgery were then compared with the prior radiographic results. The data was compiled in SPSS 17 and analyzed by using the chi- square, Fisher’s exact, and Kappa tests.

Results 3_2015_draft A total of 28 men and 32 women took part in this study. Table 1 shows the results of the Fisher’s exact test for the relation of PPV by gender. iss Fig. 3 CBCT of left third molar: (A) 2D image; (B) multiplanar image.

Table 1. Frequency distribution of surgical findings by gender Surgical + - Total Findings Number Percentage Number Percentage Number Percentage Gender Male 5 17.9 23 82.1 28 100 Female 3 9.4 29 90.6 32 100 Total 8 13.3 52 86.7 60 100 8_specialP-value= 0.454 Fisher’s Exact Test

The PPV for panoramic radiography was 13.3% of CBCT correlated much more highly with the results of compared to the surgical results. This showed that surgery for diagnosing possible proximity of the impacted surgery confirmed only 13.3% of the possible proximity of third molar tooth to the inferior alveolar canal of the lower the impacted third molar tooth to the inferior alveolar jaw of subjects who had positive panoramic results (Table canal of the lower jaw as assessed while using panoramic 2). radiography. The results showed that the diagnostic value

Table 2. Frequency distribution of surgical findings by side involved Surgical Findings + - Total The side involved Number Percentage Number Percentage Number Percentage Right side 6 14.6 35 85.4 41 100 Left side 2 10.5 17 89.5 19 100 Total 8 13.3 52 86.7 60 100 JML_Volume The accuracy of CBCT was 100%, which shows was 72%, indicating a high positive predictive value. It the excellent ability of this technique for diagnosing implies that 72% of 100 cases diagnosed as positive by positive cases (false + real positive). The ability of CBCT this technique were real positive by using the results of of specifying and diagnosing negative cases was 94% surgical findings as the standard of comparison. This (false positive + real negative). The PPT for this technique factor is significantly better than for panoramic

85 Journal of Medicine and Life Vol. 8, Special Issue 3, 2015

radiography. The PPV was 3.3% for panoramic The accuracy of the study was 95%; in 95% of radiography, which is outstandingly low and unreliable cases, the surgical results were congruous with CBCT (real positive/ real positive + false positive). The negative results. The diagnostic value of CBCT radiography was predictive value of CBCT was 100%, showing that the evaluated by using this index. The agreement of CBCT NPV of this technique is reliable. All cases were results with the surgical results was evaluated at a Kappa congruous with the results of surgical findings as the of 0.813, which is significant at p = 0.001. This suggests standard of comparison (real negative/ real negative + that the results of CBCT tests were in agreement with the false negative). surgical results for those patients having positive panoramic radiographies (Table 3).

Table 3. Diagnostic value of radiographic findings of CBCT Surgical Findings + - Total CBCT findings Number Percentage Number Percentage Number Percentage + 8 13.3 3 5 11 18.3 - 0.00 0.00 49 81.7 49 81.7 Total 8 13.3 52 86.7 60 100 P-value= 0.000 Measure of Agreement Kappa

Seven factors used in previous studies were When these 3 factors were surveyed by using employed to evaluate the panoramic radiography to panoramic radiography, the detection of the proximity of determine the proximity of an impacted third molar to the impacted third molars to the inferior alveolar canal of the inferior alveolar canal. Only 3 out of 7 factors showed a lower jaw increased significantly. The analysis indicated significant agreement with the results of surgery. These that the agreement between3_2015_draft the factors and the surgical factors were deflection and curvature of the root, dark results was not significant. The frequency distributions of bifid root apex near the nerve, and an island-shaped the 3 factors are shown in Table 4. The first factor, dark apex; they showed a significant agreement with the bifid root apex, had the highest frequency. The lack of results of surgical findings as the standard of comparison cortical bordersiss of the alveolar canal, narrow nerve canal, atp = 0.022, p = 0.027 and p = 0.007, respectively. and root apex deflection were not observed in panoramic radiography (Table 4).

Table 4. Frequency distribution of determining factors in panoramic radiography + - Total Surgical findings P-value Panoramic findings Number Number Number Percentage Percentage Percentage Percentage Interruption of white line of the mand. 5 62.5 30 57.7 35 58.3 0.000 canal wall 8_special Darkening of the root 1 12.5 18 34.6 19 31.7 0.416 Diversion of the mand. canal 0 0 0 0 0 0 - Narrowing of the mand. canal 7 87.5 18 34.6 25 41.7 0.007 Narrowing of the roots 0 0 22 42.3 22 36.7 0.022 Deflection of the roots 3 37.5 3 5.8 6 10 0.027 Fisher’s Exact Test

Four factors were used to evaluate CBCT: lingual, when observing the inferior and lingual factors buccal, intra-radicular, and inferior positions of the root simultaneously and was statistically significant at p = 0.000 relative to the canal. The proximity of the impacted third (Table 5). mandibular molar to the inferior alveolar canal increased only

Table 5. Frequency distribution of determining factors in CBCT radiography + - Total Surgical findings JML_Volume P-value

CBCT Number Number Number Percentage Percentage Percentage Percentage 1 7 87.5 26 50 33 55 0.063 2 0 0 10 19.2 10 16.7 0.330

86 Journal of Medicine and Life Vol. 8, Special Issue 3, 2015

3 4 50 9 17.3 13 21.7 0.059 4 4 50 43 82.7 47 78.3 0.059 5 3 37.5 17 32.7 20 33.3 0.000 6 0 0 10 19.2 10 16.7 0.330 Fisher’s Exact Test

Discussion analyzed risk factors in the determination of close proximity of the tooth to the nerve and determined the topography of It is necessary for a surgeon to use radiography to nerve to the mesial and distal roots. Their results showed determine possible difficulties arising during surgery and that the darkening of the root was the most common factor prepare for them before beginning surgery for an impacted isolated in panoramic radiography; in 13 out of 14 patients third molar. There exists the possibility of damage to the showing this sign, the third molar was in close proximity to sinus of the upper jaw or alveolar canal of the lower jaw the nerve. In 4 out of 5 patients showing an island-shaped during impacted tooth surgery [13]. Although several studies apex, the third molar was in close proximity to the nerve. A have surveyed the accuracy of panoramic and tomographic dark bifid root apex and deflection of the root apex did not radiography, variables related to the risk of damage to the indicate a close proximity of the tooth root to the mandibular alveolar nerve have not been comprehensively studied [14]. nerve. The performance of tomography versus panoramic The present study evaluated the diagnosis of close radiography was not discussed [21]. proximity of the mandibular canal to the third impacted Tantanapornkul et al. compared panoramic mandible molar by panoramic radiography by using CBCT radiography and CBCT to evaluate the topographic proximity images. Variables related to increased risk of two-structure of an impacted third molar tooth to the mandibular canal. relatedness were identified [15]. Disorders of the inferior They considered 4 factors for the proximity of the nerve to alveolar nerve result from damage to sensory tissue; if the the tooth: lack of continui3_2015_draftty of mandibular canal; root tooth and mandible canal are in close proximity, the risk darkening; mandibular canal deflection; and narrowing of the increases. This lesion may be temporary, but could become root. The existence or nonexistence of a direct relationship permanent if scar tissue develops after surgery. The size of between root and nerve were the criteria for CBCT. After the the patient dose in CBCT is lower than for a CT scan [16]. analysis of theiss radiographs, patients underwent surgery and Studies have shown that CBCT is a suitable device to the results determined during surgery were recorded. After diagnose the proximity of the mandibular canal to prevent surgery, patients were examined for the existence of damage to it and its neurovascular bundle. Its diverse paresthesia. The results revealed that every factor for advantages recommend it for application in tooth surgery. panoramic radiography was related to the exposure of the Pawelzik et al. compared panoramic radiography nerve; hence, these factors effectively predicted the risk of and volumetric CT to study the impacted third mandible damage to the nerve. The lack of continuity of the molars before surgery. They scanned 10 patients with mandibular canal was introduced as the most important impacted third mandibular molars by using panoramic diagnostic factor. Specificity was 93% and sensitivity was radiograph and found a close proximity of the tooth to the 77% for CBCT, 70%, and 63% for panoramic radiography, inferior alveolar nerve. Five oral surgeons analyzed a respectively. This showed that CBCT outperformed number of anatomic factors. In 90% of the8_special cases, volumetric panoramic radiography [22]. CT (VCT) images facilitated the diagnosis of the proximity of The frequency of 7 factors and their significance or the impacted third molar to other anatomical features. In 70% non-significance was calculated by comparison with the of the cases, the proximity of the tooth apex to the nerve results of surgery. Three factors were found to have a could be diagnosed by using VCT [17]. It has been reported significant relationship with the results of surgery. Results that panoramic radiography and VCT are not adequate for showed that 3 out of 7 evaluations of panoramic radiography diagnosis on their own and should be used together. The factors (diversion or bent inferior alveolar canal, island- authors reported that, if an experienced radiologist is shaped apex, and dark bifid root apex) had a significant available to interpret the panoramic radiography, VCT is not relationship with results of surgery as the standard. These necessary [18-20]. were significant at p = 0.022, p = 0.027, and p = 0.007, The present study revealed that panoramic respectively. radiography failed to correctly diagnose the relation between When these factors were found in panoramic these two structures on its own. The effect of multiple radiographs, the possibility of the close proximity of the observers for radiographic accuracy was eliminated by using impacted third molar tooth of the lower jaw to the inferior only one observer and the reliability of the study increased. alveolar canal increased significantly. There were no JML_VolumeSeveral studies have found that the factors used in significant relationships found between radiographs of the panoramic radiography are better related to the proximity of interruption of the white cortical line of inferior alveolar, root the alveolar nerve to the impacted third molar of the lower deflection, and narrowing of the inferior alveolar canal. jaw. Albert et al. compared panoramic radiography with Studies have considered factors such as different numbers conventional tomography to study the proximity of the of observers, their specialties, the method of scoring of data, impacted third molar and the mandibular canal. They and results of surgery results in their research methods. The 87 Journal of Medicine and Life Vol. 8, Special Issue 3, 2015

exposure during surgery and the surgeon assessment were techniques for the prediction of the risk of nerve exposure; considered the criteria for evaluation. In other cases, however, the lingual position of the mandibular canal was paresthesia was considered for the proximity of the two significantly related to IAN nerve damage. Three cases using structures [23-29]. Valmaseda-Castellón et al. showed that panoramic radiography were significantly related to IAN inferior alveolar nerve damage might ensue after lower nerve damage. CBCT sensitivity was 96% and specificity third molar surgical extraction [24]. was 23% [18-22]; hence, they found that the diagnostic Tantanapornkul et al. surveyed the results of CBCT accuracy of panoramic radiography and CBCT were the and panoramic radiography to evaluate the proximity of the same. The benefits of this study were the random viewing of mandibular canal to an impacted third molar. Patients with panoramic radiographic images and CBCT, internal impacted third molars of the lower jaw were scanned by agreement of viewers for both techniques, and evaluation by panoramic radiography prior to surgery. The surgeons were one observer. The sensitivity and specificity of both CBCT asked to record all tooth extraction details and neurovascular and panoramic radiography have been reported differently in exposure during tooth extraction. Patients for whom there various studies; for example, a sensitivity of 96% and was doubt about neurovascular exposure were excluded specificity of 27% have been reported in a similar study. from the study. Seven days after surgery, the side effects of In the present study, the sensitivity of CBCT was third molar surgery of patients were recorded. Ten patients 100%, which indicates its effectiveness in diagnosing positive showed the side effects; patients with exposed cases. Its specificity for diagnosing and identifying negative neurovascular bundles showed significantly higher side cases was 94%, which was lower than its sensitivity. effects compared to other patients. The sensitivity of CBCT Conclusion was 93%, which was significantly higher than for those receiving only panoramic radiography. It was concluded that This study confirmed that CBCT is the most the CBCT was more effective in predicting neurovascular accurate method of radiography3_2015_draft for the determination of the exposure after surgery for an impacted third molar than proximity of impacted third molars of the lower jaw and the panoramic radiography. Moreover, its application under inferior alveolar canal. The results indicated that 3 of 7 clinical conditions to evaluate impacted third molar pre- factors used to evaluate panoramic radiography (diversion or surgery had several advantages. Since identifying bending of theiss inferior alveolar canal, dark bifid root apex) neurovascular exposure was done by the surgeon during significantly agreed with the surgical results used as the surgery, the possibility exists that some areas were standard. The CBCT diagnostic value was 95% in this study, overlooked and these results showed the low specificity of indicating that, in 95% of cases, the results of surgery were images [21]. This was a limitation of the research. The the same as the predictions from CBCT. The results of present study employed observers, which had several CBCT evaluation increased for simultaneous observation of advantages. the inferior-lingual relation to confirm the proximity of the Gaeminia et al. evaluated the proximity of impacted impacted third molar of the lower jaw to the alveolar canal. third molars to the mandibular canal by using CBCT and panoramic radiography. Their results revealed no significant Conflict of interest relation between exposed IAN and nervous disorders after The authors declare that they have no conflict of surgery by gender, place of surgery or 8_specialthird molar angle. interest. They found no significant difference between these two

References

1. Fonseca RJ, Dexter Barber H, Matheson mandibular third molar’s. J Oral Maxillofac after third molar extraction. J Oral JD. Oral and Maxillofacial Surgery. 2nd Surg. 2007; 65:83-88. Maxillofac Surg. 2003; 61:417-421. ed., 2009, Missouri: Saunders co., 215- 5. Miloro M, DaBell J. Radiographic 8. Maegavwa H, Sano K, Kitagawa Y, 216. proximity of the mandibular third molar to Ogasawara T et al. Preoperative 2. William CS, Allan GF. Cone – Beam the inferior alveolar canal. Oral Surg Oral assessment of the relationship between the computed tomography. In: White SC, Pathol Oral Radiol Endod. 2005; 100: 545- mandibular third molar and the mandibular Pharoah MJ. Oral Radiology Principle and 9. canal by axial computed tomography with Interpretation. 2009, Mosby: Elsevier, 225- 6. Enciso R, Danforth RA, Alexandroni ES, coronal and sagittal reconstruction. Oral 243. Memon A, Mah A. Third-molar to the Surg Oral Med Oral Pathol Oral Radiol JML_Volume3. Miloro M, Ghali GE, Larsen PE, Waite impaction diagnosis with cone – beam Endod. 2003; 96:639-46. PD. Peterson’s principles of oral and computerized tomography. International 9. Sedaghatfar M, August MA, Dadson TB. maxillofacial surgery. 2nd ed., 2004, Congress Series. 2005; 1281: 1196-1199. Panoramic radiographic Findings as Ontario: BC Deker Inc., 151- 152. 7. Blazer BF, August MA, Donoff RB, predictor’s of inferior alveolar nerve 4. Srinivas M, Susarla BA, Dodson TB. Kaban LB. Panoramic radigraphic risk exposure Following third molar extraction. Preoperative computed tomography factors for inferior alveolar nerve injury J Oral Maxillofac Surg. 2005; 63:3-7. imaging in the management of impacted

88 Journal of Medicine and Life Vol. 8, Special Issue 3, 2015

10. Blaeser BF, August MA, Donoff RB, 17. Pawelzic J, Cabnen M, Willers R, Becker 23. Mishima A, Kobayashi K, Yamamoto A, Kaban LB, Dodson TB. Panoramic J. A comparision of conventional KimuraY, Tanaka M. Comparison of radiographic risk factors for inferior alveolar panoramic radiographs with volumetric patient addition due from dental CT and nerve injury after third molar extraction. J computed tomography images in the spiral CT symposium of high technology Oral Maxillofac Surg. 2003; 61(4):417-21. preoperative assessment of impacted research center in Tsumi University School 11. Lindh C, Petersson A, Klinge B, Nilsson mandibular third molars. J Oral Maxillofac of Dental Medicine, 2001, Japan: M. Trabecular bone volume and bone Surg. 2002; 60: 979-984. Yekohama, 171-172. mineral density in the mandible. 18. Hosseini Ghoosheh SM, Asadi Samani 24. Valmaseda-Castellón E, Berini-Aytés L, Dentomaxillofac Radiol. 1997; 26(2):101-6. SH, Shahidi SH. Anatomical relationship Gay-Escoda C. Inferior alveolar nerve 12. Atsuko H, Yoichi N, Hisako I, Kaoru K. between mandibular third molar roots and damage after lower third molar surgical Observation of positional relation between mandibular canal in panoramic radiography extraction: a prospective study of 1117 mandibular third molars and the and CT scans. TAbib-e-Sharg. 2008; surgical extractions. Oral Surg Oral Med mandibular canal on limited cone beam 10(2):227-235. Oral Pathol Oral RadiolEndod. 2001; computed tomography. Japanese Journal 19. Ghaeminia H, Meijer GJ, Soehardi A, 92(4):377-83. of Oral and Maxillofacial Surgery. 2004; Borstlap WA, Mulder J, Bergé SJ. 25. Sheikhi M, Jahadi S. The use of cross– 50(1): 1-10. Position of the impacted third molar in sectional tomography to determine the 13. Bell GW. Use of dental panoramic relation to the mandibular canal. Diagnostic position of impacted third molars to the tomograph to predict the relation between accuracy of cone beam computed mandibular alveolar canal. Shiraz Dental mandibular third molar teeth and the tomography compared with panoramic Journal. 2005; (1,2): 47-54. inferior alveolar nerve radiologic and radiography. Int J Oral Maxillofac Surg. 26. Maghsoodi T, Ethier JE, Azevedo B, surgical findings, and clinical outcome. 2009; 38(9):964-71. Noujeim M, Langlais R. Mandibular canal British Journal of Oral and Maxillofacial 20. Nakayama K, Nonoyama M, Takaki Y, position and impacted third molars using Surgery. 2004; 42:21-27. Kagawa T, Yuasa K, Izumi K, Ozeki S, cone-beam computed tomography. Oral 14. Maegawa H, Sano K, Kitagawa Y, Ikebe T. Assessment of the relationship Surg Oral Med Oral Pathol Oral Ogasawara T, Miyauchi K, Sekine J, between impacted mandibular third molars Radiolendod. 2007; 103(2): 51-52. Inokuchi T. Preoperative assessment of and inferior alveolar nerve with dental 3- 27. Susarla SM, Dodson TB. Preoperative the relationship between the mandibular dimensional computed tomography. J Oral computed tomography imaging in the third molar and the mandibular canal by Maxillofac Surg. 2009; 67(12):2587-91. management3_2015_draft of impacted mandibular third axial computed tomography with coronal 21. Melo Albert DG, Amorim Gomes AC, molars. J Oral Maxillofac Surg. 2007; and sagittal reconstruction. Oral Surg Oral Egito Vasconcelos BC. Comparision of 65(1):83-8. Med Oral Pathol Oral Radiol Endod. 2003; ortopantomograph and conventional 28. Jung YH, Nah KS, Cho BH. Assessment 96(5):639-46. tomography images for assessingiss the of the relationship between the mandibular 15. Greenwood M, Corbett IP. Observations relationship between impacted lower third third molar and the mandibular canal using on the exploration and external neurolysis molars and the mandibular third canal. J panoramic radiograph and cone beam of injured inferior alveolar nerves. Int J Oral Oral Maxillofac Surg. 2006; 64: 1030-1037. computed tomography. Korean J Oral Maxillofac Surg. 2005; 34(3):252-6. 22. Tantanapornkul W, Okouchi K, Fujiwara Maxilloacradiol. 2008; 38: 163-7. 16. Ludlow JB, Davies-Ludlow LE, Brooks Y. A comparative study of cone-beam 29. Chu YG, Park YI, Kim JW, Lee SH. SL. Dosimetry of two extraoral direct digital computed tomography and conventional Positional Relationship of the Mandibular imaging devices: NewTom cone beam CT panoramic radiography in assessing the Canal and Impacted Third Molars by Using and Orthophos Plus DS panoramic unit. topographic relationship between the Dental Cone Beam Computed Dentomaxillofac Radiol. 2003; 32(4):229- mandibular canal and impacted third Tomography. J Korean Assoc Maxillofac 34. molars. Oralsurg Oral Med Oral Pathol Oral Plast Reconstr Surg. 2009; 31(6):492-498. RadiolEndod. 2007; 103: 253-9.

8_special

JML_Volume

89 Journal of Medicine and Life Vol. 8, Special Issue 3, 2015, pp.90-95

Correlation between adequate nursing staff and the hospital performance: Case Study in Tehran University of Medical Sciences Hospitals

Azari S* **, Mokhtari S***, Aliyari A****, Mohammadi M*****, Afroozi M**, Salimi M******, Azari GH******* *Health Management and Economics Research Center, Iran University of Medical Sciences, Tehran, Iran, **School of Public Health, Tehran University of Medical Sciences, Tehran, Iran, ***The Headquarters Students of Witness and Gallantry, Tehran University of Medical Sciences, Tehran, Iran, ****Farabi Hospital, Tehran University of Medical Sciences, Tehran, Iran, *****Student Research Committee, Kermanshah University of Medical Sciences, Kermanshah, Iran, ******Health Services Management Research Center, Institute for Futures Studies in Health, Kerman University of Medical Sciences, Kerman, Iran, *******Department of Health Service Management, Islamic Azad University-Science and Research Branch, Tehran, Iran

Correspondence to: GH Azari, MSc Student in Health Services Management, Department of Health Service Management, Islamic Azad University-Science and Research Branch, Tehran, Iran, Research Branch, Tehran, Iran, Tehran, Hesarak, Daneshgah Blvd, Iran, Phone: +98 21 4486 5179, E-mail: [email protected]

Received: March 14th, 2015 – Accepted: June 18th, 2015 3_2015_draft Abstract Background: As the largest group among different groups of hospital workforce, nurses play a crucial role in the success of the hospital activities and the promotion of community health. iss Objectives: This study aimed to find the correlation between the shortage of nursing workforce and hospitals performance of Tehran’s Medical Sciences University. Materials and Methods: This research was a cross-sectional descriptive study, which was performed in selected educational hospitals affiliated to Tehran University of Medical Sciences during the year 2010. While using three researcher-made forms, data was collected from all clinical, para-clinical, financial, administrative and support departments of hospitals. Data was analyzed according to the standards of Iran’s Ministry of Health and Medical Education by using Excel software. Pabon Lasso model was applied for performance measurement during the year 2010. The combination of 3 indicators was used to determine the length of stay, bed occupancy rate and bed turnover. Results: The results showed that the nursing staffs in the 18 wards (66.67%) were in lower levels than the standards, only one ward (3.7%) matched the standards, and the rest of the wards (29.62%) were in higher levels than the standards. Both hospitals were near the value 4 in the Pabon Lasso model. The correlation analysis between the nursing shortage and performance showed a significant relationship (P<0.05). Conclusion: Generally, the studied hospitals8_special were faced with a lack of nursing work force and the distribution of work force was not appropriate. A proper planning and management of work force in accordance with the lack of personnel compensated and achieved the standards required for the hospital’s nursing work force and this would lead to an increase in the efficiency of the hospitals’ activities and could provide satisfaction for the nursing staff.

Keywords: estimation, nursing staff, hospital, personnel standards, Pabon Lasso

Introduction developed countries is not the fact that they have access to great physical and material assets but the collection of Attitudes toward the work force and human concentrated knowledge which is a result of experimental resources have changed along with the wonderful knowledge and discoveries resulted by this experimental changes we witness in today’s word and also along with science and knowledge, of course the capacity and the information blast, globalization and similar cases, as presented educations are also considered important they were considered the main factors that cause these factors in the effective application of this science [2]. JML_Volumechanges. At present, none of the managers has an Undoubtedly, there were hospital criteria and standards instrumental attitude toward human resources, employees applied along with the proper management, which led to are valuable assets of an organization, and so many the efficiency and effectiveness of the hospital services. scholars have been trying to find an effective method to Meanwhile, the work force is the first and most important create and keep these assets [1]. The Nobel prize winner, section, creating the hospital as an organization. The Simon Kuznets, reasoned that a true asset of most importance of the work force in presenting hospital Journal of Medicine and Life Vol. 8, Special Issue 3, 2015 services is undeniable and without proper and educated standards and by doing so, shortages and surpluses of work force, hospital activities will be deranged. In fact, a required work force in Tehran Medical University’s proper combination of doctors with required specialties, hospitals would become clear and would also determine nurses, technicians, nurse aids, have a major and critical what type of career suffers from these shortages and role in the proper working routine of the hospital and the surpluses and finally it would also be determined the way presentation of hospital services [3]. The various models this information is combined with hospital performance. and methods were presented to predict the work force at the universal level and to be based on various time periods. Goodman and Viant have presented the effective Materials and methods factors on developing these methods and models and also the application limits of each one on the long term The present research is of health system studies planning of work force during the past 100 years [4]. Work type and it was performed in descriptive–analytical force was considered one of the most important resources method. The studied society in the present research and assets of the hospital and its shortage or surplus includes all sections and units with nursing group could affect the quality of services provided to the personnel (nurse, nurse’s aide, nurse’s aide assistant) in patients. Most problems in hospitals were the result of 2 hospitals. Choosing these two hospitals was due to the shortage in work force or improper distribution of work access to data regarding the nursing level in all wards. force [5,6]. Based on the results presented in a research Data were gathered by means of researcher built by Arab & et al. during 2010, studied hospitals faced a questionnaires that were designed by means of previous work force shortage and did not have a correct researches. The present research used three types of management and planning of work force. Also, there were forms to gather data, as it follows: 1 related to authorities various researches on the nurses’ dissatisfaction with the of selected clinical condition, the work force of these hospital, which was mentioned, and its major reason was sections was determined by these means. 2: related to the shortage in the number of nurses [7,8]. It was medical records section,3_2015_draft which was used to determine a essential to explain that the medical staff made up more percentage of sections of bed occupation, number of than 70 percent of the hospital’s work force and, active beds and the median of the patients’ stay in clinical considering the current expenses of the hospital, they sections and 3 used to determine the condition of the devoted 65 to 70 percent of these expenses to existing workiss force and also to study personnel structure themselves. The most important issue was that based on designed by the hospitals’ staff department director. After the reports of the Ministry of Health, the bed occupancy gathering the required data, shortages and surpluses of coefficient in Iran’s hospitals not exceeding around 60, nursing work force of studied hospitals was determined just about the active beds [9]. The final aim of the human based on career types in various sections of the hospital resources activities was to provide a proper number of and the required nursing work force was evaluated. competence employees to satisfy inpatients in hospitals. In order to assess the performance of hospitals, Hospitals required a certain number of competent Pabon Lasso model combing 3 indicators was used: individuals to ensure it would accomplish its mission and length of stay, bed occupancy rate, and bed turnover rate satisfy patients’ needs. In this sense, work force was defining which hospitals were in a certain region of determined by considering the personnel’s working efficiency. Pabon Lasso model divided hospital volume. This method used the determined8_special working performance into 4 areas: area one - hospitals with low volume for the hospital’s personnel. This index included bed occupancy rate and bed turnover, area two - the number of inpatients divided on number of surgeries, hospitals with low bed occupancy rate and high bed number of births, number of inpatients, number of turnover, area three - hospitals with high bed occupancy outpatient clinics, personnel education, visit in the house, rate and bed turnover and finally, area four - hospitals etc. For each of mentioned indexes, standard activities with high bed occupancy rate and low bed turnover. Due were defined. These standards were represented by the to ethical issues, the name of the hospital was not rate of time spent for each of these activities [10]. Planning the work force predicted the organizations’ mentioned. Data were analyzed by means of Excel future supply and regular demanding for employees. By software, descriptive statistic indexes and standards guaranteeing the number and type of required employees, handbook suggested by the Ministry of Health. the human resource unit can better predict absorption, selection, education, career planning and other activities. Findings If the organization is not supplied by a proper number and Bed occupancy rate, length of stay and bed type of work force, the planning might fail. Executive turnover of 2 hospitals could be seen in Table 1. managers recognized that the main success key in According to Pabon Lasso model, both hospitals were JML_Volumeplanning is human resource because competent placed in region 4 of efficiency, which had a high bed employees ease the successful execution of plans [11]. occupancy rate and low bed turnover, which showed that The main goal of the present research was to estimate these hospitals admitted patients with more complicated the required work force of hospitals based on the pattern conditions and an increase in the average length of stay, suggested by the Ministry of Health. The present research which led to an increase in cost and need for more was a step toward adjusting with the Hospitals’ personnel personnel.

91 Journal of Medicine and Life Vol. 8, Special Issue 3, 2015

Table 1. Efficiency region of hospitals according to Bed section (1). Generally, the distance or difference of the occupancy rate, length of stay and bed turnover existing condition from the model suggested by the hospital Bed length bed Region of Ministry of Health was of 139 individuals (Table 2). 346 occupancy of stay turnover efficiency working careers existed in Hospital A, which should have rate had 356 nurses, based on the standards of the Ministry of A 87.11 6.65 32.76 4 B 88.36 6.73 44.13 4 Health. Among 11 studied sections, 4 had a nursing surplus based on the pattern suggested by the Ministry of Both studied hospitals were public and Health, a section was proper based on the pattern and the educational-medical centers. The total number of the rest suffered a staff shortage. Based on model suggested existing nursing work force and required number were by the Ministry of Health the maximum shortage was determined based on the pattern suggested by the observed on the orthopedic section (10) and the minimum Ministry of Health for hospitals and the results were shortage was observed in the nursing office which was presented in Table 2. adjusted based on the model. The highest surplus was There were 392 nursing organizational posts in also observed in the internal section (-1) and the minimum Hospital B. Based on the standards of the Ministry of surplus was observed in the general surgeries (-1). Health, this hospital should have had 794 organizational Generally, the existing difference of the current condition posts related to nursing staff. Among 16 sections studied from the model suggested by the Ministry of Health was of in Hospital B, four sections had a nursing surplus based 30 individuals (Table 2). on the pattern suggested by the Ministry of Health and the The correlation analysis showed that there was a other suffered a shortage in the nursing work force. Based significant relationship between the nursing staff shortage on this pattern, the maximum shortage existed in ICU (36) and the region of efficiency (r= 0.82, P<0.05). and the minimum shortage existed in the newborns 3_2015_draft

Table 2. Condition of studied hospitals’ work force based on the model suggested by the Ministry of Health iss ng work force ng work Health section Section

8_special Active bed number Active bed number Active bed the Ministry of Health of the Ministry Health of the Ministry

Bed occupation coefficient occupation Bed coefficient occupation Bed Existing nursi Existing force work nursing Existing

Hospital A Hospital B Hospital

Nurses based on the model suggested by the Ministry of Ministry the by suggested model the on based Nurses Nurses based on model suggested by the Ministry of Health Ministry the by suggested model on based Nurses

Difference of existing condition with the condition suggested by suggested by condition the with condition existing Difference of suggested by condition the with condition existing Difference of

-7 17 24 18 2.76 10 22 12 15 1.75 CCU urethra

surgery

Kidney and Kidney

10 38 28 42 2.76 36 97 61 31 8.76 ICU JML_Volume orthopedic

92 Journal of Medicine and Life Vol. 8, Special Issue 3, 2015

-8 13 21 24 2.98 5 20 15 6 2.82 NICU internal

4 22 18 27 8.94 1 10 9 8 5.12 system Digestive Digestive

Newborns

1 42 43 27 8.75 8 33 25 36 7.60 infectious Orthopedic

1 15 14 18 8.94 16 36 20 17 4.79 lung

internal Nerves, Nerves,

6 41 35 23 9.65 16 36 20 40 4.71 CCU

surgery General 3_2015_draft

8 57 49 18 2.73 7 52 45 33 8.80 ICU

iss Emergency

-1 59 60 66 1.84 2 12 10 7 4.59 on

Kidney Kidney surgery General

transplantati

-7 36 43 40 1.87 4 44 20 30 7.68 Lung Cardio surgery

8_special

0 11 11 - - -9 74 63 34 3.85 on bone

office Nursing Nursing

Brain and and Brain transplantati

30 351 346 303 - 8 23 15 24 7.73 total

surgery Brain and and Brain neurology neurology

-4 30 34 24 6.94 Internal Internal hematology

26 44 17 44 3.81 birth

JML_Volume Women and and Women

93 Journal of Medicine and Life Vol. 8, Special Issue 3, 2015

-2 5 7 7 5.80 Post CCU Post

-7 11 19 - - office Nursing Nursing

139 549 392 356 - total

Discussion and conclusion the suggested standards and the rest of 58% of the sample society were far from the existing measures and standards [3]. In Mostafaiye’s study about hospitals of People working in medical careers are Medical University of Tehran, he found out that 85.1% of considered among the most important group of work force the sections had a shortage, 5.31% had a surplus, and presenting medical and healthcare services. Unique 9.57% had an exact right number of nurses, based on the characteristics of the medical group jobs, such as the standards of the Ministry of Health [14]. In the ICUs, effect on health, which is one of the most vital aspects of responsible for taking care of patients in a sensitive the mankind’s life, makes it essential to pay attention to condition both in the hospitals3_2015_draft shortage of nursing work planning to considering the future in this area. force was observed. Abrishamkar also showed that the Consideration and paying attention to work force planning ICUs faced a shortage of the nursing staff and lacked a in the healthcare area is important from two points of correct and proper management of work force [15]. The view. First, the work force is considered one of the nursing officeiss was one of the units in which the quality essential and basic factors in the effective service and quantity of the work force’s number was very providing; second, a great part of the healthcare section important because it was responsible for monitoring and financial resources is used to pay wages of this work controlling the Hospital confining sections’ activities. In force [12]. Now, third world countries devote around 60 to our hospitals studies, no shortage was observed in the 80 percent of their healthcare and medication share to required number of work force in the nursing office based their hospitals while this percent is around 38 percent for on the model suggested by the Ministry of Health, it was hospitals in developed countries and the rest is devoted to to say that there were 8 surplus employees in the nursing non-hospital medical and healthcare services. Due to this, staff of Hospital B in comparison with the model it is very important to calculate hospital staff expenses in presented by the Ministry of Health. Hospital A had the these countries [13]. Based on the results from exact number of the nursing staff in comparison with the evaluations in studied hospitals and comparing8_special them with model suggested by the Ministry of Health and there was the current condition, we realized that the nursing work no shortage in the nursing office, which could be force distribution is not balanced in various sections of the considered as one of strength points of this hospital. hospital and it does not follow the standards. Among 16 Results of this study showed that studied hospitals faced sections of Hospital B, 12 sections had less work force in a shortage of the nursing staff and the maximum shortage comparison to the model suggested by the Ministry of was related to Hospital B with 139 individual’s shortage. Health and 4 had a higher level than suggested by the The planning regarding the making up of this personnel Ministry of Health. This is while the work force distribution shortage and reaching the personnel standard level in all in the sections of Hospital A was different in a manner hospital sections and presenting the required educations that in comparison to the model suggested by the Ministry to every sectors director or manager in relation to proper of Health, 4 sections had less work force, 6 sections had and correct management and planning of work force of more work force and finally one section was adjusted the sections will increase the efficiency and effectiveness based on the model suggested by the Ministry of Health. of hospital activities [16]. Results of Bahadori study in Iran Studying the condition of nursing work force in the present also showed that 89.5% of hospital beds encounter with study and comparing it with the existing researches low nursing personnel, which is in agreement with our indicated a shortage of the nursing work force in the study [17]. Based on statistical reports about hospitals JML_Volumestudied hospitals. covered by the Ministry of Health, treatment and medical The results presented by Akbari & et al. educations were developed; the bed occupation researches showed that among 92 hospital sections coefficient in Iran’s hospitals did not exceed 60 active studied in Lorestan Medical University hospitals, only 18 beds. It is obvious that this rate is less than 50 percent sections were adjusted based on the model presented by regarding the hospital’s permanent beds. This way, the the Ministry of Health and 16 sections were better than enormous expenditure that human resources spends to

94 Journal of Medicine and Life Vol. 8, Special Issue 3, 2015 manage hospitals and other healthcare-medical centers the outcomes of the hospitals depend on the nursing requires a great and increasing attention [13]. A working hours, which showed the importance of number comparative study about the work force index and and hours of nurse staffs on hospital performance [19]. proportion of its distribution in Hospital A, which was done Everhart’s study also showed a positive relationship for the Ministry of Health, the treatment and Medical between the number of the nursing staffs and the financial Education by Sedghiani showed the fact that in the performance of hospitals [20]. What should be reminded developed countries’ hospitals, despite the use of is that this number of work force is not determined based advanced technology, which led to a decrease in the work on guessing but based on the evaluating work force and force, based on hospitals condition of being educational, time consumption of services methods. The most non-educational and singular expert, generally 3 or 4 work important point is that now, the Ministry of Health’s force were considered. hospitals only hold common standards to determine the The results of the present study showed that number and design the work force has and the personnel there is a significant relationship between the efficiency standards of the Ministry of Health. Generally, in all area of the hospitals and condition of nursing staff in both hospitals of the country, especially hospitals in which the hospitals. Both hospitals had a high bed occupancy rate bed’s capacity was not properly used and the median of with low bed turnover, which needed more personnel in hospital bed occupancy was low, such as the studied order to consider the best patient treatment and follow up hospitals, managing the hospitals use of less work force while none of these hospitals had a good condition and usually with improper design was applied, which led regarding the nursing staffs. According to results of to an irreparable damage to the body of the country’s Mark’s study, 60% of the unit of service provision was in a health system and so many facilities and capacities of the lower efficiency level, which needed a reduction of the hospitals, so, the great investments on them were left hours of working of nurses and this led to an adequate untouched. number of the nursing staff [18]. Sovie also implied that 3_2015_draft

References iss

1. El-Jardali F, Tchaghchagian V, Jamal D. Western Journal of Nursing Research. 15. Abrishamcar S, Abedinzadeh MR, Arti Assessment of human resources 2009; 31:153–170. HR, Hoshmand F. Survey of Inpatient management Practices in Lebanese 8. Arab M, Yousefi M. Estimating the number Cases and Mortality Rate in ICU in hospitals. World hospitals and health of needed personnel in admission Ayatallah Kashani Hospital of Sharehkord. services. The Official Journal of the department of Children’s Medical Center Journal of Sharehkord University of International Hospital Federation. 2010; affiliated with Tehran University of medical Medical Science. 2003; 3:73-8. 46(1):23-8. sciences using work and time 16. Sadeghifar J, Pourreza A, Ahmadi B, 2. Kuznets SS. Toward a Theory of Measurement. Hospital. 2010; 8(3):19-26. Zeraati H, Arab M. Assessment of Economic. In Lekacman R. National Policy 9. Ministry of Health and Medical Necessary Staff for Hospitals of Ilam for Economic Welfare at Home and Education. Report of Situation of Iran University of Medical Sciences in Abroad. 1995, Garden City, N.Y., Hospitals. 2000. Accordance With Personnel Criteria and Dobleday. 8_special10. WHO. Global Atlas of the Health Standards of Iranian Health Ministry. 3. Akbari F, Arab M, Momeni K, Rahimi A, Workforce. 2009. Scientific Journal of Ilam University of Bahadori M. Situation of the Necessary www.who.int/globalatlas/autologin/hrh_logi Medical Sciences. 2011; 19(1):24-31. Human Resources for hospitals of Lorestan n.asp. 17. Bahadori M, Arab M, Sadeghifar J, Province in Accordance with Proposed 11. Beardwell J, Claydon T. Human resource Ahmadi B, Salimi M, Yghoubi M. Model by the Iran’s Ministry of Health. Rev management: a contemporary approach. Estimation of nursing staff in selected Glob Medicine Healthcare Res (RGMHR). 2007, Pearson Education. hospitals of Ilam and Ahvaz provinces, 2012; 3(2):135-43. 12. Murphy GT, MacKenzie A, Alder R, Birch Western Iran. Nurs Midwifery Stud. 2013 4. Goodman HS, Weyant RJ. Dental health S, Kephart G, O’Brien-Pallas L. An Jun; 2(2):217-25. personnel planning: a review of the applied simulation model for estimating the 18. Mark BA, Jones CB, Lindley L, Ozcan literature. Journal of Public Health supply of and requirements for registered YA. An examination of technical efficiency, Dentistry. 1990; 50:48–63. nurses based on population health needs. quality, and patient safety in acute care 5. Sadaghyani E. Hospital management and Policy, Politics, & Nursing Practice. 2009; nursing units. Policy Polit Nurs Pract. 2009 organization. Pub of Jahan Rayane, 1998, 10(4):240-51. Aug; 10(3):180-6. Tehran, 47-8. 13. Sadaghyani E, Amerion A. Hospital 19. Sovie MD, Jawad AF. Hospital 6. Dehghan Nayeri N, Nazari A, Salsali M, standards. 2006, Tehran, 92-4. restructuring and its impact on outcomes: Ahmadi F. Iranian Staff Nurses’ Views of 14. Mustafai D. Estimation of the Necessary nursing staff regulations are premature. J Their Productivity and Human Resource Work force for the Hospitals of Tehran Nurs Adm. 2001 Dec; 31(12):588-600. JML_VolumeFactors Improving and Impeding It: A University of Medical Sciences in 20. Everhart D, Neff D, Al-Amin M, Nogle J, Qualitative Study. Human Resources for Accordance with the Personnel Criteria and Weech-Maldonado R. The effects of nurse Health. 2005; 3(9):1-11. Standards of the Ministry of Health. M.Sc staffing on hospital financial performance: 7. Tschannen D, Kalisch BJ. The Effect of Thesis, 2003, Tehran University of Medical competitive versus less competitive Variations in Nurse Staffing on Patient Sciences, 2-3. markets. Health Care Manage Rev. 2013 length of Stay in the Acute Care Setting. Apr-Jun; 38(2):146-55.

95 Journal of Medicine and Life Vol. 8, Special Issue 3, 2015, pp.96-100

Protective effect of Jaft against carbendazim induced biochemical changes in male Wistar rats

Mirzaei A*, Sepehri S**, Sadeghi H*, Alamdari A* *Medicinal Plants Research Center, Yasuj University of Medical Sciences, Yasuj, Iran, **Department of Biotechnology, Fergusson College, Pune – 414001, Maharashtra, India

Correspondence to: Alikaram Alamdari, PhD, Yasuj University of Medical Sciences, Yasuj, Iran, Yasuj, Kohgiluyeh Va Boyer Ahmad, Iran, Mobile phone: +9809177410439, E-mail: [email protected]

Received: March 14th, 2015 – Accepted: June 18th, 2015

Abstract Introduction: Pesticides are an important tool for crop protection and control of different pests and insects. The present research was carried out to evaluate the protective role of Jaft extract against oxidative stress and biochemical changes due to short-term exposure to carbendazim in male Wistar rats. Fresh fruits of quercus brantii were dried and the internal layer (Jaft) was collected for a hydroalcoholic extract by a maceration method at room temperature. For the experimental study, twenty-four adult male rats (Wistar albino rats weighing 150-200 g) were randomized into three groups of eight. Group I served as a vehicle treated group, received corn oil additionally to their food, while the3_2015_draft animals in group II received 0.1 ml carbendazim (50mg/ kg in corn oil) by oral route for nine days. Rats in group III received Jaft (500 mg/ kg by oral route + in carbendazim for 9 days. Blood samples were obtained by heart puncture to determine aspartate aminotransferase (AST), alanine aminotransferase (ALT), alkaline phosphatase (ALP), blood urea nitrogen (BUN) and creatinine; by using auto-analyzer in serum.Kidneys and liver were isolated from rats and prepared for tissues homogenizationiss of biochemical parameters such as MDA and GSH levels. Result: The serum content of AST, ALT, ALP, BUN and creatinine were significantly elevated by in carbendazim treatment (group II) compared to the negative group (p<0.01).The liver enzymes activities, BUN and creatinine were significantly reduced in rats (p<0.05) when Jaft was received in a short period of time (group III). Hepatic and renal MDA and GSH levels in group (II) were significantly (p<0.05) increased and reduced respectively. The MDA and GSH levels’ content were significantly normalized in rats (p<0.05) when Jaft was received by group III. Conclusions: According to the present data, Jaft can neutralize carbendazim induced oxidative stress and recover the abnormal pathological injuries in male Wistar rats.

Introduction 8_specialtoxicity via immature spermatids [5] and inhibition of microtubule assembly. Today, pesticides are an important tool for crop Also, in mammals exposure with carbendazim is protection and control of different pests and insects. associated with disturbances in liver function, Carbendazim (methyl-2-benzimidazole carbamate) with hematopoiesis and reproduction system [6]. systemic broad-spectrum is a fungicide agent that is According to some research results, widely used in gardening and agricultural disease control carbendazim can induce damages to thyroid, parathyroid , program. It is also used as preservative in paint, textile, adernal glands and some hormone content in rats [7]. paper, leather and fruit crop industry [1]. It is expected that the Jaft extract may become a Carbendazim is an end product of benomyl, the new substance in the near future, to control inflammatory most extensive ecological pollutant related to human and disease and oxidative stress pathogenesis in man and animal reproductive health. Carbendazim is a toxic animals. Hence, the present research was carried out to substance according to the World Health Organization evaluate the protective effect of Jaft extract against classification, which is broadly used as a fungicide agent oxidative stress and biochemical changes due to short- [2]. It acts on tubulin via interferes in microtubule term exposure to carbendazim in male Wistar rats. development and meiotic cell division [2]. JML_VolumeMan may be exposed to carbendazim either through Materials and methods environmental contamination or through occupational exposures. Several diseases such as hypertension, eyes, Preparation of extract nose and throat irritation and headache were reported Fresh fruits of quercus brantii were collected due to occupational exposure [3,4]. Carbendazim and its metabolite benomyl have been known to induce testicular form Yasuj Iran. The fruits were dried and an internal Journal of Medicine and Life Vol. 8, Special Issue 3, 2015

layer of the fruit (Jaft) was collected. The extraction of Jaft comparable to corresponding to the values in the control was carried out at room temperature for 2 days by group (Fig. 4,5). maceration method, and ethanol 70% was used as a As a lipid peroxidation marker in hepatic and solvent. The plant extract was filtered by using whatman renal tissues, MDA were significantly (p<0.05) increased No. 1 filter paper and concentrated by rotary evaporator after a short-duration exposure to carbendazim (group II). (BUCHI, Switzerland) at 400C. The crude extract was The MDA contents were significantly reduced in rats stored in fridge for further study. (p<0.05) when Jaft was received in short time (group III) Twenty four Adult male Wistar albino rats (Table 1). weighing 150-200 g were obtained from our rat colony. In carbendazim exposure (group II) glutathione The animals were maintained in a 12-hour light/ (GSH) was significantly reduced (p<0.001) in the hepatic dark cycle, at a temperature of 20°C ± 2°C, with a and renal tissues compared to the negative control humidity of 50% ± 10%. Animals were fed according to however, the elevation of the GSH content was reported the standard rodent food pellets and drinking water ad in the Jaft treated rats (group III) (Table 2). libitum for the entire test period. The experimental protocol was carried out according to the national guidelines on the proper care and use of animals in laboratory research which was approved by the local ethics committee. Animals were divided into three groups of eight each. Group I served as vehicle treated group, receiving corn oil additionally to their food, while animals in group II received 0.1 ml carbendazim (98.3% pure) (50mg/ kg in corn oil) orally for nine days. Rats in group III 3_2015_draft received Jaft (500 mg/ kg by oral route + carbendazim for 9 days. All the animals in all groups were fasted overnight

and scarified [2]. Fig. 1 Theiss effects of Jaft extract on serum alanine Blood samples were obtained by heart puncture aminotransferase (ALT )enzyme activity in Carbendazim under light ether anesthesia in order to determine the induced biochemical changes in male Wistar rats aspartate aminotransferase (AST), alanine aminotransferase (ALT), alkaline phosphatase (ALP), blood urea nitrogen (BUN) and creatinine by using the (I): Negative control received corn oil; (II): received auto-analyzer in serum. The serum was centrifuged at carbendazim 50 mg/ kg for 9 days; (III): received 3000 g for 10 min. Kidneys and livers were isolated from carbendazim 50 mg/ kg + Jaft extract 500 mg/ kg treated each rat and prepared for tissues homogenization of for 9 days. biochemical parameters such as MDA and GSH levels. aStatistically significant difference versus negative group The MDA level was determined based on the (P < 0. 01). Values are mean ± SD from 8 rats in each thiobarbituric acid [8]. GSH content was8_special estimated by group dithionitrobenzoic acid method described by Ellman [9].

Statistical analysis The statistical analysis was carried out by using the one-way analysis of variance (ANOVA). The values are expressed as mean ± standard Deviation (SD). A value of p <0.05 and p <0.05 was considered statistically significant.

Results

The serum activities of AST, (ALT) and ALP Fig. 2 The effects of Jaft extract on serum aspartate were significantly elevated by in carbendazim treatment aminotransferase (AST) enzyme activity in Carbendazim (group II) compared to the negative group (p<0.01). The induced biochemical changes in male Wistar rats JML_Volumeliver enzyme activities were significantly reduced in rats (p<0.05) when Jaft was received in a short time (group III) (Fig. 1-3). (I): Negative control received corn oil; (II): received Blood urea nitrogen (BUN) and creatinine were carbendazim 50 mg/ kg for 9 days; (III): received significantly (p<0.05) elevated due to carbendazim carbendazim 50 mg/ kg + Jaft extract 500 mg/ kg treated treatment (group II) while their levels in group III were

97 Journal of Medicine and Life Vol. 8, Special Issue 3, 2015

for 9 days. Values are mean ± SD from 8 rats in each cStatistically significant difference versus negative group group. (P < 0. 05). aStatistically significant difference versus negative group (P < 0. 01). bStatistically significant difference versus Carbendazim group (P < 0. 05).

Fig. 5 The effects of Jaft extract on serum creatinine in Carbendazim induced biochemical changes in male Wistar rats

(I): Negative control received corn oil; (II): received Fig. 3 The effects of Jaft extract on serum alkaline carbendazim 50 mg/ kg for 9 days; (III): received phosphatase (ALP) enzyme activity in Carbendazim carbendazim 50 mg/ kg + Jaft extract 500 mg/ kg treated induced biochemical changes in male Wistar rats for 9 days. Values are mean ± SD from 8 rats in each group 3_2015_draft

cStatistically significant difference versus negative group (I): Negative control received corn oil; (II): received (P < 0. 05). carbendazim 50 mg/ kg for 9 days; (III): received

carbendazim 50 mg/ kg + Jaft extract 500 mg/ kg treated iss Table 1.The effects of Jaft extract on hepatic MDA and GSH for 9 days. Values are mean ± SD from 8 rats in each contents in Carbendazim induced biochemical changes in male group. Wistar rats a Statistically significant difference versus negative group MDA(nmol/ g GSH (nmol/ g Groups (P < 0. 01). tissue tissue bStatistically significant difference versus Carbendazim Negative group (P < 0. 05). 61 ± 12.4 9.14 ± 1 control Carbendazim 105 ± 11.6 6.12 ± 0.57 group Jaft group 88 ± 13b 7.4 ± 0.49 b 8_specialJaft: internal layer of oak fruits, MDA: Malondialdehyde, GSH: reduced glutathione. Values are mean ± SD from 8 rats in each group aStatistically significant difference versus negative group (P < 0.001). bStatistically significant difference versus group Carbendazim (P < 0.05).

Table 2.The effects of Jaft extract on renal MDA and GSH contents in Carbendazim induced biochemical changes in male Wistar rats MDA(nmol/ g GSH (nmol/ g Fig. 4 The effects of Jaft extract on serum blood urea Groups nitrogen in Carbendazim induced biochemical changes in tissue tissue male Wistar rats Negative 61 ± 8.9 9.12 ± 1.1 control Carbendazim JML_Volume 98 ± 7.7 a 5.4 ± 0.44a (I): Negative control received corn oil; (II): received group carbendazim 50 mg/ kg for 9 days; (III): received Jaft group 76 ± 9.1b 7.2 ± 0.49b carbendazim 50 mg/ kg + Jaft extract 500 mg/ kg treated Jaft: internal layer of oak fruits, MDA: Malondialdehyde, for 9 days. Values are mean ± SD from 8 rats in each GSH: reduced glutathione. Values are mean ± SD from 8 group rats in each group

98 Journal of Medicine and Life Vol. 8, Special Issue 3, 2015

aStatistically significant difference versus negative group The increase in lipid peroxidation indicates the (P < 0.001). production of oxidative stress, which is an imbalance bStatistically significant difference versus group between the production of free radicals and the body Carbendazim (P < 0.05). defense system [12]. In the present study, lipid peroxidation levels were significantly lower in the Jaft extract treated groups compared to negative control, thus, Discussion the Jaft extract may exert antioxidant activities and protect the tissues from lipid peroxidation. Antioxidant activity of In the present research, a significant increase in Jaft was reported in our laboratory. ALT, AST and ALP activities in Carbendazim exposure The oxidative damage of carbendazim on blood (group II) were reported and this finding was similar with was indicated in our study by the higher levels of MDA; a the results of many researchers [2]. product of lipid peroxidation, together with lower content Elevation of liver enzyme markers suggested of GSH activity in blood treated with carbendazim early signs of hepatocytes injuries due to carbendazim compared to normal control. exposure. GSH is the most important non-protein sulfhydryl In the current study, a significant increase in antioxidant in the cell. In the estimation of oxidative BUN and creatinine concentration was reported due to the stress, glutathione concentration (GSH) is a good marker disturbance in renal function (p >0.05). Similarly, [13]. Similar to the current study, blood GSH Selmanoglu et al. [2] observed increased levels of concentration was significantly decreased which could be creatinine, cholesterol, and albumin in male rats treated due to an increased utilization by Glutathione peroxidase with carbendazim. [14]. Generally, the increase in creatinine content Glutathione is a tripeptide, which is concentrated occurs with renal failure. The concomitant administration in erythrocytes. Glutathione3_2015_draft has different functions of the Jaft extract was successful in reversing the including the regulation of the cell cycle and gene elevated levels of ALT, AST, ALP, BUN and creatinine, expression and play a part in xenobiotics and but the more efficacy might be possible with continued eicosanoides metabolism [15]. The increase in lipid Jaft extract treatment [2]. iss peroxidation in carbendazim treated rats, beside the The administration of carbendazim caused an decrease in GSH concentration is suggestive of oxidative elevation in lipid peroxidation content in blood which could stress. This finding is parallel to many researchers [2]. be attributed to the generation of free radicals. The Banks and Soliman showed that benomyl significantly present findings match with the results of Eun Young and increases the lipid peroxidation and reduced blood GSH Ju-chan, Muthuviveganandavel et al., Saber et al., Saber in rats. and Somaya, who reported that carbendazim induced hepatotoxicity [2]. According to Sakret al. [10], mancozeb fungicide Conclusions in albino rats caused a significant decrease in the tissue superoxide dismutase as an antioxidant enzyme and an In the current work, the increase of reduced GSH increase in lipid peroxidation. The excessive8_special peroxidation activity was reported in the Jaft treated rats. It could be of membrane lipids disrupts the bilayer arrangement, that Jaft can diminish free radical and lipid peroxidation decreases membrane fluidity, increases membrane damages and improved the capacity of antioxidant permeability, and modifies membrane bound proteins enzymes. [11].

References

1. Muthuviveganandavel V, Hoh W, 3. Can A, Albertini DF. Stage specific of germ cells and occlusion of efferent Muthuraman P. Effect of cypermethrin, effects of carbendazim (MBC) on meiotic ductules. Funda Appl Toxicol. 1991; carbendazim and their combination on cell cycle progression in mouse oocyte. 17:733–745. male albino rat serum. Int. J. Exp. Path. Mol Reprod Dev. 1997; 46:351–362. 6. Dreisbach RH. Handbook of poisoning 2012; 93,361–369. 4. Barlas N, Selmanoglu G, Songur S et prevention, diagnosis and treatment, 12th 2. Prakash N, Waghe P, Lokesh LV, al. Biochemical and histopathological edn., 1983, Los Altos, CA: Lange Medical, JML_VolumePavithra BH, Ashok P, Girish MH. effect of carbendazim to rat male 183, 137. Curcumin Ameliorate Carbendazim reproduction. Pesti. 2002; 17:59-71. 7. Barlas N et al. The effects of Induced Toxicopathological Changes In 5. Hess RA, Moore B, Forrer Linder RE et carbendazim in rat thyroid, parathyroid Male Wistar Rats. International Journal of al. The fungicide benomyl [methyl l- and adernal glands and their hormones. Pharmacology & Toxicology Science. (butylcarbomyl)-2-benzimidazole Experimental toxicology. 2002; 21:217- 2013; 3(1): 22-31. carbamate] causes testicular 221. dysfunction by inducing the sloughing

99 Journal of Medicine and Life Vol. 8, Special Issue 3, 2015

8. Ohkawa H, Ohishi N, Yagi K. Assay for 11. Halliwell B, Gutteridge JMC. Free 14. Beutler E. Nutritional and metabolic lipid peroxides in animal tissues Radicals in Biology and Medicine, 2nd aspects of glutathione. Annu Rev Nutr. bythiobarbituric acid reaction. Anal edn., 1989, Clarendon Press, Oxford. 1989; 9:287-302. Biochem. 1979; 95:351–358. 12. Abdollahi M, Ranjbar A, Shahin S et al. 15. Bergelson S, Pinckus R, Daniel V. 9. Ellman G.Tissuesulphydryl groups. Arch Pesticides and oxidative stress: a review. Intracellular glutathione regulates fos/ jun Biochem Biophys. 1959; 82:70–77. Med SciMonit. 2004; 10:141-147. induction and activation of glutathione-S- 10. Sakr SA. Ameliorative effect of ginger 13. Asensi M, Satre J, Pallardo FV et al. transferase gene expression. Cancer Res. (Zingiberofficinale) on mancozeb fungicide Ratio of reduced to oxidized glutathione 1994; 54:36-40. induced liver injury in Albino Rats. as indicator of oxidative stress status and Australian J Basic ApplSci. 2007; 14:650- DNA damage. Methods in Enzymol. 1999; 656. 299:267-276.

3_2015_draft

iss

8_special

JML_Volume

100 Journal of Medicine and Life Vol. 8, Special Issue 3, 2015, pp.101-106

The effect of aerobic exercise and electrical stimulation on weight loss and reduction of body fat

Sekhavati E*, Nikseresht A**, Najafian M**, Taheri S** *Larestan School of Medical Sciences, Larestan, Iran, **Islamic Azad University, Jahrom Branch, Iran

Correspondence to: Sakineh Taheri, MA student in the field of Sport Physiology, Islamic Azad University, Jahrom branch, Iran, Mehr Physiotherapy Center, Amine Medicine Bldg, across Imam Khomeini Blvd, New Town, Larestan, Iran, Phone: +989171836320, E-mail: [email protected]

Received: March 14th, 2015 – Accepted: June 18th, 2015

Abstract Goals: Study and comparison between the effects of walking and the electrical stimulation on weight loss and reduction of body fat. Methodology: The samples were elected among the volunteer healthy females (20-40 years) with an index rate (20 ≤ BMI ≤ 30) provided that they had no regular active exercise activity and they were classified randomly into two groups in this quasi- experimental research. The electrical stimulation was used for one group in 4 sessions per week for 8 weeks and the period of 40-60 min per session on abdominal muscles. The plan of the group with aerobic exercise included 40-60 min walking with an intensity of the stored heart rate (50-70%) within the similar period. The parameters of BMI, rate of body fact, and LBM were measured at the beginning and at end of study on weight. The given data were analyzed by means of t- independent3_2015_draft and correlation t-test at level (p≤ 0.05). The parameters of BMI, rate of body fact, and LBM were measured at the beginning and end of study on weight. Findings: Weight, Body Mass Index (BMI), and body fat percentage were significantly reduced and also the LBM parameter was increased in both groups. iss Conclusion: Walking and electrical stimulation similarly caused to decrease in weight, BMI, body fat percentage, and increase in lean body mass index (LBM).

Keywords: electrical stimulation, walking, Body Mass Index (BMI), body fat

Introduction decades [17]. Pishdad (1996) reported a higher rate of prevalence of obesity and especially overweight and a Today, obesity is one of the most epidemic lesser level of physical activity in Iranian males. Similarly, health problems in the world and its incidence is going to Azadbakht et al. (2005) mentioned the rate of prevalence increase [5,15]. The recent findings8_special signify that of public obesity as 29% in 4’164 males in Tehran city. inappropriate lifestyle and lesser daily activity cause an It has been known until today that obesity is an increase in the prevalence of obesity and particularly the independent risk factor in chronic diseases and may abdominal fatness [24]. increase the risk of premature mortality [12,14] so that the According to a report of the World Health risk of reduced lifetime in obese people is 40% higher Organization (WHO) in 2005, about 1.6 milliard adults than of the other persons and this rate reaches to 70% in were overweight and it was anticipated that by 2015 this a person with excessive obesity [9]. At the same time, it population were 2.3 milliard peoples with overweight and was characterized that the rising risk of suffering from 700 million obese persons [22]. regenerative and chronic diseases is accompanied by Likewise, based on another report, more than obesity so that the diseases of hypertension, blood fat, 60% of males and 50% of females in the world, except for arthrosclerosis of walls in coronary vessels, arthritis, and South and East Asia, were overweight and fat. This also joints contractures and obstructive pulmonary frequency rate was estimated about obesity with a rate of diseases are directly related to obesity, and the obese 30 ≤ BM of 7% in eastern Asia and up to 36% in Canada people suffer from various deficiencies in metabolism of for both female and male genders, and also 38-40% of carbohydrates and they gradually suffer from diabetes JML_Volumefemales in Central Asia, North Africa, and South Africa type-II [18,27]. [13]. While the fat may be accumulated in any point of Epidemics of obesity in Developing Countries body, the related risks depend on the region in which the like Iran have been also accompanied by a growing trend fat has been accumulated [25], so that according to the due to the rising level of welfare for people in two recent viewpoint of researchers, the over-storing of fat in the abdominal point may threaten the health and importance Journal of Medicine and Life Vol. 8, Special Issue 3, 2015

of the study in this subject being revealed, when we know exercise on the reduction of abdominal fat was examined that abdominal obesity is much more risky than the and their impacts were compared to each other. Given accumulation of lipids in the other points of the body; this fact, the effect of aerobic exercise and electrical there is a close relationship among the rate of abdominal stimulation on reduced body fat has been separately fat and the various diseases and it is followed by studied in the previous investigations; therefore, the premature mortality [12,14-16,19,26]. present research has been conducted in order to compare The existing significant relationship among the the effect of these two methods on the reduction of rate of waist circumference and cardiovascular risk factors abdominal fat. and diabetes suggests the fact that the obesity in the central part of body (abdomen) is assumed as an independent risk factor in cardiovascular diseases Materials and methods [3,5,8,10]. Thus, recently, the central obesity has been utilized as an important predictor for the risk of suffering The research population in this investigation from cardiovascular diseases [13]. consisted of 60 qualified volunteers, who have The epidemics of abdominal obesity have been participated in this investigation. The invitation notice was in turn noticeable during recent years so that the rate of published in Milad (Birth) Weekly in Lar Town to abdominal obesity has been reported to be of 29% in participate in this research. The qualifications for entering males and 48% among females. Nonetheless, this this study included age (20-40 years), rate 20≤BMI≤30, statistical rate among Caucasian people is of 56% and lack of any certain disease like cardiovascular, diabetes, 71% for males and females, respectively [13]. thyroid hypo- and hyperactivity diseases, metabolic and Therefore, the scientists have employed several hormonal disorders, not using certain drugs, lack of methods in their pursuit to find an appropriate technique certain nutrient diet, not smoking, lack of regular to reduce fat and particularly abdominal lipid in this field exercises during the past3_2015_draft 6 months, without a history of including massage, low-calories diet, drug and hormonal pregnancy more than two times and also premature methods, slimming belts, acupuncture, and liposuction childbirth before 6 months. The condition for the exclusion surgery, etc., where each of them have been followed by from this test isswas the absence in one exercise session as side effects and or they were not cost-effective [3]. Hence, well as the lack of their interest in resuming the finding a simple, cheap, and secure method to reduce participation in the test. body fat has been and is an ideal for many researchers. 60 participants enrolled in this test by receiving Sport activities and exercises are deemed as this invitation notice so the height and weight of all of one of the paramount techniques [21], which have been them were measured and their BMI was calculated. 45 drawn attention to by many researchers. participants with the BMI rate (20-30) were chosen and However, the type of exercise and the intensity the rest 15 persons were excluded because of a higher may make us achieve this goal, which has made the rate of BMI. A briefing session was held for the elected researcher examine various dimensions of the exercise participants and all these persons were informed about and their effect on the reduction of fat, especially body fat. the research goals and conditions. 5 persons have It seems that the endurance8_special and aerobic declared their rejection regarding the participation in this exercises can achieve a better position than the other study after being aware of the research conditions and the exercises in this regard. rest 40 participants were randomly classified into two The endurance exercise increase the maximum Electrical Stimulation Group (ESG) and Aerobic Group consumed oxygen (Vol. 2 Max) and also improve the AG (20 members per group). During the execution of the capability of skeletal muscles to produce energy via the test, 2 persons from the ESG group and 1 person from aerobic system [1]. The endurance exercises also reduce the AG group were excluded from this test because of weight and increase the aerobic potential [2]. their absence in these sessions. Today, the Neural-Muscular Electric Stimulation (NMES) is also proposed as another effective technique Measurement tools to reduce the lipid volume (skin fold) especially in the OMRON standard scale (Germany made) with topical form, to the extent that the body fitness institutes the accuracy rate of 0.1 kg per a kilogram was utilized to have tried to utilize electrical currents as a model for the measure weight and it was calibrated with one-kilogram quick building of body fitness and the creation of an weight after every 10-time weighting. The subcutaneous appropriate style without benefitting from an active lipoma (fat) was measured by skin-fold calipers (Ponderal JML_Volumeexercise plan for the persons who lack the adequate time Model, Germany made). Crino reported the iteration and for doing exercise plans [23]. evaluation of the fat skin-fold in several points of the body In the present study, which was carried out on as 0.95 by this device and its measurement error being of healthy females of an age range (20-40 years), the effect 0.8-1 mm. The subcutaneous lipoma was measured by of two methods of electrical stimulation and aerobic skin-fold calipers (Ponderal Model, Germany made) in

102 Journal of Medicine and Life Vol. 8, Special Issue 3, 2015

standing mode in 7 points of the body of participants The 6-channel Beautistim Stimulator (680B including one inch distant from the right side of the navel model, Isfahan Novin Medical Engineering Company) was (umbilical cord) vertically, in the point of the ilium crest, a used to test the electrical stimulation group, which was little forward and above it obliquely, the midpoint between calibrated by one of the medical engineers in Lar town the patella and the skin-fold of groin vertically, the sub every week. To reduce the strength of the skin-fold, the scapular area obliquely, just under the lower angle of the given area was cleaned with alcohol and cotton gauze shoulder with an angle of 45° with respect to the before employing the electrical current [22]. horizontal axis toward the central line, behind the arm, vertically, at the midpoint between the bone prominence Findings (acromion) and the elbow lump under the condition that The information of the collected data was shown the hand is placed open and easily beside the body, the in 3 tables after the statistical analysis and in order to thoracic area (chest) obliquely in a point at a distance of express the research findings and the acquisition of its one-third of the line in the anterior armpit and tip of chest objectives. and in the armpit area, vertically, on the middle line of the Primarily, normality of data distribution was armpit, at the level of the chest tip. The measurement was analyzed by means of Kolmogorov-Smirnov test and after started from the right side of body after marking the given the confirmation of the equality of variances and normality area with a black magic pen, this being done twice for a of data; the parametric techniques were adapted for data higher accuracy and if there was more than one-millimeter analysis. To describe data, parameters of mean and difference among the two measurements, so, the standard deviation and pairwise t-test were used for measurement was done for the third time and the mean of intergroup comparison and an independent t-test was the two closer sizes was recorded as subcutaneous lipoma index. The fat measurement test was not done employed to compare the3_2015_draft mean of parameters in the two twice immediately so that the skin-fold did not exit its groups. natural mode. The demographic attributes of participants are Also height was measured by means of Seca shown in Table 1. Both groups were compared with each height scale with 1-mm precision rate that was affected by other in termsiss of parameters like age, weight, BMI, fat the minimum ambient impacts. Therefore, it can be percentage, and fat-free body mass and the homogeneity implied that this tool could enjoy the needed reliability. of the two groups was confirmed by Kolmogorov-Smirnov In order to measure BMI, the weight (Kg) to test. square height (m) ratio formula was employed [7]. As it observed in Table 1, there was no Jackson-Pollock formula was used to compute significant difference in the two tested groups in terms of fat percentage and fat-free body mass and initially the age, weight, BMI, fat percentage, and fat-free body mass skin-fold of subcutaneous lipoma was estimated in 7 (p≥0.001), so, this indicates a normal distribution of data points of the body and at the second step density in both groups and their homogeneity. (concentration) of body of the given participant it was calculated and the finally fat percentage 8_specialwas acquired. The values of weight, BMI, fat percentage, fat- To control the intensity of exercise during free body mass before and after testing the two groups is walking, the radial heart rate of the person was personally shown in Table 2. With respect to data in the table, it was measured and the heat rate monitor (Polar Electro model, seen that the studied indices including weight, BMI, and Finland) was also utilized for this purpose and the body fat percentage in both groups were significantly Karvenon formula was used to estimate the intensity of reduced (p≤0.001) and the percentage of the fat-free aerobic exercises. body mass was significantly increased in both groups (p≤0.001).

Table 1. Mean and standard deviation of indices before testing in the studied groups Attribute Studied group Significance Electrical stimulation Walking level (18 participants) (19 participants) Mean ± standard deviation Mean ± standard deviation Age (years) 29.5 ± 4.53 30.26 ± 5.37 0.258 JML_VolumeWeight (kilograms) 64.72 ± 7.13 65.95 ± 8.18 0.870 Mass Body Index (kg/ m²) 26.11 ± 2.66 26.14 ± 2.18 0.241 Body fat (percent) 38.11 ± 3.66 38.03 ± 3.35 0.882 * It is significant at level (p≤0.001); ** It is significant at level (p≤0.05)

Table 2. Values of the studied variables before and after test in both groups 103 Journal of Medicine and Life Vol. 8, Special Issue 3, 2015

Variable Group Time Mean ± Mean Degree of T-value Significance standard difference freedom level deviation Weight (kg) Electrical Before 64.72 ± 7.13 1.15 17 5.30 0.000 * stimulation After 73.57 ± 6.86 Walking Before 65.95 ± 8.18 1.62 18 4.26 0.000 * After 64.33 ± 7.37 Body mass Electrical Before 26.11 ± 2.66 0.56 17 6.42 0.000 * index (kg/ stimulation After 25.54 ± 2.61 m²) Walking Before 26.14 ± 2.18 0.71 18 4.83 0.000 * After 42.25 ± 2.01 Body fat (%) Electrical Before 38.11 ± 3.66 7.28 17 14.20 0.000 * stimulation After 30.82 ± 3.71 Walking Before 38.03 ± 3.35 7.33 18 14.14 0.000 * After 30.70 ± 3.48 Fat-free Electrical Before 39.95 ± 4.08 3.87 17 12.05 0.000 * body mass stimulation After 43.83 ± 3.83 (%) Walking Before 40.75 ± 4.40 -2.64 18 -2.24 0.037 ** After 43.40 ± 5.30 * It is significant at level (p≤0.001); ** It is significant at level (p≤0.05)

Table 3. Comparison of variables between two groups of electrical stimulation and aerobic exercise Variable Group Mean ± standard Degree of T-value Significance deviation freedom 3_2015_draftlevel Weight (kg) Electrical stimulation 63.57 ± 6.86 35 -.0324 0.807

Walking 64.33 ± 7.37 34.99 -0.324 Body mass index Electrical stimulation 25.54 ± 2.62 iss35 0.154 0.155 (kg/ m²) Walking 25.42 ± 2.01 31.86 0.153 Body fat (%) Electrical stimulation 30.82 ± 3.71 35 0.108 0.847

Walking 30.70 ± 3.48 34.50 0.108 Fat-free body Electrical stimulation 43.83 ± 3.83 35 0.283 0.177 mass (%) Walking 43.40 ± 5.30 32.76 0.286

The values of weight, BMI, fat8_special percentage, and findings from studies of Damirchi (2008), Porkari (2002), percentage of fat free body mass after the test in both and Porkari (2004). It seems that the reason for such a groups are shown in Table 3. With respect to the above consistency was due to age, gender, body mass, type and table, it was seen that after conducting this study, there intensity of stimulation plan, while the reason for the was no significant difference among the values of these misalignment with the aforesaid studies can probably indices between the two tested groups (p≥0.001). refer to the type of the electrical stimulation device, period of stimulation, methodology, and the age of the tested persons and particularly the mice were used as tested Discussion persons in the survey of Damirchi. In 1948, Hawkins declared for the first time that The results of the independent t-test indicated the electric stimulation of the abdomen increases calories that the weight of the tested persons in both groups was with a repeated regulation of a natural weight control significantly reduced after 8 weeks of walking and the center, stimulation of A and A fibers, effect on obesity electrical stimulation in abdominal area of their bodies α β rate and as a result a rising of metabolism of the given (p≤0.001). In fact, the mean weight has been reduced in tissue [5]. the groups of walking and the electrical stimulation from Aerobic exercise also affects the body weight JML_Volume65.95 ± 8.18 and 64.72 ± 7.13 to 64.33 ± 7.37 and 63.57 loss due to the increase in the energy provided by ± 6.86 respectively. In other words, 1.62 kg and 1.15 kg lipolysis [20]. reduction of weights were seen respectively in walking The statistical analysis showed that BMI was significantly and electrical stimulation groups. The results of this study reduced after 8 weeks of walking and 8 weeks of were consistent with the findings of investigation done by electrical stimulation of the abdomen (p≤0.001). Namely, Hayati (2011) while they were not aligned with the 104 Journal of Medicine and Life Vol. 8, Special Issue 3, 2015

both walking and the electrical stimulation may reduce transferring blood to the given area. This trend resulted in BMI. The independent T-test was employed to an improvement of the muscular mass. Doing aerobic determine the significant difference among the two groups exercises increases the consumption of lipids as a fuel in which the results showed that there was no significant during exercises. The low- and average intensity aerobic difference among both groups (p = 0.155). exercises cause a further consuming of lipids as the The results of this study were consistent with the energy source and this will cause a reduction of body fat results of investigations of Habibzadeh (2010) and Miatic per se [4]. Horton and Bravan (2001) declared that our (2002), while they were not aligned with the findings of body needs to be permanently active all over the period of Porkari (2002) and Porkari (2004), who claimed that the exercise in order to burn calories and walking is a electrical stimulation in the abdominal region did not affect continuous and gradual activity that efficiently causes the BMI. Probably the type of stimulator device, age of the lipids burning [11]. tested persons, period of stimulation, and way of Likewise, the estrogen hormone in females execution of test may be assumed as reasons for such a increases the speed of lipid metabolism in women, difference. especially during the aerobic exercises with a rising of The reason for the reduction of BMI may be blood stream circulation in the adipose tissue. As a result, justified this way; both the aerobic exercise and the the mutual effect of epinephrine and Estrogen Receptor β electrical stimulation caused a weight loss in this (ER-β) increases the rate of transferring free fatty acids research. from adipose tissue to active muscles in adipose tissue, Thus, with respect to the formula for calculation being improved during exercises [6]. of BMI (BMI = Weight/ Square height), as BMI is decreased, the weight will also be reduced. Body fat percentage was significantly reduced in Conclusion the present research (p≤0.001). The results of this study 3_2015_draft The results of the present research showed that were consistent with the findings from the studies of walking with the intensity of a stored heart rate (50-70%) Habibzadeh (2010), Miatic (2002), Nikpoor (2008), and might significantly cause weight loss and it could be Damirchi (2008) while they were not aligned with the utilized as aniss efficient, secure, and cheap strategy in results of the survey by Park (2003). The selected BMI, reducing body fat and in preventing obesity. Similarly, with type of executed exercise and intensity and period of respect to this important point, there is a social class of exercise were probably considered the reasons for the people in the community composed of old persons and inconsistency with the previously mentioned study. the society of disabled and patients with osteal traumas The electrical stimulation of the muscles in the and lesions, that they cannot walk and they seek to find a abdominal area might probably lead to the consumption of method to reduce body fat, thus the electrical stimulation the additional calories and the reduction of fat percentage in the abdominal area can be employed to achieve this by passive exercise. objective. Vermiform contractions and muscular

longitudinal contractions caused by the use of electrical Acknowledgements stimulation led to the contraction of muscles and We hereby express our gratitude to the displacement of intercellular fluid and they8_special contribute to respected personnel in Mehr Physiotherapy Center at the omission of metabolites. Therefore, the better Larestan Town as well as the honored principal of Al- conditions were prepared for the omission of metabolites Zahra Primary School of Lar town and all the dear friends, by the opening of the capillaries, which were at relaxation who assisted us in implementing this study. and closed status and this trend led to the improvement of

References

1. Arazi H, Ghahremani Moghadam M, 3. Damirchi A, Mehrabani J. Prevalence of topical skin-fold of abdomen in healthy Mohammadi M. Comparison between two obesity, overweight, and hypertension and female adults. Kumesh. 2011; 12, 4. method of parallel exercises (continuous and the relevant risks with them in male adults. 6. Damirchi A, Babaei P, Mehdizadeh R. The discrete) in body composition, aerobic Quarterly of Olympic. 2009; 3 (47), 87-103. effect of aerobic exercise on weight of potential, and muscular endurance of non- 4. Habibzadeh N, Rahmaninia F, Roshan H. visceral lipid in ovariectomized desert mice. athlete male students. Journal of Sport The analysis of walking sport on rate body fat Quarterly of Olympic. 2009; 17,41-47. JML_VolumePhysiology and Physical Exercise. 2010; 5, and serum insulin in obese girls. Scientific- 7. Sharifi GH, Yazdani F, Shokravi M. Field 373- 380. Research Journal of Zanjan University of and laboratory experiments in sport 2. Eftekhari A, Nikbakht H, Etemadifar M, Medical Sciences. 2010; 18, 73:18-25. physiology. Isfahan, Research Deputy of Rabiyee K. The effect of endurance exercise 5. Hayati M, Khalkhali M, Mohammadi Panah Islamic Azad University Khorasgan Branch, on power. 2008. T. The study of electrical stimulation effect on 1st Ed., 2007.

105 Journal of Medicine and Life Vol. 8, Special Issue 3, 2015

8. Sadeghi M, Sanei H, Hekmatnia A, diabetes mellitus in 168,000 primary care Resistance Exercise Training on Abdominal Tavakoli B, Beshtam M, Kharak M, patients in 63 countries. 2007; 116:1942- Fat in Obese Middle-aged Women. J Sarrafizadegan N. Analysis on relationship 1951. Physiol Anthropol. 2003; 22 (3):129–135. among lipid distribution in abdominal CT- 14. Coker RH. Influence Of Exercise Intensity 21. Maeng-Kyu Kim MK, Tomita T, Kim MJ, Scan with some of physical and biochemical On Abdominal Fat and Adiponectin in Sasai H, Seiji Maeda S, Tanaka K. Aerobic factors in patients with cardiac ischemia: Elderly Adults. J. Metabolic Syndrome and exercise training reduces epicardial fat in GAAMI Study. Journal of Isfahan University Related Disorder. 2009; 7:363–368. obese men. J Appl Physiol. 2009; 106,5-11. of Medical Sciences. 2010; 124,194-195. 15. Despres JP, Moorjani S, Lupien PJ, 22. Novin Department, 1391, beautistim 680B 9. Farajzadeh Mavaloo SH. Appropriate Tremblay A, Nadeau A, Bouchard C. operating instruction. method for estimation of favorable weight. Regional distribution of body fat, plasma 23. Pishdad GR. Overweight and obesity in Quarterly of Medicine in Sport. 2011; 2,25- lipoproteins, and cardiovascular disease. adults aged 20-47 in Sothern Iran. Int J 31. Arteriosclerosis, Thrombosis, and Vascular Obes Relat Metab Disord. 1996; 20:963– 10. Gharakhanloo R, Gaeini A, Peighoon Biology. 1990. 965. Abdullah N. Standards of waist to pelvic 16. Ferland M, Despres JP, Tremblay A, 24. Porcari JP, Miller J, Cornwell K, Foster circumferences in males older than age 40 Pinault S, Nadeau A, Moorjani S, Lupien C, Gibson M, McLean K, Kernozek T. The at Ahwaz city and their relationship with PJ, Thériault G, Bouchard C. Assessment effects of neuromuscular stimulation training cardiovascular and diabetes risk factors. of adipose tissue distribution by computed on abdominal strength, endurance and Quarterly of Olympic. 2002; 22,59-72. axial tomography in obese women: selected anthropometric measure. Journal 11. Nikpoor S, Vahidi SH, Hedayati M, association with body density and of Sports Science and Medicine. 2005; Haghani H, Agha Alinejad H, Barimnejad anthropometric measurements. British 4:66–75. L, Soodmand B. The impact of regular Journal Nutrition. 1989; 61(2):139-48. 25. Ryun Kwon H, Kyung Wan M, Hee Jung endurance exercise on abdominal obesity 17. Hajian-Tilaki KO, Heidari B. Prevalence of A, Hee Geum S, Bo Kyung K, Ho Chul K, indices in the female employees at Iran obesity, central obesity and the associated Kyung Ah H. Effects of Aerobic Exercise on University of Medical Sciences. Journal of factors in urban population aged 20-70 Abdominal Fat, Thigh Muscle Mass and Endocrinal Glands and Metabolism of Iran. years, in the north of Iran a population- Muscle Strength in Type 2 Diabetic Subject. 2008; 2,177-183. based study and regression approach. Korean Diabetes J. 2010; 34:23-31. 12. Azadbakht L, Mirmiran P, Shiva N, Azizi Obes Rev. 2007; 8(1):3–10. 26. Ward AR, Shkuratova N. Russian F. General obesity and central adiposity in 18. Hideaki B. Role of Body Weight Reduction electrical3_2015_draft stimulation: The early representative sample of Tehranian adults: in Obesity-Associated Co-Morbidities. experiments. Physical therapy. 2002; 82 prevalence and determinants. Int J Vitam JMAJ. 2005; 48(1):47–51. (10):1019–30. Nutr Res. 2005; 75: 297–304. 19. Kurachi H, Takahashi K, Akiko ABE, 27. Kraus WE, Slentz CA. Obesity, Exercise 13. Balkua B, Deanfield JE, Despre’s JP, Ohmichi M. Women and Obesity. JMAJ.iss Training, Lipid Regulation, and Insulin Bassand JP, Fox KA, Smith SC Jr. 2005; 48(1):42–46. Action. 2009; 17, Supplement 3. International Day for the Evaluation of 20. Kab Park S, Hyun Park J, Chan Kwon Y, Abdominal Obesity (IDEA): a study of waist Sung Kim H, Suk Yoon M, Tae Park H. circumference, cardiovascular disease, and The Effect of Combined Aerobic and

8_special

JML_Volume

106 Journal of Medicine and Life Vol. 8, Special Issue 3, 2015, pp.107-112

Importance of client orientation domains in non-clinical quality of care: A household survey in high and low-income districts of Mashhad

Fazaeli S*, Yousefi M** ***, Banikazemi SH***, Ghazizadeh Hashemi SAH*** , Khorsand A****, Badiee Sh**** *Department of Medical Records and Health Information Technology, School of Paramedical Sciences, Mashhad, University of Medical Sciences, Mashhad, Iran, ** Department of Health Economics and Management Sciences, School of Health, Mashhad University of Medical Sciences, Mashhad, Iran, ***Health Strategic Research Center, School of Health, Mashhad University of Medical Sciences, Mashhad, Iran, ****Department of Complementary and Chines Medicine, School of Persian and Complementary Medicine, Mashhad University of Medical Sciences, Mashhad, Iran

Correspondence to: Mehdi Yousefi, PhD, School of Health, Mashhad University of Medical Sciences, Mashhad, Iran, Mashhad, Khorasan Razavi, Iran, Phone: +98 5138544633, Fax: +985138522775 , E-mail: [email protected]

Received: March 14th, 2015 – Accepted: June 18th, 2015

Abstract 3_2015_draft Responsiveness was introduced by WHO as a key indicator to assess the performance of health systems and measures by a common set of domains that are categorized into two main categories “Respect for persons” and “Client orientation”. This study measured the importance of client orientation domains in high and low income districts of Mashhad. In this cross-sectional and explanatory study, a sample of 923 households were selected randomly from twoiss high and low income districts of Mashhad. The World Health Organization (WHO) questionnaire was used for data collection. Standard frequency analyses and Ordinal Logistic Regression (OLR) was employed for data analysis. In general, respondents selected quality of basic amenities as the most important domain and the access to social support networks was identified as the least important domain. Households in high-income areas scored higher domains of prompt attentions and choice compared to low income. There was a significant relationship between variables of ages, having a member who needed care and self-assessed health with the ranking of client orientation domains. The study of the households’ view regarding the ranking of non-clinical aspects of quality of care, especially when faced with limited resources, can help in conducting efforts towards subjects that are more important, and lead to the improvement of the health system performance and productivity.

Keywords: responsiveness, quality of care, client orientation, households

8_special Introduction for all humans, regardless of culture, sex, age and so on. Of course, WHO expressed a serious concern about WHO identified responsiveness as one of the exploring the users’ priorities with respect to different key goals to which health systems contribute in improving aspects of health services [6]. the population health and in facilitating its measurement in Some studies showed that usually there are a systematic way across countries, by developing a divergences in priorities ‘‘between individual patients and common set of domains [1-3], that were categorized into between patients from different cultures and the health two main categories [4]: “Respect for persons” and Client care systems, and individual characteristics such as orientation”. Respect for persons refers to the intent of education, health status, sex and age [7,8]; also some capturing the ethical aspects of the interaction between studies have reported weak associations between individuals and the health system and includes three sub- priorities and individuals (or household) and the socio- elements: dignity, autonomy and confidentiality [4,5]. economic characteristics [9-11]. This difference may lead Client orientation gauges the components of consumer to conflicts and sometimes even lack of satisfaction [6]. satisfaction and includes four sub-elements: prompt Therefore, determining the relative importance of non- JML_Volumeattention, quality of basic amenities, access to social clinical aspects of quality of care among various supports networks (during inpatient care) and choice of subgroups (base on income, culture, etc.), can be useful care providers [3,6]. in providing a correct interpretation of health services WHO claimed that these domains have a users’ needs and help in optimizing the allocation of ‘‘universal’’ importance, meaning that they are important health system resources [12-14]. Despite the importance of this subject, we have a few studies (especially in Iran) Journal of Medicine and Life Vol. 8, Special Issue 3, 2015

in this area compared to other health system subjects  being able to go to another place for [6,11] and the previous studies have generally been done health care if you want to on the concept of measuring patient satisfaction [15-17]. Quality of  having enough space, seating and The main objective of this study was to Basic fresh air in the waiting room determine the relative importance of the sub-elements Amenities  having a clean facility (including related to domain of client orientation of non-clinical clean toilets) aspects of quality of care “responsiveness” among  having healthy and edible food selected districts of Mashhad. Social  being allowed to be provided food Support and other gifts by relatives while in hospital Materials and Methods  being allowed to have freedom of religious practices This cross-sectional and explanatory study was performed in 2014. Households that were resident in low Eligible respondents (18 years or older, and high-income district of Mashhad were the statistical preferably parents) were selected as participants. population of the study [18]. The sample size for each Questioners were trained before the start of data district was calculated through Cochran Sample Size collection in this study, about the study subject, questions, Formula (p=.5 for maximum variability, 95% confidence maintenance of confidentiality of household’s information, level and ±5% precision). Finally, the sample size was of sampling methods and interviewing method. Accordingly, 500 households in every district (totally 1000 at the first contact, the questioner gave some information households). to the participant based on the study guide (included a The multi stage sampling was used for sample description of the study3_2015_draft aims, sponsor and questions, selection. After the determination of classes, each class etc.). The completion of the questioner took between 15 was divided to clusters with similar characteristics (city to 25 minutes. All participants were requested to sign or blocks), each block being the area bounded by four mark (if illiterate)iss an informed consent form. If a streets. Then, the researcher specified the number of household did not tend to participate in the study or was samples of each cluster on a regular basis among the not present at home after three times referring, based on households in the selected districts. the sample selection guideline, it was replaced by a new The instrument used in this study was the WHO household. The five-point Likert scale (extremely questionnaire (included a responsiveness module important, very important, important, fairly important, and containing questions about the “importance of the not at all important from 5 to 1) was applied. Also this responsiveness domains from the people’s view” and study was approved by the Ethics Committee of the demographic characteristics of households). The Mashhad University of Medical Sciences. The standard questionnaire was translated into Persian and its validity frequency analyses were reported for each importance and reliability was confirmed in the study8_special of Rashidian et question by district and, the socio demographically al. [11]. Table 1 provides brief descriptions of the client characteristics of households included: sex, age, orientation elements in the questionnaire [6]. education, health status (self-reported health). Ordinal logistic regression (OLR) was employed to assess the Table 1. Descriptions of sub-elements of client orientation role of the ten variables on the households’ view Sub- Brief Description regarding the importance of the client’s orientation sub elements elements. All the analyses were performed by using of client SPSS 19. orientation Prompt  having a reasonable distance and Attention travel time from your home to the Results health care provider  getting fast care in emergencies A total of 480 householders in low income and short waiting times for appointments  443 householders in high-income districts completed the and consultations, and getting tests done quickly questionnaires. The examination of the demographic data JML_Volume short waiting lists for non- of participants showed that there was at least one person emergency surgery under the age of 12 in about 41% of the households. Choice  being able to choose your doctor or More than 62% of them reported their health conditions as nurse or other person usually good and very good. The extra demographic data are providing your health care presented in Table 2.

108 Journal of Medicine and Life Vol. 8, Special Issue 3, 2015, pp.107-112

Table 2. Percentage of respondents selecting sub elements as very important quality of basic demographic characteristics of the study prompt attention choice social support amenities sample n% z (sig.) n% z (sig.) n% z (sig.) n% z (sig.) low (n=480) 47.6 41.4 60.4 31.6 districts: low/ high -0.736 -2.792 -0.872 -2.741 income (0.462) (0.005) ** (0.383) (0.006) ** high (n=443) 49.4 50.5 58.5 26.4 male (n=448) 48.0 -0.803 47.6 -0.876 56.5 -1.805 29.3 -0.201 Sex female (n=441) 49.5 (0.422) 44.3 (0.381) 62.6 (0.071) 29.1 (0.841) <12 years member yes (n=383) 47.4 45.0 60.4 29.0 -0.079 -0.820 -1.130 -0.680 living in the no (n=535) 49.1 (0.937) 46.1 (0.412) 58.9 (0.258) 29.4 (0.497) household good and very good 47.6 45.0 59.9 30.9 (n=559) 0.455 0.171 0.311 9.958 self-assessed health moderate (n=285) 50.7 46.3 59.2 25.0 (0.797) (0.918) (0.856) (0.007) ** bad and very bad 48.1 53.8 58.0 32.7 (n=53) 65+ years member yes (n=262) 50.6 -0.629 48.9 -1.496 56.7 -1.258 28.7 -0.441 living in the (0.529) (0.135) (0.208) (0.659) household no (n=648) 47.5 44.3 60.5 29.0 member with yes (n=252) 58.1 -2.724 51.4 -1.516 59.4 -0.053 33.6 -1.918 needed care living 3_2015_draft (0.006) ** (0.130) (0.957) (0.055) * in the household no (n=656) 45.3 43.8 59.5 27.7 using the health during past year 50.7 46.8 59.7 29.8 services in the past (n=716) -2.148 -1.188iss -0.256 -2.322 year/ more than one (0.032) * (0.235) (0.798) (0.020) * more than one year year before 41.5 42.4 59.9 26.6 before (n=179) have (n=558) 50.5 -0.285 45.0 -2.053 60.7 -0.103 30.8 -1.317 Insurance do not have (n=289) 49.8 (0.775) 49.8 (0.040) * 61.1 (0.918) 25.9 (0.188) 0-6 (n=80) 42.9 35.9 46.2 34.6 1.908 3.887 8.301 19.197 literacy (years) 6-11 (n=494) 48.3 44.9 60.8 33.2 (0.385) (0.143) (0.016)* (0.000)** 12 < (n=323) 51.9 50.2 63.1 22.4 **Correlation is significant at the 0.01 level (2-tailed). *Correlation is significant at the 0.05 level (2-tailed).

The findings showed that participants8_special identified past year/ more than one year before (P-Value ≤ 0.05) the quality of basic amenities as the most important sub- and having a member who needed care in the household element among different client’s orientation sub-elements (P-Value ≤ 0.01). As shown in Table 1, the quality of and after that prompt attention, choice, and social support amenities was significantly related to the literacy of have the most importance respectively. responders (P-Value ≤ 0.01). Also, the score of From Table 1 we can see a significant relation importance of choice of the provider was significantly between districts, literacy, and self-assessed health with different between the two districts (P-Value ≤ 0.01) and the importance of social support (P-Value ≤ 0.01). In also between the households with and without insurance addition, there was a statistically significant difference (P-Value ≤ 0.05). between important scores in social support and the use of Table 3 shows which demographic factors affect health services or having a member who needed care in the selecting client orientation sub-elements as very the household (P-Value ≤ 0.05). important. Also significant differences were found in ranking a prompt attention in terms of using health services in the

Table 3. Determinants of selecting client orientation as very important [with 95% confidence intervals], from the Ordinal Logistic JML_VolumeRegression (OLR) 95% Confidence Interval Variables B S.E. Wald Sig. Lower Upper Bound Bound Age (years) 0.009 0.004 6.036 0.014 0.002 0.016 Journal of Medicine and Life Vol. 8, Special Issue 3, 2015

Self-assessed health (very good) -0.172 0.067 6.523 0.011 -0.304 -0.040 Education (year) 0.014 0.013 1.213 0.271 -0.011 0.040 Be in higher levels of income 0.00 0.00 1.56 0.21 0.00 0.00 Higher household size -0.036 0.031 1.302 0.254 -0.097 0.026 High income district settlement -0.003 0.237 0.000 0.991 -0.467 0.462 Female responder -0.122 0.101 1.461 0.227 -0.320 0.076 65 > years members living in the household 0.240 0.114 4.425 0.035 0.016 0.464 12 < years members living in the household 0.047 0.114 0.171 0.679 -0.176 0.270 Members who needed care in the household -0.280 0.117 5.688 0.017 -0.509 -0.050 Model statistics: LR χ2=23.47 (P. value=0.015), Pseudo R-Square=0.044. (Link function: Complementary Log-log.)

Logistic regression analyses showed that age households in high income and those in low-income had a positive effect on the level of importance of the districts. But, in addition to the priorities set and based on client orientation elements. Self-assessed health the results from the WHO’s general population surveys of (mentioned as very good) of responders and having a “health system responsiveness” in 41 countries, which member who need care in the household had a negative was reported in 2008, the most important domain for effect on the level of importance of the client’s orientation Iranian participants was prompt attention (31%) [6]. This sub-elements that were mentioned by the households. result can also be seen in some other studies [6,19,21,22]. Findings of this3_2015_draft study were consistent with the Discussion previous studies in Iran and were different from the studies outside Iran in setting the priorities. This Responsiveness expresses respect for human difference may be explained through Valentine’s findings. rights in the health care systems and measures the level Valentine explainsiss this difference as it follows: “Across of fulfillment of legitimated expectations of people from subgroups within countries, convergence was stronger the health system [19]. than convergence across countries, indicating that health Responsiveness has two main areas and this system investments, culture and the human development study determined the relative importance of each element context were stronger regarding the influences on the associated with the client’s orientation from the populations’ priorities for their health systems than the perspective of the households in high and low income individual level factors like age, sex, education, health districts. Ranking these areas from the perspective of status, and utilization of health services”[6]. people with different economic, social and cultural On the other hand, the quality of basic amenities characteristics has been emphasized in several studies not only affects the patient’s comfort, but is also [6]. associated with the feeling of promoting health, wellbeing Generally, the results in this study showed that 8_specialand acceleration in the recovery processes [23]. However, quality of basic amenities was selected as the most some studies have shown that there is a gap between the important element from the perspective of participants as patients’ needs and access to basic desired amenities well as the studies conducted by Rashidian et al. in the even in developed countries. Undesirability of basic district 17 of Tehran, Karami et al. among heart inpatients amenities may put the patient at risk [24]. in hospital and Kowal et al. in Asia (2011)[20]. In his study, Valentine showed that setting The similarity of these results does not mean the priorities in the responsiveness domains in field of client same expectations, but these results showed that the orientation is more associated with the geographic area quality of basic amenities was the most important element as well as the level of human development and, in some compared to other elements of the client’s orientation. cases, the level of health expenditure. Also, in this study, However, considering the scale of measurement of the the significant relationship between the type of location importance level of the sub-elements of client’s and paying attention to the right choice statistically were orientation, the importance of these areas cannot be also observed. This means that people living in the low- proved in various studies. income district have the higher priority for the choice The next point in the current study was the compared to the high-income district [6]. similarity of this priority between high and low income JML_Volume Some studies found that older respondents pay districts that showed that even households who live in attention to autonomy little more than younger ones. districts with low income, also expect to receive services However, in this study and in the study conducted by with an appropriate quality of service. This can be paid Rashidian there was no significant relationship between more attention to knowing that the significant part of the independency and demographic characteristics of people outpatient health services in Mashhad are similar between

110 Journal of Medicine and Life Vol. 8, Special Issue 3, 2015

[23]. In the study on eight European countries, Coulter resource constraints [5,26]. Because without the showed that most people (51%) preferred the model of understanding of the priorities in the community, efforts to joint decision-making and 31% of the people over 55 reform and improve the health system performance that years, admitted that the doctor should decide [24]. often focuses on tangible benefits, such as revenues and In his study, like in any other study there were costs, may be misguided. This may be due to the fact that some limitations. The weak willingness of households to many of the costs such as the cost caused by the lack of participate in these kinds of studies was one of the main a convenient accessibility of patients to needed services limitations this study faced with. To overcome these or caused by the lack of good quality of basic amenities limitations, we tried to determine the appropriate time by a as an important priority cannot be understood by the representative from the households to complete the usual data in performance assessment. Therefore, the questionnaire, use the promotional tools, and strengthen design of appropriate mechanisms that allows the the communication skills of interviewers as well. Another prioritizing by people in order to plan to do the reform, the limitation was the cultural issues during a visit to the home health system is one of the related fields of policy making that was resolved by training interviewers and using in the improvement of health system responsiveness. researchers in both sexes, as well as obtaining the required legal permissions. Also, the low relationship Acknowledgment between importance prioritizing and individual This research would not have been done without characteristics may be partly explained by the omission of the generous and patient cooperation of the residents of individual characteristics like ethnicity, which was found to Mashhad. We received financial support from Mashhad be an important determinant in some studies [25]. University of Medical Sciences. Policy makers in the health system can apply these results in prioritizing their efforts when faced with 3_2015_draft

References

iss research domain. Soc Sci Med. 1998; 15. Rezaei F, Askari HA. Checking the 1. Murray CJ, Frenk J. A framework for 47(10):1573-88. relationship between physicians' assessing the performance of health 8. Jung HP, Baerveldt C, Olesen F, Grol communication skills and outpatients' systems. Bulletin of the world Health R, Wensing M. Patient characteristics as satisfaction in the clinics of Isfahan Al- Organization. 2000; 78(6):717-31. predictors of primary health care Zahra(S) Hospital in 2011. Journal of 2. Valentine NB, de Silva A, Kawabata K, preferences: a systematic literature Education and Health Promotion. 2014; Darby C et al. Health System analysis. Health Expectations. 2003; 3:105. Responsiveness: Concepts, Domains and 6(2):160-81. 16. Farmahini Farahani M, Shamsikhani S, Operationalization. in Murray CJL, Evans 9. Fung CH, Elliott MN, Hays RD, Kahn Sajadi Hezaveh M. Patient satisfaction DB. Health System Performance KL, Kanouse DE, McGlynn EA et al. with nursing and medical care in hospitals Assessment (Debates, Methods and Patients' preferences for technical versus affiliated to arak university of medical Empiricism). 2003, Geneva: World Health interpersonal quality when selecting a sciences in 2009. Nursing and Midwifery Organization, 573. 8_specialprimary care physician. Health Services Studies. 2014; 3(3):e14022. 3. Hsu CC, Chen L, Hu YW, Yip W, Shu Research. 2005; 40(4):957-77. 17. Jafari Kelarijani SE, Jamshidi R, CC. The dimensions of responsiveness of 10. Sofaer S, Crofton C, Goldstein E, Hoy Heidarian AR, Khorshidi M. Evaluation a health system: a Taiwanese E, Crabb J. What do consumers want to of factors influencing patient satisfaction in perspective. BMC Public Health. 2006; know about the quality of care in social security hospitals in Mazandaran 6(1):72. hospitals?. Health Services Research. province, North of Iran. Caspian Journal of 4. Campbell SM, Roland MO, Buetow SA. 2005; 40(6p2):2018-36. Internal Medicine. 2014; 5(4):232-4. Defining quality of care. Social science & 11. Rashidian A, Kavosi Z, Majdzadeh R, 18. Yousefi A. A reflection on the social medicine. 2000; 51(11):1611-25. Pourreza A, Pourmalek F, Arab M et al. boundaries of urban space Mashhad, 5. Fazaeli S, Ahmadi M, Rashidian A, Assessing health system responsiveness: Mashhad, position Classification. Journal Sadoughi F. A Framework of a Health a household survey in 17th district of of Social Sciences. 2010; 6(2):61-91. System Responsiveness Assessment tehran. Iran Red Crescent Med J. 2011; 19. Karami-Tanha F, Moradi-Lakeh M, Information System for Iran. Iranian Red 13(5):302-8. Fallah-Abadi H, Nojomi M. Health Crescent Medical Journal. 2014; 16(6). 12. Wensing M, Elwyn G. Methods for System Responsiveness for Care of 6. Valentine N, Darby C, Bonsel GJ. Which incorporating patients' views in health Patients with Heart Failure: Evidence form aspects of non-clinical quality of care are care. BMJ. 2003; 326(7394):877-9. a University Hospital. Archives of Iranian most important?. Results from WHO's 13. Malhotra C, Do YK. Socio-economic Medicine. 2014; 17(11):736-40. general population surveys of “health disparities in health system 20. Kowal P, Naidoo N, Williams SR, JML_Volumesystems responsiveness” in 41 countries. responsiveness in India. Health Policy and Chatterji S. Performance of the health Social Science & Medicine. 2008; Planning. 2012; czs051. system in China and Asia as measured by 66(9):1939-50. 14. Yousefi M, Assari Arani A, Sahabi B, responsiveness. Health. 2011; 3(10):638- 7. Wensing M, Jung HP, Mainz J, Olesen Kazemnejad A, Fazaeli S. Household 48. F, Grol R. A systematic review of the Health Costs: Direct, Indirect and 21. Peltzer K, Phaswana-Mafuya N. Patient literature on patient priorities for general Intangible. Iranian Journal of Public experiences and health system practice care. Part 1: Description of the Health. 2014; 43(2):202-9. responsiveness among older adults in

111 Journal of Medicine and Life Vol. 8, Special Issue 3, 2015

South Africa. Glob Health Action. 2012; through structural reform. Health Aff family members in the treatment of 5:1-11. (Millwood). 2005; 24(6):1467-76. schizophrenia. Psychiatric Services. 2002; 22. Liabsuetrakul T, Petmanee P, 24. Vafaee-Najar A, Pourtaleb A, 53(6):724-9. Sanguanchua S, Oumudee N. Health Ebrahimipour H, Dehnavieh R. Study of 26. Kerssens JJ, Groenewegen PP, Sixma system responsiveness for delivery care patient’s complaints reported over 36 HJ, Boerma WG, Ivd E. Comparison of in Southern Thailand. International months at a large public educational patient evaluations of health care quality Journal for Quality in Health Care. 2012; specialized center of obstetrics and in relation to WHO measures of 24(2):169-75. gynecology. Middle-East Journal of achievement in 12 European countries. 23. Knaul FM, Frenk J. Health insurance in Scientific Research. 2013; 16(1):23-9. Bulletin of the World Health Organization. Mexico: achieving universal coverage 25. Fischer EP, Shumway M, Owen RR. 2004; 82(2):106-14. Priorities of consumers, providers, and

3_2015_draft

iss

8_special

JML_Volume

112 Journal of Medicine and Life Vol. 8, Special Issue 3, 2015, pp.113-117

Evaluation of medical students of teacher-based and student-based teaching methods in Infectious diseases course

Ghasemzadeh I*, Aghamolaei T**, Hosseini-Parandar F*** *Infectious & Tropical Diseases Research Center, Hormozgan University of Medical Sciences, Bandar Abbas, Iran, **Department of Public Health, Health School, Hormozgan University of Medical Sciences, Bandar Abbas, Iran, ***Department of Social Sciences, Shahid Bahonar University of Kerman, Kerman, Iran

Correspondence to: F Hosseini-Parandar, MD, Department of Social Sciences, Shahid Bahonar University of Kerman, Kerman, Iran, Address: Pajoohesh Sq., Kerman, Iran, Phone: +98-34-31323066, E-mail: [email protected]

Received: March 14th, 2015 – Accepted: June 18th, 2015

Abstract Introduction: In recent years, medical education has changed dramatically and many medical schools in the world have been trying to develop new training methods. The aim of this study was to evaluate the medical students of teacher-based and student-based teaching methods in Infectious diseases course, in the Medical School of Hormozgan University of Medical Sciences. Methods: In this interventional study, a total of 52 medical students who took part in the Infectious3_2015_draft diseases course were included. About 50% of this course was presented by a teacher-based teaching method (lecture) and 50% by a student-based teaching method (problem-based learning). The satisfaction of students regarding these methods was assessed by a questionnaire and a test was used to measure their learning. Data were analyzed by using SPSS 19 and paired t-test. Results: The satisfaction of students of student-based teaching method (problem-basediss learning) was more positive than their satisfaction of teacher-based teaching method (lecture).The mean score of students in teacher-based teaching method was 12.03 (SD=4.08) and in the student-based teaching method it was 15.50 (SD=4.26) and there was a significant difference between them (p<0.001). Conclusion: The use of the student-based teaching method (problem-based learning) in comparison with the teacher-based teaching method (lecture) to present the Infectious diseases course led to the student satisfaction and provided additional learning opportunities.

Keywords: Problem-Based Learning, lectures, students, medical, communicable diseases

Introduction In an overall classification of teaching methods, 8_specialthey can be divided into lecture based and student based Lecturing has been the main type of education methods. Group discussion and problem solving are for a long time. During recent decades, newer considered student based methods and lecturing is technologies have been implemented and visual aids considered a lecture based method. In student based education, students face with an exciting challenge and such as slides and PowerPoint presentations have been brainstorm over solving the challenge. Irrelevant thoughts used to boost education. Since lectures have a low effect and ideas are filtered and the conversation goes on over on the development, the employment of newer techniques the solutions. In this method, students face with the is inevitable and actively engage the students in the responsibility of the teaching process and attempt to education process [1]. realize the issue under the guidance of the professor [3]. The main point that leads to an effective learning One of the main applications of the problem is an effective and high quality teaching in a proper solving education is that as they recognize the environment. Making an efficient learning environment is educational purposes they learn both the basic and the one of the main challenges of medical education. The clinical sciences [2,4]. This method improves motivation daily increase in the medical sciences leads to the and clinical reasoning skills [5]. The students spend more recognition of more problems. On the other hand, the time for self-teaching and implement various information JML_Volumelecture based education has been replaced with student sources such as libraries and digital libraries more based education. This has provided new responsibilities frequently [4]. A systematic review has shown that the for policy makers, professors and students on the basis of problem solving education increases technical, social, selecting the most proper teaching and learning methods cognitive, management, research and educational skills of according to the field of study [2]. the students [6]. Journal of Medicine and Life Vol. 8, Special Issue 3, 2015

Although newer teaching methods have been points), weak (two points) and very weak (one point). introduced, the lecture based method is still one of the Thus, each question had a score range of one to five. The most usual methods because it is the safest and easiest questionnaire was reliable (Cronbach’s alpha = 0.95) and method and the professor is able to have a better control the validity was confirmed by experts. over the class. Evidence showed that a decent lecture The questionnaires were distributed at the end of content along with a noble lecturer can lead to positive, the term and students were asked to demonstrate their appropriate and reasonable results. However, each opinions. The students’ names were concealed. Also, in method has its own benefits and cons. Thus, all the the final exam, each student had two individual scores components of the learning process (such as curriculum, (out of 20) and the final scores of each method were teaching methods and students’ learning) should be compared. evaluated [7]. This has led to various discussions and Data were entered in SPSS v.19 and paired t- studies. For example, Carey conducted a descriptive test was used to compare the differences of each method. study to determine the students’ experiences during the problem solving method and its impacts on their gained Results knowledge. They showed that more than half of the participants described the process as “relatively hard”, All participants completely filled out and returned however, an increase in knowledge was reported [8]. This the questionnaires (response rate = 100%). Among all study was conducted to evaluate and compare the students, 46.2 percent were male and 53.8 percent were efficacy of the lecture-based method versus the student- female. based method among the medical students of Hormozgan According to the results of this study, the University of Medical Sciences. difference between the lecture based method and the student based method 3_2015_draftwas significant in 12 out of 19 Method questions (p<0.05). In eight of these items including the student’s participation in education, stability of education This interventional study was conducted on topics, self-confidence, personal difference consideration, fourth year medical students of Hormozgan University of long-term memoryiss involvement, motivating students, Medical Sciences in 2013 during their infectious diseases interaction between professor and students, and creation course (three credits equaled to 51 educational hours). All of a team-work sense, the student based method was the 52 students who took this course were enrolled. considered as the better method. On the other hand, the Both the lecture based and the student-based lecture-based method was better in four items; quality of methods were chosen as the teaching style (50 percent education content, compliance to the structure and each). In the lecture-based method, the professor sequence of the study, efficacy of class time and creating presented a lecture with the aid of PowerPoint slides. In a comfortable environment in the classroom. Also, the the student-based method, the professor asked a problem difference between seven items were not statistically or question at the beginning and students had to prepare significant; forming a positive attitude regarding study themselves and study on the issue for the next session. topics, establishing the professional needs of the During the following session, students commented8_special on the students, helping them to achieve the educational goals, issue and engaged in a supervised discussion. Finally, better understanding of the study contents, deeper the professor completed and concluded the discussions. understanding of the study contents, better responses to Both methods were evaluated by using a Likert the questions and application of the education (Table 1). based questionnaire. The questionnaire was designed by The final score of the lecture based method and experts while using valid scientific sources. It included 19 the student-based method was 12.03 ± 4.08 and 15.50 ± questions. Each question contained five options including 4.26, respectively. Paired t-test showed that this excellent (five points), good (four points), moderate (three difference was significant (p<0.001, t= -8.82).

Table 1. Students’ attitude toward the two educational methods (paired t-test)

Mean Standard Mean Standard T P-value deviation deviation Quality of study content 3.80 1.04 3.21 1.16 2.66 0.01* Creating a positive attitude 3.48 0.99 3.48 1.09 0.000 1.00 toward the study topics JML_VolumePreparing professional needs 3.57 1.09 3.32 1.21 1.01 0.31 of the students Student contribution in the 2.73 1.06 4.02 0.99 -5.63 0.000* learning process Helping students achieve the 3.51 1.09 3.31 1.19 0.92 0.35 educational goals

114 Journal of Medicine and Life Vol. 8, Special Issue 3, 2015

Better understanding of the 3.51 0.85 3.50 1.11 0.09 0.92 study content Long-term memory 3.08 0.98 3.63 1.12 -2.51 0.01* improvement Motivating students to learn 2.96 0.96 3.46 1.19 -2.46 0.01* Compliance to study 3.92 1.02 3.11 0.94 4.03 0.000* structure and sequence Deeper understanding of the 3.26 0.95 3.46 1.07 -0.92 0.35 study content Better response to questions 3.40 0.91 3.46 1.05 -0.26 0.79 Stability of learning process 3.09 0.91 3.78 1.12 -3.06 0.003* Application of the study 3.40 1.15 3.55 1.10 -0.70 0.48 content Self-confidence improvement 2.61 0.95 4.00 1.22 -6.06 0.000* Considering the student 2.84 1.28 3.48 1.24 -2.65 0.01* differences Better interaction of students 2.94 0.97 3.78 1.28 -3.69 0.001* and professors Creating a sense of 2.42 0.95 3.80 1.10 -6.72 0.000* teamwork among students Time efficacy 3.94 1.09 2.80 1.08 4.83 0.000* Creating a comfortable 3.65 1.11 3.05 1.25 2.55 0.01* environment *significant at a level of 0.05 3_2015_draft Discussion deeper knowledge, and assigning more time for studying. Also, these methods give more opportunities to the The aim of this study was to demonstrate the learner to review and criticize the lecturer and the students’ attitude toward the lecture-based education and educational contentsiss [17-19 ]. the student based education in the infectious diseases The participants of this study believed that course of Hormozgan University of Medical Sciences. implementing the student based methods such as Implementing newer educational techniques and problem solving, results in higher contribution of students improving them is a main goal in organizations that are in the learning process and creates a sense of team involved in education. Most universities of the world are group among students. This was consistent with Nikfar et al. [10] and Kermaniyan et al. [11]. Creating a sense of planning to develop their educational methods to improve contribution is an important issue in improving the medical the students’ learning. There are two main patterns; education and since the team work is a necessary part of lecture based education and student based education. problem solving, it can be expected that this method will Problem solving is a type of student based education reduce the personal differences and increase the student which leads to gaining professional8_special views, contribution in the team work [20]. communicational, proper problem solving and gaining Nikfar et al. [10] and Qin et al. [21] showed in knowledge skills [9]. their study that the student based educational methods The results of this study showed that the student increase the students’ interest and motivation. In fact, the based education leads to an improvement in student problem solving method results in critical thinking and participance, better long-term memory, motivating communicational skill development and increases the students, stability of knowledge, higher self-confidence student’s interest in learning. level, recognizing the educational differences, better Participants demonstrated that the lecture based student master interactions, and creating a sense of method results in a better study content quality, study team-work. Also, students scored higher in the problem sequence and structure and a higher time efficacy. Other solving method topics in the final exam. These results studies have also mentioned that the scientific information were consistent with the findings of Nikfar et al. [10], are often unorganized [11,22]. In the lecture-based Kermaniyan et al. [11], Momeni Danaei et al. [12], Jafari method, the professor has more authority in the et al. [13], Hekmatpour et al. [14]. Another study also classroom and is able to teach study content in a more showed that students were more prone to group organized and less time-consuming way. In this study, discussion and problem solving than to lecture [15]. participants showed that a more comfortable environment was present in the lecture-based method. This was JML_VolumeAnother study that enrolled the nursing students showed different from our expectations and further research is that they preferred group discussions [16]. Our results needed in this regard. also showed that the student-based education was The mean final exam score of the student-based related to student satisfaction. This might be due to the method was significantly higher than the lecture based activating of the students’ mind during the teaching, method. Mahram et al. also conducted a study to

115 Journal of Medicine and Life Vol. 8, Special Issue 3, 2015

compare the lecture based method and group discussion these two studies were consistent with our study. It must method and showed no difference in their final scores be kept in mind that in our study, the study content of the [23]. Their results were inconsistent with our study. two methods was different and this might be the reason Delaram also compared these two methods among for different scores. However, since the results of this midwifery students and demonstrated no difference in study were not consistent with most similar studies, final scores [24]. Momeni Danaei et al. [12] also showed further research is needed. no significant difference between the two study methods. Dusold and Sadoski also conducted a study to compare the final exams of students of both methods. They Conclusion reported no statistically significant difference [25]. Herzig It can be concluded that the overall satisfaction et al. also conducted this study on medical students of students attending the infectious diseases course was during their pharmacology course. They also reported no higher and more learning opportunities were provided. significant difference in none of the taken exams [26].

Safari et al. [18] showed that the mean scores of the Acknowledgement student based method was significantly higher than the We would like to thank all the students who lecture based method. Eslavin et al. also concluded that participated in this study. the student based methods and combined models have a better impact on the students’ learning [27]. The results of

References 3_2015_draft

1. Bligh D. What's the Use of Lectures 2000 8. Carey L, Whittaker KA. Experiences of 14. Hekmatpou D, Seraji M, Ghaderi T, San Francisco. Calif Jossey-Bass. problem-based learning: issues for Ghahremani M, Naderi M. Comparison of 2. Prince KJ, Van Mameren H, Hylkema N, community specialist practitioner students.iss Group Discussion and Lecture Method in Drukker J, Scherpbier AJ, Van Der Nurse Education Today. 2002; 22(8):661- Students’ Learning and Satisfaction of Life Vleuten CP. Does problem‐based 8. Instructions Unit. Qom University of learning lead to deficiencies in basic 9. Gurpinar E, Musal B, Aksakoglu G, Medical Sciences Journal. 2013; 7(2). science knowledge? An empirical case on Ucku R. Comparison of knowledge scores 15. Antepohl W, Herzig S. Problem‐based anatomy. Medical Education. 2003; of medical students in problem-based learning versus lecture‐based learning in 37(1):15-21. learning and traditional curriculum on a course of basic pharmacology: a controlled, randomized study. Medical 3. Brock Enger K, Brenenson S, Lenn K, public health topics. BMC Medical education. 1999; 33(2):106-13. MacMillan M, Meisart MF, Meserve H et Education. 2005; 5(1):7. 16. Sand-Jecklin K. The impact of active/ al. Problem-based learning: evolving 10. Nikfar R, Valavi E, Aminzadeh M, Taheri cooperative instruction on beginning strategies and conversations for library M, Ziaee T, Mortazavi M et al. Comparing nursing student learning strategy instruction. Reference services review. medical student opinions regarding preference. Nurse Education Today. 2007; 2002; 30(4):355-8. 8_specialteaching based on lectures and problem- 27(5):474-80. 17. Chadwick SM, Bearn DR, Jack AC, 4. Koleini N, Farshidfar F, Shams B, based learning in large groups. Bimonthly O'Brien KD. Orthodontic undergraduate Salehi M. Problem based learning or Journal of Hormozgan University of education: developments in a modern lecture, a new method of teaching biology Medical Sciences. 2013; 17(3):257-63. curriculum. European Journal of Dental to first year medical students: an 11. Kermaniyan F, Mehdizadeh M, Iravani Education. 2002; 6(2):57-63. experience. Iranian Journal of Medical S, MArkazi Moghadam N, Shayan S. 18. Safari M, Yazdanpanah B, Ghafarian Education. 2003; 3(2):57-63. Comparing lecture and problem-based HR, Yazdanpanah S. Comparing the effect of lecture and discussion methods 5. Baker CM, Pesut DJ, McDaniel AM, learning methods in teaching limb on studentslearning and satisfaction. Fisher ML. Evaluating the impact of anatomy to first year medical students. Iranian Journal of Medical Education. problem-based learning on learning styles Iranian Journal of Medical Education. 2006; 6(1):59-64. of master's students in nursing 2008; 7(2):379-88. 19. van den Hurk MM, Dolmans DH, administration. Journal of Professional 12. Momeni Danaei S, Zarshenas L, Wolfhagen IH, vMuijtjens AM, van der Nursing. 2007; 23(4):214-9. Oshagh M, Khoda O, Maryam S. Which Vleuten CP. Impact of individual study on tutorial group discussion. Teaching and 6. Koh GCH, Khoo HE, Wong ML, Koh D. method of teaching would be better; Learning in Medicine. 1999; 11(4):196- The effects of problem-based learning cooperative or lecture?. Iranian Journal of 201. during medical school on physician Medical Education. 2011; 11(1):24-31. 20. O'Neill P. The role of basic sciences in a JML_Volumecompetency: a systematic review. 13. Jafari A, Khami M, Mohamadi M. problem-based learning clinical Canadian Medical Association Journal. Presenting the course of community curriculum. Medical Education. Oxford. 2008; 178(1):34-41. dentistry as problem based learning 2000; 34(8):608-13. 21. Qin XJ, Kong J, Lu L, Lu ZF, Wang XK. 7. Lowenstein AJ. Fuszard's innovative workshop and comparing it to learning Application of problem-based learning in a teaching strategies in nursing. 2003, through lecture. Iranian Journal of Medical large class in stomatology course. Journal Jones & Bartlett Learning. Education. 2010; 9(3):216-24.

116 Journal of Medicine and Life Vol. 8, Special Issue 3, 2015

of Oral and Maxillofacial Surgery. 2010; Development Medical Education 2008- 26. Herzig S, Linke RM, Marxen B, Börner 68(4):739-43. 272X Kerman University of Medical U, Antepohl W. Long-term follow up of 22. Zarshenas L, Momeni Danaei S, Sciences. 2012; 5(2):71-9. factual knowledge after a single, Oshagh M, Salehi P. Problem based 24. Delaram M. The effect of lecture and randomised problem-based learning learning: An experience of a new focus group teaching methods on course. BMC Medical Education. 2003; educational method in dentistry. Iranian midwifery student’s learning in obstetrics 3(1):3. Journal of Medical Education. 2010; (2) course. J Med Educ Develop. 2006; 27. Slavin RE, Cheung A, Groff C, Lake C. 10(2):171-9. 2(2):3-7. Effective reading programs for middle and 23. Mahram M, Mahram B, Mousavinasab 25. Dusold R, Sadoski M. Self-directed high schools: A best‐evidence synthesis. SN. Comparison between the effect of learning versus lecture in medicine. Reading Research Quarterly. 2008; teaching through student-based group Academic Exchange Quarterly. 2006; 43(3):290-322. discussion and lecture on learning in 10(4):29. medical students. Journal of Strides

3_2015_draft

iss

8_special

JML_Volume

117 Journal of Medicine and Life Vol. 8, Special Issue 3, 2015, pp.118-121

Prevalence of Hepatitis C infection in Qeshm Island in 2013-2014, Iran

Ghasemzadeh I*, Alavi-Nasr A*, Khademi M**, Kargar Kheirabad A***, Gouklani H**** *Infectious and Tropical Diseases Research Center, Hormozgan University of Medical Sciences, Bandar Abbas, Iran, **Clinical Research Development Center, Shahid Mohammadi Hospital, Hormozgan University of Medical Sciences, Bandar Abbas, Iran, ***Department of Virology, School of Public Health, Tehran University of Medical Sciences, Tehran, Iran, ****Molecular Medicine Research Center, Hormozgan University of Medical Sciences, Bandar Abbas, Iran

Correspondence to: Hamed Gouklani, PhD, Molecular Medicine Research Center, Hormozgan University of Medical Sciences, Bandar Abbas, Iran Immam Hosein Boulevard, Bandar-Abbas, Iran Phone: +98 (76) 33668476, Fax: +98 (76) 33685047, E-mail: [email protected]

Received: March 14th, 2015 – Accepted: June 18th, 2015

Abstract Introduction: Hepatitis has involved many individuals and has left many complications. Hepatitis C is a type of hepatitis associated with many complications. The aim of this study was to investigate the epidemiology of Hepatitis C in Qeshm Island in 2014. Method: this was an interventional study conducted on 1500 inhabitants of Qeshm Island. Participants3_2015_draft were selected by using cluster sampling. Five cc of blood was drawn from each participant in order to test for HCV-Ab with ELIZA technique. Positive samples were referred for PCR to investigate the presence of anti Hepatitis C anti body. Data were entered in SPSS v.16 after sample collection and were analyzed using descriptive statistics (prevalence, mean, percent and standard deviation) and chi-square. Results: out of 1500 participants, 986 (65.7 percent) were females and 514 (34.3 isspercent) were males. HCV anti body was seen in four patients (0.3 percent). The results of this study showed that neither of the investigated factors (age, gender, marital status, place of residence, educational level, history of IV drug abuse, being in jail, quitting addiction, risky sexual behavior, etc.) was related to the prevalence of anti body. Conclusion: The prevalence of this disease was 0.3 percent in Qeshm Island, which was consistent with the results of other studies. Also, factors investigated for HCV were not recognized as HCV risk factors.

Keywords: epidemiology, Hepatitis C, Qeshm

Introduction the liver [10]. Chronic hepatitis is one of the other 8_specialcomplications of this disease [11]. Some of these patients Viruses are present everywhere and have will be led to liver cirrhosis [12]. Another dangerous important roles in health and evolution. Many biologists complication of Hepatitis C is forming hepatocellular recognize them as creatures with specific and different life carcinoma which can evolve two to four decades after the territories that can swap genes between different species hepatitis infection [13]. [1]. The different prevalence of Hepatitis C was Hepatitis is an infectious disease which causes reported. The Scandinavian countries and England have inflammation in the liver [2]. This disease is classified to the lowest prevalence [14]. Other studies have shown that Hepatitis B, A, C and E [3-6]. the prevalence of Hepatitis C has increased from 2.5 Hepatitis C is an inflammatory and liver necrosis percent in 1998 to 2.8 percent in 2005 and the frequency disease, which develops as acute or chronic and belongs of these patients has changed from 122 million to 185 to the flaviviridae family. It tends to live inside the liver and million, worldwide [14]. to proliferate among its tissue. This virus consists of a Since no previous studies have been conducted single stranded positive RNA with 9500 nucleotides [7]. in this area, this study was carried out to determine the Genotype one Hepatitis C virus consists of 60 to 75 prevalence of Hepatitis C among the general population percent of positive HCV cases in the United States. The of Qeshm Island is 2014. JML_Volumetreatment of this type is the most difficult treatment [8]. Hepatitis C has different complications including Method neurological complications. It can also cause hemorrhagic or ischemic CVA. Thus, HCV must be recognized as a This descriptive study was conducted in 2014 in differential diagnosis for neurological disorders [9]. Qeshm Island of Hormozgan province. The study However, the most important complications are related to Journal of Medicine and Life Vol. 8, Special Issue 3

population consisted of 130.000 inhabitants. The sample four patients (0.3 percent) were positive for HCV size was calculated to be 1500, by using the following antibodies. formula: The results of the study showed that none of the investigated factors was related to the prevalence of the antibody. Two women (0.2 percent) and two men (0.4 percent) had positive HCV antibodies and the difference of prevalence of HCV antibody was not significant among Before the study, the Ethics Committee of genders (p=0.610). Hormozgan University of Medical Sciences approved the Among all participants, 87.7 percent had an study. Stratified sampling was used to select the educational level of high-school diploma or below. All participants. Qeshm was divided into several HCV positive patients were among them. However, no geographical areas and individuals who referred to health significant relationship was found between HCV and the centers or hospitals were asked to fill in the checklist and educational level (p=0.976). be evaluated for HCV. Data were collected by using a In this study, 88 percent (1320 participants) were checklist that was designed according to similar studies married and 12 percent (180 participants) were male. All and the experts’ opinion. Data that was collected included HCV patients (four individuals) were married. There was name, surname, age, gender, occupation, marital status, no significant association between the antibody residence status, educational level, ethnicity, religion, prevalence and the marital status (p>0.005). history of blood donation, knowledge regarding Hepatitis In addition, 372 participants (24.8 percent) lived C virus, how they acquired knowledge (friends and family, inside the urban area while 1128 (75.2 percent) lived in television, radio and television, newspapers, hospitals and rural areas. All four patients were from the rural areas. medical centers), blood type and history of previous However, no significant association was seen between diseases. Also, participants were assured that all HCV antibodies and place3_2015_draft of residence (p=0.578). information will remain confidential. All participants The mean age of HCV positive patients and the provided an informed, written consent. healthy group was 36.75 ± 16.78 years and 32.58 ± If a person providing a consent and live in 13.16. This differenceiss was not significant (p=0.528). Qeshm included to study, and person with cardiovascular No participant of the study had a history of IV disease, RF, Infections, recent measles infection, mumps, drug abuse, being imprisoned, quitting addiction, or risky Infectious mononucleosis, past medical history of malaria, sexual behaviors. There was no significant association brucellosis, tuberculosis, other viral hepatitis, HIV/AIDS, between these factors and the prevalence of antibody toxoplama, GI problem, pregnancy, recent trauma, (p>0.005). Also, all four patients had a history of dentist hematogenous or sexual transmitted disease, blood visits, however, this was not significant with the transfusion during one year ago, lactation, vaccination, prevalence of antibody (p>0.005). Among all the previous immunoglobulin injection, psyachtric disease, participants of the study, one (0.07 percent) used opium diabetes mellitus and thyroid disorders excluded from and two (0.13 percent) used heroin. None of the HCV study positive patients was drug abusers. There was no In this study, five cc of blood was8_special drained from significant association between drug abuse and HCV each participant for HCV-Ab evaluation using a third antibodies (p>0.005). generation anti-HCV kit (Biometrix). Positive samples Also, no participant had a history of hemophilia, (according to ELIZA method) were referred for PCR (third dialysis or organ transplantation. generation, made in France) to confirm the presence of anti-HCV antibodies. Patients with positive HCV RIBA Conclusion were considered infected with Hepatitis C or having a history of HCV. Another five cc of venous blood was Hepatitis C infection is an important problem drained from the brachial vein and the serum was isolated worldwide that affects almost 200 million people around and assessed for HCV according to ELIZA technique. the world [15]. In some countries, it is an important cause Positive cases were determined and referred for genome of chronic liver disease and the most common cause of extraction with RT-PCR using specific primers for HCV HCC [16,17]. The aim of this study was to determine the infection. Data was entered in SPSS v.16 software and prevalence of Hepatitis C among the general population analyzed by descriptive statistics (frequency, mean, of Qeshm in 2014. percent, and standard deviation) and chi-square. This was the first study conducted in Qeshm JML_Volume Island that investigated the prevalence of Hepatitis C. The Results results showed that 0.3 percent of the participants had HCV and the PCR results of four patients were positive. Among 1500 participants, 986 (65.7 percent) However, many studies have been conducted in Iran in were females and 514 (34.3 percent) were males. Only this regard.

119 Journal of Medicine and Life Vol. 8, Special Issue 3

Our result was consistent with the prevalence of group. Shakeri et al. [17], Alavian et al. [34], Vermehre et HCV among the general population of Iran being below al. [33] and Sharifi et al. [32] reported that older one percent in a study by Alavian et al. [18]. Alavian et al. individuals are more prone to this disease. [19] conducted another study and reported a prevalence All four patients lived in rural regions of Qeshm. of 0.16 percent and Merat [20] conducted another study However, there was no significant association between which reported a prevalence of 0.5 percent in Iran. Other the place of residence and hepatitis. Fattahi et al. [35] reports in Iran included: a prevalence of 0.83 percent reported a 0.24 percent prevalence in rural areas of Fars reported by Sayad et al., 0.2 percent reported by Taghi prevalence. Other studies have shown that the place of Shakeri [17] and 0.05 percent reported by Zamani et al. in residence is not related to Hepatitis C infection [36]. Amol [21]. The results of our study were similar to the No participant of our study had a previous history findings of other studies in Iran. The few differences can of hemophilia, using a shared needle, dialysis, or organ be related to several factors such as lifestyle, population donation. Thus, we cannot discuss their effect on density and education about Hepatitis C [21]. Hepatitis C. Other studies have reported them as risk According to other studies, the prevalence of factors of Hepatitis C [37-39]. HCV was higher in other countries; 5.9 percent in Hawaii The prevalence of this disease was 0.3 percent [22], 2.7 percent among New York population aged above in Qeshm Island, which was consistent with the results of 20 [23], 1.57 percent in Pakistan [24], 1.71 percent in a other studies, but lower than other regions of the world. It state of Nigeria [25], 0.5 percent in Serbia and Tajikistan, also proved a lower prevalence of Hepatitis C in Iran 13 percent in Uzbekistan among the general population of compared to other countries. WHO regions [26], 1.5 percent among Hispanic/ Latinos of America [27], two percent in Rhode Island of the US Limitations [28], 1.2 percent among the general population of Libya Some inhabitants of the region did not agree with [29] and 4.62 percent in India [30]. the participation in the study.3_2015_draft Our study showed that half of the patients were Suggestions males and half were females. Also, no relationship was Other studies should be conducted to determine found between Hepatitis C and gender. Our result was Hepatitis C genotypeiss in Qeshm Island and investigate consistent with Shakeri et al. [17] and Alavian et al. [31]. their complications. However, Sharifi et al. [32] and Veemehren et al. [33] and Thakral et al. reported inconsistent results and showed a Acknowledgements higher prevalence of Hepatitis C among the male This study was the result of a general physician population. thesis. We would like to thank all professors, Qeshm Although there was no significant association inhabitants, health system authorities, and Hormozgan seen between age and Hepatitis C prevalence in our University of Medical Sciences who helped us during this study, there were three cases in the 25-35 years age study.

References 8_special

1. Herrero-Uribe L. Viruses, definitions and International Journal of Food 11. Seeff LB. Natural history of chronic reality. Revista de Biología Tropical. Microbiology. 2015; 193:29-33. hepatitis C. Hepatology. 2002; 2011; 59(3):993-8. 6. Ikobah JM, Okpara HC, Ekanem EE, 36(S1):S35-S46. 2. Shaheen MA, Idrees M. Evidence-based Udo JJ. Seroprevalence and predictors of 12. Sangiovanni A, Prati GM, Fasani P, consensus on the diagnosis, prevention hepatitis A infection in Nigerian children. Ronchi G, Romeo R, Manini M et al. and management of hepatitis C virus Pan African Medical Journal. 2015; 20(1). The natural history of compensated disease. World Journal of Hepatology. 7. Zein NN, Persing DH. Hepatitis C cirrhosis due to hepatitis C virus: A 2015; 7:(3):616. genotypes: current trends and future 17‐year cohort study of 214 patients. 3. Børresen ML, Andersson M, Wohlfahrt implications. Mayo Clinic Proceedings. Hepatology. 2006; 43(6):1303-10. J, Melbye M, Biggar RJ, Ladefoged K et 1996, Elsevier. 13. Liang TJ, Heller T. Pathogenesis of al. Hepatitis B Prevalence and Incidence 8. Kohli A, Shaffer A, Sherman A, Kottilil hepatitis C—associated hepatocellular in Greenland: A Population-Based Cohort S. Treatment of hepatitis C: a systematic carcinoma. Gastroenterology. 2004; Study. American Journal of Epidemiology. review. JAMA. 2014; 312(6):631-40. 127(5):S62-S71. 2015; 181(6):422-30. 9. Acharya JN, Pacheco VH. Neurologic 14. Wong T, Lee SS. Hepatitis C: a review 4. Yao N, Hesson T, Cable M, Hong Z, complications of hepatitis C. The for primary care physicians. Canadian JML_VolumeKwong A, Le H et al. Structure of the Neurologist. 2008; 14(3):151-6. Medical Association Journal. 2006; hepatitis C virus RNA helicase domain. 10. Khan MH, Farrell GC, Byth K, Lin R, 174(5):649-59. Nature Structural & Molecular Biology. Weltman M, George J et al. Which 15. Claveria-Gimeno R, Vega S, Grazu V, 1997; 4(6):463-7. patients with hepatitis C develop liver de la Fuente JM, Lanas A, Velazquez- 5. Di Bartolo I, Angeloni G, Ponterio E, complications?. Hepatology. 2000; Campoy A et al. Rescuing compound Ostanello F, Ruggeri FM. Detection of 31(2):513-20. bioactivity in a secondary cell-based hepatitis E virus in pork liver sausages. screening by using γ-cyclodextrin as a

120 Journal of Medicine and Life Vol. 8, Special Issue 3

molecular carrier. International Journal of Pakistan. Pakistan Journal of Zoology. antibodies in two metropolitan emergency Nanomedicine. 2015; 10:2249. 2014; 46(1):270-2. departments in Germany: a prospective 16. Hoofnagle JH. Hepatitis C: the clinical 25. Akinbolaji TJ, Adekoya-Benson T, screening analysis of 28,809 patients. spectrum of disease. Hepatology. 1997; Akinseye FJ, Odeyemi FA, Adegeye PloS one. 2012; 7(7):e41206. 26(S3):15S-20S. FO, Ojo OI. Prevalence of Hepatitis B 34. Alavian SM, Gholami B, Masarrat S. 17. Shakeri MT, Nomani H, Mobarhan MG, Virus and Hepatitis C Virus Co-Infections Hepatitis C risk factors in Iranian Sima HR, Gerayli S, Shahbazi S et al. among Ekiti People in South-Western volunteer blood donors: A case–control The prevalence of hepatitis C virus in Nigeria. International Journal of Health study. Journal of Gastroenterology and mashhad, iran: a population-based study. Sciences and Research (IJHSR). 2015; Hepatology. 2002; 17(10):1092-7. Hepatitis Monthly. 2013; 13(3). 5(3):121-6. 35. Fattahi MR, Safarpour A, 18. Alavian SM, Adibi P, Zali MR. Hepatitis 26. Hope V, Eramova I, Capurro D, Sepehrimanesh M, Asl SMKH, C virus in Iran: Epidemiology of an Donoghoe M. Prevalence and estimation Mohamaddoust F. The Prevalence of emerging infection. Arch Iranian Med. of hepatitis B and C infections in the WHO Hepatitis C Virus Infection and Its Related 2005; 8(2):84-90. European Region: a review of data Risk Factors Among the Rural Population 19. Alavian SM, Ahmadzad-Asl M, focusing on the countries outside the of Fars Province, Southern Iran. Hepatitis Lankarani KB, Shahbabaie MA, European Union and the European Free Monthly. 2015; 15(2): e24734. Bahrami Ahmadi A, Kabir A. Hepatitis C Trade Association. Epidemiology and 36. Mohebbi SR, Sanati A, Cheraghipour infection in the general population of Iran: Infection. 2014; 142(02):270-86. K, Nejad MR, Shalmani HM, Zali MR. a systematic review. Hepat Mon. 2009; 27. Kuniholm MH, Jung M, Everhart JE, Hepatitis C and hepatitis B virus infection: 9(3):211-23. Cotler S, Heiss G, McQuillan G et al. epidemiology and risk factors in a large 20. Merat S, Rezvan H, Nouraie M, Jafari E, Prevalence of hepatitis C virus infection in cohort of pregnant women in Lorestan, Abolghasemi H, Radmard AR et al. US Hispanic/ Latino adults: results from West of Iran. Hepatitis Monthly. 2011; Seroprevalence of hepatitis C virus: the the NHANES 2007–2010 and HCHS/ 11(9):736. first population-based study from Iran. SOL studies. Journal of Infectious 37. MacDonald MA, Wodak AD, Dolan KA, International Journal of Infectious Diseases. 2014; jit672. van Beek I, Cunningham PH, Kaldor Diseases. 2010; 14:e113-e6. 28. Kinnard E, Taylor L, Galárraga O, JM. Hepatitis C virus antibody prevalence 21. Zamani F, Sohrabi M, Poustchi H, Marshall B. Estimating the true among injecting drug users at selected Keyvani H, Saeedian FS, Ajdarkosh H prevalence of hepatitis C in rhode island. needle3_2015_draft and syringe programs in Australia, et al. Prevalence and risk factors of Rhode Island Medical Journal 2013. 1995-1997. Collaboration of Australian hepatitis C virus infection in amol city, 2013; 96(7):19-24. NSPs. The Medical Journal of Australia. north of iran: a population-based study 29. Daw MA, El-Bouzedi A. Prevalence of 2000; 172(2):57-61. (2008-2011). Hepatitis Monthly. 2013; hepatitis B and hepatitis C infectioniss in 38. Orman ES, Fried MW. Hepatitis C viral 13(12). Libya: results from a national population infection in patients with hemophilia and 22. Takeuchi LC, Pham TK, Katz AR. based survey. BMC Infectious Diseases. hemolytic disorders. Clinical Liver Hepatitis C Virus Antibody Prevalence, 2014; 14(1):17. Disease. 2012; 1(3):95-7. Demographics and Associated Factors 30. Sandhu R, Dahiya S. Prevalence of Anti- 39. Vidales-Braz BM, da Silva NMO, Lobato among Persons Screened at Hawaii Hepatitis C Virus Antibodies among R, Germano FN, da Mota LD, Barros EJ Community-based Health Settings, 2010- Inpatients and Outdoor Attendees of a et al. Detection of hepatitis C virus in 2013. Hawaii Journal of Medicine & Public Tertiary Care Institute. Advanced patients with terminal renal disease Health. 2015; 74(1). Biomedical Bulletin. 2015; 3(1):08-14. undergoing dialysis in southern Brazil: 23. Balter S, Stark J, Kennedy J, 31. Alavian S, Fallahian F. Epidemiology of prevalence, risk factors, genotypes, and Bornschlegel K, Konty K. Estimating the Hepatitis C in Iran and the World. Shiraz viral load dynamics in hemodialysis prevalence of hepatitis C infection in New E Medical Journal. 2009; 10(4):162-72. patients. Virology Journal. 2015; 12(1):8. York City using surveillance data. 32. Sharifi-Mood B, Metanat M. Co-infection Epidemiology and Infection. 2014; HIV/ AIDS and hepatitis C. International 142(02):262-9. 8_specialJournal of Virology. 2006; 2(1):63-6 . 24. Tabassum F, Ali B, Khurshid R, Khokar 33. Vermehren J, Schlosser B, Domke D, I. Prevalence of antibodies to hepatitis C Elanjimattom S, Müller C, Hintereder G virus among the population of Lahore city, et al. High prevalence of anti-HCV

JML_Volume

121 Journal of Medicine and Life Vol. 8, Special Issue 3, 2015 pp. 122-128

Relationship between personality traits and mental health among the staff in Kermanshah University of Medical Sciences, 2015

Ziapour A*, Kianipour N** *Social Development & Health Promotion Research Center, Kermanshah University of Medical Sciences, Kermanshah, Iran, **Research Committee, Kermanshah University of Medical Sciences, Kermanshah, Iran

Correspondence to: Kianipour N, MD, Students Research Committee, Kermanshah University of Medical Sciences, Kermanshah, Iran, Kermanshah, Iran, Phone: (+98) 9126880851, E-mail: [email protected]

Received: March 14th, 2015 – Accepted: June 18th, 2015

Abstract Workplace stress affects the mental health of employees and customers can run their occupational safety and health care centers in damage. The employees who are sent to the work place have different characters and different events happen in their life experience. The present study aimed to investigate the relationship between personality traits and mental health among the staff in Kermanshah University of Medical Sciences, the study being performed for the year 2015. In a cross-correlation, 270 employees working in Kermanshah University of Medical Sciences in 2015 were randomly selected and neo3_2015_draft personality traits and mental health questionnaires were completed by Goldenberg. Data in SPSS 21 were analyzed by using descriptive statistics, Pearson correlation coefficient, and Regression testing. Based on the analysis of solidarity, of conscientiousness (R =0/ 332, p <0/ 001), OCD (R =0/ 221, p <0/ 001) and extraversion (p <0/ 001, R= 115/ 0, the mental health of employees showed a significant positive correlation (p <0/ 001). The results of the regression analysis showed that, among the five factorsiss of personality traits, conscientiousness and neuroticism had two variables 14.08 percentage change criterion variables (mental health) to significantly predict staff (p <0/ 001). It seemed to support an increased employment rate and provide psychiatric and psychological counseling for employees with improved facilities and, their income could improve their general health and thus improve the efficiency of the quality of health services provided.

Keywords: mental health, personality traits, employees

Introduction of the overall burden disease it was predicted that in 2020 the share of the overall burden of mental disorders and Mental health 8_specialneurological diseases will increase by 50% to 15% of the In fact, the aspect of the concept of health is time, 10.5% of the patients being alone straw convention based on methods and strategies of preventing the [7,8]. Therefore, the way to mental health in all areas of development of mental illness; moreover, treatment and personal, social and employment matters [9,10]. rehabilitation are used [1]. In other words, the mental Considering that mental health is one of the pillars of health of the successful performance of mental function health, life requires a useful, effective and satisfactory results in fruitful activities, satisfying relationships with the individual by promoting mental health in particular others, the ability to adapt to change and cope with population segments that require an effective and adversity [2,3]. The mental health refers to the feeling of constructive dynamics, development and promotion of the wellbeing and ensures the effectiveness, self-reliance, community [11,12]. Being one of the areas of mental and self-actualization capacity, competition, intellectual health, it is important to mention the characteristics of the and emotional potential, etc. [4,5]. Today, in most character. The character is the most fundamental concept countries, the attempt to industrialization and increasing of psychology. Psychology is a field that examines the urbanization and migration could be seen in these characteristics of individual characters, both emotional fundamental changes from day to day stress and mental and behavior, and are usually fixed, predictions being JML_Volumehealth problems and, increased social communities and followed in daily life [13]. With regard to the first and most the world witnessed major changes in stem epidemiology important component of paced organization, human of the disease. The health needs such as mental illness subjects with their different personalities, motivations, and premature death are not the early causes of disability abilities, attitudes, beliefs and ideas are really important now [6]. Based on the findings of mental disorders as one components that make up the human personality, of the most important and most meaningful components expectations, etc., and expect people and also the Journal of Medicine and Life Vol. 8, Special Issue 3, 2015

organization to be determined [14]. Thus, without a in the headquarters of Kermanshah University of Medical detailed knowledge of the individuals, a fit between Sciences and Health Services, in 2015. Based on the personality and job creation will not be possible and it will sampling table by Krejcie & Morgan, the volume of the be a problem that many organizations grapple with sample was of 270 (130 males and 137 females). A [15,16]. Since the work force is one of the largest sources simple random sampling was performed with the use of a of funding for each organization, health having the role of table of random numbers. The inclusion criteria were increasing the efficiency, any planning and investment in based on a consent to participate in the study, have at the sector leads to the maintenance and improving of the least a secondary school degree and a work experience health of employees and it can eventually lead to an of two years in the University and the desire to participate increased efficiency and return the investment associated in the study. with it. An effective management cannot be achieved without the attention to the health of the employees, and if Measuring tool the enterprise forgets the human dimension of the work Questionnaire: To determine the characteristics of the environment and leads it to an acceptable level of population, a questionnaire containing demographic performance by adopting various ways, the staff characteristics (sex, age, education and work organizations have features such as abnormalities, experience), was used. physical and nervous diseases waiting for the opportunity to live up to their psychological distress negligence, Big Five Personality Factors Questionnaire: to absence, rumors and character assassination [17,18]. measure the Big Five personality, the (NEO-PI-R) NEO Therefore, the mental health staff uses appropriate Personality Inventory-Revised was used. methods to eliminate disruptive factors of mental health A personality test was based on a factor analysis and efficient deployment of forces in organizations is performed in 1985 by Paul T. Costa and Robert Armak influenced by personality traits [19-22]. Mental health staff McCrae from the National3_2015_draft Institute of Health in the Aging and managers monitor such practices, quality of life, Research Center in Baltimore, Maryland [31]. This test of performance management, and in particular the 60 items was based on Likert scale (1 = strongly disagree, characteristics of the affected person [22-24]. Personality 2 = disagree,iss 3 = somewhat, 4 = agree, 5 = strongly traits, including (OCD, extraversion, agreeableness, agree) and was designed as one of the Big Five openness and conscientiousness), in turn, play a role in personality 12 Items (OCD, extraversion, agreeableness, mental health, followed by the plays [19,25,26]. Research openness and conscientiousness), the measured and has shown that employees, have, beside their external calculated scores for each factor and the five scores characteristics, a far better relationship with the other obtained [32-34]. A narrative content to Costa and employees, resulting in an improved performance and a McCrae (1992), was reviewed having a 90/ 0 reliability for better health system [19-22,25,27]. On the other hand, neuroticism, extraversion equal to 0/ 78 to 0/ 76 to according to the categories of individuals, an organization openness, agreeableness equal to 0/ 86 and 0/ 90 can help organizations achieve efficiency [28,29]. responsibility to report [31]. This test was performed after Achieving the objectives of the organization represents an being translated and adapted from Persian [35]. Gross action based on force capabilities in the implementation of Carpet in Iran (2001) confirmed the five-factor structure of the tasks assigned and the versatility8_special of a changing the questionnaire as a whole and its internal consistency environment. In the meantime, according to the director, by Cronbach’s coefficients reported for the main factors the characterization of the people make the staff work so were of 0/ 86, 0/ 73, 0/ 56, 0/ 68 and 0/ 87 [36]. The as to fit in the things that they like and thereby their reliability test using Cronbach’s alpha coefficient for the performance and effectiveness of the organization adds to United States was used in a sample of 0/ 93 OCD, this [30]. This study is in line with the existing research extraversion 0/ 87, graceful of 0/ 89, 0/ 76 and flexibility or gap, and, according to the Kermanshah University of conscientiousness and the task of 0/ 86, respectively [37]. Medical Sciences, there has been no study on the Kyamehr validated this questionnaire on 380 students of relationship between employees. Moreover, five factors of Tehran University, the questionnaire with Cronbach’s personality and mental health in Kermanshah University alpha coefficient of internal consistency being between 0/ of Medical Sciences have been analyzed to evaluate the 54 to 0/ 79 acquired [38]. Hejazi et al. (2002) reported an relationship between the five-factor model personality alpha value of 74% [39]. In this study, Cronbach’s alpha (neuroticism, extraversion, openness, agreeableness and coefficient values for OCD were the following: 0/ 91, conscientiousness), all dealing with mental health. extraversion 0/ 78, agreeableness 0/ 76, experience of 0/ Research Methodology 73 (openness to experience) and conscientiousness 0/ 86 JML_VolumeResearch methods, population, and sample: This is a respectively. The options mentioned by Mathias descriptive cross-correlation study. The study sample was questionnaire before were between 0 and 4 (strongly represented by all the employees working in different disagree = 0, disagree = 1, somewhat = 2, somewhat administrative groups (contract, treaty, and formal), and agree = 3, strongly agree = 4). The general range of an upper secondary school with 872 people was formed Mathias questionnaire was between 0 and 240.

123 Journal of Medicine and Life Vol. 8, Special Issue 3, 2015

less than 0/ 05. The calculation of data analysis was General Health Questionnaire Goldenberg (28 - Health performed by using SPSS21 software. Questionnaire = GHQ): General Health Questionnaire by Goldberg was established in 1972 and was built on a Findings screening questionnaire, being based on self-report In this study of 223 patients, 137 (51.3%) were clinical methods set out to trace those who have the males and 130 (48.71%) were femalesThe mean age of the sample was of 0/6/7 ± 38. 41 to 45 years old group, disorder [40-43] The General Health Questionnaire having the highest rate of 64, 24%. In terms of education, contained 28 items in the form of an option. The seven- the samples with the bachelor’s degree were of 64% (171 item questionnaire contained the four subscales of persons). Most of the samples (89, 33.3%) were between Somatic Symptoms, Anxiety and Insomnia, Social 11 and 15 years of service. The mean sample and Dysfunction and Depression Measures [40] Scoring with a standard deviation was of 8.5 years of service ± 17 4-point Likert scale (0 = none to 3 = to submit a more than obliteration of the type of employment relationship, more samples (108, 40. 4%) being contracted (Table 1). usual) took place. Each person in this test received four The results showed that the personality traits scores and the scores were achieved an overall score. In were associated with the greatest and lowest factors, 2004, Noorbala noted the psychometric properties of “personality trait neuroticism” with a mean ± SD of 0.29 internal consistency GHQ, having = 0/ 83 [44]. In 1999, ±3.49 and “personality traits of extraversion” with a mean the internal consistency of the scale, GHQ 85/ 0 was ± SD of 0.37 ± 3.34 (Table 2). highlighted by using Cronbach’s alpha coefficient for In connection with the mental health samples, the results showed that the highest rate of “social somatic symptoms, anxiety and insomnia, 0/ 87, 0/ 79 dysfunction”. The mean and standard deviation was of social dysfunction, symptoms of serious depression of 0/ 0.40 ± 3.31 and the lowest grade for “depression” with the 91 and the total scale of 0/83 representing the public mean and standard deviation3_2015_draft was of 0.39 ± 2.60 (Table health [45]. In 2004, Rumi carried out the test on 116 2). Iranian students and the analysis of the questions in the Regarding the relationship between the questionnaire, Cronbach’s alpha reaching a value of 91/ personality traits,iss the mental health of employees and significant were of (R = 0.328, p < 0.001). Also, the 0. In 1994, Jacob validated the test on 625 residents in conscientiousness personality trait most related to OCD urban and rural areas and Some’esara used the simple was R = 0.332, p <0. 001 and the character traits of the Likert scoring method of sensitivity and specificity of the lowest possible relationship with OCD experience (R = test in the best cut off point of 23, respectively of 0/5/86 0.072, p>0. 001) (Table 3). and 0/ 82 [46] The range of Mathias’ questionnaire was between 0 and 84. Regarding Cronbach’s alpha, the Table 1. Characteristics of individual samples reliability was of 0/ 898 in the present study, indicating Frequency (percent) Groups Demographic 137 (3/ 51) Man that the questionnaire had a good reliability and internal Gender solidarity. To gather information, the necessary permits 130 (7/ 48) Woman were obtained from the Department 8_specialof Science and 66 (7/ 24) ≥ 30 Technology of the University of Origin and from the 41 (4/ 15) 35-31 42 (7/ 15) 40-36 responsible staff from the university. At first, the aim of Age (years) this study was to describe people and ethics by filling in a 64 (24) 45-41 questionnaire and ensuring the necessary part concerning 47 (6/ 17) 50-46 the confidentiality of personal information. Moreover, a 7 (6.2) ≤ 50 consent to participate in the study sample was signed. 18 (7/ 6) Diploma The consent of the people to participate in the study and 35 (1/ 13) Degree who had at least a high school diploma qualification, a 171 (64) License work experience of two years in the University were Master’s Education respectively taken into account. After completing the 28 (5/ 10) degree or higher questionnaire, the data were analyzed and descriptive 15 (6.5) PhD statistics (frequency, mean, and standard deviation) and 10 (7.3) ≥ 5 inferential statistics were used. The mental health of JML_Volume 19 (1/ 7) 10-6 multiple linear regressions was used to determine the Work experience 89 (33.3) 15-11 relationship between the five dimensions of personality (years) variables. A significant level of interest in this study was 70 (2/ 26) 20-16 79 (6/ 29) ≤ 21 Table 2. Index of statistical variables

124 Journal of Medicine and Life Vol. 8, Special Issue 3, 2015

Minimum, Variable Index scale The mean (SD) maximum OCD (N) 49/ 3 (29/ 0) 42/ 2.4 Openness O 49/ 3 (27/ 0) 50/ 2.4 Agreeableness A 44/ 3 (31/ 0) 58/ 2.4 Personality traits Loyalty C 38/ 3 (31/ 0) 25/ 2.4 Extroversion E 34/ 3 (37/ 0) 25/ 2.4 General characteristics 43/ 3 (16/ 0) 92/ 2.87/ 3 Impairment of social functioning 31/ 3 (40/ 0) 67/ 1.4 Physical symptoms 03/ 3 (41/ 0) 86/ 1.4 Mental Health Anxiety and sleep disorders 99/ 2 (56/ 0) 67/ 1.4 Depression 60/ 2 (39/ 0) 43/ 1.57/ 3 Mental health 98/ 2 (28/ 0) 04/ 2.57/ 3

As it can be seen in Table 2, the findings personality traits the personnel desired. Also, the mental indicated that the highest scores of the five personality health variable, the highest mean and SD criteria related traits, employees, the personality trait neuroticism, with a to social dysfunction (Mean = 3.31, SD = 0.40) and the mean deviation criterion (mean = 3.49, SD = 0.29) and lowest mean and SD criteria for depression (Mean = 2.60, the lowest index of the character traits of extroversion with SD = 0.39), was allocated. In the mean deviation criterion a mean deviation criterion being of (mean = 3. 34, SD = the mental health staff range was (Mean = 2.98, SD = 0.37). The mean total measure personality traits 0.28). employees was of (mean = 3.43, SD = 0.16), meaning the 3_2015_draft

Table 3. Pearson correlation coefficients between personality and students happiness Hypothesis Independent variable Dependent variable issCorrelation coefficient Sig (2-tailed) Conscientiousness 1 Mental Health 0.332** 0.000 (conscientiousness) 2 Neuroticism (OCD) Mental Health 0.221** 0.000 3 Extroversion (extroversion) Mental Health 0.115** 0.041 Openness to experience (the 4 Mental Health 0.099** 0.105 experience of) 5 Agreeableness (Agreeableness) Mental Health 0.072** 0.242 6 (Total) Personality characteristics (Total) Mental Health 0.328** 0.000 Correlation was significant at 0.01 (2-tailed)

As shown in Table 3 (R = 0,8_special p <0.001). The had the lowest possible correlation with the mental health personality trait conscientiousness presented the (R = 0. 072, p>0.001). Generally, the relationship between strongest relationships with the mental health (R = 0. 332, the personality traits and for example, the mental health of p <0.001). In addition, the personality trait agreeableness employees, is significant.

Table 4. Explanation of the mental health of employees based on personality traits The coefficient of Statistical indicators Multiple correlation The coefficient of determination of the net SEM models Model 1 coefficient determination R2 R Amounts 0/385 0/148 0/142 0/26121

Table 5. Explanation of the coefficients of the variables affecting the mental health of employees Standardized Unstandardized Coefficients Sig t Coefficients Variables Beta Std. Error B JML_Volume0.000 5.315 - 0.254 1.384 (Constant) 0.000 5.552 0.316 0.050 0.280 Conscientiousness Duty 0.001 3.423 0.195 0.057 0.197 Neuroticism OCD

125 Journal of Medicine and Life Vol. 8, Special Issue 3, 2015 pp. 122-128

The multiple regression analysis method This means that people who have a high mental health (Stepwise) according to Table 4, and in anticipation of the extraversion score better. In other words, by increasing total mental health variables remained significant in the the extroversion personality characteristics, the rates of second step. The multiple correlation coefficient was mental health increase as well. It can be concluded that equal to R = 0/ 385, coefficient of determination R2= 0/ extraverts are happy, energetic and optimistic people, 148 and the coefficient of determination of the net R2 = 0/ 142 was obtained. The significant influence of the willing to interact with others, for them life is movement variables in the model, up to about 14.8% of the variance, and emotion of desire and a demand to the environments could be explained by the mental health staff. The and positive emotions [55]. According to this explanation, standard Beta coefficients of the variables to be it can be deduced that this group of people have social considered were the following: conscientiousness with skills and interact with other mental health and more. The Beta β =0/ 316 and neuroticism with beta β=0/ 195. The results of this part of the research study were underlined highest correlation in predicting the mental health scores by A. et al., 2009; Goodwin and Friedman, 2006; Ansell et were, in fact, due to the low score and indicated a high al., 2007 [19,49,55]. According to Gupta & Kumar, the level of mental health and mental health of individuals. In extroversion leads to enjoyment and participation in social fact, conscientiousness and neuroticism was positively correlated with the level of mental health. activities. Therefore, it can be assumed that the extroverted people are happier because they share their inner feelings with others and their minds are occupied Discussion with different things so that they cannot just focus on the negative experiences [56]. Larsen & Keterlaar also The aim of this study was to investigate the suggested that extroverted people more than introverted relationship between the personality and the mental people respond positively3_2015_draft to stimuli and are stronger. health of employees in Kermanshah University of Medical Therefore, when these people find themselves in Sciences. The results showed there was a significant enjoyable situations they express more positive feelings relationship between neurosis and mental health (R = 0/ [57]. The resultsiss of the regression analysis in this study 221). The findings of most previous studies in this area showed that the components of the five personality [47-52] were highlighted. Taking into account these factors that were predicted for the component of overall findings, it could be argued that people with neuroticism health of employees are the following: conscientiousness subscale, the high scores people are anxious, depressed, and OCD. In fact, according to the prioritization of the have a sense of guilt in a variety of fields, low self- importance of predictive factors, conscientiousness and esteem, are woven, unreasonable, shy and moody [53]. neuroticism are the most important factors in predicting They are also prone to irrational beliefs, and are not able mental health. The openness and agreeableness to control their impulsivity and stress. According to this variables were significantly associated with mental health explanation, it can be concluded that employees with high in this study. The findings of some studies [58-59] were neuroticism, anxiety and depression because of the veins, 8_specialconsistent in this regard. are more likely to reduce the overall health. The results of this study showed that there is a positive significant relationship between conscientiousness and extroversion Conclusion features and components of the mental health staff. It The highest and lowest average characteristics could be stated that the relationship between of workers are “neuroticism” and “extroversion”, conscientiousness and the mental health of employees is respectively. The rate of mental health, as well as “social significant (R = 0/ 332). The findings of the studies dysfunction” more and “depression” are the least met [48,50,53,54] were consistent. It could be concluded that among the employees. The personality trait of people with a high conscientiousness, are careful, conscientiousness and neuroticism are two dimensions meticulous, punctual, reliable and able to control their significantly associated with mental health and mental impulses favorably [18,50]. So, it could be concluded that health among predictor variables. This seems to support the optimal ability to control impulses, stresses and an increased employment and provide psychiatric and coping with social situations in people with higher scores psychological counseling for employees with improved JML_Volumein the subscales of openness to experience and facilities and their income can improve their general health and thereby improve the quality of health services conscientiousness earned more areas to improve their provided by them. overall health provision. The results showed that the The current study faced several constraints. In correlation between extroversion and a significant positive this study, the use of self-report data was collected, but correlation with the mental health staff was (R = 0/ 115). the method might have affected the accuracy of the Journal of Medicine and Life Vol. 8, Special Issue 3, 2015

results. In addition, with regard to the subjects of this Medical Sciences, the results cannot be generalized to study, the employees of Kermanshah University of other employees of other universities of medical sciences.

References

1. The World Health Reports. Mental nursing: a literature review. Br J Nurs. utilization. Personal Ment Health. health: new understanding, new hope. 2008 Jan 24-Feb 13; 17(2):82-7. 2008; 2(4):207–217. Geneva: World Health Organization, 12. Braithwaite R, Delevi R, Fincham D. 22. Shirazi M, Khan MA, Ansari MF. 2013, Romantic relationships and the Mental health in relation to personality http://discovermagazine.com/2000/oct physical and mental health of college characteristics among professional /featworld. students. Personal Relationships. and non-professional students. 2. Lambert VA, Lambert CE. Literature 2010; 17:1-12. Journal of Arts, Science and review of role stress/strain on nurses: 13. Montes-Berges B, Augusto JM. Commerce. 2012; 3:8-15. an international Exploring the relationship between 23. Takahashi M, Sawada S, Araki S. Perspective. Nurs Health Sci. 2001; perceived emotional intelligence, Work organization and workers’ safety 3:161-72. coping, social support and mental and health. Industrial Health. 2008; 3. Burns JK. The mental health gap in health in nursing students. Journal of 46(2):103-4. South Africa: A human rights issue. Psychiatric and Mental Health 24. Zeinder M, Matthews G, Roberts The Equal Rights Review. 2011; 6:99- Nursing. 2007; 14(2):163-71. RD. What we know about emotional 113. 14. Kim H, Shi KH, Swanger N. Burnout intelligence: how it acts learning, work, 4. Dhuria M, Sharma N, Taneja DK, and engagement: A comparative relationships, and mental health. Kumar R, Ingle GK. Assessment of analysis using the Big Five personality 2009, Massachusetts, The MIT Press, mental health status of senior dimensions. Int. J. Hosp. Manage. 182-190. secondary school children in Delhi. 2009; 28:96-104. 25. 3_2015_draftMiller JD, Pilkonis PA, Mulvey EP. Asia Pac J Public Health. 2009; 15. Giluk TL. Mindfulness, Big Five Treatment utilization and satisfaction: 21(1):19-25. personality, and affect: A meta- examining the influences of axis II 5. Sharma M, Romas JA. Theoretical analysis. Personality and Individual psychopathology and the five-factor foundations of health education and Differences. 2009; 47:805–811. iss model personality. Journal of health promotion, 2008, Sudbury, 16. Krueger RF, Eaton NR, Derringer J, Personality Disorders. 2006; 20:369– USA, Jones and Bartlett Publishers, Markon KE, Watson D, Skodol AE. 387. 85-100. Personality in DSM–5: Helping 26. Cohen NL, Ross EC, Bagby RM, 6. Hashemi Nazari SS, Khosravi J, Delineate Personality Disorder Farvolden P, Kennedy SH. The 5- Faghihzadeh S, Etemadzadeh SH. A Content and Framing the factor model of personality and survey of mental health among fire Metastructure. Journal of Personality antidepressant medication department employees by GHQ-28 Assessment. 2012; 93(4):325-331. compliance. The Canadian Journal of questionnaire in 2005, Tehran-Iran, 17. Lee MS, Lee MB, Liao SC, Chiang Psychiatry. 2004; 49:106–113. Hakim. 2007; 10(2):56-64. FT. Relationship between mental 27. Yen CF, Hsu CC, Liou SC, Huang 7. MacKean G. Mental Health and Well- health and job satisfaction among CF, Ko CH, Yen JY, Cheng CP. Being in Postsecondary Education employees in a medical center Relationships among Mental Health Settings: A Literature and department of laboratory medicine. Status, Social Context, and Environmental Scan to Support Journal Formos Med Assoc. 2009; Demographic Characteristics in Planning and Action in Canada. 8_special108(2):146-54. Taiwanese Aboriginal Adolescents: A CACUSS Pre-Conference Workshop: 18. Nordin NM, Talib MA, Yaacob SN. Structural Equation Model. Psychiatry Student Mental Health: A Call to Personality, loneliness and mental and Clinical Neurosciences. 2006; Action, Toronto, 2011. health among undergraduates at 60:575-583. 8. Westerhof G, Keyes C. Mental Malaysian Universities. European 28. McCrae RR, Costa PT. The five Illness and Mental Health: The Two Journal of Scientific Research. 2009; factor theory of personality. In John Continua Model across the Lifespan. 36:285-298. OP, Robies RW, Pervin LA. Handbook Journal of Adult Development. 2010; 19. Ziapour A, Sharafi K, Sharafi H, of Personality Psychology. 2008, New 17:110-119. Kiani pour N, Moradi SH. The study York Guilford, 159-181. 9. Ghodasara SL, Davidson MA, Reich of organizational health and social 29. Gomez V, Krings F, Bangerter A, MS, Savoie CV, Rodgers SM. factors associated with (Case study: Grob A. The influence of personality Assessing student mental health at Among the staff Kermanshah and life events on subjective wellbeing the Vanderbilt University School of University of Medical Sciences and from a lifespan perspective. Journal of Medicine. Acad Med. 2011; 86(1):116- Health Services in 2013) (One study Research in Personality. 2008; 21. Cross). Technical Journal of 43:345-354. 10. Cheng Y, Kawachi I, Coakley EH, Engineering and Applied Sciences, 30. Wismeijer A, Assen MV. Do Schwartz J, Colditz G. Association 2015; 5 (1): 147-156. neuroticism and extraversion explain between psychosocial work 20. Hampson SE, Friedman HS. the negative association between self- JML_Volumecharacteristics and health functioning Personality and health. In John OP, concealment and subjective well- in American women: prospective Robins RW, Pervin LA. Handbook of being?. Personality and Individual study. BMJ. 2000 May 27; personality. 2008, New York, Guilford, Differences. 2008; 45:345-349. 320(72):1432-6. 770-794. 31. Costa PT, McCrae RR. Influence of 11. Dickinson T, Wright KM. Stress and 21. Christopher J, Hopwood BD, extraversion and neuroticism on burnout in forensic mental health Quigley CM Grill et al. Personality subjective well-being: happy and traits and mental health treatment unhappy people. Journal of

127 Journal of Medicine and Life Vol. 8, Special Issue 3, 2015

Personality and Social Psychology. 41. Behjati Ardekani Z, Akhoundi MM, psychological health conscious now of 1980; 38:668-678. Kamali K, Fazli Khalaf Z, Eskandari the University of Tabriz. Journal of 32. Hopwood CJ, Thomas KM, Markon Sh, Ghorbani B. Mental health status Mental Health Research. 2008; KE, Wright AG, Krueger RF. DSM-5 of patients attending avicenna 1(4):281-288. personality traits and DSMIV Infertility Clinic. J Reprod Infertil. 52. Swami V, Chamorro Premuzic T, personality disorders. Evaluation 2010; 11(4):319-24. Sinniah D, Maniam T, Kannan K, Studies Research Support, N.I.H., 42. Esteva M, Larraz C, Jiménez F. Stanistreet D, Furnham A. General Extramural. J Abnorm Psychol. 2012; Mental health in family doctors: effects Health Mediates The Relationship 121(2):424-432. of satisfaction and stress at work. Rev between Loneliness, Life Satisfaction 33. Roberts BW, Walton KE, Clin Esp. 2006; 206:77-83. and Depression. Soc Psychiatry Viechtbauer W. Patterns of mean- 43. Miller JD, Pilkonis PA, Mulvey EP. Psychiatr Epidemiol. 2007; level change in personality traits Treatment utilization and satisfaction: (42):161166. across the life course: a meta-analysis examining the influences of axis II 53. Tosun LP, Lajunen T. Dose Internet of longitudinal studies. Psychol Bull. psychopathology and the five-factor Use Reflect Your Personality?. 2006; 132:1–25. model personality. Journal of Relationship between Eysenks 34. Gramstad TO, Gjestad R, Haver B. Personality Disorders. 2006; 20,369– Personality Dimensions and Internet Personality traits predict job stress, 387. Use. Computer in Human Behavior. depression, and anxiety among junior 44. Noorbala AA, Bagheri Yazdi SA, 2010; 26(2):162167. physicians. Gramstad et al. BMC Yasamy MT, Mohammad K. Mental 54. Okwaraji FE, Onyebueke GC, Medical Education. 2013; 13(150):1-9. health survey of the adult population Aguwa EE. Personality Traits, 35. Haghshenas H. Five factor in Iran. Br J Psychiatry. 2004; 184:70- Loneliness and Mental Health among personality characteristics project. 1st 7. HIV Clinic Attendees in a Nigerian ed., 2006, Shiraz: Shiraz University of 45. Homan HA. Psychometric properties Tertiary Health Institution. Journal Medical Sciences, 17-34. of general health questionnaire on Psychiatry. 2014; 18(1):1-7. 36. Garousi Farshi MT, Mehriar AM, student of Tarbiat Moallem University. 55. Abdulkarim NS, Zamzuri NH, Ghazi Tabatabai M. The use of neo Student counseling Tehran University Muhamadnor Y. Exploring the personality test and analysis of research, 1999, 12-5. Relationships, between Internet Ethics features and its factor structure 46. Yaghobi N, Nasr M, Shah Mohamadi 3_2015_draftin University Students and Big Five of among Iranian university students. J D. Epidemiological study of mental Personality. Computer & Education. Humanities Res Alzahra. 2001; disorders in urban and rural areas 2009; 53(1):8689. 11(39):173-98. Some’esara. Journal Thought and 56. Gupta SD, Kumar D. Psychological 37. John OP, Nauman LP, Soto CJ. Behavior. 1994; 1(4):55-56. iss correlates of happiness. Indian Paradigm shift to the integrative Big 47. Sharma M, Kaveri, Sharma NR, Journal of Social Science five taxonomy: History, Measurement Yadava A. Personality Factors as Researches. 2010; 7(1):60-64. and conceptual issues. In John OP, Correlates of Health among Adults. 57. Larsen RJ, Keterlaar T. Personality Robin RW, Pervin LA. Handbook of Journal of the Indian Academy of and susceptibility to positive and personality. Theory and research. Applied Psychology. 2010; negative emotional Statues. Journal of 2008, Guilford Press, New York, 114- 36(2):328333. Personality and Social Psychology. 158. 48. Haslam N, Whelan J, Bastian B. Big 1991; 61:132-140. 38. Kiamehr J. Short Form questionnaire Five Traits Mediate Associations 58. Ziapour A, Zokaei AH, Mohammadi Standardization NEO. FFI and factor between Values and Subjective Javid N, Mohammadi Javid P, structure among students of Tehran WellBeing. Personality and Individual Mohammadi Javid N, Haydar Pour University. Master thesis. Tehran: Differences. 2009; (46):4042. B. Association between Personality Allameh Tabatabai University, Faculty 49. Goodwin RD, Friedman HS. Health Traits and Social Laziness: (Case of Psychology and Educational Status and the FiveFactor Personality Study: Staff of Kermanshah University Sciences, 2002. 8_specialTraits In A Nationally Representative of Medical Sciences in 2014). 39. Hejazi Y, Iravani M. The relationship Sample. Journal of Health Technical Journal of Engineering and between personality traits and job Psychology. 2006; 11(5):643654. Applied Sciences, 2015; 5 (1): 49-54. performance. Journal of Psychology 50. Ahmadi KH, Nejati V, Abdi MR. 59. Takalo F, Ahmad K, Ziapour A. and Educational Sciences. 2002; Comparison of public health and its Relationship between components 32(2):171-189. relationship with personality traits in Five Factor Model of Personality and 40. Goldberg DP, Hiller VF. A scaled adolescents. Guilan University of Social laziness employees version of the Goldberg & Hiller Medical Sciences. 2012; 21(81):26- Kermanshah University of Medical Questionnaire. Psychological 36. Sciences in 2014. Journal of Clinical Medicine. 1979; 9:139-145. 51. Abdi S, Babapvrkhyraldyn G, Sadri Reseaech in Paramedical Sciences, Oskoee E. The relationship between 2015; 4(1): 43-51. personality characteristics &

JML_Volume

128 Journal of Medicine and Life Vol. 8, Special Issue 3, 2015, pp.129-133

Relationship between ethical leadership and psychological empowerment: perspectives of hospital nurses in Imam Reza (AS) Kermanshah, 2015

Cheraghi R, Mohammadi M, Mohammadi E, Esfandnia F, Bayat R, Esfandnia N, Esfandnia A Student Research Committee, Kermanshah University of Medical Sciences, Kermanshah, Iran

Correspondence to: A Esfandnia, MD, Student Research Committee, Kermanshah University of Medical Sciences, Kermanshah, Iran, Kermanshah University of Medical Sciences, Iran, Phone: +989189464518, E-mail: [email protected]

Received: March 14th, 2015 – Accepted: June 18th, 2015

Abstract Background. The purpose of this study was to prove the relationship between the moral leaders of the psychological empowerment perspectives of nurses in Imam Reza (AS) Kermanshah Hospital in 2015. Methods.This was a cross-sectional study. The required data were collected at the beginning of the towering use of the Internet search and library. Data related to the population were gathered by using questionnaires. Standard data were collected. The population of the study included all formal hospital-training nurses, meaning the persons responsible3_2015_draft with the treatment of patients in Kermanshah University of Medical Sciences, respectively 550. According to the formula of the Cochran, 226 questionnaires were simple random Bayat samples; 219 questionnaires were distributed, used, and returned from the final population. The reliability and their validity were already under investigation and confirmation. Results. The results showed a psychological relationship between the ethical leadershipiss and the enabling nurses. There was also a significant (sig = .000). Moreover, there was a positive and significant relationship [sig = .000] between the moral leader and enabling the psychological aspects of the nurses. Discussion. According to the findings of this study, it could be said that the leader of morality led to the psychological empowerment of nurses. The moral evil leader of the yen means creating trust, job satisfaction, increased efficiency and it activates the effective organizational goals.

Keywords: moral leader, psychological empowerment, Imam Reza hospital

Introduction need for a coherent and integrated approach, which is based on the extent and quality of care, the comment on Psychological empowerment is8_special regarded in the that, feeling, etc. Clinical governance is important to sense of understanding the meaning, competence, self- realize the best possible cover [11]. In addition, the health determination, and efficiency in the short job [1-3], while care management literature has a common view being interpreted as a mental state and intrinsic emerging from the lack of a sense of psychological motivation. The way employees feel about their work empowerment, doctors being able to increase cognitive control [1] and the emotions arising from intrinsic stress, absenteeism, and lower job satisfaction [12]. A motivation turn them into active members of the review of literature regarding the way new leadership organization [4]. The concept of psychological suggested that organizational leaders instilled positive empowerment represents the knowledge as a means of thinking was performed, by showing respect for encouraging employees regarding the job requirements, employees, interpersonal skills, inspiration, etc., and their thinking, sense of duty, their level of understanding ethics influenced subordinates follow their cause [13]. and competence, their upgrade [5]. The research review Due to these factors, moral leadership is direct and was made on the use of psychological empowerment, the through clinical governance, its background creation, and cognitive care showing the link between the variable promotion of mental empowerment is cognitive. Nurses, JML_Volumequality of health care [6] among nurses [7] and doctors the largest human resources in most organizations and [8,9], respectively. It is important to note here the number health play a major role in the quality of services [14] and of deaths, patient satisfaction, recovery patients, providing represent the bulk of the responsibility for their care. information to patients, privacy, and the likelihood that Therefore, the importance of informed leadership on they will be used in evaluating the quality of patient care, health care, especially in nursing, is clearly apparent [15]. the valid index not working properly [10]. Thus, there is a A look at the style of leadership implies the existence of a Journal of Medicine and Life Vol. 8, Special Issue 3, 2015

variety of other styles, which are newer in terms nature ethical leadership and psychological empowerment from and emphasis of style [16]. The opening leg of the third the perspective of hospital nurses in Imam Reza (AS), millennium was the supplier of moral leadership. By Kermanshah, in 2015. definition, moral leadership is “Showing a normative behavior through personal actions and interpersonal Methods relationships and promoting this kind of behavior among the followers through bilateral communication, This study was cross-sectional and performed in encouragement, and decision-making” [17]. The the first half of 2015, in Imam Reza (AS). The data for this characteristics of leadership could be the following: respect for others, serving the others, just being honest, study, as the first to use the library and internet search being a support in the collectivity [18], having developed was collected. The data on population were collected by skills and confidence in subordinates [19], compassion, using a questionnaire and the research was done during fairness, being able to advise followers to adhere and the development of the hospital. The study sample comply with ethical standards and consider the rewards included all registered nurses teaching hospitals - and punishments for ethical and immoral behavior hospitals affiliated to the city of Kermanshah University of [16,20,21], respect and human relations [22]. In fact, Medical Sciences (550 Nurses). According to the formula leading to a variety of skills and techniques in order to of the Cochran, 226 questionnaires were given through a meet challenges, nowadays needs change and new random sampling method, and, 219 sable questionnaires demands [23]. Research suggests that moral leadership were returned. In 2011, Salehniya mentioned the with mental empowerment is cognitively [24] positive and instruments used for data collection: a standard the significant association is important. In 2014, the questionnaire, a questionnaire moral leadership and, results of Moghtadery and Nadi referred to the based on the views of Brown3_2015_draft et al. (2005), the model for relationship between the ethical, psychological empowerment and job satisfaction and the organizational data collection was designed. Validity and reliability of citizenship behavior among the employees of private ethical leadership were reviewed and approved through hospitals in Shiraz, showing that between the ethical the confirmatoryiss factor analysis and Cronbach’s alpha characteristics [ethical climate, ethical leadership and value (0/ 88) [21]. The questionnaire moral leadership moral values], psychological empowerment, job was in the form of ten questions and the three satisfaction and organizational citizenship behavior, there components of interpersonal relationships, their modeling, is a significant positive correlation [25]. In 2014, the and pragmatism was measured. The second survey results of Govna Fathi et al. regarding the modeling of the questionnaire analyzed mental abilities. In 1995, Spritzer relationship between the ethical leadership and the elaborated 12 questions about the meaning and clinical governance psychological empowerment was the significance of four aspects, competence, self- following: perspectives of the nurse’s government determination impact on the range of five degrees Likert hospitals in Kermanshah showed that the was a (1 = strongly disagree to strongly agree = 5) size decision. relationship between the ethical leadership and the 8_specialThe validity and reliability study of psychological clinical governance and mental empowerment from the cognitive point of view. The cognitive relation was empowerment (Golparvar et. al, 2010) was done by using significant regarding the mental empowerment of clinical the confirmatory factor analysis and Cronbach’s alpha governance. The results of the research showed that the value (0/ 89) was examined and approved [24]. ethical leadership regarding the influence of nurses was performed directly and through a clinical governance of Results mental empowerment [26]. In 2013, Mousavi Jad’s research results with the title role of moral leadership in According to demographic data, 58.6% of the empowering mentality showed that there was a significant participants were females and 41.4% males. When the relationship with the dimension empowerment between educational distribution of the participants was examined, the moral leadership and items [27]. In 2012, the results 17.1% had a master degree in science, 46.1% had a of Mahdad regarding the individual emotions, were similar bachelor degree, 25.1% had an associate degree, and to the ones of an association leader, Mir Jafari, with regard to the moral and psychological health of the 11.7% had a regular diploma. 63.2% of the participants JML_Volumeworkplace organizational trust, showing that there is a were married, and 36.8% were single. The distribution of significant and positive relationship between the ethical participants in different age groups was the following: leadership and the organizational trust and the work with 50.1% between the ages of 25 and 30, 19.7% between 31 mental health, mental health workplace organizational and 35 years, 12.5 between 36 and 40 years, 10.4% trust [28]. Considering the above principles, the aim of this between 41-45 years, and 7.3% more than 45 years. study was to investigate the relationship between the 130 Journal of Medicine and Life Vol. 8, Special Issue 3, 2015

Table 1. The relationship between the ethical leadership and the correlation coefficient was .867, the main hypothesis the psychological empowerment dimensions by using Pearson of this study being approved. By using Pearson at 95 Moral percent there was a relationship between the ethical leadership leadership and the psychological empowerment of nurses R 0.867 and there was also a significant positive relationship (sig = Psychological Empowerment Sig. 0.000 .000). The correlation coefficient was no more than .8. N 219 The hypotheses of the sub-study were also approved. R 0.861 Interpersonal Relationships Sig. 0.000 N 219 R 0.852 Pattern Being Sig. 0.000

N 219 Fig. 1 The hypothesis of the study explained R 0.835 Pragmatism Sig. 0.000 Based on the above chart, the moral leadership N 219 has a direct effect: the psychological empowerment (0/ 79), interpersonal relations (0/ 31), pattern (0/ 62) and Based on the table showing the relationship pragmatism (0/ 86) being explained. The impact of the between the ethical leadership and psychological ethical leadership and the component “pragmatism” was empowerment of nurses by using Pearson at 95% of the of 73%. shares, there was a positive relationship (sig = .000) and 3_2015_draft Table 2. Standardized total, direct, and indirect effects: relationships between hypotheses Standardized Total Interpersonal Pattern Pragmatism Moral leadership Effects Relationships Psychological iss 0.247 4.12 0.574 0.787 Empowerment Standardized Direct Interpersonal Pattern Being Pragmatism Moral leadership Effects Relationships Psychological 0.000 0.000 0.000 0.787 Empowerment Standardized Indirect Interpersonal Pattern Pragmatism Moral leadership Effects Relationships Psychological 0.247 0.412 0.574 0.000 Empowerment

Based on the table above, the8_special standard of the relationships, patterns, is pragmatic and the moral whole regarding the relationship between the dimensions leadership rates are 0.000, 0.000, 0.000, and 0.787 of interpersonal relationships, patterns, is pragmatic and respectively. The standardized indirect effects for the the moral leadership rates are 0.247, 0.412, 0.574, and relationship between the dimensions of interpersonal 0.787 respectively. The effects of the standard direct relationships, patterns, were pragmatic and the moral relationship between the size of interpersonal leadership rates were 0.247, 0.412, 0.574, and 0.000.

Table 3. Final fitting: Index research model Standard model Acceptable level Interpretation The result At reception Chi-square CIMIN The chi-square table Chi-square obtained with the chi-square 133.561 Passable table for a certain degree of freedom compared The root mean square error of Younger than 05. Less than 05. A good fit 0312/ 0 Passable estimate [RMSEA] Tucker Lewis TLI Not fitted] to 1 [perfect fit] The amount of nearly 95 a good fit 0792/ 0 Relatively JML_Volume acceptable Chi-square relative CIMIN/ DF 1 to 5 Less than 1 indicates poor fitness levels 2.260 Passable indicate the need for improvement is more than 5 Normalized fit index frugal PNFI More than 5 or 6. 0523/ 0 Passable Comparative fit index frugal PCFI More than 5 or 6. 0525/ 0 Passable

131 Journal of Medicine and Life Vol. 8, Special Issue 3, 2015

Bentley index Bonet NFI Comparing the model to Must be greater than 9. 871. Relatively Index Fitness Hnja Grow model without its acceptable relationship CFI Comparing the model to Must be greater than 9. 875. Relatively model without its acceptable relationship Increase fitness index IFI Between zero and one The standard rate is more than 9 876. Relatively acceptable Chi-square = 133.561 Degrees of freedom = 6 Probability level = .000

The ratio of the economy or PRATIO, a kind of empowerment [25]. Mousavi stated that managers in frugal fit indices considered in it, do not represent the fit hospitals and new colleagues could show a good moral index, but rather show the extent to which the researcher behavior, interpersonal relationships, promoting efforts to spent the definition of free parameters. This index was reinforce such attitudes among the followers of the areas developed based on degrees of freedom, model-to-model of empowerment of nurses to provide a psychological degrees of freedom can achieve independence, a value contest [27]. In 1931, Single et al. stated that the power between zero, and one and, any size is much smaller, from recovery leadership and the health cognitive indicating that the researcher spent more money environment increases the organizational trust [28]. The regarding the free parameters. Often, higher values of 0.5 psychological sense of empowerment was seen as a were seen for this indicator, the rate being of 0.600. Also, positive approach to the characteristics of positive for an adequacy number of samples, HOTLTER index psychology on people and it was not unexpected that was used in this study sample, number 41 being leaders were bound by moral principles, underlying the acceptable according to the study sample size of 54 3_2015_draft companies, models of these indicators being also fitted. creation and promotion of a sense of psychological ECVA, MECVI, AIC, BCC indicators determine the most empowerment [26]. In 2010, Golparvar et al. established elegant model with the smallest amounts to more elegant the results of the research direction, which were similar; models considered in this study .741, 0.738,162.350, their findingsiss showed that there is a positive significant 161.561 respectively, which amounted for a MECVI of relationship between the ethical leadership and the 0.738 as the most effective model. psychological empowerment of employees. In other words, the existence of moral leadership as the creation of infrastructure for the staff is a psychological sense of Discussion and Conclusion empowerment [29]. The results of this study were consistent with the results of Moghtadery and Nadi This study aimed to investigate the relationship (2014), Mousavi Jad (2013), Avatefi Monfared (2012), between the ethical leadership and psychological Mahdad and Mirjafari (2012). The ethical leaders believe empowerment of nurses in hospitals of Imam Reza (AS). that intrapersonal and interpersonal trust can create In Kermanshah, the results were highlighted by a positive effects, inside and outside the organization, so that to relationship between the ethical leadership and the influence the organizational success, the constant empowerment of the shares, which was 8_specialmental. The main changes in technology and design of jobs and roles and hypothesis of this study was approved. The ethical responsibilities that are necessary [28]. With regard to the leadership and empowerment of mental significant findings of this study, it can be said that the moral positive correlation and secondary research hypotheses leadership empowers the mental meaning that moral were confirmed. In 2014, the results of this study with the leadership builds trust, job satisfaction, increased results of Govna Fathi stated the ethics and leadership efficiency of activities and goals, so that the running style based on the ethics circuit in the hospital, space, and and effectiveness of ethical leadership creates a positive texture to enhance the effectiveness of clinical atmosphere in the hospital. It should be noted that the governance approach, a sense of psychological leaders feel valuable by demonstrating integrity and empowerment, promoting knowledge among nurses [26]. respect in relationships and interactions, involving Nadi showed the powerful efforts to increase the role of employees in decision-making and showing confidence in private hospitals in terms of organizational citizenship themselves. behavior, the structural equation taking the psychological

JML_VolumeReferences

1. Spreitzer GM. Psychological validation. Academy of Management 2. Seibert SE, Wang G, Court Right SH. empowerment in the workplace: Journal. 1995; 38:1442-1465. Antecedents and consequences of Dimensions, measurement and psychological and team empowerment

132 Journal of Medicine and Life Vol. 8, Special Issue 3, 2015

in organizations: A meta-analytic 12. Laschinger HKS, Finegan J, 21. Salehniya M. Organizational Ethics review. Journal of Applied Psychology. Shamian J, Wilk P. Impact of with an Emphasis on Ethical Charter. 2011; 96:981-1003. structural and psychological Ethics in Science & Technology. 2010; 3. Joo BK, Lim T. Transformational empowerment on job strain in nursing 4(1,2):66-78. leadership and career satisfaction: the work settings: Expanding Kanter’s 22. Zhu W. The effect of ethical leadership mediating role of psychological model. Journal of Nursing on follower moral identity: The empowerment. Journal of Leadership & Administration. 2001; 31:260-272. mediating role of psychological Organizational Studies. 2013; 13. Hassani M, Shohoodi M. The empowerment. Kravis Leadership 20(3):316-326. relationship between components of Institute. Leadership Review. 2008; 4. Frazier ML, Fainshmidt S. Voice Secure-Base Leadership and 8:62-73. Climate, Work Outcomes, and the Psychological Safety with dimensions 23. Haris A, Spillane J. Distributed Mediating Role of Psychological of Work holism: the perspective of leadership through the looking glass. Empowerment: A Multilevel employees in the University of Urmia. Management in Education. 2008; Examination. Group & Organization Journal of Executive Management. 22(1):31-34. Management. 2012; 37(6):691-715. 2013; 5(10):85-106. 24. Golparvar M, Padash F, Atashpoor 5. Laschinger HKS, Finegan J, 14. Dehghan Nayeri N, Nazari AA, H. The reinforcement Model sense of Shamian J, Wilk P. A longitudinal Salsali M, Ahmadi F, Adib energy and creativity of employee’s analysis of the impact of workplace Hajbaghery M. Iranian staff nurses through ethical leadership. Iran empowerment on work satisfaction. views of their productivity and Occupational Health Journal. 2010; Journal of Organizational Behavior. management factors improving and (3):4-11. 2004; 25(4):527-545. impeding it: a qualitative study. Nurse 25. Nadi MA, Moghtadery N. The 6. Patrick A, Laschinger HKS. The Health Sci. 2006; 8(1):51-60. relationship between ethical, effect of structural empowerment and 15. GH, Toosi F. A survey on the effects of psychological empowerment and job perceived organizational support on teaching on head nurses awareness satisfaction and organizational middle level nurse manager’s role about human communication with citizenship behavior among employees satisfaction. Journal of Nursing nursing personnel. Proceedings of the of private hospitals in Shiraz. Tehran Management. 2006; 14:13-22. Conference on Problems in Nursing University’s Faculty of Allied Health 7. Scotti DJ, Harmon J, Behson SJ. and Midwifery Management, 3_2015_draftSciences. Health Fertility & Sterility. Links among high-performance work Khorasegan. June 5-6, 1996, Islamic December-January 2014; 8,(5)399- environment, service quality and Azad University of Khorasegan Branch. 414. customer satisfaction: an extension to 16. Golparvar M, Javadian R, 26. Govna F, Javanak M, Taheri M, the healthcare sector. Journal of Hosseinzade KH. Structural modeliss of Shohoodi M. Modeling the relationship Healthcare Management. 2007; psychological contract, organizational between ethical leadership and clinical 52(2):109-125. justice, moral leadership, exchange governance psychological 8. Harmon J, Scotti DJ, Behson B, leadership-members and empowerment: perspectives of nurse’s Farias G et al. Effects of high- organizational support. Journal of new government hospitals in Kermanshah. involvement work systems on Psychology of industrial/ Monthly Journal of Kermanshah employee satisfaction and service organizational. 2011; 2(7):21-32. University of Medical Sciences. 2014; costs in veterans' healthcare. Journal 17. Brown ME, Trevino LK. Ethical 18,4. of Healthcare Management. 2003; leadership: A review and future 27. Mousavi J, Seyyed M et al. The role 48(6):393-406. directions. The Leadership Quarterly. of moral leadership in mental capacity. 9. Joiner TA, Bartram T. How 2006; 17:595-616. Journal of Hospital. Winter 2014; 8,4. empowerment and social support affect 18. Siyadat SA, Esfahani AN, Allahyari 28. Avatefi M, Ehsan M, Mirjafari A, Australian nurses’ work stressors. S. Moral leadership in educational Seyyed A. The relationship between Australian Health Review. 2004; organizations. Cultural Engineering. ethical leadership and organizational 28(1):56-64. 8_special2010; 5(45,46):38-46. trust workplace mental health. 10. Bonias D, Bartram T, Leggat SG, 19. Yukl G, Mahsud R, Hassan SH, Quarterly Morality At Sciences And Stanton P. Does psychological Prussia GE. An Improved Measure of Technology. 2012; 7,3. empowerment mediate the relationship Ethical Leadership. Journal of 29. Golparvar M, Padash F, Atashpoor between high performance work Leadership & Organizational Studies. H. The reinforcement Model sense of systems and patient care quality in 2013; 20(1):38-48. energy and creativity of employee’s hospitals. Asia Pacific Journal of 20. Niri SH, Golparvar M, Mahdad A. The through ethical leadership. Iran Human Resources. 2010; 48(3):319- role of Ethical values and moral Occupational Health Journal. 2010; 337. leadership in reducing job stress of 7(3):4-11. 11. Wade DT. Clinical governance and employees. Ethics in Science & rehabilitation services. ClinRehabil. Technology. 2010; 5(3,4):67-76. 2000; 14:14.

JML_Volume

133 Journal of Medicine and Life Vol. 8, Special Issue 3, 2015, pp.134-140

A study of the relationship between personality traits and Employee Engagement (A case study of nurses across Kermanshah, Iran in 2015)

Ziapour A*, Kianipour N** *Social Development & Health Promotion Research Center, Kermanshah University of Medical Sciences, Kermanshah, Iran, **Research Committee, Kermanshah University of Medical Sciences, Kermanshah, Iran

Correspondence to: Kiani Pour N, MD, Students Research Committee, Kermanshah University of Medical Sciences, Kermanshah, Iran Phone: +98 9126880851, E-mail: [email protected]

Received: March 14th, 2015 – Accepted: June 18th, 2015

Abstract Employee Engagement is an individual’s interest and willingness to carry out the assigned duties, together with his continued employment with organizations. Therefore, the present study aimed to delve into the relationship between the personality traits and Employee Engagement among nurses employed in Kermanshah-based hospitals in 2015. In this descriptive-correlational study, 322 nurses of public hospitals in Kermanshah were selected in 2015. For data collection, Schaufeli & Bakker’s Utrecht Employee Engagement scale and NEO Five-Factor Inventory (NEO-FFI) were used. Data were analyzed through descriptive statistics (Frequency, Percentage, Mean, and Standard Deviation) and inferential statistics (Pearson Correlation3_2015_draft Test and Multiple Regression Analysis). Also, the 21st version of SPSS software was used for data analysis. The results demonstrated that the highest and lowest means of personality traits among nurses related to openness to experience (3.75 ± 0.63) and neuroticism (2.82 ± 0.55). Also, the highest and lowest means of Employee Engagement related to absorption (5.41 ± 0.76) and vigor (5.04 ± 0.86). Furthermore, the results of the Pearson correlation test showed that there were significant relationshipsiss between the two dimensions of personality traits, i.e. neuroticism (P<0.001, r=0.172) and extraversion (P<0.001, r=0.038), and work engagement. Moreover, neuroticism had the most important relationship with Employee Engagement (P<0.001, r=0.172). On the other hand, the results of multiple regression analysis showed that conscientiousness and agreeableness were good predictors for work engagement. Given that the two dimensions of personality traits, i.e. conscientiousness and agreeableness, were closely related to work engagement, it was suggested that these dimensions were given a careful consideration in the event of employing workforce, especially nurses, with the aim of boosting the organizational productivity.

Keywords: Employee Engagement, personality traits, nurses, Kermanshah

Introduction 8_specialcertain inclinations and attitudes towards tasks and goals in organizations based on their personality traits [46]. Personality is a complex psychological construct Thus, the differences in the individuals’ personality traits used for the discovery of the way individuals behave and can be a source of creativity or the root cause of hassles as a general rule, shows different kinds of human in organizations, and they can influence actions, behaviors in diverse situations [44]. The individuals’ conducts, and decisions across enterprises [47]. Since personality dimensions fall into different categories. The personality traits act as factors that determine the five factors of neuroticism (including traits such as individuals’ behaviors, identifying such traits can result in nervousness, moodiness, and tempera mentality), increasing the Employee Engagement in organizations extraversion (implying an energetic approach and through predicting behaviors [35,44]. Given that the includes traits such as sociability, activity, assertiveness, variable of Employee Engagement is a new, positive idea, and positive emotionality), openness to experience it has proven to be capable of suitably predicting (including traits such as imagination, curiosity, and occupational and personal outcomes [7,17]. In recent creativity), agreeableness (including traits such as years, Employee Engagement has interested so many altruism, tender-mindedness, trust, and modesty), and scholars and has been given a great deal of attention. JML_Volumeconscientiousness (including traits such as organization, Employee Engagement is widely believed to predict staffs’ thoroughness, and reliability) were introduced by Costa & outcomes, organizational success, and financial McCrae (1992) as basic biological inclinations [10]. These performance [8,17,30,36]. In fact, Employee Engagement basic inclinations are readiness to act and feel in certain is a positive construct with great potential in identifying manners and are not directly affected by the environment desirable organizational outcomes. It is the individuals’ [48]. According to this model, individuals can adopt interests and willingness to carry out the assigned duties, Journal of Medicine and Life Vol. 8, Special Issue 3, 2015

together with their continued employment with the studies conducted on nurses by Jahanbakhsh Ganjeh organizations, and the circulation of such energy across et al. (2009) demonstrated that they had the highest organizations, acting as an extra-energy inside scores in terms of conscientiousness and flexibility [21]. individuals, which is beneficial to work groups and the whole society [9]. William Kahn (1990), as the first scholar “Work engagement” is defined as “positive, satisfying, job- of this field, defined “work engagement” as “using the related mental states that are differentiated by three whole of one’s being to carry out the assigned job-related indexes of vigor, dedication, and absorption” [38]. roles”. To perform the assigned roles in work Since nurses are seen as the most prominent engagement, individuals use or express their whole resources in hospitals, they make quite an impact on the physical, cognitive, and emotional traits. In the absence of levels of health and hygiene in societies through the work engagement, individuals are physically, cognitively, agency of delivering diverse health care services and emotionally detached from their job-related roles [7,11,32]. The differences in personality traits among [22,30]. nurse communities influence their manner of Employee The surveys conducted by consulting companies Engagement and interactions with patients and are of vital revealed that the level of the employees’ Employee significance [5,34]. Employee Engagement is necessary Engagement is taking a downward trend [12,29]. for all occupations, including nursing jobs and helps managers assess the level of the employees’ personality Furthermore, the majority of organizations are suffering traits and loyalty to organizations. from a lack of work engagement, which has resulted in Therefore, given that no earlier studies have the imposition of sky-high costs on organizations [29]. dealt with the relationship between the nurses’ personality Some positive attachments are created between staffs traits and work engagement, the present study aimed to and organizations through work engagement, having study the foregoing. Furthermore, considering the definition and different nature3_2015_draft of the dimensions of work positive consequences for both sides, including positive, engagement, the relationship between personality traits strong occupational attitudes towards jobs, mental and and work engagement, and their effects are ambiguous, psychological health (e.g., positive emotions and so clarifying isssuch a relationship is deemed a scientific reductions in burnout), better job performance, enhancing necessity. intrinsic motivation, adopting personal initiatives and Methodology proactive behaviors, and acquisition of occupational and The present work is a descriptive-correlational personal interests [23,41]. In the presence of Employee study. According to the statistics collected from the HRM Engagement and loyalty in organizations, an intimate and Department of the Medical School of Kermanshah in familiar atmosphere is created, as a result of which work 2014, the statistical population consisted of all nurses employed in public hospitals across Kermanshah processes get facilitated, and the pace of the work (n=1987, including 1542 males and 445 females). Also, groups’ actions get adjusted and advance with a full the number of the sample population was determined throttle towards the set aims [41]. In studies conducted by through Cochran’s sample size formula (n=322, including Cheung (2008), the results demonstrated8_special that such 249 females and 73 males), chosen through the agency of stratified-random sampling. For data collection, three factors as communication and conducts mixed with trust, questionnaires were used: (1) a demographic accountability and clear duties, sufficient number of questionnaire containing the staffs’ personal information qualified nurses, conversant, proficient, reliable (gender, age, education, work experience, and job leadership, collaborative decision-making, understanding positions), (2) NEO Five-Factor Inventory (NEO-FFI) [10], and (3) Schaufeli & Bakker’s Utrecht Employee the value of nurses’ jobs, and the chance of professional Engagement scale [38]. growth, play vital roles in the staffs’ continuation of The NEO Five-Factor Inventory (NEO-FFI) was employment with organizations [49]. Haslam et al. (2003) based on the factor analysis and was constructed by have the opinion that no emotional relationships in Costa & McCrae (1992) in Baltimore, Maryland in 1985. This questionnaire consisted of 60 questions with five- organizations, considerable contacts, significant planning, point Likert scaling (1 = strongly disagree, 2 = disagree, 3 and leadership exist without Employee Engagement [18]. = neutral, 4 = agree, 5 = strongly agree) and examined The results of studies performed by González et al. the five dimensions of personality traits: openness to (2005) showed that personality traits had significant experience, conscientiousness, JML_Volume extraversion, agreeableness, and neuroticism [37,15]. relationships with age and gender, and studies performed The content validity of NEO Five-Factor Inventory (NEO- by Halbesleben (2010) showed that there was a positive FFI) was confirmed by Costa & McCrae (1992), and the relationship between work volume and Employee reliabilities of neuroticism, extraversion, openness to Engagement (vigor and dedication) [16]. The results of experience, agreeableness, and conscientiousness were 0.90, 0.78, 0.76, 0.86 and 0.90, respectively [10]. In Iran, 135 Journal of Medicine and Life Vol. 8, Special Issue 3, 2015 the five-factor structure of this questionnaire was absorption held the highest level (Mean=5.41, SD=0.76) generally confirmed by Garousi Farshi et al. (2001), and and vigor held the lowest level (Mean=5.04, SD=0.86) their internal consistency reliability coefficients were (see Table 2). reported by the measure of Cronbach’s alpha as 0.86, The results of the Pearson correlation coefficient 0.73, 0.56, 0.68 and 0.87, respectively [13]. In the test showed that there were positive, significant American sample, the reliabilities of neuroticism, relationships between the two dimensions of personality extraversion, openness to experience, agreeableness, traits, i.e. neuroticism (p<0.001, r=0.172) and extraversion and conscientiousness were 0.93, 0.87, 0.76, 0.89, and (p<0.001, r=0.038) and work engagement. Furthermore, 0.86, respectively [1]. In a study conducted by Kiamehr neuroticism and extraversion had the strongest and (2002), the internal consistency reliability coefficient of weakest relationships with work engagement, respectively this questionnaire was reported by the measure of (Table 3). Cronbach’s alpha (ranging from 0.54 to 0.79) [24]. Concerning the relationships between the five Furthermore, in studies performed by Hejazi & Iravani dimensions of personality traits (openness to (2002), the Cronbach’s alpha for this questionnaire was experience, conscientiousness, 0.74 [19]. In the present study, Cronbach’s alphas of extraversion, agreeableness, and neuroticism) and work neuroticism, extraversion, agreeableness, openness to engagement, the results of stepwise linear regression experience, and conscientiousness were 0.91, 0.78, 0.76, tests indicated that only two dimensions of 0.73, and 0.86, respectively. Conscientiousness and Agreeableness remained in the As for the Employee Engagement questionnaire, final model, and the other dimensions were eliminated. it was constructed by Schaufeli et al. (2002) and Given the β coefficients, conscientiousness and consisted of 17 questions with seven-point Likert agreeableness significantly specified work engagement. Scaling (0=strongly disagree,1=quite disagree, 2=slightly Also, comparing the standard coefficients demonstrated disagree, 3=neither, 4=slightly agree, 5=quite agree, that conscientiousness (β =0.148) and agreeableness (β 6=strongly agree) and examined 3 dimensions of vigor, =0.140) had the most 3_2015_draftand the least impacts on the dedication, and absorption [38]. This questionnaire has dependent variable of nurses’ work engagement, been used in China, Finland, Greece, Japan, South respectively (Table 4). Africa, and Spain and has a high reliability and validity [39]. The content validity of Employee Engagement Table 1. The Demographiciss Characteristics of participants questionnaire has been confirmed in studies performed by Variables Groups No (%) Abaszadeh et al. (2013) and Isakhani et al. (2013) [2,3]. male 73 (22.7%) Gender In the present study, the Cronbach’s alphas of vigor, female 249 (77.3%) dedication, and absorption were 0.92, 0.89, and 0.86, 30≤ 171 (53.1%) respectively. As for data analysis, the descriptive statistics Age 31-40 125 (38.8%) (years) (Frequency, Percentage, Mean, and Standard Deviation) 41-50 26 (8.1%) and inferential statistics (Pearson Correlation Test and Bachelor’s degree 260 (80.7%) Multiple Regression Analysis) were applied. Also, the 21st Education Master’s Degree 62 (19.3%) version of SPSS software was used for data analysis. 5≤ 29 (9%) 6-10 24 (7.5%) 8_specialWork Results 11-15 16 (5%) Experience 16-20 110 (34.2%) (years) Out of the 322 participants in the present study, 26-21 115 (35.7%) 73 individuals (22.7%) were males and 249 individuals 26≥ 28 (8.7%) (77.3%) were females. The Mean and Standard Deviation nurse managers 22 (6.8%) of the ages of the sample population were 31.54 ± 6.03. Positions Supervisor 65 (20.2%) The 31-40-year-old age group held the biggest number Head nurse 235 (73%) (125 individuals, 38.8%). In terms of education, 260 individuals (80.7%) held a B.A. and 62 individuals (19.3%) Table 2. The Mean, Standard Deviation, Minimum Score, held an M.A. and higher degrees. Most samples (115 Maximum Score and participants’ Rankings individuals, 35.7%) had 21-26 years of work experience. The Mean and Standard Deviation of the work experience Statistical Mea Variables SD Rank of the sample population were 18.48 ± 6.5. In terms of job indexes n positions, most samples (235 individuals, 73%) were head Openness to 0.6 nurses (see Table 1). 3.75 First As for the dimensions of personality traits in the experience 3 JML_Volume 0.5 Secon sample population, the results demonstrated that the Extroversion 3.48 openness to experience held the highest level 2 d Conscientiousnes 0.3 (Mean=3.75, SD=0.63) and neuroticism held the lowest 3.46 Third level (Mean=2.82, SD=0.55) (see Table 2). s 9 Personality traits Personality traits 0.3 As for the dimensions of Employee Engagement Agreeableness 3.18 Fourth in the sample population, the results demonstrated that 2 136 Journal of Medicine and Life Vol. 8, Special Issue 3, 2015

0.5 Neuroticism 2.82 Fifth As for the independent variable of personality 5 traits, the results showed that openness to experience 0.2 Personality traits 3.34 - held the highest mean score (Mean=3.75, SD=0.63) and 9 neuroticism held the lowest mean score (Mean=2.82, 0.7 (Absorption) 5.41 First SD=0.55) (see Table 2). In total, the Mean and Standard 6 0.8 Secon Deviation of nurses’ personality traits were 3.34 and 0.29, (Dedication) 5.24 2 d respectively, which indicated that all indexes of nurses’ 0.8 personality traits were at average levels. As for the (Vigor) 5.04 Third 6 independent variable of work engagement, the results Employee 0.4 showed that absorption held the highest mean score 5.23 -

Employee Engagement Engagement 8 (Mean=5.41, SD=0.76) and vigor held the lowest mean score (Mean=5.04, SD=0.86) (see Table 2). In total, the Mean and Standard Deviation of nurses’ Employee Engagement were 5.23 and 0.48, respectively.

Table 3. Pearson correlation coefficients between nurses’ personality traits and work Engagement Correlation Hypothesis Independent variable Dependent variable Sig (2-tailed) coefficient 1 Neuroticism work Engagement 0.172** 0.002 2 Agreeableness work Engagement 0.165** 0.003 3 Conscientiousness work Engagement 0.072 0.199 4 Openness to experience work Engagement 0.061 0.276 5 Extroversion work Engagement 3_2015_draft0.038 0.496 6 (Total) Personality traits (Total) work Engagement 0.162** 0.004 **Correlation is significant at 0.01 (2-tailed)

As it was shown in Table 3, there was a positive, To predictiss the level of Employee Engagement direct, significant relationship between the nurses’ based on different dimensions of personality traits, the personality traits and Employee Engagement (p<0.001, stepwise multiple regression test was used. The results of r=0.162). Except for the conscientiousness that had a this test indicated that the two dimensions of Neuroticism negative, insignificant relationship with work engagement, and Agreeableness predicted 4.9% of the variance of the other ones (openness to experience, nurses’ work engagement. Therefore, after eliminating the extraversion, agreeableness, and neuroticism) had insignificant variables (openness to experience, positive, direct, significant relationships with Employee extraversion, and conscientiousness), the results of Engagement (p<0.001). In addition, neuroticism had the multiple regression test for predicting the nurses’ most important relationship with Employee Engagement Employee Engagement were as it follows (see Table 4): (p<0.001, r=0.172), while extraversion had the least important relationship with Employee8_special Engagement (p<0.001, r=0.038).

Table 4. The results of multiple regression test for predicting the nurses’ work Engagement Unstandardized Standardized The dimensions of Coefficients R R Square Coefficients t Sig. personality traits B Std. Error Beta (Constant) 4.197 0.279 15.067 0.000 neuroticism 0.128 0.048 0.221 0.049 0.148 2.681 0.008 Agreeableness 0.211 0.083 0.140 2.533 0.012

Discussion by Zaidi et al. (2013), Ziapour et al. (2015), and Inceoglu & Warr (2012) [20,43,45]. The maximum and minimum The present study aimed to delve into the levels of personality traits related to the openness to relationship between personality traits and Employee experience and neuroticism, respectively. To put it bluntly, JML_VolumeEngagement among the nurses of hospitals based in the less the neuroticism developed in nurses, the more Kermanshah in 2015. The results of the present study the Employee Engagement increased, while the more the showed that the Mean and Standard Deviation of nurses’ openness to experience developed in nurses, the more personality traits were 3.34 and 0.29, respectively. This their Employee Engagement was. One explanation for the result was consistent with the results of studies conducted foregoing might be that the ones with high levels of

137 Journal of Medicine and Life Vol. 8, Special Issue 3, 2015

neuroticism are incapable of coping with conflicts and their perceptions of work performance in the future should anxieties, resulting in a lack of Employee Engagement in result in positive psychological conditions. In the present the workplace. To some extent, this result was consistent study, no relationships were found between the three with the results of studies conducted by Komarraju et al. dimensions of personality traits, i.e. conscientiousness, (2009), Zhang & Bruning (2011), and Naseh et al. (2012) openness to experience and extraversion, and the [4,26,32,44]. In studies performed by Langelaan et al. dependent variable of work engagement. (2006), the results demonstrated that the Employee The present study was faced with several Engagement was differentiated by low levels of limitations: (1) data were collected through self-reporting method, which may influence the accuracy of results, (2) neuroticism and high levels of extraversion [27]. In studies due to the fact that the data were collected from samples carried out by Kim et al. (2009) and Neetu (2013), the in Kermanshah-based hospitals, the results cannot be results indicated that the Employee Engagement could be generalized to other nurses employed in other hospitals predicted by neuroticism and conscientiousness [25,33]. across Iran. Given the prominent roles that nurses’ The results of the present study showed that the personality traits play in hospitals, it is recommended that Mean and Standard Deviation of the nurses’ Employee further studies are conducted in other public and private Engagement were 5.23 and 0.48, respectively. Also, the hospitals throughout Iran, and the results are compared maximum and minimum levels of Employee Engagement with one another. related to absorption and vigor. The results of the studies conducted by Abaszadeh et al. (2013) showed that the Mean of nurses’ Employee Engagement in Sirjan-based Conclusion hospitals was 3.50 out of 6. In studies performed by Mauno et al. (2007) [31], the Mean of nurses’ Employee The maximum and minimum levels of personality Engagement in hospitals was 4.45 out of 6. Furthermore, traits related to the openness to experience and in American samples, the results of the studies carried out neuroticism, respectively.3_2015_draft Furthermore, two dimensions of by Lawarence (2009) [28] showed that the Mean of work engagement, i.e. absorption and vigor, held the nurses’ Employee Engagement in American hospitals was highest and lowest means among staffs. Out of five 4 out of 6, which was lower than the mean of the dimensions of personality traits, the two variables of Employee Engagement in the present study. neuroticism issand agreeableness had significant There was a significant relationship between relationships with Employee Engagement and could neuroticism and work engagement in the present study, specify it. The individuals’ personality traits, as inherent which was consistent with the results of studies performed by Swider & Zimmerman (2010), Shimizutani et al. (2008), components of human beings’ personalities, influence Azeem (2010), and Ghorpade et al. (2007) [6,14,40,42]. organizational environments. The organizational Due to such symptoms such as anxiety, insecurity, and commitment, one of the outcomes of work engagement, is anger in nurses with high levels of neuroticism, it was directly influenced by the individuals’ personality traits, expected that these staffs had high levels of work deemed the biggest human resources in hospitals engagement, too. Therefore, given the tendency of these influencing the quality of services outstandingly. staffs towards negative feelings, it was anticipated that Therefore, to increase the productivity of human neurotic individuals had higher levels of work resources in organizations, especially for major engagement. 8_specialmanagerial positions, it is suggested that the individuals’ In addition, there was a significant relationship personality traits are given acute consideration in the between agreeableness and work engagement, which event of recruitment and appointment of workforce. was to some extent consistent with the results of studies performed by Swider & Zimmerman (2010), Shimizutani Acknowledgements et al. (2008), Azeem (2010), and Ghorpade et al. (2007) This article was based on the findings of the [6,14,40,42]. Those with high levels of agreeableness, research plan No. 93375, supported by the Vice even when working in horrible conditions, do their utmost Chancellery of Research & Technology of the Medical to adapt to their working conditions and their School of Kermanshah. In the end, the kindly supports agreeableness (which involves traits such as altruism, and assistance of the rector of the Medical School of tender-minded, trust, and modesty) gives them enough Kermanshah and our colleagues are sincerely incentive to achieve personal success. Agreeable individuals are cooperative, reliable people. Therefore, appreciated.

JML_VolumeReferences

1. Stewart M, Ebmeier K, Deary I. Personality and Individual Differences. qualitative research. Transformation Personality correlates of happiness and 2005; 38(5):1085-1096. Managemet Journal. 2013; 5(10):1-24. sadness: EPQ-R and TPQ compared. 2. Isakhani A, Fani AA, Danaie Fard H. The 3. Abbas Zadeh A, Barhani F, Forogh future belongs to explain the work using Ameri G, Najmi Dolat Abadi S. The

138 Journal of Medicine and Life Vol. 8, Special Issue 3, 2015

relationship between moral distress of employee satisfaction, Employee longitudinal study. Journal of Vocational nurses who work: a descriptive study of Engagement, and business outcomes: a Behavior. 2007; 70:149-71. communication. Journal of Medical Ethics. meta-analysis. Journal of Applied 32. Naseh M, Chelilvand J, Vahdani M. A 2013; 7(24):33-53. Psychology. 2002; 87:268-279. study of the relationship between nurses’ 4. Naseh M, Jalilvand J, Vahdani M. 18. Haslam SA, Postmes T, Ellemers M. personality traits and exhaustion. Modern Relationship between personality More than a metaphor: organizational Health Care Quarterly of Birjand Medical dimensions and job burnout of Nurses. identity makes organizational life possible. School of Nursing and Midwifery. 2012; New Care Journal. 2013; 9(2):87-94. British Journal of Management. 2003; 9(2):87-94. 5. Astura GB. Stress (new illness of 14(4):357-369. 33. Neetu J. Personality as Predictor of civilization). Dadsetan P. 2008. Tehran: 19. Hejazi Y, Iravani M. The relationship Employee Engagement: An Empirical Roshd. between personality traits and job Study. Journal of Management Science. 6. Azeem SM. Personality hardiness, job performance. Journal of Psychology and 2013; 4(2):213-221. involvement and job burnout among Educational Sciences. 2002; 32(2):171- 34. Rammstedt B, John OP. Measuring teachers. International Journal of 189. personality in one minute or less: a 10-item Vocational and Technical Education. 2010; 20. Inceoglu I, Warr P. Personality, and Job short version of the big five inventory in 2 (3):36-40. Engagement. Journal Psychology. 2012; English and German. Journal of Research 7. Bakker AB, Demerouti E. Towards a 6(3):1-9. in Personality. 2007; 41(1):203-12. model of work engagement. Career 21. Jahanbakhsh Ganjeh S, Omidi Arjenaki 35. Takalo F, Ahmadi K, Ziapour A. Development International. 2008; 13:209- N, Nori A, Oreyzi HR. The relationship of Relationship between components Five 23. personality characteristics and burn out Factor Model of Personality and Social 8. Çakinberk A, Derin N, Demirel ET. among nurses. Iranian Journal of Nursing laziness employees Kermanshah Shaping of organizational identification by and Midwifery Research. 2009; 14 (4):190- University of Medical Sciences in 2014. organizational commitment: example of 194. Journal of Clinical Research in private education institutions in Malatya 22. Kahn WA. Psychological Conditions of Paramedical Scienses. 2015; (4)1:43-51. and Tunceli, İşletmeAraştırmaları Dergisi. Personal Engagement and Disengagement 36. Richman AL, Civiana JT, Shannona LL, 2011; 3(1),89-121. at Work. The Academy of Management Hillb JE, Brennanc RT. The relationship of 9. Cook S. Essential guide to Employee Journal. 1990; 33(4):692-724. perceived flexibility, supportive work-life Engagement: better business performance 23. Kandulapati S, Manchala DG. policies,3_2015_draft and use of formal flexible through staff satisfaction. 2008, London, Relationship between Employee arrangements and occasional flexibility to GBR: Kogan Page. Engagement and commitment: a study at Employee Engagement and expected 10. Costa PT, Mc Crae RR. Normal IVRCL. International Journal of Research in retention. Community, Work & Family. personality assessment in clinical practice: Commerce, IT & Management. 2011;iss 2008; 11(2):183-197. The NEO personality inventory, 1(3):44-48. 37. Roberts BW, Walton KE, Viechtbauer psychological assessment. Journal of 24. Kiamehr J. Normalization of NEO W. Patterns of mean-level change in Consulting and Clinical Psychology. 1992; personality inventory and exploration of its personality traits across the life course: a 7(4):5-13. factor analysis in the students of university meta-analysis of longitudinal studies. 11. Esfandiary Z, Jafari A, Amirimajd M. The of Tehran. (Dissertantion). 2002, Allameh Psychology Bull. 2006; 16(9):132:1–25. role of coping strategies in explanation of Tabatabai University. 38. Schaufeli WB, Bakker AB. UWES Utrecht relationship between personalitytraits and 25. Kim HJ, Shin KH, Langford SN. Burnout Employee Engagement scale: Test manual job stress in nurses. (MSc. Thesis). 2012, and engagement: A comparative analysis Unpublished manuscript, 2003, Department Counseling, Abhar: Islamic Azad using the Big Five personality dimensions. of Psychology, Utrecht University. University. International Journal of Hospitality 39. Schaufeli WB, Salanova M, Gonzalez- 12. Federman B. Employee Engagement: a Management. 2009; 16(9):28-38. Romá V, Bakker AB. The measurement of roadmap for creating Profits, optimizing 26. Komarraju M, Karau SJ, Schmeck RR. engagement and burnout: a confirmative performance, and increasing loyalty, 2009, Role of the big five personality traits in analytic approach. Journal of Happiness USA: Jossey-Bass. 8_specialpredicting college student s academic Studies. 2002; 3:71-9. 13. Garousi Farshi MT, Mehriar AM, Ghazi motivation and achievement. Learning and 40. Shimizutani M, Odagiri Y, Ohya Y, Tabatabai M. The use of neo personality Individual Differences. 2009; 19:47-56. Shimomitsu T, Kristensen TS, Maruta T. test and analysis of features and its factor 27. Langelaan S, Bakker AB, Van Doornen Relationship of nurse burnout with structure among Iranian university students Lorenz JP, Schaufeli Wilmar B. Burnout personality characteristics and coping (Persian). J Humanities Res Alzahra. 2001; and work engagement: Do individual behaviors. Ind Health. 2008; 46 (4):326-35. 11(39):173-98. differences make adifference?. Personality 41. Simon LA. Handbook of Employee 14. Ghorpade J, Lackritz J, Singh G. Burnout and Individual Differences. 2006; 8(3):40- Engagement: Perspectives, Issues, and personality: evidence from academia. 49. Research and Practice, 2010, USA, Journal of Career Assessment. 2007; 15 28. Lawarence LA. Work engagement, moral Edward Elgar Publishing. (2):240-56. distress’ education level, and critical 42. Swider BW, Zimmerman RD. Born to 15. Gramstad TO, Gjestad R, Haver B. reflective practice in intensive care nurses. burnout: a meta-analytic path model of Personality traits predict job stress, Arizona - University of Arizona. Doctoral personality, job burnout, and work depression, and anxiety among junior Tesis Nursing. 2009; 6(2):188-199. outcomes. Journal of Vocational Behavior. physicians. Gramstad et al. BMC Medical 29. Leigh B. The 7 hidden reasons employees 2010; 76(3):487-506. Education. 2013; 13(150):1-9. leave: how to recognize the subtle signs 43. Zaidi NR, Wajid RA, Zaidi FB, Zaidi GHB, 16. Halbesleben JRB. A meta-analysis of and act before it’s too late. 2005, USA: Zaidi MT. The big five personality traits and work engagement: relationships with AMACOM. their relationship with Employee JML_Volumeburnout, demands, resources and 30. Macey WH, Schneider B, Barbara KM, Engagement among public sector consequences, in Bakker AB, Leiter MP. Young SA. Employee Engagement: tools university teachers of Lahore. African Work Engagement: Recent Developments for analysis, practice and competitive Journal of Business Management. 2013; in Theoryand Research. New York: advantages. 2009, UK: Willey- Blackwell. 7(15):1344-1353. Psychology Press. 2010; 3(16):102–117. 31. Mauno S, Kinnunen U, Rookolainen M. 44. Zhang DD, Bruning E. Personal 17. Harter JK, Schmidt FL, Hayes TL. Job demands and resources as characteristics and strategic orientation: Business-unit level relationship between antecedents to work engagment: A entrepreneurs in Canadian manufacturing

139 Journal of Medicine and Life Vol. 8, Special Issue 3, 2015

companies. International Journal of 46. Erdheim J, Wang M, Zichar M. Linking the hopelessness, and suicide ideation. Entrepreneurs in Behaviour & Research. big five personality constructs to Personality and Individual Differences. 2011; 17:103-82. organizational commitment. Personality 2005, 38(6):1283-1291. 45. Ziapour A, Zokaei AH, Mohammadi and individual differences. 2006; 41(5):959- 49. Cheung FM, Cheung SF, Zhang J, Leung Javid N, Mohammadi Javid P, 970. K, Leong F, Huiyeh K. Relevance of Mohammadi Javid N, Haydar Pour B. 47. Khanifer H, Moghmi M, Jndaghi GHR, openness as a personality dimension in Association between Personality Traits and Taher F, Sayar A. Character Recognition Chinese culture: Aspects of its cultural Social Laziness: (Case Study: Staff of of directors, management requires relevance. Journal of Cross-cultural Kermanshah University of Medical organizational behavior. Journal of Health Psychology. 2008; 39:81-108. Sciences in 2014). Technical Journal of Management. 2008; 12,50. Engineering and Applied Sciences. 2015; 48. Chioqueta A, Stiles T. Personality traits 5(1):49-54. and the development of depression,

3_2015_draft

iss

8_special

JML_Volume

140 Journal of Medicine and Life Vol. 8, Special Issue 3, 2015, pp.141-145

Relationship between patient safety and accountability of nurses in Al-Zahra Gilangharb Hospital in 2015

Esfandnia F, Mohammadi E, Mohammadi M, Cheraghi R, Esfandnia N, Esfandnia A Student Research Committee, Kermanshah University of Medical Sciences, Kermanshah, Iran

Correspondence to: Afshin Esfandnia, MD, Student Research Committee, Kermanshah University of Medical Sciences, Kermanshah, Iran. Kermanshah University of Medical Sciences Phone: +98 9189464518, E-mail: [email protected]

Received: March 14th, 2015 – Accepted: June 18th, 2015

Abstract Introduction The aim of this study was to investigate the relationship between the patient safety and the accountability of nurses in Gilangharb Hospital in 2015. Methods. This was a cross-sectional study conducted in Al-Gilangharb, in 2015. The data needed for research was taken from the library and an internet search and was collected by using standard questionnaireThe professional and caring nurses’ questionnaire was based on the extension evaluation office Nursing Care, Ministry of Health and Medical Education and demographic information and questions about 4 different roles of nurses were prepared and included. Moreover, patient safety was highlighted in a validation questionnaire, validated by an experts judging group of teachers and academics, which was established. Cronbach’s alpha test was used to assess the reliability. Finally, the reliability and professional standards of nursing care, patient3_2015_draft safety questionnaire 093. 86/ 0 percent calculated the population of Gilangharb Hospital nurses (n = 70) and, in the strata selected, a statistical analysis using data from the questionnaires included in the SPSS statistical software, version 21, took place. Results .The patients’ safety and accountability was observed at the level of 95 percent by using the Spearman correlation (SIG = .000). The correlation coefficient was (R=.768). Also, the dimensions of responsibilityiss between the patient’s safety (regarding the role of the nurse educator, administrator, researcher and clinician) at 95 percent and the positive use of Spearman correlation was found (SIG = .000). Conclusions. Given the correlation between the patient safety and accountability, it can be said that the nurses in all roles (educator, researcher, administrator, and clinical specialist) have been successful, so, we suggested that given the experience, expertise and abilities, they have made an efficient use of their lifting power.

Keywords: patient safety, accountability, responsiveness, nurse, Gilangharb Hospital

Introduction researchers and experts in the health field [4]. This report, 8_specialtogether with reports of similar other institutions in Since the task and mission of critical health care countries like Britain, Canada and Australia, on this topic, and community life represent the quality of services in the made the international monitoring health regimes health sector, it has a special place [1]. Patient safety is understand that they are not safe enough [3]. According one of the main components of health care, in the sense to the available evidence, it was estimated that, in of avoiding the introduction of any injury to the patient developing countries, one out of ten patients enters and during health care [2] and includes items such as appeals to hospital services while being injured. However, medication errors (wrong type or dose of medication there are no accurate statistics on this issue in developing prescribed), applying to compromise (acting in the wrong countries. The World Health Organization estimates that position, wrong technique, postoperative complications), tens of millions of people are lost or suffer from disabilities false diagnosis (delayed diagnosis, misdiagnosis, every year due to medical errors and unsafe processes incorrect diagnosis), failure of plant and equipment, [5]. Care and treatment services for people suffering from leading to misdiagnosis and other cases, such as a heavy financial burden represent an unsafe addition to nosocomial infections, patient falls, bed sores, wrong the estimated time that would come forth, in fact between treatment, etc. [3]. 5% and 10% of the health-related costs resulting from JML_Volume non-clinical services that are safe. The proportion of The issue of patient safety (Patient safety patients is represented by the damage and failure of After the release of the report of the Institute of systems and procedures over the role of individuals [6]. In Medicine (Institute of Medicine-IOM), in the United States, addition, nursing, which is one of the largest health care in 1999, whose role was to determine the prevalence of provider groups in the public and private health sectors, is medical errors in this country, it has been of interest to more in contact with patients than nurses and other Journal of Medicine and Life Vol. 8, Special Issue 3, 2015

personnel providing care and performance and activity of medical errors is indispensable. Therefore, the issue of resulting from the interaction of a combination of terms patient safety is a crucial issue in the health systems of such as nurse, health, environment, and nursing [6]. In different countries [7]. With regard to the importance of addition to the basic tasks related to the clinical care of patient safety, a wide range of effects has been taken on patients (based on their professional mission delegation patients and our health care system. According to that, which means a lot of responsibility in different areas), staff resources are scarce and if you put the skills and professional nurses are responsible for eight general capabilities of a variety and flexibility to the organization’s standards, the following indicators being considered: 1. competitive advantage, the improvement of organizational performance is of an effective help, according to the role accountability. The continuity of expertise and efficiency. of human resources in service organizations, especially The application of knowledge, skills, and judgement. 4. hospitals and the importance of the performance of the Professional ethics. 5. Professional communication and organization, this study investigating the way patient participation. 6. Professional leadership and safety and accountability of nurses are explored. In a management. 7. Quality of care. 8. Self-control and study undergone in 2011, Movahedgar and Arabs tried to evaluation of performance. determine the perceptions of patients in clinical departments of general hospitals of Tehran University of Four major roles in determining the nursing profession. Medical Sciences to participate in treatment decisions and These roles include the clinical expert, educator, patient safety showing that the abnormal signals that administrator, and researcher. One or more roles for might be interpreted by a person were probably explained nurses concern thelocation and the skill level [7]. differently by another person. This difference was due to Accountability represents the status of the person demographic differences. The patient participation in responsible for the work of the others. Currently, treatment decisions affected his assessment of the safety professional accountability is very important into the age of the patient in the hospital [9]. In 2011, Ravaghi and et of accountability and rapid changes in the health system al. described the relationship3_2015_draft between the perception of a in which treatment occurs. As defined by the standard of culture of patient safety and care providers, patients’ accountability, “directing professional standards of nursing perception of medical errors in public hospitals in Tehran practice are determined based on the scope and range of showing that patients in hospitals, with a more positive performance”. Based on this definition, each nurse is safety culture,iss presented one of more errors experience responsible for her performance, guidance, and direction and were providers of a more positive perception of some to her performance on the road to professional and legal aspects of safety culture regarding the patient compared standards. Also, the nurse should provide optimal clinical to other dimensions respectively. These dimensions care and should be skilled and responsive to community. included organizational learning and continuous The World Health Organization recognizes the importance improvement and teamwork within the unit [1]. During a of patient safety and public health as a main concern of study performed in 2011, Zh. Abdi demonstrated the the World Health Assembly resolution - WHO 55/ 18, and culture of patient safety as the harvest workers in selected outlines the various responsibilities of the organization hospitals of Tehran Medical University showed that chart, which include technical support of Member States various aspects of safety culture in that hospital needed to for the development of reporting systems and risk improve and assess the culture of patient safety in reduction, setting evidence-based policies, promoting a hospitals, being able to assume multiple roles. According safety culture and encouraging research8_special into patient to a study by Moghry and et al. performed in on the one safety [8]. Regarding the research in Iran, several hand, there can be a strong or weak degree of safety problems were found in fields related to patient safety, culture of the center and it is clear on the other hand, that including the incidence of bedsores, infection, and falling managers and supervisors have the potential to increase from bed. With regard to the importance of patient safety staff awareness of patient safety, contributing to and a wide range of effects on patients and our health improvement [10]. The Persian translation of a care system, and given that Employees in organizations questionnaire validated patient safety culture surveys of in which resources are scarce and diverse skills and hospital (HSOPSC) and the assessment of safety culture capabilities and flexibility have helped improve from the perspective of nurses, physicians, laboratory and organizational performance are effective, The solutions radiology staff of public hospitals in Tehran University of and projects aimed at promoting changes in order to Medical Sciences in Iran has confirmed validity and achieve greater safety for patients who need urgent reliability to work [11]. In 1389, the doctor and his health care system is growing, this study showed the colleagues presented the attitudes regarding the safety of importance of patient safety and accountability of nurses employees of a medical center, a hospital in Tehran, to in hospitals in Al-Zahra Gilangharb. Daily, many patients evaluate the safety of a hospital staff showing that the JML_Volumein hospitals worldwide are safely treated and cured, but attitude of managers and employees was relatively low with the knowledge and technology in recent decades, and efforts of promoting hospital safety culture were health care facilities are more very complex. Naturally, in essential (Singer et al., 2009) [12]. to investigate the such circumstances, the possibility of increased risk in relationship between safety climate and safety health care facilities and experimental evidence indicates performance in the hospital, 12 Patient safety indicators that the number of patients who are due to complications (PSIs) were presented and the study showed a significant

142 Journal of Medicine and Life Vol. 8, Special Issue 3, 2015 relationship between a safety climate and stronger and 4) Are there any researchers regarding the role of nurses safer performance in hospitals [13]. In the study of Al-e in hospital patient safety events in Gilangharb Al-Zahra? Ahmad (2010), examining the relationship between a safety climate hospital and hospital performance in patient safety indicators (PSIs), a significant relationship was Methods found between a safety climate and stronger and safer performance in hospitals [14]. Following this, in 2010, This study was cross-sectional and was carried Screw et al. showed the relationship between the culture out in 2015 in Al Gilangharb. Data needed for research in of patient safety and the adverse events in US hospitals using the library and internet search were collected by studied. In their study, from the relationship between the using standard questionnaires. According to the 15 variables related to patient safety culture surveys of evaluation office extension of the Nursing Care Ministry of hospital and eight patient safety indicators for the Health and Medical Education, the questionnaire expected (negative) and the relationship of these 15, professional nursing care was prepared and included seven were statistically significant. In other words, a demographic information and questions about 4 different better safety culture in hospitals was associated with nurses roles (clinician, educator, administrator, lower rates of adverse events [2]. In 2010, Homer and his researcher) and patient safety was highlighted by Likert colleagues titled psychometric characteristics of hospital scale responses from very disagree to very agree with the care in the patient safety culture for hospital management grading of 1 to 5, respectively. The validation (HSOPS_M) so as to investigate a wide range of sub- questionnaire validated by experts judged group of dimensions questionnaire HSOPS, such as feedback and teachers and specialist academics that were established. communication about errors/ events, organizational To assess the reliability, Cronbach’s alpha was used. learning, hands and transferring personnel, and, their Finally, reliability and professional standards of nursing team work showed that with the help HSOPS_M, the survey of hospitals could be viewed as a cross-country care, 86/ 0 was calculated3_2015_draft and, given that the value of evaluation of senior management on a safety culture at alpha was of more than 7.0, the questionnaire was the hospital and as a measurement tool to support desirable and acceptable. The population consisted of interventions in the hospital in terms of safety hospital nurses in Gilangharb (70 cases), and the Census performance and the attitudes and perceptions of senior Select the strata.iss Data from questionnaires were analyzed management, expectations, and Senior management of by using statistical software version SPSS 21. hospital patient safety measures on fundamental aspects of a safety culture [15]. Results Main hypothesis: Based on demographic information, 58.6 percent 1) Are there any patient safety events regarding responsibility in Al Gilangharb? were females and 41.4 percent were males. 63.2 percent Sub assumptions: and 36.8 percent were single, married, 50.1% between 25 1) Are there any safety events with an index clinician and 30 years old, 19.7 Drsd 31-35 years, 12.5 percent nurse regarding the relationship in Gilangharb Al-Zahra Byn 36 and 40 years, 10.4% between 41 and 45 years hospital? and 7.3 percent more than 45 years old. 46.1 percent had 2) Are there any events in hospital 8_specialregarding patient a bachelor’s degree, 25.1% a high school degree, 11.7% safety indicators or the nurse educator role in Gilangharb had a higher education degree and 17 percent a MS Al-Zahra? degree. 3) Are there any patient safety events regarding the role of the director of nursing in Gilangharb Al-Zahra hospital?

Table 1. Evaluation of data normality - Kolmogorov-Smirnov test safety Accountability Researcher manager Training Specialist Providers Clinical N 385 385 385 385 385 385 Mean 196.6052 126.1221 14.8779 29.2416 37.4260 44.5766 Normal Parameters a, b Std. Deviation 61.94874 31.88061 4.08671 8.09490 11.06752 12.77877 Absolute 0.071 0.077 0.108 0.089 110 -0.106 Most Extreme Differences Positive 0.071 0.077 0.105 0.089 110 0.106 Negative -0.069 -0.059 -0.108 -0.080 -0.054 -0.064 JML_VolumeKolmogorov-Smirnov Z 1.392 1.502 2.126 1.753 2.154 2.079 Asymp. Sig. (2-tailed) 0.042 0.022 0.000 0.004 0.000 0.000 a. Test distribution was Normal. b. Calculated from data. Based on the table above for normal data, One-Sample Kolmogorov-Smirnov Test was used as the significance

143 Journal of Medicine and Life Vol. 8, Special Issue 3, 2015

level and less than 0.05 results showed that profits were 29.2416 and also the results used the Friedman test with not so normal data and Spearman test was used to 1048.856 Chi-Square = And DF = 3 And SIG = .000 to analyze the data. rank the dimensions of the responsibility that the Specialist Clinical had with an average 3.82 rating and Table 2. The relationship between the hypotheses using dimensions, Training Providers, manager, Researcher Spearman’s rho test respectively, with an average rank of 3.09, 2.09 and 1, Correlations having the highest average rating. safety Conclusion 0.768 R The findings showed that a positive and Accountability SIG 0.000 significant relationship between patient safety and N 70 accountability could agree that the main theory was R 0.817 approved; patient safety and positive relationship between Specialist Clinical SIG 0.000 the dimensions of responsibility were therefore sub- N 70 hypotheses that were confirmed. In 2012, Stoic et al. R 0.622 suggested that patients in hospitals with a positive safety Spearman’s rho Training Providers SIG 0.000 culture would experience fewer errors [1]. Screw and N 70 colleagues showed that a better safety culture in hospitals R 0.691 was associated with lower rates of adverse events [2]. In manager SIG 0.000 2011, Hope et al. indicated that safety programs had a N 70 positive impact on reducing accidents indicators that R 0.666 would play a role in reducing the severity of accidents, Researcher SIG 0.000 reduce accident frequency3_2015_draft index, reduce the severity of N 70 accidents and loss of a repeated diseases-frequency,

various amounts of leading and indicated job The table above showed that patient safety and consequently, increasing the level of productivity for any accountability was situated at the level of 95 percent, the organization [iss16] especially in the area of governance and use of Spearman correlation was positive (SIG = .000) leadership strategies using aggressive teeth, a hospital regarding the correlation coefficient for the 768. The main patient safety could be considered as a priority strategy hypothesis was confirmed. Between patient safety and and upgrade [17]. In 2014, Hemati Maslakpak stated that accountability at the level of 95%, using Spearman and nurses could use the appropriate communication skills positive relationship existed (SIG = .000) and secondary with patients in intensive care, maintain, and improve hypotheses were also approved. safety [18]. Friedman rank test results showed that nurses in roles of responsibility, such as Specialist Clinical, Table 3. Mean standard deviation and the mean rating by Training Providers, manager and Researcher Friedman test to rank the dimensions of responsibility respectively, had the highest priority. Kim and colleagues Mean Std. Deviation8_special Mean Rank demonstrated that the error reporting and coordination Researcher 14.8779 4.08671 1.00 between sectors were identified as priority cases [19]. manager 29.2416 8.09490 2.09 With regard to the relationship between patient safety and Training Providers 37.4260 11.06752 3.09 responsibility, it could be said that nurses in all roles Specialist Clinical 44.5766 12.77877 3.82 (teacher, researcher, administrator and specialist clinical) have been successful, so we suggested that given the The above table showed the highest average experience, expertise, and their ability and power, they standard deviation for the later Specialist Clinical, the rate could force the operation for an efficient use. In addition to being 12.77877 ± 44.5766. The average standard the increase of patient safety and accountability, nurses deviation of Training Providers, manager, Researcher, need to attract collaborate and have contract with the was 4.08671 ± 14.8779 11.06752 ± 37.4260,8.09490 ± employment from a treaty change and, according to the theory of equality of benefits, they are changed.

References JML_Volume

1. Ravaghi H, Barati Marnani A, Safety Culture and Patients’ 2. Mardon R, Khanna K, Sorra J, Dyer Hoseini AF, Takbiri A. The Perceptions of Medical Errors in N, Famolaro T. Exploring relationships Relationship between Health Care Teaching Hospitals in Tehran. 2011, between hospital patient safety culture Providers’ Perceptions of Patient http://journals.tums.ac.ir/ 2013.

144 Journal of Medicine and Life Vol. 8, Special Issue 3, 2015

and adverse events. Journal Patient and safety among public hospitals of hospitals. Quality Safety Health Care. Safety. 2010. Tehran Medical Sciences University. 2010; 19,1-5. 3. Abdi J. Maleki MR, Khosravi A. Staff 2010. http://journals.tums.ac.ir/ 2013. 15. Hammer A, Ernstmann N. perceptions of patient safety culture in 10. Abdi Zh, Maleki MR, Khosravi A. Psychometric properties of the Hospital hospitals of Tehran University. Perceptions of patient safety culture Survey on Patient Safety Culture for Quarterly Monitoring 411. Fall 2011; among staff of selected hospitals hospital management (HSOPS_M). 4,1:419. affiliated to Tehran University of BMC Health Services Research, 2011. 4. Fleming M, Wentzell N. Patient safety Medical Sciences. Payesh Health http://www.biomedcentral.com/1472- culture improvement tool: development Monit J Iran Instit Health Sci Res. 6963/11/165. and guidelines for use. Healthcare 2011; 10:411–9. 16. Omidvary M, Javaheryzadeh N, Quarterly. 2008. 11. Moghri J, Arab M, Akbari Saari A et Allahnoormoradi H, Davodi MM. The 5. 10 facts on patient safety. al. The Psychometric Properties of the effect of safety programs on indicators Www.who.int/Features/Factfiles/Patient Farsi Version of “Hospital Survey on of occupational accidents and _Safety/En/Index.html. Patient Safety Culture” In Iran’s Diseases in the food industry Ilam 6. Pauniaho S, Lepojarvi M, Peltomaa Hospitals. Iranian J Publ Health. 2012; province in a five-year period. Journal K et al. A surgical checklist increases 41(4):80–86. of Ardabil health, the second period. patient safety. 2009. 12. Tabibi J, Nasiripour A, Maleki M, Fall 2011; 3:14-23. 7. Professional standards and nursing Raesi P, Mahmoudi M, Azimi L. The 17. Nasiripour A, Haghshenas K, Rabiei care. Office of Nursing, Ministry of survey of staff safety attitude in one F. Strategies to promote patient safety Health and Medical Education therapeutic, educational, and medical in clinical departments, 15 Khordad Cooperation with Tehran University of center Tehran 2010. Quarterly of hospitals in Tehran. Health Medical Sciences. health management. 2010; (48)15. Management. 2010; 4 and 3,2. 8. Janghorbani M, Raisi A, Dehghani S, 13. Singer S, Lin S, Falwell A, Gaba D, 18. Hemati Maslakpak M, Sheikh Beklo Mousavi A. Assessment of safety Baker L. Workforce Perceptions of M, Baghei R. The relationship between status in operating rooms of Shahid Hospital Safety Culture: Development communication skills and nurse - Beheshti hospital by the world health and Validation of the Patient Safety patient immune status of patients in organization standards for safety- Climate in Healthcare Organizations intensive care. Journal of Clinical friendly hospitals. Health Information Survey. Health Services Research. 3_2015_draftNursing. Summer 1993; 3,2. Management. 2013; 9(7):1066-72. 2007; 42(5):1999–2021. 19. Kim J, An K, Kim MK, Yoon SH. 9. Movahed Kor E, Arab M, Akbari S, 14. Alahmadi HA. Assessment of patient Nurses’ perception of error reporting Hosseini M. Inpatient Perceptions of safety culture in Saudi Arabian and patient safety culture in Korea. Participating in cure decision making iss West J Nurse Res. 2007; 29(7):827-44.

8_special

JML_Volume

145 Journal of Medicine and Life Vol. 8, Special Issue 3, 2015, pp.146-150

Evaluation of stress factors among the elderly in the nursing homes for the elderly (Eram and Mother) in Kermanshah, in 2015

Moradi Z*, Far Ajallah Bike Nouri M**, Mohammadi M***, Esfandnia F***, Taovsi P***, Esfandnia A** *Isfahan University of Medical Sciences, Isfahan, Iran, **Tabriz University of Medical Sciences, Tabriz, Iran, ***Kermanshah University of medical sciences, Kermanshah, Iran

Correspondence to: A Esfandnia, MSc, Kermanshah University of Medical Sciences, Kermanshah, Iran, Kermanshah University of Medical Sciences, Iran, Phone: +989189464518, E-mail: [email protected]

Received: March 14th, 2015 – Accepted: June 18th, 2015

Abstract Introduction: The purpose of this study was to assess the stress factors among the elderly living in nursing homes (Eram and Mother) in Kermanshah, in 2015. Research method: This was a descriptive - cross analysis and was done in the first half of 2015 in a sectional way. The statistical society included 150 elderly men and women aged 60 to 74, and the sample size was selected3_2015_draft from 108 people using the Cochran formula. A standard questionnaire was used to collect data from a previously validated survey. Finally, a total of 100 questionnaires were filled in and data were analyzed by using Amos 21 and SPSS 21 software. Results: The results showed that the dimension of the physiological problems had the highest average and standard deviation of 5.36 ± 21.02 and Disappointment, Home empty, Disability and independence, Relationshipiss problems, Seclusion with an average and standard deviation of 3.12 ± 20.55, 5.29 ± 18.82, 4.54 ± 17.72, 3.59 ± 16.66 and 4.55 ± 16.41, had the highest average and standard deviation. Conclusion: Given that the majority of elderly live with the family in Kermanshah and have sufficient support, recommended that the government planned to reduce isolation and increase the social support for this group of elderly nursing.

Keywords: assessment, stress factors, elderly

Introduction Council of the Elderly, people above 60 years old are elderly [8]. With regard to improving health and economic The phenomenon of the increasing8_special population of communities, each year, the number of elderly increases the elderly is one of the most important economic, social, [9]. At the same time, almost 70% of the elderly suffer and health challenging in the 21st century [1]. Based on from multiple chronic diseases. Due to the increasing UN estimates, the world’s elderly population of 350 million number of elderly in the population and the increase of people reached one billion in 1975 and it is estimated to chronic diseases among older people with multiple reach one hundred million people in 2025, the growth of chronic diseases, their care can be difficult and, the elderly population growing much faster than the total unfortunately, care systems act inefficiently [10]. To population of the world, most of them living in developing improve the control population and increase life countries [2]. So, an increasing age increases the risk of expectancy, as well as improve the treatment, the global one or more chronic diseases so that most people over 60 population ages [11]. The growth of the elderly population years old have at least one chronic disease [3]. Almost 80 in developed countries is over and now more than half of percent of the elderly patients had a chronic disease, so the world’s elderly live in developing countries. According that they became more vulnerable than others [4]. Elderly to the UN report, in 2000, the elderly population in people are increasingly exposed to various diseases [5]. developing countries was 12.5%-17% of the world’s The physiological changes that occur during the aging population [12]. On the other hand, the total number of process and certain changes in the nervous system and elderly in the world, in 2006, was 687 million and will be of JML_Volumethe musculoskeletal system, could be affected regarding 923 thousand in 2050, and the figure reached one billion the performance of the gestures, increasing the risk of and 968 million and 53 thousand people, also, according accidents such as burns, accidents, etc. [6]. One of the to the report, currently 6% of the population aged up to 26 goals of dynamic aging is to reduce disability related to million and 393 thousand (equivalent to 26% of the chronic diseases in old age [7]. According to the National population per year). Also, according to the center’s Journal of Medicine and Life Vol. 8, Special Issue 3, 2015

report, the life expectancy for men and older women in women who were staying in welfare institutions. The Iran during the years 2005 and 2010 was 77 and 78 years sample included 150 elderly men and women aged 60 to respectively [13]. Taking into account the tressing factors 74, and a sample size of 108 Cochran formulas was used, period, aging is a loss, the loss of a child, spouse, vision, which came to a final number of 100 questionnaires filled hearing, occupation, social status, etc. [14]. Elderly in. The questionnaires were distributed randomly. Data people, who are prone to disease and disability, are collection was performed by using a standard physically different regarding the mental health of those questionnaire. To collect the questionnaires, the centers whom they accept. Some psychological problems within of the Elderly Rehabilitation Center for Men (Eram) and Women (Mothers) were visited and a list of the elderly this period of life are more prevalent [15]. The aging people was provided. Then, the questionnaires were population influences the various economic and political completed and the final data were analyzed with the help aspects, causing a sharp rise in public spending and of SPSS 21 and AMOS 21 software. A valid and reliable imposing additional pressure on social security [16]. One questionnaire from the study of Sadrossadat et al. (2013) of these problems is stress. Stress and new diseases of [18] was approved. Cronbach’s alpha reliability coefficient the civilization today is the rise of many physical and method of total scale was equal to 0.95 and the mental diseases [17]. The aim and principles of this study Spearman–Brown’s was 0.84 and 0.79 respectively, the were to evaluate the stressor factors among the elderly tests indicating a good reliability for this scale [19]. living in nursing homes for the elderly (Eram and Mother) in Kermanshah, in 2015. Results

Method The results showed that in terms of gender, 53% were females (53 patients) and 47% (n = 47) were males. This cross-sectional analytical-descriptive study 33% were single (late spouse3_2015_draft and widow), 33 and 67 design was done in the first half of 2015 in the Welfare percent (67 people) were married. 33% (32) had an under Rehabilitation Center in Kermanshah to assess the diploma certificate, 34% (33) held a diploma, 11.3% (11) stressor factors among the elderly, in the nursing homes held an associate degree, 16.5% (16) had a bachelor’s for the elderly (Eram and Mother). The statistical society degree and 5.2%iss (5 patients) held an MA and upper. included all 60 years old people and older men and

Table 1. Mean, standard deviation and the mean scores by using the Friedman test Dimension Mean Rank Mean Std. Deviation Disappointment 2.61 16.4100 4.55958 Seclusion 4.57 20.8500 3.12169 Home empty 2.77 16.6600 3.59073 Relationship problems 3.54 18.8200 5.29604 Physiological problems 4.26 21.0200 5.36728 Disability and independence 3.26 17.7200 4.54402

The table above shows the dimension8_special of the square 91.092 and, df = 5, and the significant level of 000 physiological problems with the highest mean and was used, the results showing the dimension Seclusion, standard deviation of 5.36 ± 21.02, Disappointment, with an average grade of 4.57, the highest rank and Home empty, Disability and independence, Relationship aspects of Physiological problems and Relationship problems, Seclusion with a mean and standard deviation problem and Disability Disappointment and independence of 3.12 ± 20.55, 5.29 ± 18.82, 4.54 ± 17.72, 3.59 ± 16.66 and Home empty and the average rating respectively and 4.55 ± 16.41, was the highest average and standard 4.26, 3.54, 3.26, 2.77 and 2.61, having the highest rank. deviation. Also, the rankings of the Friedman test with chi-

Table 2. Relationship between stressor factors and their dimensions Estimate S.E. C.R. P Disability and independence <--- Stressors of aging .157 .023 6.878 *** Physiological problems <--- Stressors of aging .168 .028 5.974 *** Relationship problems <--- Stressors of aging .175 .027 6.474 *** Home empty <--- Stressors of aging .104 .019 5.422 *** JML_VolumeSeclusion <--- Stressors of aging .112 .015 7.294 *** Disappointment <--- Stressors of aging .196 .020 9.978 *** ***Indicates the significance of the relationship at the level of 95%. Based on the table, there is a significant relationship between the dimensions of stress factors among the elderly living in nursing homes for the elderly (Eram and mother) in Kermanshah. The means confidence level is less than 0.05, meaning the relationship between the dimensions of significant stress factors and positive factors.

147 Journal of Medicine and Life Vol. 8, Special Issue 3, 2015

Table 3. Total, directly or indirectly standardized effects Standardized Total Effects Standardized Direct Effects Standardized Indirect Effects Stressors of aging Stressors of aging Stressors of aging Disappointment .708 .708 .000 Seclusion .591 .591 .000 Home empty .478 .478 .000 Relationship problems .545 .545 .000 Physiological problems .515 .515 .000 Disability and independence .569 .569 .000

The table above shows that the standard of the and independence equal to the amount 0.708, 0.591, total amount of their direct effects is equal to the 0.478 , 0.545, 0.515 and 0.569 respectively. Also indirect dimensions Disappointment, Seclusion, Home empty, effects are standard for all resolution 0.000, respectively. Relationship problems, Physiological problems, Disability

Table 4. The final model-fitting index of the research Acceptation Obtained value Interpretation Accepted level Standard criterion level Accepted 283.483 Chi-square obtained compared with the chi- Value of chi-square in Chi-square CIMIN square table for a certain degree of the table freedom. Accepted .042 Should be less than 0.5 Less than 0.5 The root mean square error of estimate 3_2015_draft (RMSEA) Rather Accepted Near to 0.95 is fitted Zero (non-fitted), one Louise Tucker TLI .854 (good fitted) Accepted 4.899 Less than 1 indicates weakness; more than iss 1 to 5 relative Chi-square 5 shows the need to improve fitness levels. CMIN/ DF Rather Accepted 0.575 Should be more than 0.5 or 0.6 Normalized frugal fit index PNFI Rather Accepted 0.589 Should be more than 0.5 or 0.6 Comparative frugal fit index PCFI Rather Accepted 0.848 Should be more than 0.9 Comparing the Bentley Bonet index model to model NFI without its normalized Fitness relationship indicator Rather Accepted .883 Should be more than 0.9 Comparing the CFI model to model 8_special without its relationship Rather Accepted .878 Standard value is more than 0.9 Between 0 and 1 incremental Fitness index IFI Chi-square = 283.483 Degrees of freedom = 15 Probability level = .000

The ratio of the economy or PRATIO, a kind of deemed and a model with the smallest amounts to more frugal fit indices considered in itself, is not fit index, but elegant models were considered in this study, rather shows the extent to which the researcher has spent respectively, 3.303, 3.268, 326.999, 323.483, which the definition of free parameters. This index was amounted to 3.268, ECVA being the most effective model. developed based on the degrees of freedom model, which can achieve independence, a value between zero and the one to take any size is much smaller, indicating that the researcher has spent more money in the free parameters. Often, higher values of 0.5 for this indicator have seen JML_Volumethat this rate is of 0.714. Also, for an adequacy number of samples, the HOTLTER index used in this study sample number 41 was acceptable and according to the study sample size it was of 100 companies and models of these indicators were also fitted. Indicators ECVA, MECVI, AIC, BCC, were used to determine the most elegant model Fig. 1 ECVA model

148 Journal of Medicine and Life Vol. 8, Special Issue 3, 2015

labor issues, health and mortality in the elderly, were Based on the above, stress factors have a direct stressful [18]. Research results of Zia Pour and Kianpour effect on dimension Disability and independence (0.57), (2014) showed that 44% of the elderly people have sleep Physiological problems (0.51), Relationship problems problems, 23% hearing problems, 63.6% vision problems, (0.55), Home empty (0.48), Seclusion (0.59) and 21.7% constipation, 45.3% memory impairment, 14.8% Disappointment (0.71). The highest impact between the urinary tract problems, 90.8% dental problems, and 43% stress factors among the elderly and those dimensions stress [15]. For the ranking dimensions of stress factors related to dimension Disappointment were at a rate of among the elderly, Friedman test with chi-square df 0.71 percent and the lowest for Home empty dimension =91.092 5 was used, and the significance level was sig = 0.48 respectively. 0.000 results, showing that dimension Seclusion, with an average grade dimensions of 4.57 had the highest rank Discussion and Conclusion and then Physiological problems and Relationship The purpose of this study was to assess the problem and Disability and independence and Home stress factors among the elderly in Kermanshah. empty and Disappointment with the average rate, According to the results obtained, the dimension respectively, 4.26, 3.54, 3.26, 2.77 and 2.61, were the physiological problems, with the highest average standard highest ranks. Galligan stated that one of the most deviation dimensions of 5.36 ± 21.02 respectively and important aspects in old age is to keep or create stronger then Disappointment, Home empty, Disability and ties and participate in social activities. Loneliness and independence, Relationship problems, Seclusion, with an limited social relations are a major cause of stress is the average and standard deviation of 3.12 ± 20.55, 5.29 ± elderly. In general, strong social relationships cause 18.82, 4.54 ± 17.72, 3.59 ± 16.66 and 4.55 ± 16.41, was social support and empowerment of people to help others the highest average and standard deviation. Oldehinkel et in crisis [21]. In the Barry study, approximately 60% of the al. noted that physical health problems, problems related cost of health care for the3_2015_draft elderly was shown to account to disability, hearing, vision, and memory as stressor for for 35% of the medical evacuations and 47% of the days seniors, were medical conditions due to a reduced ability in the hospital to be included [22]. Given that the majority to carry out their work and in severe cases caused stress of older peopleiss living in Kermanshah with the family and to others in the association with older people [20]. enjoying a sufficient support from the government, Difficulty in recalling and remembering things, reducing suggested that programs are created to reduce isolation the power of the senses (hearing, smell, touch), bladder and increase the social support for this group in elderly control issues, specific diseases, changes in sleep, nursing. changes in diet, inability to perform daily activities (shopping, food preparation, cleaning the house), are Acknowledgment: factors that the elderly people are exposed to. Research Colleagues of the University of Medical results of Shiri Mohammad Abadi et al. (2014) showed Sciences, who helped us in implementing this project. that the events related to financial issues, social issues, This project did not have a source of financing.

8_special References

1. Mohtasham Amiri Z, Farazmand A, Tehran, Iran. Payesh J. Iran Inst Health 22th state Congress of Medical and Toloei M. Causes of patient’s Sci Res. 2004; 3(3):219-25. Paramedical Updates. Esfahan. 11-12 hospitalization in Guilan university 6. Potter PA, Perry AG. Fundamentals of Jan 2005; 101. hospitals. J Guilan Univ Med Sci. 2002; Nursing. 2005, St. Louise: Mosby. 10. Seyf Rabiee MA. Geriatric care of 11(42):28-32. 7. Cigolle CT, Langa KM, Kabeto MU et al. patients with chronic diseases. National 2. Haji Jafari M. Prevalence of common Geriatric conditions and disability: The Congress of Chronic Diseases, Geriatrics chronic diseases in pensioners of Imam health and retirement study. Ann Intern Health and Treatment. 2008. Khomeini relief committee in Kashan from Med. 2007; 147(3):156-64. 11. Davies E, Higginson IJ. The solid facts: Feb to May. 2007; 43. 8. Clausen T, Romøren TI, Ferreira M, Palliative care. World Health Organization 3. Aldrich N, Benson WF. Disaster Kristensen P, Inqstand B, Holmboe Regional Office for Europe. 2004. Preparedness and the Chronic Disease Ottesen G. Chronic diseases and health http://www.euro.who.int/__data/assets/pdf Needs of Vulnerable Older Adults. inequalities in older persons in Botswana _file/0003/98418/ E82931.pdf. Preventive Chronic Disease. 2008; 5(1):1- (southern Africa): a national survey. J 12. Habibi A, Nikpour S, Seiedoshohadaei 7. Nutr Health Aging. 2005; 9(6):455-61. M, Haghani H. Quality of life and status of JML_Volume4. Woo Ek, Han C, Jo SA et al. Morbidity 9. Nasehifar R, Sarikhani M, Jalali S. physical functioning among elderly people and related factors among elderly people Assessing the consumption and culture of in west region of Tehran: a cross- in South Korea: results from the Ansan food and it’s relation with factors such as sectional survey. Iran Journal of Nursing. Geriatric (AGE) cohort study. BMC Public education, marital and economic status in 2008; 21(53):29-39. Health. 2007; 7:10. older people living in Booshehre city in 13. Edmonds P, Karlsen S, Khan S, 5. Tootoonchi P. Chronic diseases and 2005. Abstracts book of National Addington-Hall J. A comparison of the senile changes in the elderly population, Congress of Gerontology & Geriatrics, palliative care needs of patients dying

149 Journal of Medicine and Life Vol. 8, Special Issue 3, 2015

from chronic respiratory diseases and 16. Zia Pour A. Survey of elderly leisure and their relation to depression and cognitive lung cancer. Palliat Med. 2001; 15(4):287- its social factors. European Online decline, rising. Journal of Public Health, 95. Journal of Natural and Social Sciences. School of Public Health, Yazd Research 14. What should be done with the stress of 2013; 2, 4:669-676. Journal. February 2012; 8,6. aging?. The elderly are under stress, 17. Ghaderi, Shadi et al. estimated the 20. Oldehinkel AJ, Ormel J, Brilman EI, health magazine, No. 289, commissioned prevalence of depression and its Vandenberg L. Psychosocial and by the Office of population health, family associated factors in the elderly home vascular risk factors of depression in later and school health departments of the residents in 2010. Journal of Aging. life. Journal of Affective Disorders. 2003; Ministry of Health and Medical Affairs, Spring 2011; 7,24. 74(3):237-46. especially the elderly, 2010. 18. Sadrossadat SJ, Houshyari Z, 21. Galligan D. Psychosocial Factors that 15. Zia Pour A, Kiani Pour N. Factors Sadrossadat L. Construction and Promote Successful Aging. Journal of Affecting Chronic Diseases among Elderly standardization of the measurement scale Aging and Health. 2002; 12(4):470-89. Residents in Nursing Homes (Eram and stressors of aging (aging of Iran) in the 22. Barry PP. An overview of special Mother) In Kermanshah. International eighth. Spring 2013; 28. consideration in the evaluation and Journal of Management and Humanity 19. Shiri MA, Elaheh YK, Fariba Dadgari A. management of the geriatric patient. Am J Sciences. 2014; S(3),3962-3966. Identify stressful events of the elderly and Gastroentral. 2000; 95:8-10.

3_2015_draft

iss

8_special

JML_Volume

150 Journal of Medicine and Life Vol. 8, Special Issue 3, 2015, pp.151-155

Assessing the reasons for the choice of dentistry as a career by Iranian dental students: A Questionnaire Survey

Hamissi J *, Bairami P **,Hamissi Z*** *Department of Periodontics and Dental Caries Prevention Research Center, Qazvin University Medical Sciences, Qazvin, Iran, **Department of Dentistry, Al Ghadier General Hospital, Tabriz, Iran, *** College of Dentistry, Shahied Behesti University of Medical Sciences, Teheran, Iran,

Correspondence to: Jalaleddin H Hamissi, DDS, MDS, Associate Professor, In Periodontics and Dental Caries Prevention Research Center Qazvin University Medical Sciences, Shahid Bahonar Blvd, Qazvin, Iran, Phone: +989121812543, E-mail: [email protected], [email protected]

Received: March 14th, 2015 – Accepted: June 18th, 2015

Abstract Aims: The aim of this study was to determine the reasons for the choice of dentistry as a career by undergraduate dental students in Iran. Materials & Methods: Questionnaires were distributed among the first-year to the sixth-year undergraduate dental students at the College of Dentistry in Qazvin University of Medical Sciences in Qazvin, Iran. The questionnaires were presented in a lecture hall at the end of the second semester in the 2011-2012 academic years. The questionnaire comprised3_2015_draft 30 items and the students were required to rate the importance of each item for selecting dentistry as a career, on a 10-points scale. T-test and ANOVA were also used for the data analysis. Results: The response rate in the study was 55% (out of 100%) of the students recruited. Ninety-six students (93.2%) selected dentistry as a first choice. Dentistry as a carrier which is “insurer of financial independence”iss was given a maximum score by 82.5% of the students recruited and a similar number of the students (75.7%), gave a maximum score to the factor “I like to make a lot of money”. Dentistry as a “science-based profession” was also given a score by 80.6% of the students. Conclusion: There were no differences in the motivation between male and female students. It was concluded that “insurer of financial independence” and “I like to make a lot of money” were important motivating factors in this population of dental students.

Keywords: dentistry, career, questionnaire, dental students, dental education

Introduction Choosing dentistry as a career has been studied in many countries. A variety of reasons has been The motivations for choosing8_special dentistry as a mentioned for this, including: status and security, the career in Iran are not clear. This study was aimed at nature of career, patient care, and working with people exploring the reasons why students chose this career. [9]. Most of the studies investigating the reasons for a Dentists have an important position in the society as choice of dentistry as a career have been carried out in licensed healthcare workers [1,2]. developed countries such as the US [10], UK [9-11], Dentistry is ranked fourth in comparison with Ireland [12], Australia [5] and Denmark [14]. Self- medicine, pharmacy, and veterinary science. employment and business-related motives were reported Consequently, a high level of academic performance is as important factors by the students in the US [10] and necessary to start a career as a dentist. However, less perceived as ease of employment were, being self- clearly defined are the factors that influence the choice of employed, working for regular hours, and having a high dentistry as a career. Ranking and correlating these income and the opportunity to help people, being reported factors would be helpful in determining the students’ as the reasons for entering this profession in Ireland [12]. needs and expectations in their subsequent In Iran, the dental program lasts for at least for 6 undergraduate careers. Recent studies were performed years. Admission to the program depends on the results elsewhere [3-8]. of the Iranian University Entrance Exam (the Concurs) The motives for choosing a career are complex which requires 12 years of study in order to be qualified to JML_Volumeand a choice of dentistry as a career is no exception. take this exam. A high level of academic performance or a There are a number of factors deciding the career high grade point average (GPA) is necessary for dental choices, such as: working conditions and financial students to start a career as a dentist. There is limited rewards, the nature of the career, working with people, information concerning the career choices of students in etc. [9,10]. developing countries [15]. Journal of Medicine and Life Vol. 8, Special Issue 3, 2015 Nevertheless, there is no available data 1- One or more of my relatives are dentists. regarding the reasons for the choice of dentistry as a 2- One or more of my friends are dentists. career in the Iranian population. Our study is therefore 3- My GPA encouraged me to choose dentistry as a aimed at investigating the carrier motivation. career. 4- I chose dentistry because of family persuasion. 5- It is easy for dentists to find employment. Materials & Methods 6- Dentistry pays better than other job options open to me. The Questionnaire 7- I want to be self-employed. The dental program consists of two years of 8- I want to treat/ help people improve their appearance. basic science theory and one year of preclinical theory 9- Dentistry has more regular hours than other caring and a three-year clinical phase. The method adopted was professions. an anonymous questionnaire distributed by the authors to 10- Other people encouraged me to become a dentist. the first-year to the sixth-year students at the College of 11- I always wanted to be a dentist. Dentistry in Qazvin University of Medical Sciences. 12- I can start practicing dentistry independently after Ethical approval was granted by the Qazvin University of graduating. Medical Sciences. All participants received a copy of the 13- I like working with people. questionnaire before the lecture was started and they 14- I had a good experience when visiting the family were informed, through a brief oral announcement, about dentist. the structure and the aims of this survey. During the 15- I like the autonomy that dentists have. completion of the questionnaire, participants were 16- A career in dentistry offers a better job security. expected to encounter some tasks or questions that might 17- A dentist has a flexible schedule. have seemed incomprehensible, as the questionnaire was 18- Choosing dentistry will give me more time to spend aimed at assessing various levels of competence, from with my family. elementary to highly advanced levels. The predictable 19- Dentistry will give me3_2015_draft the opportunity to work with my time for the completion of the questionnaire was ten hands. minutes. The data were collected at the end of the second 20- Dentistry is a caring profession. semester in the 2011-2012 academic years. 21- Dentistry is a science-based profession. The three-page questionnaire used in this study 22- I like to makeiss a lot of money. was based on the previous studies [10,12,15]. In addition 23- Dentistry is a prestigious profession. to the items related to cultural and family influences and 24- I heard about dentistry as a career in high school. the university admission procedures, socio-demographic 25- I heard about dentistry as a career in college. factors such as gender, nationality, family income, and 26- The family dentist encouraged me. parents’ occupation were recorded. Moreover, motives 27- Dentistry as a career ensures financial independence. that influenced dental students in their choice of study 28- There is not much “on-call” work. were recorded as well. These included the motives 29- Dentists usually do not deal with life-or-death categorized as “financially-oriented”, “people (caring)- situations on a routine basis. oriented” and “business (flexibility)-oriented” (Table 1). 30- I worked in a dental-related field and now I want to The questionnaire (Table 1) was translated into Persian become a dentist. to ensure that all the aspects were clearly understood by the students. It consisted of 30 items with8_special each item on Table 2. Response rates the questionnaire containing a statement which required the respondents to indicate their level of agreement on a Year No. Percentage 10-point scale ranging from 0 = strongly disagree to 10 = 1 15 14.9 strongly agree. Two additional questions were answered 2 18 17.8 with yes or no depending on the fact whether dentistry was the student’s first choice and whether the student 3 27 26.7 would choose dentistry again. There was also the 4 23 22.8 opportunity to make free comments on the questionnaire. 5 18 17.8 Total 101 100 Table 1. Wording of 30 motives in the questionnaire Factor

Table 3. Top 10 reasons for pursuing a career in dentistry for males & females, as determined by mean rating No. Factors Scores (Mean) (Sd) JML_Volume Male 13 I like working with people. (4.28)(3.52) 21 Dentistry is a science-based profession. (4.15)(3.62) 27 Dentistry as a career ensures financial independence. (4.05)(3.35) 8 I want to treat people to improve their appearance. (4.03)(3.21) 22 I like to make a lot of money. (3.93)(3.4)

152 Journal of Medicine and Life Vol. 8, Special Issue 3, 2015

16 A career in dentistry offers better job security. (3.88)(3.44) 15 I like the autonomy that dentists have. (3.78)(3.6) 23 Dentistry is a prestigious profession. (3.77)(3.36) 18 Choosing dentistry will give me more time to spend with my family. (3.75)(3.39) 20 Dentistry is a caring profession. (3.52)(3.23) Female 27 Dentistry as a career ensures financial independence. (3.77)(3.24) 10 Other people encouraged me to become a dentist. (3.48)(3.41) 29 Dentists usually do not deal with life-or-death situations on a routine basis. (3.47)(3.56) 15 I like the autonomy that dentists have. (3.43)(3.27) 3 My GPA encouraged me to choose dentistry as a career. (3.37)(3.48) 22 I like to make a lot of money. (3.35)(3) 7 I want to be self-employed. (3.35)(3.95) 23 Dentistry is a prestigious profession. (3.31)(3.11) 14 I had a good experience when visiting the family dentist. (3.29)(3.61) 5 It is easy for dentists to find employment. (3.27)(3.05)

Table 4. Factor loadings on primary motive factors Factors Factor 2 Factor 3 Factor 1 Money People Flexibility Male Male Male Female Female Female 3.48

3.26 3_2015_draft 6-Dentistry pays better than other jobs. 4.05

3.77 27-Dentistry as a career ensures financial independence.

3.23 iss 5- It is easy for dentists to find employment. 3.27

2.1 7- I want to be self-employed. 3.35

3.93 22- I like to make a lot of money. 3.35

3.88 16- A career in dentistry offers better job security. 3.26

3.78 15- I like the autonomy that dentists have. 3.43

29- Dentists usually do not deal with life-or-death situations 3.2 8_special on a routine basis. 3.47

8- I want to treat people improve their appearance. 4.03

3.18

13-I like working with people. 4.28

2.88

19- Dentistry gives me the opportunity to work with my hands. 3

18- Choosing dentistry will give me more time to spend with 3.13

my family. 3.75

28- There is not much “un-call” work. 3.03

3.45

29- Dentists usually do not deal with life-or-death situations 3.11

on a routine basis. 3.2

9- Dentistry has more regular hours than other caring 3.47

professions. 2.88

17- A dentist has a flexible schedule. 2.19

3.2

JML_VolumeMean (total) 2.87

3.63 3.05 3.49 3.17 2.37 3.31

153 Journal of Medicine and Life Vol. 8, Special Issue 3, 2015, pp.151-155

Statistical Analysis reports [18] found no difference in the academic The returned questionnaires were checked for performance or graduation rate of “first choice” students completeness of data; the data were processed and and other students. Still, this is similar to the almost 90% analyzed by means of the Statistical Package for the reported in the UK [19]. Qualitative approaches are Social Sciences (SPSS PC Version 14.0) (SPSS Inc., obligatory to explore and understand the students’ Chicago, USA). The t-test was used to investigate reasons for choosing or not choosing dentistry as a whether statistically significant differences existed career. Moreover, due to the lack of professional and between scores for different groups. The t-test was used longitudinal studies on oral health, studies should survey for the analysis of the two groups and ANOVA was used the career path and retention according to career choices for more than two groups. Scale means for males and [20]. females were calculated and an independent sample t- The results of a study in the US showed that test was then used to examine the differences in the there were differences in the motivation of male and scores related to gender and the first choice group and female students [10]. Female students were less the non-first choice group. concerned than male students with the business component of a career choice (were less financially oriented) and were more concerned with the caring and Results people factors (were more people (caring)-oriented) [10,21]. This was similar to a recent study conducted by An overall response rate of 55% (103 out of 188) the first-year dental students in Peru [14]. was obtained. Out of 103 respondents, 39.2% (40) were However, in our study, the high number of the males and 60.8% (62) females, and one student did not female students who have chosen dentistry as a first identify his/ her gender. There was no statistically choice might be due to the easy dental practice significant difference in gender distribution among the requirements. 3_2015_draft participants from each year (P>0.05). Iranian dental It could be concluded that “prestige” and “helping students can directly enter the Dental School after people” were important motivating factors for this group of graduating from high school and after passing the dental students [15]. Our study came up with the same National University Entrance Exam. At the time of the iss results. survey, the age of the respondents ranged from eighteen The results presented in this study are the first to twenty-seven, with a median age of twenty-one. reported data in the Islamic Republic of Iran on the The majority of the students (93.2%) placed reasons and motives for choosing dentistry as a career. dentistry as their first career choice. On the other hand, Further research could increase the sample surveyed, by 3% of the students placed other courses, other than extending the study to the remaining Dental Schools in dentistry, as their first preferences. Iran. A longitudinal data set could also be created by Most fathers (34.5%) were clerks and most repeating the survey for several years and by comparing mothers (59.8%) were housewives. Also, 50% of the the results obtained with the baseline results reported fathers had a bachelor’s degree and 29.6% of the here. It was decided to confine the study to a single mothers had higher degrees. This included 10.3% of the Dental School in a single year, but further research could fathers and 4.5% of the mothers with postgraduate 8_specialextend this to a longitudinal study including the other degrees. There was no significant correlation between the schools as well. parents’ educational levels.

Discussion Conclusion

The educational requirements, admission The present study was the first data on the requirements, and selection procedures greatly varied Iranian population, looking into the choice of dentistry as a among schools and, not surprisingly, the impact of these career. “Prestige” and “helping people” were found to be requirements was reflected in the sociodemographic important motivating factors for this group of dental profile of the students. Additionally, there was an increase students. There were also statistically significant in female representation among the dental students. A differences in the motivation between male and female similar trend has also been observed in the US [16], the students with the financial factors being more influential UK [17] and South Africa [7]. for the former. Of concern is the result that half the Most of the students (93.2%) placed dentistry as students indicated that dentistry was not their first choice JML_Volumea first career choice, and the majority of those who did not, had dentistry as their second choice (65%). This of career. It might be a good idea to establish career represents an increase from the 43% reported to have education programs in schools in order to educate placed dentistry as a first choice in the 1981-1985 period students regarding their career choices and employment [18] and in the mid-1990s [13]. However, some research opportunities following graduation. Based on the results Journal of Medicine and Life Vol. 8, Special Issue 3, 2015

obtained, it was concluded that the reasons for choosing The authors wish to thank the anonymous dentistry as a professional career were different for the referees for their commentaries on an earlier draft of this sexes. paper. And also, we would like to acknowledge the participation of students without whom we would not have Conflict of Interest reached this high response rate. The authors are also The authors declare that they have no conflicts greatly indebted to Professor Al-Bitar, Z.B from the of interest. University of Jordan for his helpful comments and contribution to the manuscript. Acknowledgements

References

1. Vigild M, Schwarz E. Characteristics and 8. Morris S. What Kind of People Want to 15. Al-Bitar ZB, Sonbol HN and Al-Omari Study Motivations of Danish Dental Become Dentists?. Br Dent J. 1992; IK. Reasons for Choosing Dentistry as A Students in a Longitudinal Perspective. 173:143–144. Career by Arab Dental Students. Eur J Eur J Dent Educ. 2001; 5(3):127-33. 9. Crossley ML, Mubarik A. A Comparative Dent Educ. 2008; 12:247–251. 2. Eli I, Judes H, Allerhand-Alexander Y. Investigation of Dental and Medical 16. Noonan AS, Evans CA. The Need for Dentists and Dentistry: Attitudes towards Students’ Motivation towards Career Diversity in the Health Professions. J Dent the Chosen Profession. Human Relations. Choice. Br Dent J. 2002; 193:471–473. Educ. 2003; 67:1030-3. 1989; 41:929-37. 10. Scarbecz M, Ross JA. Gender 17. Bedi R, Gilthorpe MS. Social 3. Rice CD, Glaros AG, Shouman R and Differences in First-year Dental Students’ Background of Minority Ethnic Applicants Hlavacek M. Career Choice and Motivation to Attend Dental School. J to3_2015_draft Medicine and Dentistry. Br Dent J. Occupational Perception in Accelerated Dent Educ. 2002; 66:952–961. 2000; 189:152-4. Option and Traditional Dental Students. J 11. Whittaker DK. Reasons for Choice of 18. Sivaneswaran S, Barnard PD. First Dent Ed. 1999; 63:354–358. Dentistry as a Career in Applicants to a Choice Dentistry or Medicine?. Academic 4. Zadik D, Gilad R, Peretz B. Choice of British Dental School. Br Dent J. 1984;iss Performance of Dental Students. 31st Dentistry as a Career and Perception of 156:23–25. Annual Scientific Meeting IADR ANZ the Profession. J Dent Ed. 1997; 61:813– 12. Hallisey J, Hannigan A, Ray N. Reasons Section, 1991. 816. for Choosing Dentistry as a Career–A 19. Stewart FMJ, Drummond JR, Carson L, 5. Gietzelt D. Social Profile of First-year Survey of Dental Students Attending a Hoad Reddick G. The Future of the Dentistry Students at the University of Dental School in Ireland During 1998–99. Profession: A Survey of Dental School Sydney. Aust Dent J. 1997; 42:259–266. Eur J Dent Educ. 2000; 4:77–81. Applicants. Br Dent J. 2004; 197:569-73. 6. Brand AA, Chitke UM, Thomas CJ. 13. Vigild M, Schwarz E. Characteristics and 20. Lefevre JH, Roupret M, Kerneis S, Choosing Dentistry as a Career–A Profile Study Motivation of Danish Dental Karila L. Career Choices of Medical of Entering Students (1992) to the Students in a Longitudinal Perspective. Students: A National Survey of 1780 University of Sydney, Australia. Aust Dent Eur J Dent Educ. 2001; 5:127–133. Students. Med Educ. 2010; 44(6):603-12. J. 1996; 41:198–205. 14. Bernabe´E, Icaza JL, Delgado-Angulo 21. Kristensen BT, Netterstrom I, Kayser L. 7. Brand AA, Chitke UME. Choosing EK. Reasons for Choosing Dentistry as A Dental Students’ Motivation and the Dentistry as a Career – Part 1: A Career: A Study Involving Male and Context of Learning. Eur J Dent Educ. Comparison of Student Motives. J Dent 8_specialFemale First-year Students in Peru. Eur J 2009; 13(1):10-4. Assoc SA. 1992; 47:469–473. Dent Educ. 2006; 10:236–241.

JML_Volume

155 Journal of Medicine and Life Vol. 8, Special Issue 3, 2015, pp.156-168

Explaining the relation between self-controlling and child parenting styles and psychological welfare of high school students

Sekhavati E*, Rahimian Boogar M*, Khodadost M**, Afkari R***, Atefeh Raoufi* *Larestan School of Medical Sciences, Larestan, Iran, **Department of Epidemiology, School of Public Health, Shahid Beheshti University of Medical Sciences, Tehran, Iran, ***Department of Microbiology, Jahrom Branch, Young Researcher Club, Islamic Azad University, Jahrom, Iran

Correspondence to: Mojtaba Rahimian Boogar, MD, Larestan School of Medical Sciences, Larestan, Iran, New City, Larestan, Fars, Iran, Phone: +989179178078361, E-mail: [email protected]

Received: March 14th, 2015 – Accepted: June 18th, 2015

Abstract Introduction: One of the axes of health evaluation of different societies is psychic welfare of the societies. Welfare means effort to Self-actualization and promotion which reveal in accommodation of individual's talents and abilities. No doubt psychological welfare plays an important role in ensuring dynamism and effectiveness in each society and can be influenced by various factors. Therefore, present study was done with aim of explaining relation between self-controlling and child parenting3_2015_draft styles and psychological welfare among high school students of Abadeh City. Methodology: In this sectional-correlation study, 370 students were chosen and included in the study in stage-cluster sampling method from high schools of Abadeh City. To collect information, Tangney’s self-controlling questionnaire, Bamrynd’s child parenting scale, Reef’s psychological questionnaire and a form of demographic informationiss were used. Data was analyzed using software SPSS 19 or Pearson’s correlation coefficient test and stepwise multivariable regression analysis. Findings: Analysis of data shows self-controlling variable has high and reverse predictability about psychological welfare variable (t =0.003, β =-0.158, P=2.99). So self-controlling has high and reverse predictability about two elements of psychological welfare scale i.e. self-acceptance (P= 0.0001, t=4.87, β= - 0.181) and dominance on environment (P= 0.0001, t=3.807, β= - 0.200). The results represent presence of a significance relation between predictability of child parenting styles about psychological welfare (p=0.01, F=3.85, r2= 0.031, r=0.177). These results show high predictability of child parenting methods in two different directions in two styles of autocratic (P=0.035, t= 2.12, β=0.113) and authoritative (P=0.014, t=2.437, β= 0.434). Autocratic style has reverse significant relation in most aspects of psychological welfare. Also they show that "authoritative style" variable alone has predication ability 0.143 according to variance of psychological welfare variable. And adding two other variables i.e. self-controlling and autocratic style, this figure increase to 0.188 and 0.225. Highest value for predicting ability belongs to authoritative style of child Parenting directly and after that to self-controlling and autocratic style reversely. Conclusion: According to meaningful correlation8_special of child parenting methods and self-controlling in predicting psychological welfare, necessity of attention to these factors is felt in explaining psychic welfare of students as much as possible. So, it is recommended that training of child parenting methods is considered as a preventive and promoting way for psychological welfare in psychic health programs for all teenagers especially students so that parents can be successful in promoting their children's psychological welfare and preventing their psychic disorders with knowledge and using proper child parenting styles (as authoritative style) and avoiding inefficient methods of child parenting (as autocratic style).

Keywords: self-controlling, child parenting style, psychological welfare

Introduction One of axes of health evaluation related to different societies is psychic health of the societies. Certainly In modern world, health views have received psychic health plays important role in insuring dynamism vaster perspectives and non-medical determining factors and efficiency of each society. Psychic health is among of health have been faced with special attention. Each of things which humans search in their lives. Since psychic these determinants has influence on health status in their health has been considered vital need for improving JML_Volumeself or by influencing each other and causes injustice in humans’ quality of life, World Health Organization (WHO) health status. These determinants include genetics; way describes health as a mood of welfare in which a person of life, environment, and psychic-social-economic status, recognizes his capabilities, uses them in effective and etc. that have significant effect on health and its productive way and is useful for his own society [57]. consequences like life quality and psychological welfare. Psychic health is a fundamental need and vital aspect for Journal of Medicine and Life Vol. 8, Special Issue 3, 2015

improvement of human's quality of life [58]. Approximately Reef knows psychological welfare as person’s 60 years ago, WHO described health as a mood of effort for vindicating his real potential abilities. Reef's complete physical, psychic and social welfare rather than model has been formed and developed through merging just not being sick [57,58]. A decade later, Jahooda different theories of personal growth (like Maslow’s self- criticized not being sick as psychic health criterion and actualization and Rajerz’s perfect person) and adaptive instead offered multiple criteria for determining psychic performance (like Jahooda’s positive psychic health health [28]. Unfortunately, no considerable development theory) [17]. Based on exact review of research literature was observed in application of these views in scientific and developmental theories solidarity Reef reminded that and practical areas for some times. In some places of the these views include similar and supplementary criteria of world, indices of health status has been focused yet on positive psychological welfare [43]. Psychological welfare disease and negative concepts and fundamental concepts is a multi dimensional context that includes merriness and of Epidemiology deal with death rate but not positive hope in addition to being healthy and lack of disability performance level of people [42]. Health is a [32,54]. Theoretical dimensions of positive psychological multidimensional concept and includes merriness and welfare in recent view involve independency, welfare feeling in addition to not being sick and unable environmental dominance, personal growth, positive [32]. Most of psychiatrists, psychologists and researches relations with others, being purposeful in life and self- of psychic health ignore positive aspects of health [42,48]. acceptance. Mentioned pattern has been studied vastly in Some efforts made to transit from traditional patterns of all over the world [3,18,42]. On the other hand, health have provided necessary ground for considering psychological welfare is related to personal and health as a mood of welfare (not just being sick) but are environmental factors and healthy life condition as well as not enough. Of course new patterns of health emphasize healthy body. How environment and other factors generally on negative features and in them measuring influence human’s psychological welfare structure and tools of health often deal with bodily problems (mobility, with which way they deal3_2015_draft with environmental conflicts are ache, marital problems, etc.), psychic problems matters proposed in different psychological approaches (depression, anxiety and concern) and social issues and each describe human’s psychological welfare in a (disability in playing social role, marital problems and etc.) special way issaccording to their own views about human [43]. Psychic health has relation with inner enabling nature and his impetus. Meanwhile two factors considered features or inner resources of power. Presence of these in describing individuals’ psychological welfare by inner resources increases ability of a person for adaptive researches are self-controlling and parents’ child growth in spite of adverse conditions and negative events parenting style. Investigations suggest that self-controlling to keep his own psychic health. Psychologists and has positive relation with psychic and physical health and psychiatrists know a person having healthy psyche who reduces negative effects of stress as an inner resistance has balance between his behaviors and control in dealing source and prevents from happening of psychic and with social problems [11]. But study around personal and physical disorders and generally lead to rise of person’s social effective determining factors on psychic health in all welfare [8,30]. In a condition that injured people’s psychic aspects has become a necessity for health care system of welfare is influenced by negative consequences of societies. A group of researchers in psychic health area undesirable events, self-controlling and self-toleration are has chosen a different theoretical and research8_special approach personal inner sources that can moderate stress and to explain and study of this concept inspired by Positive disability levels in undesirable conditions and cause less psychology perspective. They have treated psychic health brilliance of negative effects of stress [5]. One of as equivalent to positive function of psychology and important skills which are characteristic of individuals’ conceptualized it in psychological welfare term. This psychic welfare is that they have self-controlling. People group knows lack of disease is not enough for feeling who can prioritize realistic purposes and make balance health. It believes having satisfaction of life, sufficient between feelings and wisdom while making decision are progress, effective and efficient interaction with world, self-controlling [4,6]. Self-controlling represents adaption positive energy and creation of connection, desired rate of self-behavioral characteristics and available relation with all people, society and positive progress is conditions and situation [31]. Self-controlling concept among features of healthy person and psychic welfare which was developed by Schneider means a how flexible [41,29]. This has changed a study around effective or stable is a person in a special situation [30]. Results of personal and social determining factors on physical health studies show people with high self-controlling have and psychic welfare into a necessity for health care highest social skill and desirable psychological welfare system of societies. Vising and Vanaden recognized a [19]. Log describes self-controlling as this: addressing JML_Volumegeneral psychological welfare factor in 1997 and those behaviors which results in further delayed rewards. described it as a combination of special qualities including Self-controlling can be seen in various aspects for solidarity feeling, life satisfaction, emotion balance and example as a delay in gratification and practically as time general approach to optimism or positive orientation to life duration that a person waits to reach more valuable but [15]. later consequence [33]. Adolescents use self- controlling

157 Journal of Medicine and Life Vol. 8, Special Issue 3, 2015

skills when they want to reach a long term purpose. For psychic health. For example, autocratic parents provide this they must waive from enjoyment of food, alcohol, children with anxiety more than other parents and are in gamble, spending money, etc. They did this through second rank after style of indifferent (inconsiderate) controlling temptations of lying, escape from made parents [49]. promise and also calming themselves for obtained failure. Already a number of studies have been carried In many complicated and dual situation which need out about child parenting methods and their psychological having choice by the adolescent, he must use self- results including role of mothers’ severe disciplinary controlling. So deficiency in self-controlling is main core of methods in increasing children’s negative excitements many problems in front of the adolescent. Insufficiency in [23], deficiency of participation, intimacy and reward in self-controlling has relation with impulsiveness and child-parents relationship as predicator of problems anxiety and is indicative of inability in thinking about happening in the future [7], inconsiderate parents’ role in consequences of the behavior. Therefore, recognition and impulsiveness and aggression, dependency and determination of influence of this important variable seem responsibility in children [9], influence of excessive necessary on psychological welfare. On the other hand, support of parents or their rejection in inner disorders of parents’ child parenting style has meaningful influence on children and adolescents [14], autocratic child parenting formation of children’s thoughts, behavior and emotions. effect on early identity and inconsiderate styles in identity According to vulnerability-stress model in psychic disturbance [24]. Therefore, according to studies and pathology, a number of researches have investigated role importance of role related to self-controlling and child of factors related to the family as underlying factor in parenting style variables in explaining compatibility and person’s vulnerability and psychic welfare [25,26]. Family psychic health, fundamental issue at present study is this: has been always considered by related specialists due to whether are self-controlling and child parenting styles able its certain influence on children’s social and psychic to predict students' psychological welfare? growth. It is basis of community formation and keeping 3_2015_draft human emotions as smallest social unit and every deficiency in family's performance causes undesirable Method effects on normalizing children [45]. Most of incompatible Presentiss study is sectional-descriptive type with and problematic people live in families having correlation design that was carried out with aim of inconsiderate and autocratic style and children in families investigating relation between self-controlling and child with severe conflicts show further incompatible behaviors parenting styles and psychological welfare of high school due to lack of psychic peace, further lack of concentration students in Abadeh City. Main variables studied in the and disturbance and suffer from weaker psychological research include self-controlling, child parenting style, and welfare [2,59]. psychological welfare. Statistical population of present In other words, relation between parents and study consisted of all students of public high schools in children and other members of family can be seen as a Abadeh City in 2013-14. Sample size was obtained 370 system or network that interacts with each other. This persons according to purposes and type of the study and system influences on children directly or indirectly through previous studies in this area and considering suppositions different styles and methods of child parenting. Child as significance level 95% and error 0.05 and chosen in parenting styles are a set of trends,8_special actions, and stage-cluster sampling method from mentioned centers. nonverbal expression that determine interaction nature of In this work, Tangney’s revised scale of self- controlling, children and parents in all various situations. They have Bamyrand’s child parenting scale and Reef’s effect on different growth aspects of child of which can psychological welfare questionnaire were used related to mention responsibility and self-controlling [52,53]. aims of the study: Bamyrand proposed for the first time autocratic, A) Tangney’s self-controlling scale: this test has been authoritative and inconsiderate child parenting styles. prepared by professor Tangney et al. in 2004 and Based on Bamyrand’s theory, child parenting styles serve has 36 items which have been provided with as medium between parents’ normal variables and inspiration of previous studies and for eliminating children’s sociability. They also have supportive and non- defects of those questionnaires developed for self- supportive roles and consequences of applying each one controlling. Questions of this scale was answered is different on child’s evolution. Obtained results of some based on Likert’s 5-point spectrum i.e. 1= it has works have shown relation between child parenting styles similarity at all, 2= it has a few similarity, 3= and children’s social competencies and psychological incomparable similarity, 4= high similarity, 5= very welfare [10,60]. Also some studies emphasize on high similarity. Total score of people participated in JML_Volumepresence of relation between individuals’ psychic health the test will be 36 ones in least case and 180 ones in status and their child parenting styles. In a study Shake maximum mood. studied influence of parents’ child parenting methods on Terms adolescents’ psychic health. He concluded that parents’ 1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,2 child parenting features have correlation with adolescents’ 1,22,23,24,25,26,27,28,29,30,31,32,33,34 are scored

158 Journal of Medicine and Life Vol. 8, Special Issue 3, 2015

reversely. Tangney reported 0.89 as validity and which has 14 locutions and is responded based on credibility of these tools using Crohnbach’s alpha Likert’s 6- point spectrum (1= completely disagree – [38]. Spencer (2005) reported its inner correlation 6= completely agree). To obtain score of each scale it coefficient as 0.92 using Crohnbach’s alpha and is enough to sum scores of all locutions related to Piquero et al. (2002) reported it as 0.84 [39,40]. considered subscale. Total score of psychological Allahverdipoor et al. (2006) obtained 0.80 for its welfare is revealed by score sum of 84 locutions. In Crohnbach’s alpha in their research on high school the scale, higher score shows better psychological students of Tehran City which shows high inner welfare [42,43]. Validity and reliability of consistency of the test [1]. psychological welfare scales have been reported B) Bamyrand’s child parenting styles questionnaire: proper in various researches. Dierendonck (2005) this questionnaire is a self-reporting tools that has reported that inner consistency of all subscales were been developed by Diana Bamyrand (1967) and appropriate and their Crohnbach's alpha was measured 3 child parenting styles with 30 items and between 0.77- 0.90 [20]. Schmitt and Reef (1997) based on Likert’s 5-point scale. 3 child parenting and obtained inner consistency of psychological welfare their related locutions include: between 0.82- 0.90 [47]. In another work, Reef found 1. Inconsiderate style: inner consistency coefficient of scales between 0.86- 1,6,10,13,14,17,19,21,24,28 0.93 [42]. Bayani et al. (2002) reported credibility and 2. Autocratic style: 2,3,7,9,12,16,18,25,26,29 reliability of the questionnaire between 0.89- 0.90 in 3. Authoritative style: Iran showing desirability of this tool in Iranian sample 4,5,8,11,15,20,22,23,27,30 [11]. Finally, data was analyzed which was gathered The style with higher score is considered as by statistical software SPSS and there is possibility of dominant child parenting style. Credibility of this performing descriptive and inferential statistics. questionnaire was reported 0.81, 0.85, and 0.92 by However, main methods3_2015_draft for analysis of assumptions Bamyrand in retest method for inconsiderate, autocratic, in this plan include: frequency, mean, percent, and and authoritative child parenting styles respectively. She also tests of Pearsonian correlation coefficient and also reported about reliability of the questionnaire and multivariableiss regression analysis were used showed that autocracy of mother has relation with her simultaneously to determine relation between studied inconsideration (- 0.50) and rational authority (- 0.52) [21]. variables. Buri (1991) has reported credibility of the questionnaire among mothers and fathers groups using retest method Research questions as following: 0.81, 0,86, 0,78 were obtained for 1. How much is predicting validity of students’ respectively inconsiderate, autocratic and authoritative psychological welfare based on self-controlling? methods in group of mothers and 0.77, 0.80 and 0.92 2. How much is predicting validity of students’ related to these methods in group of fathers. He observed psychological welfare based on child parenting autocracy of mother has reverse relation with styles? inconsideration (- 0.38) and rational authority ( - 0.48) 3. How is comparison of predicting validity of students’ [16]. In a research done by Raisi (2004) in Iran, test psychological welfare based on self-controlling and reliability was reported for inconsiderate,8_special autocratic, and child parenting styles? authoritative styles in retest method as respectively 0.69, 0.77, and 0.73, which show acceptable credibility and Findings validity of these tools [40]. 4-1 descriptive information related to sample group C) Reef’s psychological welfare scale: this tool is a In this section, descriptive and inferential self-reporting scale that was developed by Reef in statistics and information have been offered. Table 1 1989 for measuring psychological welfare structures. shows mean and standard deviation of variables studied This questionnaire has 84 items and 6 subscales in the research with understudied sample.

Table 1. Mean and standard deviation scale variable mean Standard deviation Self-acceptance 47.10 6.257

Positive relationship with others 45.25 6.315

JML_Volume autonomy 46.18 5.59 Psychological Dominance on environment 46.91 6.05 welfare Purposeful life 46.27 5.58 personal growth 44.99 6.77 Total score 276.72 13.87

159 Journal of Medicine and Life Vol. 8, Special Issue 3, 2015

Self-controlling Self-controlling 97.52 13.50 Inconsiderate style 28.46 4.71 Child parenting Autocratic style 29.32 3.65 Authoritative style 28.78 4.12

As findings of Table 1 show highest and lowest Highest mean score in questionnaire of child parenting score means was respectively dedicated to self- style was obtained in scale of autocratic child parenting acceptance scale (M=47.10, SD=6.257) and personal style (SD=3.65, M=29.32). Table 2 shows correlation growth scale (M=44.99, SD=6.77) in psychological matrix of self-controlling, child parenting styles and welfare questionnaire. Mean and standard deviation of psychological welfare areas. self-controlling were 97.52 and 13.50 respectively.

4-2 correlation between under studied variables

Table 2 correlation matrix between self-controlling, child parenting styles and psychological welfare areas.

others Welfare

Autonomy Autocratic

Psychological Authoritatively Inconsiderately environment

Self -acceptance 3_2015_draft Dominance on Dominance Purposeful life life Purposeful

Positive relationship with with Positive relationship Intellectual development Self-acceptance 0.30** 1.00 Positive iss relationship with 0.22** 0.04 1.00 others Autonomy 0.47** -0.13 -0.19 1.00 Dominance on 0.36** 0.14* - 0.24** 0.05 1.00 environment Purposeful life 0.44** - 0.31** -0.03 0.21** 0.04 1.00 Personal 0.49** -0.10 **-0.123 0.23** - 0.14* 0.20** 1.00 growth Inconsiderate 0.01 0.04 -0.07 - 0.15** 0.25** -0.02 -0.02 1.00 style 8_special Autocratic style -0.12* - 0.23** -0.08 -0.05 0.12* 0.114* - 0.12* - 0.22** 1.00 Authoritative 0.13* 0.11** -0.09 0.10* 0.02 0.07 0.10 -0.09 -0.06 1.00 style

Self-controlling -0.16** - 0.25** 0.05 -0.08 - 0.20** 0.06 0.05 0.09 -0.04 0.01

*:p=<0.05 **:p=<0.001

Findings of Table 2 show that correlation correlation was observed in element of dominance on between under studied variables has different levels and environment (r=0.25) with inconsiderate child parenting directions in this research. Highest score of positive style while highest rate of negative correlation was seen correlation can be observed in the element of personal in element of self-acceptance (r=0.23) with autocratic growth (r=0.49) and its lowest score can occurred in the child parenting style. Also two elements of self- element of positive relations with others (r=0.22) with total acceptance (r=0.25) and dominance on environment JML_Volumescore of psychological welfare scale. Generally, element (r=0.20) had highest negative correlation coefficient with of positive relations with others has lowest correlation self-controlling scale. comparing with other Elements and scales in the Among different styles of child parenting, only research. two styles of inconsiderate and autocratic child parenting Among elements of psychological welfare scale had negative correlation coefficient (r=0.22) with each and child parenting style, highest rate of positive other. There has not been observed meaningful

160 Journal of Medicine and Life Vol. 8, Special Issue 3, 2015

correlation between authoritative style and two other Purposeful life 0.062 0.004 1.35 0.264 styles (Table 2). Personal growth 0.054 0.003 1.037 0.309

4-3 investigating predictability of self-controlling on As the results in Table 4 show self-controlling psychological welfare variable has predicting potential for two elements of self- To calculate predictability of self-controlling on acceptance (r=0.252, r2=0.064, F=23.74, P=0.0001) and psychological welfare and its elements, linear regression dominance of environment (r=0.200, r2=0.040, F=14.94, method was used with technique of enter of all variables P=0.0001). Next investigations were done with these simultaneously. Then tables of regression score of self- conditions. Tables 4,5 show results investigation of ability controlling scale on total score obtained from and direction of this scale for 6 aspects of psychological psychological welfare scale and a table including its all welfare scale. elements were investigated. Results of calculating regression for self-controlling predictability about Table 5. Self-controlling regressions about psychological psychological welfare represent presence of significance welfare elements Predicting statistical relation (r=0.158, r2= 0.025, F=8.94, P=0.003). B β T P variable:self-controlling Therefore, investigation of predicting potential and Self- - - 0.000 direction of self-controlling about psychological welfare acceptance 0.11 0.25 4.87 1 was considered in next step. Table 3 shows results of the 8 2 investigation. Positive 0.06 1.16 relationship 0.26 0.246 2 1 Table 3. Results of calculating regression predictability of self- with others Autonomy - - controlling about psychological welfare 1.51 psychologica 0.03 0.08 0.131 Predicting variable P T β B 3_2015_draft 4 Self-controlling 0.003 2.99 -0.158 -0.164 l welfare 3 1 aspects Dominance - on 0.08 3.80 0.000 Through investigating results represented in 0.20 environmen 9 7 1 iss 0 Tables 3,4 and according to β value obtained in t psychological welfare variable, high and reverse Purposeful 0.06 0.06 1.16 0.264 predicting potential of self-controlling scale was life 2 2 1 considered (β=- 0.158, t=2.99, P=0.003). Consequently, Personal 0.02 0.05 1.01 0.309 research supposition is supported and statistical growth 7 4 8 supposition is rejected. So, according to findings we can say that in the research, the higher is person’s self- According to obtained data that has been controlling, the lower success can be predicted for person brought in Tables 4,5, self-controlling variable has high in providing conditions that lead to psychological welfare. and reverse predicting ability in two elements of Or in other words, self-controlling acts as an inhibiting psychological welfare i.e. self-acceptance (β=- 0.181, factor in learning necessary abilities for psychological t=4.87, P=0.0001) and dominance on environment (β=- welfare. 8_special0.200, t=3.807, P=0.0001). Therefore, research supposition is supported in these elements and is rejected 4-3-1 investigating predictability of self-controlling in other elements. In other words, the results suggest that about elements of psychological welfare scale self-acceptance and person’s dominance on environment To determine predictability rate of self-controlling will decrease wherever person’s self-controlling is higher. about six elements of psychological welfare scale, linear It means self-controlling variable can influence as regression method was used with technique of enter of all inhibiting variable on accepting abilities and weaknesses variables simultaneously. Calculation results of the and also providing proper self-confidence in ability of regression have been brought in two Tables 4 and 5. dominance on environment.

Table 4. Primary results of measuring variance of self- 4-4 Investigating predictability of child parenting controlling variable in different aspects of psychological welfare styles about psychological welfare Psychological value Significance R R R2 To calculate predictability of self-controlling welfare aspects F level about psychological welfare and its elements, linear Self-acceptance 0.252 0.064 23.74 0.0001 regression method was used with technique of enter of all JML_VolumePositive relationship with 0.048 0.002 0.821 0.336 variables simultaneously. Then tables of regression score others of self- controlling scale on total score obtained from Autonomy 0.081 0.007 2.291 0.131 psychological welfare scale and a table including its all Dominance on elements were investigated. Results of calculating 0.200 0.040 14.94 0.0001 environment regression for predictability of child parenting styles about

161 Journal of Medicine and Life Vol. 8, Special Issue 3, 2015

psychological welfare represent presence of significance was observed. Consequently, research supposition is statistical relation (r=0.177, r2= 0.031, F=3.85, P=0.01). supported in these two styles and statistical supposition is These results justify presence of at least a significance rejected. So, according to findings we can say that in the statistical relation between various child-parenting styles. research, desirable psychological welfare can be reached Therefore, investigation of predicting potential and by applying authoritative child parenting style and direction of child parenting styles about psychological welfare was considered in next step. Table 6 shows avoiding autocratic style. In other words, findings of this results of the investigation. research suggest that inconsiderate child parenting style has no influence on people's psychological welfare. So, Table 6. Calculation results of predictability regression of child zero supposition is supported for this style. parenting about psychological welfare Predicting variable B β T P 4-4-1 Investigating predictability of child parenting Inconsiderate style -0.011 -0.004 0.068 0.946 Autocratic style -0.428 -0.113 2.12 0.035 styles about elements of psychological welfare scale Authoritative style 0.434 0.130 2.437 0.014 To determine predictability rate of three child- parenting styles about 6 elements of psychological Through investigating results represented in welfare scale, linear multivariable regression method was Table 6 and according to obtained β value, high used with technique of enter of all variables predicting potential in two different directions in two simultaneously. Calculation results of these regressions autocratic (β=- 0.113, t=2.12, P=0.035)and authoritative have been brought in two Tables 7 and 8. (with direct prediction β=0.434, t=2.437, P=0.014) styles

Table 7. Preliminary results of variance for child parenting variable in different aspects of psychological3_2015_draft welfare Psychological welfare aspects R R2 F value Significance level Self-acceptance 0.264 0.070 8.89 0.0001 Positive relationship with others 0.160 0.025 3.104 0.027 Autonomy 0.185 0.034 iss 4.197 0.0001 Dominance on environment 0.319 0.102 13.427 0.0001 Purposeful life 0.062 0.004 1.35 0.264 Personal growth 0.139 0.019 2.353 0.070

According to results brought in Table 7 it can be least one of the styles has high ability for prediction in seen that child parenting styles do not have enough other aspects of psychological welfare. Accordingly, next variance for proper comparison of groups only in two investigations were carried out. Table 8 shows elements of purposeful life (r=0.022, r2=0.004, F=1.35, investigation results of ability and direction of this scale for P=0.264) and personal growth (r=0.139, r2=0.019, 6 aspects of psychological welfare scale. F=2.353, P=0.07). In this condition, it is expected that at 8_special Table 8. Calculation results of predictability regression for child parenting about psychological welfare psychological welfare aspects Predicting variable P T β B Inconsiderate style 0.962 0.047 0.002 0.003 Self-acceptance Autocratic style 0.000 4.542 -0.239 -0.393 Authoritative style 0.056 1.920 0.099 0.145 Inconsiderate style 0.050 -1.967 -0.106 -0.144 Positive relationship with others Autocratic style 0.041 -2.049 -0.110 -0.190

Authoritative style 0.053 -1.944 -0.102 -0.157 Inconsiderate style 0.004 -2.874 -0.154 -0.186

Autocratic style 0.164 -1.394 -0.075 -0.114 autonomy Authoritative style 0.119 1.563 0.082 0.111 Inconsiderate style 0.000 5.794 0.300 0.356 Dominance on environment Autocratic style 0.000 3.802 0.196 0.296

Authoritative style 0.208 1.260 0.064 0.085 Inconsiderate style 0.850 0.189 0.010 0.012

Autocratic style 0.025 2.253 0.121 0.185 JML_VolumePurposeful life Authoritative style 0.131 1.513 0.080 0.108 Inconsiderate style 0.488 -0.694 -0.037 -0.053

Autocratic style 0.028 -2.199 -0.118 -0.211 Personal growth Authoritative style 0.090 1.701 0.090 0.142

162 Journal of Medicine and Life Vol. 8, Special Issue 3, 2015, pp.156-168

With a glance at Table 8 it can be found that Table 10. Predictable variance amount as step wise by under autocratic style has meaningful and reverse relation in studied variables in predicting psychological welfare Predicting variable F Significance most of psychological welfare aspects (self-acceptance R R2 β=- 0.393, t=4.542, P=0.0001; positive relations with of variance value level others β=- 0.144, t= 2.049, P=0.041; personal growth β=- Authoritative style 0.143 0.021 7.109 0.008 Self-controlling and 0.188 0.035 6.168 0.002 0.028, t=2.199, P=0.028) but this relation is positive and authoritative style meaningful in aspect of dominance on environment Self-controlling and (β=0.296, t=3.802, P=0.0001). In other words, further authoritative and 0.225 0.051 5.987 0.001 applying of autocratic style leads to fall of self-acceptance autocratic styles level, having positive relations with others, personal growth and morale increase of dominance on Based on results represented in Table 10, environment. Inconsiderate child parenting style has variable of authoritative style has alone predicting ability second highest predicting ability following autocratic style. 0.143 of variance of psychological welfare variable. By This style has reverse relation with two aspects of positive adding two other variables i.e. self-controlling and relations with others (β=0.144, t=1.976, P=0.05) and self- autocratic style, this figure increases to 0.188 and 0.225. autonomy (β= 0.186, t= 2.874, P=0.00) and direct relation Accordingly, regression coefficients of these variables with dominance on environment (β=0. 356, t=5.794, were calculated in stepwise way. Table 11 shows these P=0.0001). This result suggests that inconsiderate child results. parenting style reduces expecting positive relations with others and ability of self-autonomy and increases Table 11. Different models of regression with stepwise increase tendency for dominance on environment. On the other of variables for calculating predictability of variables having hand, psychological aspect of relation with others is the ability to predict psychological welfare only aspect that has shown reverse and meaningful Stage Variables 3_2015_draft P T β B One predicting ability in every 3 child parenting styles. Authoritative variabl 0.008 2.666 0.143 0.505 style e 4-5 Comparison of predictability for child parenting Authoritative Two iss 0.008 2.684 0.143 0.506 styles and self-controlling about psychological style variabl welfare Self- es 0.024 2.267 -0.121 -0.140 To compare predictability of child parenting controlling styles and self-controlling about psychological welfare, Authoritative 0.010 2.599 0.138 0.487 linear multivariable regression was used with technique of style Three Self- stepwise enter. In the following, first investigation of score 0.019 2.365 -0.126 -0.145 correlation tables for child parenting and self-controlling variabl controlling es Autocratic scales about total score obtained from psychological 0.02 2.337 -0.124 -0.427 welfare scale and then regression tables were performed. style Table 9 includes information about correlation investigation of child parenting styles and self- controlling With reference to results obtained from Table about psychological welfare. 8_special11, it is understood that highest rate of predicting potential belongs directly to authoritative style of child parenting Table 9. Correlation coefficients of self-controlling and child and following that is reversely in self-controlling and parenting styles variables about psychological welfare autocratic style. Predicting variable Number R Sig Self-controlling 341 -0.12 0.013 Inconsiderate style 341 0.015 0.390 Discussion Autocratic style 341 -0.126 0.010 Before starting discussion about findings and Authoritative style 341 0.143 0.004 results, it is worth mentioning that demographic information of testees was offered based on gender,

education grade, field of study, education stand of parents As findings obtained from Table 9 show, primary and economic status of the family and testees were results of investigating correlation of self-controlling and matched based on this information. However, 56.5% and child parenting styles with psychological welfare suggest 43.5% of participants were among girls and boys meaningful correlation of three variables of self- respectively. Most of studied sample students (48.6%) controlling, autocratic, and authoritative styles with JML_Volume have educated in second grade in high school. Also most psychological welfare. The variable “inconsiderate style” of them have studied in experimental field. About was excluded from calculation process because of its education stand of parents, most of fathers (50.3%) had lower correlation rate with psychological welfare. diploma and most of mothers (47.6%) were with Therefore, next steps of regression were performed education stand of under diploma. In addition, most of based on three other variables. Journal of Medicine and Life Vol. 8, Special Issue 3, 2015

studied sample (67.4%) reported their economic status in predictability of self-controlling about psychological medium level. Average score of students’ self-controlling welfare scale, research findings show self-controlling was reported 97.52% and this figure suggests desirable variable has high and reverse predicting potential in two status of self-controlling in the sample of present elements of psychological welfare scale i.e. self- research. Highest score in elements of psychological acceptance and dominance on environment. In other welfare scale was dedicated to self-acceptance with elements, self-controlling did not show significant 47.10%, which shows the students have more desirable statistical predicting potential. In other words, the results status in self-acceptance. Also, autocratic child parenting of the study indicate self-acceptance and dominance on style has received highest average (29.32%) among environment rates reduce wherever person’s self- elements of child parenting styles. This finding implies controlling is higher. This means that self-controlling can that autocratic child parenting style has been used more be influencing as an inhibitive variant in accepting abilities than other styles by parents of the students. and weaknesses and also providing proper self- The findings represent correlation between confidence in ability for dominance on environment. In studied variables has different levels and directions in this explaining these findings it can be said that self- research such that highest rate of positive correlation for controlling is an unique personality feature that is different total score of psychological welfare scale can be in various people i.e. individuals who have high self- observed with personal growth element and its lowest rate controlling show different reactions according to their level is with positive relations with others. Generally, element of of self-controlling and behave differently or people with positive relations with others has lowest correlation with high self-controlling prefer compatibility and accordance other elements and scales of this work. Among elements with their environment rather than dominance on of psychological welfare scale and child parenting styles, environment and self-acceptance and this area requires highest positive correlation was observed between necessity of doing accurate and extensive studies by element of dominance on environment and inconsiderate specialists. Also Mayer3_2015_draft and Salovey introduce self- child parenting style and highest negative correlation controlling under title of correct application of excitements belonged to element of self-acceptance and autocratic and believe power of adjusting feelings cause increase of child parenting style. Also, two elements of self- personal capacityiss to mitigate himself, understanding acceptance and dominance on environment have highest popular anxieties, depressions or impatience [36]. People negative correlation coefficient with self-controlling scale. with weak self-controlling encounter permanently with Among various styles of child parenting, only two styles of hopelessness, depression and uninteresting to action and autocratic and inconsiderate child parenting have use weaker psychological skills. While people with strong negative correlation coefficient with each other. No skill in this area can pass misfortunes more quickly and meaningful relation of correlation has been shown have desirable elements of psychological welfare [44] and between authoritative style and two other styles. As this finding is not in agreement with findings of present findings about first question of the research i.e. “how study. As findings about second question of the research much is predicting ability of students’ psychological i.e. “how much is students’ predicting ability of welfare based on self-controlling?” show results of psychological welfare based on child parenting styles” calculating predicting regression of self-controlling about show results of calculating predicting regression of child psychological welfare, suggest presence8_special of meaningful parenting styles about psychological welfare represent statistical relation. According to findings and β value existence of significant statistical relation. These results obtained in psychological welfare variable, it can be suggest existence of at least one significant statistical concluded that self-controlling has high and reverse relation between various styles of child parenting. predicting potential about psychological welfare. These According to research findings and obtained β value, high results are along with findings of other studies predicting potential about psychological welfare in two [8,13,30,50,56]. Findings of these researches significantly directions in two autocratic and authoritative styles can be suggest self-controlling has high predicting potential about understood. Based on this finding of the research it can variants like social compatibility, responsibility, solving be seen that utilizing authoritative child parenting style conflict, psychic health, and psychological welfare. and avoiding autocratic style can lead to desirable However, in most of studied, direction of predicting psychological welfare. On the other hand, findings of this potential of self-controlling about these variables were work suggest that inconsiderate child parenting style has positive while in present study, self-controlling has no effect of individuals’ psychological welfare. These reverse predicting ability about psychological welfare. results agree with findings of other studies Therefore, based on findings it can be said that in the [22,27,34,35,39,40,55]. Findings of these studies JML_Volumework, the higher person’s self-controlling, the lower significantly justify that there is meaningful relation success is expected for person in creating conditions that between type of child parenting style and psychic health lead to psychological welfare. In other words, self- and psychological welfare. controlling acts as an inhibitive factor in learning By reviewing previous studies, it seems that necessary abilities for psychological welfare. For adolescents and youth are self-confident, calm, and

164 Journal of Medicine and Life Vol. 8, Special Issue 3, 2015

hopeful in families with authoritative style and their authoritative style has maximum ability of direct prediction personal identity is not injured. Also this method about psychological welfare. While autocratic style has accompanies with further attachment to parents especially meaningful and reverse relation with psychological during childhood and further satisfaction of life and welfare. Also, autocratic and inconsiderate child parenting provides ground for further feeling of being worthwhile methods have respectively maximum meaningful and and self-confidence in adolescent and as a result more reverse ability for prediction about 6 elements of desirable psychic health status. On the other hand, psychological welfare. autocratic treatment with children can provide ground for As findings about third question of the research happening of mental disorders and derangement as well i.e. “how is comparison of students’ predicting ability of as undesirable emotional effects and low self-confidence. psychological welfare based on self-controlling and child In this regard, some experts believe authoritative child parenting styles” show authoritative child parenting parenting style relates to individuality and independency method has highest ability of direct prediction about feeling of the child in the family unlike autocratic style psychological welfare and is followed by self-controlling which is so important in promoting psychic health and and autocratic style with reverse but not direct prediction. psychological welfare. While autocratic child parenting In explaining these findings, it can be noted that in style injures individuality and independency of children in authoritative child parenting method, parents have high the family with cruel, limiting and extreme controlling level of control and responding and their children are treatments [7]. For predictability of child parenting styles social and effectively competent and have less behavioral about 6 elements of psychological welfare, research problems [12] and high psychological welfare but in findings show autocratic child parenting style has autocratic style, parents apply high level of control and meaningful and reverse relation with most aspects of low level of responding. They expect their children obey psychological welfare like self-acceptance, positive them and often punish their children for preventing from relations with others and personal growth but in aspect of disobedience. In inconsiderate3_2015_draft style, parents are so dominance on environment, this relation is meaningful responsive unlike strict parents, permit much autonomy and positive. In other words, further applying of autocratic for children, and do not oblige them to have immature style leads to reduction level of self-acceptance, positive behavior [46].iss Influence of autocratic child parenting on relations with others and personal growth and morale early identity and of inconsiderate styles on identity increase of dominance on environment. Also these disorder has been supported in several researches [24]. findings represent inconsiderate child parenting style has Agreement is on existence of relation between child second rank for maximum potential of predicting following parenting style and different consequences including autocratic style. This style has reverse relation with two psychic pathology, behavioral problems and educational aspects of positive relations with others and autonomy achievement [37,55]. Thompson et al. reminded and direct relation with dominance on environment. It is autocratic child parenting approaches as a danger for concluded that inconsiderate child parenting style reduces behavioral problems [52] and Turner et al. characterized persons' expectation for positive relations with others and in a research with aim of determining relation of ability of autonomy and increases person’s tendency to authoritative child parenting style with educational dominate on environment. In other words, psychological achievement, self-efficacy and progress motivation on aspect of relations with others is the only8_special aspect about university students that authoritative child parenting has which each 3 child parenting styles have shown also positive effect on students’ educational achievement meaningful and reverse predicting potential. Results of and inner motivation and education self-efficacy [53]. present research are in agreement with results of Generally, results of these studies show psychological previous researches [7,27,55,40] and show child welfare and psychic health have direct meaningful parenting methods have meaningful influence on psychic correlation with authoritative child parenting method and health and psychological welfare. In other words, reverse and meaningful correlation with autocratic child autocratic child parenting style has worst influence on parenting method. Also, findings of present research status of psychological welfare comparing to other styles. show self-controlling has maximum meaningful and It can be mentioned that the more autocratic style is used, reverse ability to predict about psychological welfare after the more providing conditions and factors are inhibited authoritative child parenting method. Or in other words, which lead to psychological welfare. Also, inconsiderate self-controlling in this research acts as an inhibitive factor method results in undesirable status in psychic health and in providing psychological welfare. psychological welfare for children because of rise of autonomy chance for children and ignorance of parents JML_Volumeabout them instead of disciplinary behavior following Conclusion autocratic style. Generally, findings of this research One of evaluation axes for health of different characterize child parenting methods influence status of societies is their psychological welfare. Undoubtedly, psychological welfare. Such that ability of predicting for psychological welfare plays important role in securing each method about psychological welfare is different and dynamism and efficiency for each society and meanwhile

165 Journal of Medicine and Life Vol. 8, Special Issue 3, 2015

self-controlling and methods of child parenting are of their child parenting methods on their children’s important as two factors influencing on adolescents’ psychological welfare. psychological welfare. According to results obtained from 2- Holding courses for self-controlling skills and rate and this research, psychological welfare has direct correlation situation of using these skills related to students’ with authoritative child parenting style and high abilities. meaningful reverse correlation with autocratic style. In 3- Attention to understanding parents’ child parenting other words, it can be said that in this research, desirable methods and self-controlling skills to promote psychological welfare will obtain by utilizing authoritative students’ psychological welfare. child parenting style and avoiding autocratic style. Also, 4- Determining influencing variables on students’ autocratic child parenting style has reverse and psychological welfare and trying to promote these meaningful relation with most aspects of psychological variables such that they lead to increase their psychic welfare as self-acceptance, positive relations with others welfare and promotion of life quality. and personal growth but this relation is positive and 5- Based on high and reverse predicting potential of meaningful in dominance on environment aspect. In other self-controlling variable about psychological welfare, words, further application of autocratic style leads to it is necessary to do comprehensive and exact reduction level of self-acceptance, positive relations with studies about influencing mechanism of this variable others and personal growth and morale increase of on psychological welfare by specialists and dominance on environment. In addition, findings of this psychologists as much as possible. research show self-controlling have high and reverse potential to predict psychological welfare. Or in another Research limitations direction, self-controlling acts as an inhibitive factor in This research has been performed on high learning necessary abilities for psychological welfare. school students of Abadeh City and generalization of its Therefore, it is recommended that methods of child results to other communities3_2015_draft must be done accurately. parenting are considered as a preventive and promoting Also, results of this research cannot be generalized to strategy for psychological welfare in health programs for student societies of other cities and provinces especially all adolescents especially students so that parents can those with soiss different cultural, ethnic and training from promote their children’s psychological welfare and be Abadeh City features due to limitation of above successful in preventing from children’s psychic disorders community and it is necessary to be careful in with knowledge and using proper method of child generalizing results of the research. parenting (as authoritative style) and avoiding inefficient method of child parenting (as autocratic style) and Acknowledgement nurturing their children’s self-controlling skills. Authors of the paper thank education authorities of Abadeh City, counseling unit, personnel and students Research suggestions of studied schools. Also they appreciate other people who 1- Holding training and justifying programs for families assisted them in doing this study. and providing knowledge for parents about influence 8_special

References

1. Allahverdipour H, Shafii F, Azad Fallah University, 2nd Universal Seminar of and performance. Personality Psychology. P, Emami A. The statues of self-control Students Psychic Health. 2004. 2005; 58,745-765. and its relation to drug abuse-related 5. Bahrami Khundabi F, Sharifi Daramadi 9. Baumrind D. Peering competent children. behaviors among Iranian male high P. Emotional Intelligence, its Application in In: Damon (editor) child development School students. Social Behavior and Work Environment, Learning, today and tomorrow. 1989, San Personality. 2006; 34(4),413-424. Communications, Motivation, Leadership, Francisco: Jossey Bass, 349-378. 2. Alizadeh H, Yari M. The study of Organizations and Psychic Diseases of 10. Baumrind D. Current patterns of parental parenting styles in families of youths with Isfahan: Sepahan. 2006. authority. Develop Psychol. 1971; 4(1, pt behavior disorder and families without 6. Barber B. Adolescent socialization in 2):1-103. behavior disorder. Research on context: the role of connection regulation 11. Bayani AA, Koochaki AM, Bayani A. Exceptional Children. 2006; 20(2):697- and autonomy in the family. J Adol Res. Validity and reliability of Reef’s 704. 1997; 12(1):5-11. psychological welfare scale. Psychiatry 3. Antonelli E, Cucconi L. Effects of 7. Barber BK, Stolz HE, Olsen JA. and Clinical Psychological Journal of Iran, JML_Volumeretirement on psychological well-being, Trajectories of physical aggression from 2001. 2002; 14. the self-concept, and self-esteem. toddlerhood to middle childhood. 12. Bigham H. The relationship between Ricerche Di Psicologia. 1998; 22(3),27- Monogram Soc Res Child Dev. 2005; obsessive-compulsive disorder and 55. 70(4):1-137. parenting styles of authority rational 4. Aqhayar S. Studying Relation between 8. Barrick MR, Parks L, Mount MK. Self- democratic and despotic. (Thesis). Tehran Self-controlling and Life Quality among Monitoring as a moderator of the Psychiatry Institute. 2000. Girl and Boy Students of Isfahan relationships between personality traits

166 Journal of Medicine and Life Vol. 8, Special Issue 3, 2015

13. Blakely GL, Andrews MC, Fuller J. Are 26. Harris, Curtin. Parental Perception, Early 42. Ryff CD, Singer B. Human health: New chameleons good citizens? A Logitudinal Maladaptive Schemas and Depressive directions for the next millennium. Study of the relationship Between Self- Symptoms in Young Adult. Cognitive Psychological Inquiry. 1998; 9,69- 85. monitoring and Organizational Therapy and Research. 2002; 26,3,405- 43. Ryff CD. Happiness is everything or is it? Citizenship. Journal of Business and 416. Exploration on the meaning of Psychology. 2003; 18,2. 27. Heidgerken AD. Direct and Indirect psychological well-being. Journal of 14. Bronte-Tinkew J, Moore KA, Carrano J. Effects of Parenting and Children’s Goals personality and Social Psychology. 1989; The father-child relationship parenting on Child Aggression. Journal of Clinical 6,1069-1081. styles and adolescent risk behaviors in Child and Adolescent Psychology. 2004; 44. Safari Dehkharghani N. Comparison of intact families. J Famil Issues. 2006; 33,4,684-693. Effectiveness of Parkinson’s impulse 27(6):850-881. 28. Jahoda M. Current Concepts of Positive controlling method and training self- 15. Burns RA, Machin AM. Investigating the Mental Health. 1985, New York: Basic controlling for reducing girl adolescents’ Structural Validity of Ryff’s Psychological Books. impulsiveness in Tehran City. MA Thesis Well-Being Scales across Two Samples. 29. Karademas E. Positive and negative of General Psychology, Educative Social Indicators Research. 2009; aspects of well-being: Common Sciences and Psychology Faculty in 93(2),359-375. andspecific predictors. Personality and Allameh Tabatabayee University. 2008. 16. Buri JR. Parental authority questionare. Individual Differences. 2007; 43,277-287. 45. Sarukhani B. An Introduction to Family Journal of Personality Assessment. 1997; 30. Kaushal R, Kwantes TC. The role of Sociology. 1991, Tehran: Sorush 57,110-119. culture and personality in choice of Publication. 17. Compton WC. Toward a tripartite factor conflict management strategy. Internatinal 46. Sayad Shirazi M. The relationship structure of mental health: Subjective Journal Relations. 2006; 30,579-603. between parents’ educational styles and well-being, personal growth, and 31. Krintner R, Kinicki A. Organizational youths’ formation of religious identity type. religiosity. Journal of Psychology. 2001; Behavior. Translator: Farhangi AA, Unpublished master’s Thesis in 135,486-500. Safarzadeh H. 2005, Tehran: Payam counseling. 2004. Allameh University. 18. Cusullo MM, Castro-Solano A. Pooya Publication. 47. Schmutte PS, Ryff CD. The structure of Adolescent students’ perception of 32. Lareson JS. The measurement of health: personality and well-being: Reexamining psychological well-being meaning. Concepts and indicators. 1991, New York: methods and meaning. Journal of Revista Ibe roamericana Diagnostico Y Green Wood Press. Personality3_2015_draft and Social Psychology. 1997; Evaluasion. 2001; 12(2):57-70. 33. Logue AM. Research on self-control: an 73,549- 559. 19. Day DV, Kilduff. Self-monitoring integration framework. Behavioral and 48. Seligman MP. Positive Psychology: personality and work relationships: Brain Science. 1988; 11,666-709. Fundamental assumption. The individual difference in social network. In 34. Loper A. The relationship of Maladaptiveiss Psychologist. 2003; 16,126-127. Barrick MR, Ryan AM. Personality and Beliefs to Personality and Behavioral 49. Shieck N. Parenting style and is work: reconsidering the role of personality Adjustment among Incarcerated Women. correlates. Genetic social, general in organizations. 2003, San Francisco: Journal of Cognitive Psychotherapy. psychology monographs. 2006; Jossey-Bass, 205-228. 2003; 17,3,253-266. 125(3):269-297. 20. Dierendonck D. The construct validity of 35. Marmon T. Images of mother, self and 50. Spencer DL. Race, self-control, and drug Ryff Scales of Psychological well-being God as predictors of dysphoria in non- problems among jail inmates. Journal of and its extension with spiritual well-being. clinical samples. Personality and Drug Issues. 2005; 22(4,5),645-664. Personality and Individual Differences. Differences. 2004; 36,1669-1680. 51. Tangney JP, Baumeister RF. High Self- 2005; 36,629-643. 36. Mayer JD, Salovey P. Measuring Control Predicts Good Adjustment, Less 21. Esfandiari GH. The study and emotional with the MSCEIT V.2.0. Pathology, Better Grades, and comparison of parenting styles of affected Emotion. 2003; 3,97-105. Interpersonal Success. 2004, children’s mothers to conduct disorder 37. Oyserman D, Bybee D, Mowbray C. Unpublished manuscript, Department of and normal children’s mothers and the Influences of maternal mental illness on Psychology, George Mason University, effect of mothers’ training on conduct 8_specialpsychological outcomes for adolescent Journal of Personality. disorders of children. 1992, Tehran: children. J Adolescence. 2002; 25(6):587- 52. Thompson A, Hollis C, Richards D. Tehran Psychiatry Institute. 602. Authoritarian parenting attitudes as a risk 22. Farzadfard H. The Role of Child Rearing 38. Piquero AR, Gibson CL, Tibbetts SG. for conduct problems: results from a Parenting Skills in Reducing Mothers’ Does self control account for the British national cohort study. Eur Child Stress and Children’s Behavioral relationship between binge drinking and Adol Psychiatry. 2003; 12:84-91. Problems. Journal of iranian psychologists alcohol related behaviors?. Criminal 53. Turner A, Chandler M, Heffer W. The sprin. 2008; 4,15,277-292. Behavior and Mental Health. 2002; influence of parenting styles achievement 23. Florsheim P. Chinese adolescent 12,135-154. motivation and self-efficacy on academic immigrants: factors related to 39. Prevatt F. The contribution of parenting performance in college students. J psychosocial adjustment. Journal of Youth practices in a risk and resiliency model of College Student Development. 2009; and Adolescence. 1997; 26(2):143-163. children’s adjustment. British Journal of 50(3):337-346. 24. Ghasemi M, Arefi M, Sheikholeslami R. Developmental Psychology. 2003; 54. Van Dierendonck D, Diaz D, Rodriguez- The study of relationship between identity 21,469–480. Carvajal R, Blanco A, Moreno-Jimenez and values in youngsters. Special editorial 40. Raisi A. The study of relationship B. Ryff’s Six-factor Model of Psychological of educational sciences and psychology between parents’ parenting styles with Well-Being, A Spanish explanation. Soc faculty of Ferdowsi University. 2004; mental health of girl students in grade 1 at Indic Research. 2008; 87:473-479. 7(1):245-263. high school in Isfahan. (Unpublished 55. Vostanis P, Graves A, Meltzer H, JML_Volume25. Gunty, Buri. Parental Practices and the Master’s Thesis). 2005, Isfahan: Isfahan Goodman R, Jenkins R, Brugha T. Development of Maladaptive Schemas University. Relationship between parental Online Submission, Paper presented at 41. Ryan RM, Deci EL. On Happiness and psychopathology parenting strategies and the Annual Meeting of the Midwestern. Human Potentials: a Review of Research child mental health. Soc Psychiatry Psychological Association. May 2008, on Hedonic and Eudaimonic Well-being. Psychiatr Epidemiol. 2006; 41:509-514. Chicago, IL, 33. Annual Review of Psychology. 2001; 56. Winstok Z. From Self-control capabilities 52:141–166. and the need to control others to proactive

167 Journal of Medicine and Life Vol. 8, Special Issue 3, 2015

and reactive aggression among 58. World Health Organization. Mental health: Azad University of Torbat-e-jam Branch. adolescents. Journal of Adolescence. new understanding, new hope. The world 2006. 2009; 32,455-466. health report Geneva. World Health 60. Zimmerman BJ, Bandura A, Martinez 57. World Health Organization. Promoting Organization. 2001. PM. Self-motivation for academic mental health: Concepts, emerging 59. Moghaddam Z, Akbar A. Studying attainment. The role of self-efficacy beliefs evidence. Summary report a report of the Effectiveness of Cognitive-Behavioral and personal goal setting. American world health organization. Department of Training for Self-confidence on Social Educational Research Journal. 2003; Mental Health and Substance. 2004. Compatibility of High School Girl Students 26(3):663-676. of Neyshaboor. MA Thesis in Islamic

3_2015_draft

iss

8_special

JML_Volume

168 Journal of Medicine and Life Vol. 8, Special Issue 3, 2015, pp.169-172

Priorities of continuing education for general practitioners in Kashan University of Medical Sciences 2013

Aghajani M*, Jahangir F**, Saiedi Majd M**, Jahangir N** *Department of Psychiatric Nursing, Trauma Nursing Research Center, Kashan University of Medical Sciences, Kashan, IR Iran, **Kashan University of Medical Sciences, Kashan, IR Iran

Correspondence to: Farahnaz Jahangir, MSN, Kashan University of Medical Sciences, Ghotb Ravandi Highway, IRAN/ Kashan, Phone: +983615550021, Fax: +983615556633, E-mail: [email protected]\

Received: March 14th, 2015 – Accepted: June 18th, 2015

Abstract Introduction: Continuing the medical education has already been a concern, as a universal principle and necessity in the world, so that the World Health Organization has also recognized it as an urgent necessity. The aim of the study was the assay of priorities of continuing education for general practitioners at Kashan University of Medical Sciences. Materials and Methods: In this cross-sectional study, 212 out of 600 general practitioners participating in the continuing the medical education programmes held by KUMS were covered. After being interviewed about their needs and interest in the programmers, a questionnaire containing demographic data such as the education needed, way of teaching, etc.,3_2015_draft was given to them. The data were then analyzed by SPSS v 11.5. Results: 137 (64.6%) cases were males and 75 (48.3%) were females. Also, 38 (17.9%) individuals were working in emergency wards. Findings indicated that the first priority of the programs was the internal diseases emergency, and then the pediatric common diseases. The third priority was the infectious common diseases. iss Conclusions: The needs of the CME and the use of the appropriate methods to match the content of the training needed the assessment of the GP training program design painting by the learners, thus improving quality and increasing the productivity of CME applications.

Keywords: continuing education, medical sciences, general practitioners

Introduction addressed by the CME were all satisfactory and designed based on their needs, beliefs, and opinions. He hoped the Continuing medical education has already been programmes were more attractive and could promote a concern, as a universal principle and8_special necessity in the professional capacities of the participants [3]. Also in Iran, world, so that the World Health Organization has also continuing the medical education was given much recognized it as an urgent necessity. At the world attention. It is growing both from the quantitative and from conference of medical education in Edinburgh 1993, CME the qualitative point of view. Nevertheless, since various was emphasized as a necessary activity for the programmes were scheduled and performed for general maintenance of professional standards and skills. It was practitioners, it is important to what extent these declared that in order for the medical educations to be programmes were principally designed and according to more effective and relevant, the educations should be the needs of learners or how they contributed to the given based on the needs of the graduates [1,2]. Since promotion of providing health and therapeutic services. continuing medical education is to enhance the Few studies in Iran revealed that a part of CME physicians’ knowledge and functionality, gain programmes could not meet the real needs and concerns advantageous standards for the medical services of the society due to an incorrect recognition and matched with the needs of society, and promote the prioritization of educational needs. Therefore, the health level, the assessment and consideration of the education given had a trivial value. For instance, based needs of this group is of value. Various studies have been on a study conducted in the Medical University of JML_Volumeconducted on CME in different countries in which different Zahedan on the attitudes of general practitioners on the methods for the assessment and design of the CME contents of CME programmes, 87.8% of the participants programmes have been evaluated. Davis investigated asked for more applied programmes, 78.2% were about 1% of the studies done in this regard. He declared interested in previous discussions, information, and that programmes provided for physicians or those sources; 76.3% requested seasonal and domestic Journal of Medicine and Life Vol. 8, Special Issue 3, 2015

discussions selected according to surveys. Regarding the of the programmes. Thus, this study’s aim was to proportion of time to the contents of internal and surgical determine the attitudes of general physicians towards programmes, 85.3% and 83.9% of the physicians found it their educational priorities and programmes of the medical inappropriate, respectively. 50% of the participants continuing education performed in Kashan University of mentioned no positive point for the programmes. Based Medical Sciences during 2012 and 2013. on the above-mentioned findings, monitoring factors and cases such as carefully selected discussions, setting Methods times for each discussion, prioritizing domestic and seasonal diseases, using survey results for the selection 212 out of 600 general practitioners participating of discussions, and giving information to participants in the continuing medical education programmes held by about the contents and resources were recommended in Kashan University of Medical Sciences were covered in order to improve continuing medical education [4]. this cross-sectional study. After being interviewed Another study entitled “Attitudes of general practitioners regarding their needs and interest in the programmes, a towards their profession” was carried out in Kashan questionnaire containing demographic data such as University of Medical Sciences in 1380. The findings were education needed, way of teaching, etc., was given to the following: them. The data were then analyzed by SPSS. The validity Mostly, physicians had a problem with the of the study was assessed by studying at least 30 of the diagnosis and the interpretation of radiographs. They physicians by using Cronbach’s alpha coefficient. Related rarely had a problem with the examination of the patients. experts confirmed the reliability of the study based on In the case of drug prescription, drug interactions were similar studies. their main concern. General practitioners requested to perform CME courses in the field of emergency skills, nutrition, and radiography interpretation. Emergency Results 3_2015_draft skills, toxicities, and cardiac pulmonary arrest were the main problems physicians were encountered with. This study covered 212 general practitioners and Consequently, meeting the physicians’ needs, especially experts (10 cases) in Kashan of whom, 137 (64.6%) were those focused on by the physicians themselves was males and 75iss (48.3%) were females. 95 (45%) were necessary to achieve the best outcomes in order to recruited officially or by contract, 1 (5%) was working on a continue medical education. Therefore, since reviewing project, 66 (31.1%) were businessmen, and 10 (4.7%) opinions of learners is considered one of the vital ways to were faculty members (Table 1 and 2). improve the quality of continuing education, using their ideas could be effective and could guarantee the quality

Table 1. Prevalence distribution of priority for continuing medical education in the view of general practitioners Times of being selected as the first Methods of Teaching in CME n (%) priority (%) Methods of Lecturing in CME 64 (30.3) 212 (100) Methods of questioning and Answering in CME 74 (22.2) 212 (100) Methods of Group Work 8_specialin CME 35 (16.5) 121 (100) Methods of teaching Case Reports in CME 71 (33.5) 212 (100)

Table 2. Prevalence distribution of priority for continuing medical education in the view of general practitioners Times of being selected as the first priority Type of continuing the education programme n (%) (%) Continuing education programmes 76 (35.8) 212 (100) Conferences of CME 9 (4.2) 212 (100) Seminars of CME 8 (3.8) 212 (100) Workshops of CME 13 (6.1) 212 (100) Educational symposium of CME 6 (2.8) 212 (100) Congresses of CME 18 (8.5) 212 (100) Professional short-term programmes of CME 29 (13.7) 212 (100) Self-educated programmed in CME 37 (17.5) 212 (100)

JML_Volume38 (17.9%) individuals were working in respectively with a mean age of 41 years. 162 cases had emergencies, 41 (19.3%) in hospitals, 62 (29.2%) in a work experience of 11.3 years (1-41 years of work private offices, 8 (3.8%) in private clinics, 18 (8.5%) in experience) (Table 3 and 4). health and hygiene centers, and 14 (6.6%) in other centres. Among the 212 participants, 27 and 77 individuals were the youngest and oldest physicians,

170 Journal of Medicine and Life Vol. 8, Special Issue 3, 2015, pp.169-172

Table 3. Prevalence distribution of priority for time of continuing medical education in the view of general practitioners Day Times of being selected as the first priority (%) n (%) Saturday 39 (18.4) 212 (100) Sunday 13 (6.1) 212 (100) Monday 20 (9.4) 212 (100) Thursday 22 (10.4) 212 (100) Wednesday 26 (12.3) 212 (100) Tuesday 85 (40.1) 212 (100)

Table 4. Prevalence distribution of priority for continuing medical education in the view of general practitioners Times of being selected as the Type of continuing the education programme n (%) first priority (%) Internal diseases emergency 141 (66.5) 212 (100) Pediatric common diseases 100 (47.2) 212 (100) Infectious common diseases 100 (47.2) 212 (100) Cardiovascular common diseases and emergency 98 (46.2) 212 (100) Digestive common diseases 92 (43.4) 212 (100)

Discussion representation (71 cases, 33.5%), and type of programme (76 cases, 35.8%) were the main priorities. However, The main purpose for the performance of the based on a study done in Zanjan in 1389, the general continuing education programmes for the general practitioners evaluated 3_2015_draftthe efficacy of the continuing physicians or other groups addressed was to fulfill their education programmes as average or low, which was not basic needs so as to promote their professional abilities. the same as that in our study [6]. The results gained by Performing an appropriate assessment was the main way Mehdi Amirnia et al. [7]. confirmed the inefficiency of the to achieve that goal. That helped the executers design way of lecturingiss versus the active methods of teaching. more effective and useful programmes. The main According to a Canadian study, lecturing did not have any priorities in this study included 141 (66%) cases of effect on changing the clinical function or health care, internal diseases emergency, 100 (47.2%) cases of which was stated in our study as well. Programmes of the pediatric common diseases, 98 (46.2%) cases of common continuing education mostly focused on giving new and cardiovascular diseases, 98 (46.2%) cases of latest information about treating patients (92 cases, cardiovascular disease emergency, 92 (43.3%) cases of 43.4%). This was consistent with the results gained by digestive common diseases and paraclinic laboratorial Mehdi Amirnia and colleagues. Mandana Shirazi et al. [8]. results, 85 (40.1%), cases of pediatric diseases concluded that lecturing using videos (52%) and types of emergency, and 82 (38.7%) cases of 8_specialsurgical disease programmes (58.3%) were the most common ways for emergency. In their study “Continuing education needs of continuing education, which was in line with our study. general practitioners”, Abolghasem Amini et al. concluded Also, this study demonstrated that the best time to hold that their priorities were the following: injuries and events the programmes was on Thursdays (85 cases, 40.1%). emergency (61.7%), heart internal diseases (60.4%), skin The length of one-day programmes (84 cases, 39.6%) diseases (58.5%), internal common emergency (58.2%). was two hours (43 cases, 20.3%), while for the As it was shown, heart diseases along with internal programmes lasting for more than two days, the emergency had the highest rate of consistency in our participants included 48 individuals (7.30%). These study. Also, in a study conducted by Abbasalat Borji in results were the same as those given by Abolghasem Zahedan Medical University [3], internal diseases (85.9) Amini et al. [9]. in the Medical University of Tabriz, in were prioritized over others. That result was in which the best days were Thursday (61%) and Friday consistency with the one in the present study. (52%). The best time was before noon as well. According Abdollhossein Shokournia et al. believed that the main to our study, the top priorities in continuing education JML_Volumeeducational needs were related to the internal diseases programmes included internal diseases emergency, just as mentioned in our study [5]. common pediatrics diseases, infectious diseases, Moreover, that study showed that the physical common cardiovascular diseases and emergency, and educational activity in performing the continuing education common digestive diseases, respectively. programmes (52 cases, 24.5%), case report Journal of Medicine and Life Vol. 8, Special Issue 3, 2015 Results Acknowledgements The researchers would like to express their Since the educational needs of general gratitude to the personnel of KUMS/ Iran. practitioners, the application of novel methods for the evaluation of the target population, and the consistency of Financial Disclosure educational content with the general practitioners’ The authors declare that they have no competing educational needs all contribute to the promotion of interests. continuing the education programmes, they will consequently lead to a general satisfaction among the Funding/Support learners. The top priorities in this study included internal This study was funded and supported by the diseases emergency, common pediatric and infectious Deputy of Research, Kashan University of Medical diseases, common cardiovascular diseases, and common Sciences (KAUMS). digestive problems, respectively.

References

1. Jarvis P. Amozesh Bozorgsalan va 4. Bordji A, Imani M, Moradi A. The study 7. Amirnia M, Mohammadi F, Vahidi R, Amozesh Modavem. Tarjomeh Sarmad of general practitioners’ views on the Mohammadzadeh M, Gojazadeh M, Gholam Ali. Tehran: Sazmane Motalee va content of composed programs in Hejazi S et al. General Practitioners Tadvine Kotobe Olume Ensani Zahedan. Tabibe Shargh. 2004; 6(2):145- Views3_2015_draft toward Quality of Continuing Daneshgahha. 2007. 151. Medical Education Programs in Tabriz. 2. Pohlmann G. Continuing Medical 5. Shakournia A, Elhampour H, Marashi Iranian Journal of Medical Education. Education in Wisconsin: current status T, Heidari Sourshejani S. Concordance 2012; 12(4):231-239. and future directions. WMJ. 2007; of Length and Contents of Continuingiss 8. Shirazi M, Zeinalou AA, Alaeddini F. 106(1):20-26. Medical Education Programs with The View Points of General Surgeons 3. Davis D, O’Brien MA, Freemantle N, Educational Demands of Practicing GPs Attending CME Programs Regarding their Wolf FM, Mazmanian P, Taylor-Vaisey in Khuzestan Province. Iranian Journal of Educational Needs, in Tehran University A. Impact of formal continuing medical Medical Education. 2007; 7(1):85-92. of Medical Sciences. Iranian Journal of education: do conferences, workshops, 6. Koosha A, Karimizanjani N, Nourian Medical Education. 2004; 4(1):31-36. rounds, and other traditional AA, Mousavinasab N. General 9. Amini A, Kargarmaher M, Hatami continuingeducation activities change practitioners’ viewpoints about continuous Sadabadi F, Salami H. Determining CME physician behavior or health care medical education programs. Strides in needs of general physiciansin East outcomes?. JAMA. 1999; 282(9):867-870. Development of Medical Education. 2010; Azarbaijan province. Iranian Journal of 7(1):70-74. Medical Education. 2002; 2:1.

8_special

JML_Volume

172 Journal of Medicine and Life Vol. 8, Special Issue 3, 2015, pp.173-177

Prevalence of Hepatitis B infection among Qeshm Island population in 2013-2014, Iran

Kargar Kheirabad A*, Elmira Jokari E**, Sajjadi MJ**, Gouklani H*** *Department of Virology, School of Public Health, Tehran University of Medical Sciences, Tehran, Iran, **Student Research Committee, Hormozgan University of Medical Sciences, Bandar Abbas, Iran, ***Molecular Medicine Research Center, Hormozgan University of Medical Sciences, Bandar Abbas, Iran

Correspondence to: Hamed Gouklani, PhD, Molecular Medicine Research Center, Hormozgan University of Medical Sciences, Bandar Abbas, Iran Immam Hosein Boulevard, Bandar-Abbas, Iran Phone: +98 (76) 33668476, Fax: +98 (21) 89776826, E-mail: [email protected]

Received: March 14th, 2015 – Accepted: June 18th, 2015

Abstract Introduction: About 1/ 3 of the world population (2 billion) suffers from HBV infection. 15 to 40% of Hepatitis B cases develop into chronic hepatitis, cirrhosis, and hepatocellular carcinoma (HCC). Considering the dangerous complication of the disease and the fact that the prevalence is different in various areas of the country, this study was conducted with the purpose of determining the prevalence of the Hepatitis B among Qeshm Island population. Method: This cross-sectional study was conducted on 1500 subjects. The sampling method was3_2015_draft the stratify-cluster combination. After completing the checklist, including the demographic data and risk factors, blood samples were drawn. The prevalence of HBsAg was assessed by ELISA method. Finally, the statistical analyses were performed by using the Statistical Program for Social Sciences software (SPSS) system version 16.0. The data were analyzed by Chi-square and descriptive statistical tests. Result: The overall prevalence of HBsAg positivity was 1%, 0.8%, and 1.1% amongiss men and women, respectively. The mean age of participants was 30.07 years. Infection was more prevalent in married persons, students, lower than in 15-years-old educated people and persons who had a history of vaccination and transfusion. The prevalence of Hepatitis B in people who had a history of sex and substance infusion was zero. Finally, the results of the study showed that none of the investigated factors was related to the prevalence of HBsAg. Conclusion: It seems that the prevalence of HBV infection in Qeshm is slightly lower than that of the nation.

Keywords: epidemiology, Hepatitis B, Qeshm

Introduction endemic areas, the risk of infection with HBV is of more than 60% and the transfer mostly occurs prenatally from Hepatitis B virus (HBV) was discovered8_special in 1966. mother to baby. This value is between 20 to 60% in According to the World Health Organization (WHO), HBV intermediate-endemic areas like Iran and can affect all infected almost 1/ 3 of the world’s population (2 billion) [1], ages. In the low-endemic regions, the risk of infection among whom more than 350 million people worldwide are decreases to lower than 20% and limits to adults (World chronically infected with the virus [2-4] and 75% of them Health Organization). HBsAg, Hepatitis B e Ag (HBeAg) live in Asia [5]. HBV infection is one of the deadliest and antibodies against HBeAg are tested by ELISA. The diseases which leads to the death of 0.5-1.2 million presence of HBsAg in the serum for 6 months or longer is people annually. It was reported that 15-40% of HBV indicative of chronic Hepatitis B infection [10]. infected patients would develop chronic hepatitis, cirrhosis The complications of chronic Hepatitis B include and hepatocellular carcinoma (HCC), in whom the later advancement to cirrhosis and liver failure, hepatocellular plays a major pathogenic role worldwide [6] and accounts carcinoma and extra-hepatic diseases (polyarteritis for 320000 deaths each year [3,7]. Hepatitis B prevalence nodosa, glomerulonephritis and leukocytoclastic varies in different parts of the world from 1 to 20%. vasculitis) [11]. HBV is transmitted prenatally or by Overall, approximately 45% of the global population lives percutaneous and mucous membrane exposures to in areas of hyper-endemic HBV prevalence where the infectious body fluids, such as serum, semen, and saliva JML_Volumeamount of hepatitis B surface antigen (HBsAg) is reported [12]. in more than 8% in these areas. 43% of the world’s The prevalence of HBsAg in Iran was reported to people live in the intermediate-endemic regions with a be between 2.5% and 7.2% in 1979. In the 1980s, almost prevalence of 2 to 7%; and 12% live in low-endemic areas 3% of the population was affected, differing from a of lower than 2% prevalence of HBsAg [7-9]. In the hyper- prevalence rate of 1.7% in the Fars Province to 5% in Journal of Medicine and Life Vol. 8, Special Issue 3, 2015

Sistan-Balouchestan Province [13-15]. The most common Serum samples were screened for HBsAg by ELISA using routes of transmission mentioned are perinatal a third generation Kit (Biomeriex, Amsterdam). Positive transmission and intravenous drug abuse [16]. samples (according to ELISA method) were referred for There has been little work done to investigate polymerase chain reaction (PCR) to confirm the presence the prevalence of HBV in Iran until now and it seems that of HBsAg. Patients with positive HBsAg in PCR were the importance of this problem is underestimated. Given considered as being infected with Hepatitis B. Two copies that the prevalence of HBV varies in different regions and of the laboratory test results were prepared. One of these based on what was said, the study investigates the was delivered to the participants and another was prevalence of Hepatitis B among the inhabitants of the encoded and an anonymous copy was kept for the study. Qeshm island. The study was approved by the Ethical Committee of the Hormozgan University of Medical Sciences. Written informed consent was obtained from all Method of the participants and personal data were kept confidential both during and after the study. The results of During these two years (2013-2014) cross- the viral marker tests were given to each of the sectional study, the statistical population included 130000 participants (over 18 years old) or their parents (for people of Qeshm Island. The sample size was calculated participants under 18 years old). to be 1500, by using the following formula: Collected data was entered in SPSS v.16

software and analyzed by using descriptive statistics

(frequency, mean, percent, and standard deviation) and

chi-square test.

The island was divided into several regions in 3_2015_draft which participants were selected by a multistage cluster Results sampling from people who referred to health centers, hospitals, and health houses in different areas. Data were A total number of 1500 individuals were included collected by using a checklist that was designed in this study,iss 511 males, and 989 females. HBsAg according to similar studies and the experts’ opinion. After positivity of the serum samples were investigated by the selection of persons, the study’s purpose was clearly ELISA and the PCR method where 1% (11 females and 4 discussed with the participants and demographic males) with the mean age of 30.07 and standard deviation characteristics and medical histories including name, age, (SD) of 13.69 (P=0540) were HBsAg positive, and the gender, job, level of education, history of sexual contact, remaining 99% (1485 persons) with the mean age of history of vaccination, history of blood transfusion and 32.63 and standard deviation of 13.17 were HBsAg injecting drug use, were collected by using a checklist. negative (P=0.340). HBV infection was only detected in The inclusion criteria consisted of being a lower than 15-year-old educated people (P=0.390). The Qeshm inhabitant and providing a consent. Participants largest amount of HBV prevalence was detected in the with cardiovascular diseases, hypertension, rheumatoid students (1.8%; 4 persons) while the others (workers, fever, active infections, recent measles 8_specialinfection, mumps employees, and un-employees), were HBV negative (P= and IMN, history of malaria, toxoplasma, brucellosis, 0.510) (Table 1). tuberculosis, HBs-Ag+, HCV-Ab+, HIV or its probability, According to Table 2, one person had a history gastrointestinal diseases such as ulcers, blood or sexual of substance infusion and 4 persons had the sex history, diseases, pregnancy, lactation, recent accident, receiving however, they were not infected (P=1.000). HBV infection immunoglobulin during three months previous to the prevalence was reported to be 2.9% (2 persons) for those study, mental disorders, diabetes, thyroid disorders or people with transfusion history, while it was 0.9% (13 patient in-cooperation, were excluded from the study. persons) for the remaining people with no history of In this study, ten-milliliter venous blood samples transfusion (P=370). Finally, the results of this study were obtained from each individual. Serum was separated showed that none of the investigated factors was related by centrifugation, and samples were stored at -20°C. to the prevalence of HBsAg.

Table 1. Demographic characteristics of participants Variable No. HBsAg Positive P-value Sex JML_Volume Male 511 4 (0.8%) 0.540 Female 989 11 (1.1%) Education Less than 15 years 1344 15 (1.1%) 0.390 More than 15 years 156 0 (0%)

174 Journal of Medicine and Life Vol. 8, Special Issue 3, 2015

Job Household 723 8 (1.1%) Free 323 2 (0.6%) Health personnel 91 1 (1.1) 0.510 Student 217 4 (1.8%) Employee 101 0 Worker 16 0 Un-employee 29 0

Table 2. Risk factors associated with Hepatitis B surface antigens Variable No. HBsAg Positive (%) P-value History of injecting drug use Yes 1 0% 1.000 No 1499 1% History of sexual contact Yes 4 0% 1.000 No 1496 1% Hepatitis B vac. Yes 489 1% No 540 0.9% 0.570 Unknown 471 1.1% Transfusion history Yes 70 2.9% 3_2015_draft No 1430 0.9% 0.370 Unknown 17 0%

Discussion of Erden et al.iss [24], the largest amount of prevalence was observed in the ages between 21 and 40 years. Gogos et HBV infection is a health problem of global al. [33], Salehi et al. [26], and Ansari-Moghaddam et al. importance in which many people are involved worldwide [28] showed that the HBV is more prevalent in persons [17,18]. Countries in the Middle East region are different older than 65 years. regarding the prevalence of HBV. Kuwait and Bahrain can In our study, the incidence of HBV in women was be classified as low-endemic countries, whereas Egypt, more than that of the men, which is consistent with Jordan, Oman, Palestine, Yemen and Saudi Arabia are Roshandel’s work [34], but differs from other studies [23- high-endemics [19]. Iran is known as a low- to 25, 28, 29]. This difference is due to the greater number intermediate- endemicity area regarding the prevalence of of women enrolled in this research than men; and the HBV. results could change if the equality could change. The studies have demonstrated8_special that the The prevalence of HBV was only detected in prevalence of HBV is not the same in different parts of the those people with the education level of less than 15 country. In the present study, this value was estimated to years, where the amount of HBsAg was of approximately 1% which is lower than the whole national statistics 1.1%. This result agreed with the research of McQuillan et (2.14%) [20]. Also, these results showed lower values al. [22], in which the disease is more common in people than Todd et al. [21], McQuillan et al. [22], Shahin Merat with the literacy less than high-school. In Merat’s et al. et al. [23], Erden et al. [24], Abdolahi et al. [25], Salehi et [23] work, the prevalence of HBV in people with the al. [26], Moezzi et al. [27], Ansari-Moghaddam et al. [28] literacy less than 12 years was 4%, while in others it was and Fathimoghaddam et al. [29] studies. Of course, the 3%. Ghadir [32] showed that the largest amount of HBsAg prevalence value was greater than the values estimated could be found in the serum sample of illiterate people by Wasley et al. [30] and Keyvani et al. [31]. In Ghadir et (2.95%) whereas people with academic degree showed al. study [32], the prevalence of HBsAg was reported at the lowest amount of HBsAg. The reason for the lower 1.3%. These differences in prevalence could be due to prevalence in the well-educated people is their good cultural differences that lead to the vaccination of more awareness about the transmission ways of HBV and the people and the avoidance of high-risk sexual behaviors, avoidance of the high-risk sexual behaviors. JML_Volumeetc. In the present study, the largest prevalence was The mean age of patients infected with HBV was detected in the students while it was zero in the 30.07 years. HBV prevalence in persons older than 50 unemployed people. Failure to provide the entertainment years was greater than the younger’s’ in the works of possibilities and thus the tendency to the unhealthy Wasley et al. [30] and McQuillan’s et al. [22]. In the study entrainments such as addiction or risky sexual behaviors might cause the mentioned result. Gogos et al. [33] 175 Journal of Medicine and Life Vol. 8, Special Issue 3, 2015

reported the largest amount of HBV prevalence in In the present study, the rate of infection in farmers. In contrast to our work, Erden et al. [24] and people with the history of transfusion (2.9%) was more Ghadir et al. [32] have showed that the lowest rate is than that of those with no transfusion (0.9%), which related to the students. Also, Taeri et al. [35] reported that disagrees with the study of Jahani et al. [38]. In the 90% of the HBsAg positives were unemployed and researches of Salehi [26] and Fathimoghadam (3.17%) mentioned that it could be due to their tendency to high- [26,29], the HBV prevalence was more than that in our risk jobs such as selling sex and drug trafficking. result. Ghadir [32], Keyvani [31], and Moezzi [27] reported We did not see any HBV positivity in the serum the rates of 1.63%, 1.88%, and 4%, respectively. In the sample of individuals with substance infusion history. In Mirershadi’s research [39], it was shown that there was a the study of Machado et al. [36], the prevalence of 0.4% direct relation between the times of bleeding and the HBV was detected in those people and in Moezzi’s research infection in the thalassemia patients; so that the rate of [27], this rate was 6%. Another work [37] showed the HBV 8.3% was detected in those patients with more than 20 rate of 1.9% and 9.7% for those with less than 1 year and bleeding times. more than 1 year history of drug injection, respectively. These differences could be due to the different economic, social, and cultural conditions, and also supportive care Conclusion services and the used tools. The amount of HBV prevalence in Qeshm and its In this research, the HBV prevalence was zero suburbs was 1%; so it classified as a low endemicity area for those people with a sexual contact history which in Iran. In this research, the maximum rate of HBV agreed with the Keyvani’s work [31]. McQuillan’s study infection was observed in the household women with [22] showed that the greater the number of sex partners, literacy of less than 15 years and the history of the higher the prevalence of HBV there was, so that those transfusion or vaccination. Also, for the employed people, persons with more than 50 sex partners showed a rate of 3_2015_draft the highest rate of infection was estimated for the 6.5%, and in Jahani et al. study [38], this rate was 2.5%. students. Todd [21] demonstrated that the HBsAg prevalence for

homosexual men was 4% and for heterosexual persons Acknowledgementsiss with the substance infusion it was 2%. The zero-rate in This study was the result of a general physician our study could be due to the religious beliefs (in Iran or thesis. We would like to thank all professors, Qeshm other Islamic countries) which limit the great number of inhabitants, health system authorities, and Hormozgan sex partners. University of Medical Sciences who helped us during this study.

References

8_special 1. Liaw YF, Chu CM. Hepatitis B virus hepatitis B virus infection. Hepatitis B in 11. Villeneuve JP. The natural history of infection. The Lancet. 2009; the Asian-Pacific Region. 1997; 1:79-87. chronic hepatitis B virus infection. Journal of Clinical Virology. 2005; 34:S139-S42. 373(9663):582-92. 6. Hou J, Liu Z, Gu F. Epidemiology and 12. Kim W. Epidemiology of hepatitis B in the 2. Zidan A, Scheuerlein H, Schüle S, prevention of hepatitis B virus infection. United States. Hepatology. 2009; Settmacher U, Rauchfuss F. International Journal of Medical Sciences. 49(S5):S28-S34. Epidemiological pattern of hepatitis B and 2005; 2(1):50. 13. Zali MR. Epidemiology of hepatitis B in hepatitis C as etiological agents for 7. Ocama P, Opio CK, Lee WM. Hepatitis B the Islamic Republic of Iran. 1996. hepatocellular carcinoma in iran and virus infection: current status. The 14. Alavian SM. Ministry of Health in Iran Is American Journal of Medicine. 2005; worldwide. Hepatitis Monthly. 2012; 12(10 Serious about Controlling Hepatitis B. 118(12):1413. e15-e22. Hepatitis Monthly. 2007; 7(1):3-5. HCC). 8. Mast EE, Margolis HS, Fiore AE, Brink 15. Zali M, Mohammad K, Noorbala A, 3. Lavanchy D. Hepatitis B virus EW, Goldstein ST, Wang SA et al. A Noorimayer B, Shahraz S. Rate of epidemiology, disease burden, treatment, comprehensive immunization strategy to hepatitis B seropositivity following mass and current and emerging prevention and eliminate transmission of hepatitis B virus vaccination in the Islamic Republic of Iran. control measures. Journal of Viral infection in the United States. MMWR. 2005. Hepatitis. 2004; 11(2):97-107. 2005; 54(16):1-32. 16. Alavian SM, Fallahian F, Lankarani KB. 9. Kowdley KV. The cost of managing The changing epidemiology of viral 4. Lee WM. Hepatitis B virus infection. New JML_Volume chronic hepatitis B infection: a global hepatitis B in Iran. Journal of England Journal of Medicine. 1997; perspective. Journal of Clinical Gastrointestinal and Liver Diseases. 337(24):1733-45. Gastroenterology. 2004; 38(10):S132-S3. 2007; 16(4):403. 5. Lai C. Chronic hepatitis B in Hong Kong: 10. Lai CL, Ratziu V, Yuen MF, Poynard T. 17. Maynard J. Hepatitis B: global immunization strategies for the control of Viral hepatitis B. The Lancet. 2003; importance and need for control. Vaccine. 362(9401):2089-94. 1990; 8:S18-S20.

176 Journal of Medicine and Life Vol. 8, Special Issue 3, 2015

18. McMahon BJ. Natural history of chronic 26. Salehi M, Alavian S, Tabatabaei S, Izadi 33. Gogos C, Fouka K, Nikiforidis G, hepatitis B–clinical implications. The S, Moghaddam ES, Kafi-Abad SA et al. Avgeridis K, Sakellaropoulos G, Medscape Journal of Medicine. 2008; Seroepidemiology of HBV infection in Bassaris H et al. Prevalence of hepatitis 10(4):91. South-East of iran; a population based B and C virus infection in the general 19. André F. Hepatitis B epidemiology in study. Iranian Red Crescent Medical population and selected groups in South- Asia, the middle East and Africa. Vaccine. Journal. 2012; 14(5):283. Western Greece. European Journal of 2000; 18:S20-S2. 27. Moezzi M, Imani R, Khosravi N, Epidemiology. 2003; 18(6):551-7. 20. Merat S, Malekzadeh R, Rezvan H, Pourheidar B, Ganji F, Karimi A. 34. Roshandel G, Semnani S, Abdolahi N, Khatibian M. Hepatitis B in Iran. Arch Hepatitis B Seroprevalence and Risk Besharat S, Kashtkar AA, Joshaghani Iran Med. 2000; 3(4):192-201. Factors in Adult Population of HR et al. The prevalence of Co-infection 21. Todd CS, Abed AM, Strathdee SA, Chaharmahal and Bakhtiari Province in with HCV and HDV in HBV infected Scott PT, Botros BA, Safi N et al. HIV, 2013. Hepat Mon. 2014; 14(5):e17398. patients in Golestan province of Iran. hepatitis C, and hepatitis B infections and 28. Ansari-Moghaddam A, Ostovaneh MR, Journal of Gorgan University of Medical associated risk behavior in injection drug Mood BS, Sanei-Moghaddam E, Sciences. 2008; 9(4):61-5. users, Kabul, Afghanistan. Emerging Modabbernia A, Poustchi H. 35. Taeri K, Kasaeian N, Fadei N, Ataei B. infectious diseases. 2007; 13(9):1327. Seroprevalence of hepatitis B surface The prevalence of hepatitis B, hepatitis C 22. McQuillan GM, Coleman PJ, Kruszon- antigen and anti hepatitis C antibody in and associated risk factors in intravenous Moran D, Moyer LA, Lambert SB, zahedan city, iran: a population-based drug addicts with HIV in Isfahan. Journal Margolis HS. Prevalence of hepatitis B study. Hepatitis Monthly. 2012; 12(9). of Isfahan Medical School. 2008; virus infection in the United States: the 29. Fathimoghaddam F, Hedayati- 26(90):273-7. National Health and Nutrition Examination Moghaddam MR, Bidkhori HR, Ahmadi 36. de Paula Machado DFG, Martins T, Surveys, 1976 through 1994. American S, Sima HR. The prevalence of hepatitis Trevisol DJ, e Silva RAV, Narciso- Journal of Public Health. 1999; 89(1):14- B antigen-positivity in the general Schiavon JL, Trevisol FS et al. 8. population of Mashhad, Iran. Hepatitis Prevalence and factors associated with 23. Merat S, Rezvan H, Nouraie M, Jamali Monthly. 2011; 11(5):346. hepatitis B virus infection among senior A, Assari S, Abolghasemi H et al. The 30. Wasley A, Kruszon-Moran D, Kuhnert citizens in a southern brazilian city. prevalence of hepatitis B surface antigen W, Simard EP, Finelli L, McQuillan G et Hepatitis Monthly. 2013; 13(5). and anti-hepatitis B core antibody in Iran: al. The prevalence of hepatitis B virus 37. Shirin3_2015_draft T, Ahmed T, Iqbal A, Islam M, a population-based study. Arch Iran Med. infection in the United States in the era of Islam MN. Prevalence and risk factors of 2009; 12(3):225-31. vaccination. Journal of Infectious hepatitis B virus, hepatitis C virus, and 24. Erden S, Büyüköztürk S, Calangu S, Diseases. 2010; 202(2):192-201. human immunodeficiency virus infections Yilmaz G, Palanduz S, Badur S. A study 31. Keyvani H, Sohrabi M, Zamaniiss F, among drug addicts in Bangladesh. of serological markers of hepatitis B and Poustchi H, Ashrafi H, Saeedian F et al. Journal of Health, Population and C viruses in Istanbul, Turkey. Medical A Population Based Study on Hepatitis B Nutrition. 2000;145-50. principles and practice: international Virus in Northern Iran, Amol. Hepatitis 38. Jahani MR, Motevalian SA, Mahmoodi journal of the Kuwait University, Health Monthly. 2014; 14(8). M. Hepatitis B carriers in large vehicle Science Centre. 2002; 12(3):184-8. 32. Mohammad Reza G, Mojtaba B, Akram drivers of Iran. Vaccine. 2003; 25. Abdolahi N, Keshtkar A, Semnani S, H, Mahboobeh J, Iman A, Hosseinali H 21(17):1948-51. Roshandel G, Beshrat S, Joshaghani H et al. Distribution and risk factors of 39. Mirershadi F, Jafari A, Ghane M. et al. HBV Seroprevalence among hepatitis B virus infection in the general Prevalence of Hepatitis B in ß- Golestan Adults. Iranian Journal of population of Central Iran. Hepatitis thalassemic Patients in Ardabil during Epidemiology. 2006; 2(3):35-40. Monthly. 2012 2, Feb; 112-7. 1389. Govaresh. 2010;15(2):110-5.

8_special

JML_Volume

177 Journal of Medicine and Life Vol. 8, Special Issue 3, 2015, pp.178-183

Relationship between learning styles and interpersonal communication skills of nursing student in Tehran University of Medical Sciences in 2012

Azari S* **, Mokhtari S***, Mousavi H****, Mohammadi M*****, Aliyari A ******, Salimi M*******, Azari GH******** *Health Management and Economics Research Center, Iran University of Medical Sciences, Tehran, Iran, **Health Economics, School of Public Health, Tehran University of Medical Sciences, Teheran, Iran, ***The Headquarters Students of Witness and Gallantry, Tehran University of Medical Sciences, Tehran, Iran, ****Health Services Management, Ahvaz Jundishapur University of Medical Sciences, Ahvaz, Iran, *****Student Research Committee, Kermanshah University of Medical Sciences, Kermanshah, Iran, ****** Farabi Hospital, Tehran University of Medical Sciences, Tehran, Iran, *******Health Services Management Research Center, Institute for Futures Studies in Health, Kerman University of Medical Sciences, Kerman, Iran, ********Health Services Management, Department of Health Service Management, Islamic Azad University-Science and Research Branch, Tehran, Iran

Correspondence to: GH Azari, MSc student, Health Services Management, Department of Health Service Management, Islamic Azad University-Science and Research Branch, Tehran, Iran, Tehran, Hesarak, Daneshgah Blvd, Iran, Phone: +98 21 4486 5179, E-mail: [email protected] 3_2015_draft Received: March 14th, 2015 – Accepted: June 18th, 2015

Abstract Introduction: Interpersonal communication skills are required for training and representiss one of the most important factors affecting the quality of student learning. In other opinions, learning is a continuous process and students prefer a set of learning styles based on their personality and unique experiences. The aim of this study was to assess the relationship between the learning styles and interpersonal communication skills of the nursing student in Tehran University of Medical Sciences in 2012. Methods: In this analytical descriptive cross-sectional study, 361 students from the School of Nursing and Midwifery were selected through a census method. The data gathering tools were standardized, presenting a questionnaire named Interpersonal Communication Skills Standards Test and VARK Learning Styles questionnaire. Data was analyzed by SPSS software (18th edition) by using Mann-Whitney and Kruskal-Wallis test. Results: 320 questionnaires were completed. 60.6% of the participants were females. The mean score of the students’ communication skills level was 101.91  10.35. More than half of the samples (58.8%) preferred multi-modal learning styles (Bi-Tri and Quad Modals) and 41.2% of the students preferred single modal learning styles. There were no significant differences between the Interpersonal Communication Skills and the learning styles (P= 0.46). Conclusion: According to no significant relationship8_special between the communication skills of students with learning style and Demographic variables and Lack of appropriate condition of communication skills, we were able to create new units and courses related to improving the skills’ level.

Keywords: interpersonal communication skills, learning styles, nursing students, Tehran University of Medical Sciences

Introduction categorized communicative skills. In a classification of cognitive, conceptual and procedure, skills were The process of transferring the idea, message, introduced as basic and an essential part of information, and attitudes that provide the possibility of communicative skills and another classification divided turning these data into action is called communication, communicative skills in two groups of basic and advanced which is considered one of the mankind’s basic and skills, where interpersonal communicative skills were essential skills and like so many other skills, some have considered among the basic communicative skills [3]. greater talent in this area [1]. Communication in medical Achieving an acceptable and knowledgeable behavior JML_Volumescience is a planned or programmed conversation aiming and reaching a level of emotional relationship by means at presenting information to the patient, consulting, of collecting the potential and active communicative skills treatment, determining and solving problems [2]. In fact, is called interpersonal [3]. Interpersonal communication communication is the process of exchanging information, happens when people interact with each other. In every concepts, values, and beliefs between individuals. communication, at least two individuals should take part, Therefore, many categorizing procedures have listen and respond to each other by various methods and Journal of Medicine and Life Vol. 8, Special Issue 3, 2015

it results in sending and receiving a massage to Separated studies have studied the process of accomplish a specific goal [4,5]. Communication is so determining the nursing students’ learning style and the important in human life that some scholars consider it the interpersonal communicative skills level [20-24], but yet, basis of all human development, individual damages and there has not been a study to determine the relation mankind development and progresses [6]. between the learning style and the interpersonal We should not only consider scientific, academic communicative skills, and what type of learning style is and technical skills of a student but also the importance of preferred by each student and what type of connection students’ communicative skills, and such an issue is exists between the learning style and the rate of essential in regard to considering the patients’ rights and communicative skills. Therefore, the present research increasing their information [7]. Having a daily and normal was undergone while aiming to determine the relation communication does not free the expert groups from the between the learning style and interpersonal need of goal-based and skill-based education in communicative skills of the third and the fourth year advanced levels; in addition proper education is needed nursing students of Tehran Medical University during the to achieve such skills. Among the important factors year 2012. effecting the students’ learning and quality of this learning, a proper usage of communicative skills and considering the fact that communicative skills are educable could be Method mentioned and a proper basis could be created in order to transfer concepts and information to the students in the The present research is a descriptive–analytical most effective way possible [8]. one, which was done in a sectional or periodic manner on Creating a correct and proper connection should the third and fourth year Nursing students of Tehran be a part of health and medical care section employees’ Medical University. The research society was made up of characteristics, this being of such great importance as it third and fourth year nursing3_2015_draft students of nursing and has significant effects on the patients’ satisfaction, topology faculty of Tehran Medical University. They were improving clinical consequences and increasing the determined to take part in the study by means of non- patient’s partnership [9,10]. In some countries, accidental simple sampling method and due to the reason communicative skills educating lessons are included in that sample volumeiss was close to total sample society. In the nursing educational program lesson plan [11], but this addition, all third and fourth year students took part in this does not include Iran and its clinical education program study in the form of census and students in their first and [9,10]. A proper communication between the medical second educational year did not take part in it. The reason team and the patient increases the patient’s health and for choosing the third and fourth year students was their decreases the rate of complains; on the other hand, a far greater clinical experience due to the fact that they study has shown that a weak connection and passed more traineeship units. Therefore, all the students communication of health and medical care section of these two years, which included 361 individuals, employees and patients leads to a low satisfaction of entered the study in the form of census. patients [12,13]. The students’ cognitive agreement was obtained On the other hand, learning is a continuous by presenting a letter of satisfaction including the title and process and it happens based on various8_special scenarios for explanations about the research before the work was various people. Individuals prefer a collection made of started. Data were gathered by means of a questionnaire learning styles and methods based on their personal including three parts. The first part included the students’ personality and experiences [14]. The learning style is demographic information (educational semester, gender, method for thinking, processing and understanding average grade and the history of taking part in the information that individuals receive, and apply it for communicative skills workshop). The second part of the learning and solving problems [15]. A process that an questionnaire included standard learning styles of Warok individual understands and keeps information from it and from the book How Do I Learn Best by Fleming [25]. This as a result acquires knowledge and skills, is called questionnaire was also used in studies of Hamouzadeh et learning style [16]. al., Peiman et al., Bahadori et al. and Salmi et al. [26-29]. As a learner, every student has his/ her personal Based on this questionnaire, visual, hearing, reading/ and unique learning style, and, the education scholars writing and movement/ motion styles of the learner were believe that the learner has different learning styles determined. This questionnaire included 16 questions and [17,18]. Teaching methods and educational guidelines of each question placed the learner in a learning condition. each learning style have differences compared with the The responders chose the item that best presented the JML_Volumeother learning styles too. Creating the proper condition for explanation in relation to their performance in that the students’ learning and, as a result, qualitative and situation in every question. If one of the choices was not quantitative accomplishment of educational system is enough to explain their condition, they could choose more dependent on the planners and educational experts (such than one item in every question. The third part of the as teachers and lecturers of universities) knowledge and questionnaire also included the Standard Interpersonal awareness of the students’ learning styles [19]. Communication Skills test. This questionnaire included 34

179 Journal of Medicine and Life Vol. 8, Special Issue 3, 2015

five-item questions and its score was based on 34 to 170. distribution. Therefore, in order to determine the relation Each question choices were presented as almost never, between the communicative skills test’s score with the rarely, sometimes, almost always and mostly and it was other demanding variants, non-parametric tests were scored based on Likret points from 1 to 5. This applied. The minimum and maximum communication questionnaire was used for stability and admissibility in skills test score respectively belong to students who used Peipan et al. study [30]. Data were analyzed by means of reading, writing, and two-dimensional learning style. descriptive statistics method and Kruskul-Wallis and Table 3 presents the median of communicative skills Mann-Whitney U test which was more suitable to score divided by means of Warok learning styles. As it investigate the normal condition of data used in the can be seen, Kruskul-Wallis did not show a significant Cilmograph-Smirnoff test. difference between the communicative skills test score and Warok learning styles (p=0.46).

Results Table 3. The relation between using Warok learning styles and interpersonal communicative skills of students Totally, 320 third and fourth year nursing Warok learning Median and Standard P value students from the Medical University of Tehran were style deviation studied (return rate = 88.64%). One fourth of samples visual 100/8±10/8 (25%) were 8th term students, more than one third listening 102/5±8/7 Reading and writing 98/9±13/6 (39.4%) were male and less than one fifth (18%) had an performance 103/0±10/2 average grade higher than 16. Only 57 individuals 0/46 (17.8%) had a history of taking part in communicative Two dimension 103/6±9/0 skills workshops (Table 1). Three dimension 103/4±10/4 Four dimension 101/3±9/9

3_2015_draft Table 1. Redundancy of students in the study based on semester, gender, average grade and taking part in The maximum and minimum score of communicative skills workshop communicative skills test belong, respectively to nursing variant Variant type Variant (percentage) students of semestersiss 5 and 6 where there was not a Semester 8 %( 25)80 significant difference between the academic semester and Educational Semester 7 %( 22/5)72 the score of communicative skills test score (P=0.74). The semester Semester 6 %( 23/8)76 median of male and female students grade did not differ Semester 5 %( 28/8)92 much and the difference between their grade was not Male %( 39/4)126 Gender significant based on Man Withey test (P=0.79). The media Female %( 60/6)194 of communicative skills test score in students whose Less than 15 %( 24/4)78 average grade was between 15 and 16 was less than the Grade average Between 15-16 %( 56/9)182 More than 16 %( 18/8)60 one of the other students, while students with an average Yes %( 17/8)57 grade higher than 16, had the highest score in their Workshop No %( 82/2)263 communicative skills, compared to the students who took 8_specialpart in communicative skills workshops (P=0.27). Based on Warok learning styles questionnaire, more than half of the samples (58.8%) used more one Table 4. The relation between semester, gender, average style of learning and 42.2% used only one style of grade and taking part in communicative skills workshop and communicative skills test score learning. More than one third of them (38.1%) used four P Median and variant types of learning simultaneously (Table 2). value Standard deviation 102/32±10/92 Semester 8 Table 2. Redundancy of students under study based on using 101/65±10/86 Semester 7 Academic 0 0 /74 Warok learning styles 103/28±11/29 Semester 6 Semester Warok learning style Redundancy (percentage) 100/62±8/44 Semester 5 visual %( 10/6)34 101/79±10/71 Male 0 0 /79 Gender listening %( 5)16 101/98±10/13 Female Reading and writing %( 7/8)25 102/13±10/53 Less than performance %( 17/8)57 15 Two dimensional %( 9/1)29 101/21±10/38 Between 15- Grade 0 0 /27 Three dimensional %( 11/6)37 16 average JML_Volume Four dimensional %( 38/1)122 103/73±9/92 More than 16 Median and standard deviation of under study 103/39±11/29 Yes 0 0 /27 Workshop students’ communicative skills test’s score was equal to 101/59±10/12 No 35 / 10  91/ 101. Based on Cilmograph-Smirnoff test, communicative skills test’s score did not have a normal

180 Journal of Medicine and Life Vol. 8, Special Issue 3, 2015 Discussion of Hematy et al. and present research, only nursing students were included and various branches’ students The present research was realized while aiming took part. to determine the relation between the learning styles of There was no significant relation between the the third and fourth year nursing students of Medical average grade and the communicative skills test’s score University of Tehran with interpersonal communicative of the students, but the median of the communicative skills during 2012. skills test’s score in students with an average grade 41.2% of the students used one type of style higher than 16, was more than the one of the students learning and 38.1% used four styles simultaneously. The with a lower average grade. In Salimi’s study [3], it was median and standard deviation of communicative skills also observed that as the students’ average grade test of students under study was equal to 35/ 10  91/ increased, their level of interpersonal communicative skills 101 which did not show a significant difference regarding also increased but this increase was significant from the the type of students’ learning style. Meanwhile, students statistical point of view. Despite the lack of a significant with two-dimensional and four-dimensional style learning relation between the average grade and the had a higher level of communicative skills in comparison communicative skills score, we could say that students with the individuals with one-dimensional style. What who had a higher level of interpersonal communicative should also be mentioned is that the students’ skills during their education or academic period, also had communicative skills score was less than the average a better academic progress condition. obtainable score of the questionnaire (102) which was not Communicative skills test’s score in students considered to be a satisfying score. who took part in communicative skills workshops was Maslak Pak also found in studying the higher than that of students who did not; still Man-Whitney communicative skills of final year nursing students that test did not show any significant difference. Khalifezade et most of students had an average level of communicative al. research showed that3_2015_draft the design of clinical education skills [24]. The other results of the research showed that courses based on clinical monitoring and guideline pattern nurses and other medical employees were weak in could improve interpersonal, professional, and creating a connection and communicating with patients communicativeiss skills of nursing students [38]. Therefore, [30-33]. Many researches and studies reported that considering that clinical education has a critical role in nurses have great problems in creating a communication forming the professional skills of nursing students, it is with their patients [34,35] which were similar to the results essential to have such courses. obtained by the present research. Therefore, the Taking into account the researchers of the essentiality of creating a proper communication should be present article, there has not been any similar research or emphasized as a critical element of nursing services. study in relation to the connection between the learning No significant difference was observed between styles and interpersonal communicative skills of nursing the academic semester and the communicative skills students until now. Therefore, it is advisable and test’s score. However, students in all semesters had suggested to present the researches and studies that higher scores in comparison with the first semester consider these two factors to other branches and students. In a study undergone by 8_specialSalimi et al., a graduates in the working environment. significant relation was observed between the students’ academic year and their level of communicative skills in a Conclusion way that the third year students had the highest level of communication and the first year students had the lowest The level of students’ communicative skills is level [3]. Therefore, we could say that as the knowledge independent from their learning style and also to their and experience of the students increased as a result of information about it. On the other hand, the nursing the theory and practical classes, their ability level and skill students’ achieved score did not have a satisfactory level. to create connection and communication went higher. What should be taken into account is that in the recent Man-Whitney test did not show a significant year, the educating communicative skills have become difference between the students’ gender and their part of the developed countries nursing education communicative skill ability. Also Hemmaty’s research did program and meanwhile no special plan has been set for not show a significant relation between the nurses’ teaching communicative skills to medical students during speech communication performance of special section the clinical education in our country. Therefore, to correct and their gender [36]. At the same time, a study by the existing condition, the level of communicative skills JML_VolumeMolaiee et al. on students of Ardabil Medical University among the nursing students and other medical sciences concluded that the level of desired communicative skills students should be increased. The level of these skills among male and female students was statistically could be improved by creating a new educational plan for significant and female had a higher level [37]. The reason the mentioned students in relation to nurses’ for such a difference could be related to the student’s communicative skills and also presenting related courses. study branch, because in Molaiee study, against studies

181 Journal of Medicine and Life Vol. 8, Special Issue 3, 2015 References

1. Zamani A, Shams B, Farajzadegan Z, training: development of a new method. 26. Hamouzadeh P, Pourreza A, Panahi M, Tabaeian S. The Viewpoints of Clinical Med Educ. 2002 Apr; 36(4):377-383. Salimi M. Learning styles of health Faculty Members about Teaching 14. Pallapu P. Study of undergraduate services management students at Tehran Communication Skills to Medical students learning styles. A dissertation University of Medical Sciences. Hospital Students. IJME. 2003; 3(1):45-51. submitted to the graduate Faculty of Quarterly. 2012; 10(4):39-47. 2. Deveugele M, Derese A, De Auburn University for degree of doctor of 27. Bahadori M, Sadeghifar J, Tofighi S, Maesschalck S, Willems S, Van Driel M, education, 2008. Mamikhani JA, Nejati M. Learning Styles De Maeseneer J. Teaching 15. Jensen GH. Learning styles. In Provost of the Health Services Management communication skills to medical students, JA, Anchors WS. Using the MBTI Students: a Study of First-year Students a challenge in the curriculum?. Patient instrument in colleges and universities. from the Medical Science Universities of Educ Couns. 2005 Sep; 58(3):265-70. 2003, Gainesville, FL: Center for Iran. Australian Journal of Basic and 3. Salimi M, Peyman H, Sadeghifar J, Applications of Psychological Type, 123- Applied Sciences. 2011; 5(9):122-7. Toloui Rakhshan S, Alizadeh M, 155. 28. Peyman H, Sadeghifar J, Alizadeh M, Yamani N. Assessment of Interpersonal 16. Adesunloye BA, Aladesanmi O, Yaghoubi M, Mohammad Hassan Nahal Communication Skills and Associated Henriques-Forsythe M, Ivonye C. The M, Yamani N et al. Learning Styles of Factors among Students of Allied Preferred Learning Style among First Year Nursing and Midwifery Medicine School in Tehran University of Residents and Faculty Members of an Students in Ilam University of Medical Medical Sciences. IJME. 2013; internal Medicine Residency Program. J Sciences. IJME. 2012; 11(9):1350-8. 12(12):895-902. Natl Med Assoc. 2008; 100:172-175. 29. Salimi M, Sadeghifar J, Peyman P, 4. Sharifi Daramadi P, Kamkari K. Osole 17. Murphy RJ, Gray SA, Straja SR, Bogert Shams L, Jandagheian J, Khosravi A et Ravanshenasi Ertebat ba Kodak. 1st ed., MC. Student learning preferences and al. Visual, Aural, Read/Write, and 2002, Tehran: Ravansanji. teaching implications. J Dental Educ. Kinesthetic Learning Styles Preferences 5. Fathi Azar E. Teaching methods. 1st ed., 2004; 68:859–866. in Students of Isfahan University of 2003, Tabriz: Tabriz University 18. Winn JM, Grantham VV. Using Medical3_2015_draft Sciences. J Health Syst Res. Publication Office. personality type to improve clinical 2012; 8(7):1-9. 6. Shives LA, Isaacs A. Basic concepts of education effectiveness. J Nucl Med 30. Peyman H, Yaghoobi M, Sadeghi Far J, psychiatric-mental health nursing. 5th ed., Technol. 2005; 33:210–213. Saye Miri K, Alizadeh M, Yamani N et 2002, Philadelphia: Lippincott Williams & 19. Mirakzadeh AA, Ghiyasvand issF, al. Assessment of interpersonal Wilkins. Sharifzadeh A, Sharifi M. Learning communication skill levels in lecturers of 7. Das M, Townsend A. The view of senior styles of Agriculture students in Islamic Ilam University of medical sciences: A students and young doctors. Med Edu. Azad University of Takestan. Iranian case study. IJME. 2012; 11(9):1436-1442. 1998; 32:193-194. Journal of Agricultural Economics and 31. Zamani AR, Shams B, Farajzadegan Z, 8. Farhadian F, Tootoonchi M, Changiz T, Development. 2010; 40(4):89-79. Tabaeian SM. The viewpoints of clinical Haghani F, Oveis Gharan S. Faculty 20. James S, D’Amore A, Thomas T. faculty members about teaching Members’ Skills and Educational Needs Learning preferences of first year nursing communication skills to medical students. Concerning Clinical Teaching Methods in and midwifery students: Utilising VARK. Iranian Journal of Medical Education. Isfahan University of Medical Sciences. Nurse Educ Today. 2011 May; 31(4):417- 2003; 3(1):44-9. IJME. 2007; 7(1):109-118. 23. 32. Sabzevari S, Soltani Arabshahi K, 9. Zamani AR, Shams B, Farajzadegan Z, 21. Zeraati A, Hajian H, Shojaian R. Shekarabi R, Koohpayehzadeh J. Tabaeian SM. The viewpoints of clinical Learning Styles of Medical and Midwifery Nursing students’ communication with faculty members about teaching Students in Mashhad University of patients in hospitals affiliated to Kerman communication skills to medical students. 8_specialMedical Sciences. Journal of Medical University of Medical Sciences. Iranian Iranian Journal of Medical Education. Education Winter and Spring. 2008; Journal of Medical Education. 2006; 2003; 3(1):44-9. 12(1,2):17-22. 6(1):43-9. 10. Sabzevari S, Soltani Arabshahi K, 22. Alkhasawneh IM, Mrayyan MT, 33. Zamani A, Shams B, Moazzam E. Shekarabi R, Koohpayehzadeh J. Docherty C, Alashram S, Yousef HY. Communication skills training for Nursing students’ communication with Problem-based learning (PBL): assessing physicians as a strategy for enhancing patients in hospitals affiliated to Kerman students' learning preferences using patients’ satisfaction: a model for University of Medical Sciences. Iranian VARK. Nurse Educ Today. 2008 Jul; continuing education. Iranian Journal of Journal of Medical Education. 2006; 28(5):572-9. Medical Education. 2004; 4(1):15-20. 6(1):43-9. 23. Mahmudi Gh, Jahani MA. Assessing 34. Chant S, Jenkinson T, Randle J, 11. Chant S, Jenkinson T, Randle J, Communication Skill & Psychological Russell G. Communication skills: some Russell G. Communication skills: some Health in Nursing and Midwifery Student problems in nursing education and problems in nursing education and of North Iran. Booklet of Second practice. J Clin Nurs. 2002 Jan; 11(1):12- practice. J Clin Nurs. 2002 Jan; 11(1):12- Congress of Behavioral and social 21. 21. aspects of Health. 2011; 72. 35. McCabe C. Nurse-patient communication: 12. Safirian KH. Evaluation of satisfaction of 24. Hemmati Maslakpak M, Khalilzadeh H, an exploration of patients’ experiences. J patients from communication with health Rahmani A. Study of Communicative Clin Nurs. 2004 Jan; 13(1): 41-9. providers of emergency ward of Sadoghi Skills of Nursing Senior Students Urmia 36. Hemmati Maslakpak M, Sheikhbaklu M, JML_Volumehospital of Yazd University of Medical Facully of Nursing and Midwifery in 2003. Baghaei R, Sheikhi N. Study the Science. Hand book of seminar of Bimonthly Journal of Urmia Nursing and performance of nurses communication communication in health services, 2003, Midwifery Faculty. 2004; 2(1). with patients in special education and Arak, 92. 25. Fleming N, Bonwell Ch. How Do I Learn non-teaching hospital, urmia. Journal of 13. Rollnick S, Kinnersley P, Butler C. Best? A student’s guide to improved Urmia Nursing and Midwifery Faculty. Context-bound communication skills learning. August 2009; 10-12. 2012; 10 (2):286-294. [Persian]

182 Journal of Medicine and Life Vol. 8, Special Issue 3, 2015

37. Molaee B, Mohammadi MA, Dadkhah B, clinical education in nursing and nursing. Iranian Journal of Medical Mozafari N, Habibi A, Savad Poor MH. midwifery. Aug 4-5 2009, Ardebil, Iran, 21. Education. 2001; 3(1):37-41. Communicative Skills of students of 38. Khalifezadeh A , Salehi S, Ardabil University of Medical Sciences. Hassanzadeh A. The effects of clinical Abstract book of first national seminar of supervision program application on

3_2015_draft

iss

8_special

JML_Volume

183 Journal of Medicine and Life Vol. 8, Special Issue 3, 2015, pp.184-189

Epidemiologic and clinicopathologic evaluation of patients with breast cancer referred to Ghaem Hospital from 2005 to 2014

Kadkhodayan S*, Homaee Shandiz F** *Department of Obstetrics and Gynecology, Women’s Health Research Center, Ghaem Hospital, Mashhad University of Medical Sciences, Mashhad, Iran, **Department of Radiotherapy Oncology, Research Center of Solid Tumor Treatment, Ghaem Hospital, Mashhad University of Medical Sciences, Mashhad, Iran

Correspondence to: F Homaee Shandiz, Associate professor, Department of Obstetrics and Gynecology, Women’s Health Research Center, Ghaem Hospital, Mashhad University of Medical Sciences, Mashhad, Iran, Mashhad, Khorasan Razavi, Iran, Phone: +98-5118012477, Fax: +98-5118430569, E-mail: [email protected]

Received: March 14th, 2015 – Accepted: June 18th, 2015

Abstract Introduction: Breast cancer is the most common cancer and the first leading cause of cancer deaths in women of 44-40 years old. The prevalence of triple negative breast cancer includes 10-17%. This type of breast cancer is determined by a negative receptor of estrogen, progesterone and HER2 that is much more aggressive than the other types and the3_2015_draft prognosis is poorer. Therefore, this study was performed with the aim of evaluating the results of the treatment in patients with a triple negative type of breast cancer in comparison with the other patients with breast cancer. Method: This retrospective cohort study was performed by referring to the records of all patients with breast cancer whose treatment and follow-up was performed in Mashhad Ghaem Hospital during 2001 and 2010, theiriss ER, PR, HER2 results being recorded in the files. Based on immunohistochemical records (ER, PR, HER2), patients were divided into two groups: triple negative and non-triple negative and the therapeutic outcomes were compared between the two groups in terms of 2 and 5-year disease-free and overall survival by Kaplan-Meier method. P<0.05 was considered significant. Results: The medical records of 331 patients with breast cancer were analyzed in this study. The number of patients in the Triple negative group was 101 (30.5%) and in the non-Triple negative group was 230 (69.5%). The mean overall survival in the triple negative was 32.48 ± 24.56 months and in the non-triple negative was 29.67 ± 22.36 months and no significant difference was observed between the studied groups (P=0.306). Also, the mean disease-free survival in the triple negative group was 30.57 ± 24.56 months and in the non-triple negative was 28.21 ± 21.72 months and no significant difference was observed between the studied groups (P=0.184). Conclusion: According to previous conducted studies, among all the types of breast cancer, Triple negative had a poorer prognosis and a shorter survival among the patients in our study, the overall survival and disease-free survival obtained was the same in two groups of Triple negative and non-Triple negative8_special and the cause of this similarity was probably the presence of HER2 + subgroup in the non-Triple negative group which led to the survival of patients in the non-Triple negative group be similar to the Triple negative group.

Keywords: breast cancer, Triple negative, overall survival, disease free survival

Introduction death [1]. Statistics and evidence indicated an increasing incidence of breast cancer in the middle of the 1940 Breast cancer with an unknown cause has drawn decade [3,4]. the physicians’ attention in all decades. Despite centuries The malignant proliferation of epithelial cells of scientific theories and practices, breast cancer is one of lining the breast ducts or lobules are the cause of this the most horrific human diseases. Despite all the efforts disease [2]. made for treatment, unfortunately has no satisfactory end The core needle biopsy and FNA techniques are in some cases [1,2]. This cancer is a huge problem in the the most common breast cancer diagnostic techniques JML_Volumewomen’s health worldwide. Breast cancer is the most which can be used to perform all diagnostic and common cancer in women and the second leading cause prognostic tests with reliable results [2]. Today, breast of death due to cancer in the United States of America [3]. cancer is molecularly divided into four categories It was predicted in 2009 that breast cancer including: Luminal A, Luminal B, Her2 +, and Triple included 27% of all cancers and 15% of cancer-related negative. However, among all types of breast cancer, the death, including 192,370 new cases and 40,170 cases of triple negative type contains 10-17%. This type is Journal of Medicine and Life Vol. 8, Special Issue 3, 2015

diagnosed by negative receptor estrogen, progesterone negative groups, simultaneous effect of age and disease and HER2 that seems to be more aggressive than other stage and disease grade in the overall survival and types, and has a poorer prognosis [4,5]. disease-free survival. Another study was retrospectively performed by The graphs and statistical tables were used to Abu al-Khair and colleagues in Saudi Arabia, in 2012, on describe the data. Chi-square test was used to evaluate 517 patients with breast cancer, who were referred to the the relationship between the qualitative variables (age < medical center of Prince Abdul Aziz from January 2001 to and > 40 years, the tumor pathology, disease stage, December 2008, the incidence of Triple negative cancer disease grade, recurrence) with Triple negative and non- in this region being similar to the studies in the West and Triple negative (Luminal A, Luminal B, HER2 +). having no significant difference between the two groups in ANOVA test was used to evaluate the 3-year survival rate. However, the aggressiveness and relationship between age and Triple negative and non- overall survival of the disease in the Triple negative group Triple negative (Luminal A, Luminal B, HER2 +) and Log- was higher in the cases of less than 40 years than in rank was univariate used to evaluate the relationship those over 40 years [6]. between Triple negative and non-Triple negative (Luminal Now, in the case of breast cancer in addition to A, Luminal B, HER2 +), and the overall survival and conventional medical and surgical treatments disease-free survival and the percentage and mean of (chemotherapy, radiotherapy, etc.), treatment based on overall survival and disease-free survival in each Triple biological and molecular markers of tumor, and the patient negative and non-Triple negative groups (Luminal A, (such as hormone therapy and target therapy) is also Luminal B, HER2 +) were obtained by the Kaplan-Meier recommended [7,8]. The observed above-mentioned method. elements show the importance of further study of this type Cox regression was also used to evaluate the of cancer. Therefore, this study was performed with the simultaneous effects of variables. In all tests, SPSS aim of evaluating the results of treatment in patients with software version 16 3_2015_draftwas used and P<0.05 was triple negative type of breast cancer with other patients considered significant. with breast cancer and their comparison with the overall survival and disease-free survival. Results iss Materials and Methods In this study, medical records of 331 patients with breast cancer who referred to the Oncology Center of This retrospective cohort study was performed Ghaem Hospital for treatment and follow-up during 2001 by referring to the records of all patients with breast and 2010 were evaluated. According to the cancer whose treatment and follow-up was performed in immunohistochemistry results available in the file, patients Mashhad Ghaem Hospital during 2001 and 2010 and their were divided into 2 Triple negative (TN) and non-Triple ER, PR, HER2 results were recorded in the files. negative groups according to the immunohistochemistry Required data was collected and recorded in the checklist regarding the ER and PR, the cases of > 1% were recorded as positive and the ones of < 1%, negative, and, and was analyzed by a statistician. In addition, the about HER2, only the cases of 3 positive were recorded patients in the two groups were matched in terms of the 8_specialas positive. The number of patients in the Triple negative disease’s stage and treatment type. group was 101 (30.5%) and in the non-Triple negative The sample size was calculated at 59 cases group was 230 (69.5%). Also, the patients in non-Triple according to the study of Zaky et al [9] with respect to the negative group were divided into three subtypes of 70% and 90% survival rates in groups with and without luminal A, luminal B and HER2 + the number of patients Triple negative breast cancer with a confidence of 95% in each group was 142 (42.9%), 36 (10.9%) and 52 and 80% capacity. The sampling method was the easy (15.7%), respectively. Non-probability method. The mean age of patients in the TN group was Inclusion criteria included all patients with breast 43.50 years and in the non-Triple negative group it was cancer whose treatment and follow-up were performed in 48.08 years, the result of the one-way tests showing that Mashhad Ghaem Hospital during 2001 and 2010 and their the distribution of age was not similar in the studied ER, PR, HER2 results were recorded in the files. groups and the patients with Triple negative cancer were Exclusion criteria included non-carcinoma pathology, the younger (P=0.001). The number of patients aged <40 patients who had no regular referring for the treatment years was met in 43 cases (42.6%) in the TN group and and follow-up (at least 6 months), and the metastatic of 64 cases (27.8%) in the non-Triple negative group, the JML_Volumecases. result of the Chi-square test showing a significant The studied variables included age, breast difference between the studied groups and the distribution cancer type (Triple negative and non-Triple negative), of age which was not similar in the studied groups, and tumor pathology, disease stage, disease grade, the mean the number of patients aged <40 years in the TN group and median and percentage of overall survival and was higher compared to the non-Triple negative group disease-free survival in Triple negative and non-Triple (P=0.008). 185 Journal of Medicine and Life Vol. 8, Special Issue 3, 2015

The number of patients with carcinoma ductal The mean disease-free survival in patients with invasion in the TN group was of 83 cases, medullary TN breast cancer was of 30.57 ± 24.56 months and in the carcinoma 8, lobular carcinoma 2, and the other cases 5. non-Triple negative group, it was of 28.21 ± 21.72 The type of cancer was unclear in 3 cases of Triple months. The five-year disease-free survival in patients negative group and 5 in non-Triple negative group, the with TN breast cancer was 66.7% and in the non-Triple result of the Chi-square test showing a significant negative group, it was 73.3%. The result of Log-Rank test difference between the studied groups and the distribution showed no significant differences in the disease-free of various types of cancer which was not similar in the survival among the studied groups (P=0.184) (Table 2). studied groups and the subgroup of breast medullary carcinoma was more observed in the Triple negative group (P=0.042). Table 2. Comparison of the disease-free survival in the Triple In the TN group, the number of patients in stage negative and non-Triple negative groups Groups 1 was of 10 cases, in stage 2 it was of 59, in stage 3 it Variables P-value was of 32, the result of the Chi-square test showing that Non TN TN the distribution of stage was similar between Triple Mean disease-free 28.21 ± 30.57 ± negative and non-Triple negative groups (P=0.945). survival 21.72 24.56 In the TN group, the number of patients in grade Median of survival 21 20 was of 0 cases and in the non-Triple negative group it Disease- 1 year 95.9 92.4 0.184 free 2 years 89.9 79.8 was of 22 cases. The information related to the grade was survival 5 years 73.3 66.7 not available for 63 patients in the Triple negative group (%) and 131 in the non-Triple negative group, the result of the Chi-square test showing that the distribution of grade was not similar between the Triple negative and the non-Triple negative groups; no patients with Triple negative breast 3_2015_draft cancer in grade A were observed (P=0.006). The mean overall survival in patients with TN breast cancer was of 32.48 ± 24.1 months and in the non- Triple negative group it was of 29.67 ± 22.36 months. The iss overall five-year survival rate in patients with TN breast cancer was 71% and in the non-Triple negative group was 76.5%. The result of Log-rank test showed no significant difference in disease-free survival between the studied groups (P=0.306) (Table 1).

Table 1. Comparison of the overall survival between Triple negative and non-Triple negative groups Groups P- Variables Non TN TN value Fig. 2 Disease-free cumulative survival in the Triple 22.36 32.48 ± Mean overall survival negative and non-Triple negative groups ±29.67 24.18_special Median of survival 22.5 27 0.306 Overall 1 year 99 96.7 Cox regression was used to evaluate survival 2 years 91.2 92.6 simultaneous effects of grade, stage, age, and the studied (%) 5 years 76.5 71 groups on disease-free survival and the result is shown in Table 3.

Table 3. Results of Cox regression to assess the simultaneous effect of variables on the disease-free survival Variables Confidence Risk ratio Model P-value interval 95% coefficient

Stage 1 - 1ª - 0.620

Stage 2 (0.113, 8.672) 0.988 -0.012 0.992 JML_Volume Stage 3 (0.020, 5.811) 0.343 -1.070 0.459

Age (0.394, 5.618) 1.488 0.397 0.558 Fig. 1 Comparison of the overall survival in Triple negative and non-Triple negative groups

186 Journal of Medicine and Life Vol. 8, Special Issue 3, 2015

Grade 1 - 1ª - 0.996 and radiotherapy, the result of the Chi-square test in the evaluation of distribution of these cases in the studied Grade 2 (0.000,-) 0.000 -12.218 0.979 group representing the right selection of the patients. Also Grade 3 (0.291,3.828) 1.055 0.054 0.935 there was no difference among patients in this regard and

a=reference group the effect of these cases in the prognosis and survival of patients can be eliminated. Cox regression results showed that among the In terms of choosing the type of treatment, only factors of age, stage, grade, and the studied groups, none the distribution of hormone therapy was not similar in the is independently associated with disease-free survival. studied group, which is due to the negative hormone Also, the Cox regression was used to evaluate receptor in the Triple negative group, taking into account simultaneous effects of grade, stage and age on the that hormone therapy could not be used in the treatment overall survival rate and the result is shown in Table 4. of this group. In this study, the prevalence of Triple negative Table 4. Results of Cox regression to assess the simultaneous breast cancer was 30.5% with a mean age of 43.50 years, effect of variables on the overall survival which was more common in women compared to a study Variabl Confidence Risk ratio Model coefficient P- conducted by Dent and colleagues in Canada. In the es interval 95% value study of Dent and colleagues, the prevalence of Triple negative breast cancer was 11.2%, and the rate of Stage 1 - 1ª - 0.804 recurrence and mortality within 5 years from diagnosis Stage 2 (0.167, 11.151) 1.363 0.310 0.773 was more than that of the non-Triple negative group [14]. Stage 3 (0.067, 9.547) 0.797 -0.227 0.858 Similarly, in the studies conducted by Lin and colleagues in Taiwan [15], Zaky et al. in Atlanta [16], Age (0.266, 3.761) 1.000 0.000 1.000 Davis and colleagues in 3_2015_draftWest Virginia [17], the incidence of Triple negative breast cancer was lower than in our Grade 1 - 1ª - 0.900 study, but in the study of Sen and colleagues [18] in Grade 2 (0.000,-) 0.000 -12.398 0.979 Calcutta, theiss incidence of Triple negative breast cancer Grade 3 (0.216, 2.594) 0.748 -0.290 0.647 was reported as 27.78% which was statistically similar to our study in Iran. a=reference group In a study by Davis and colleagues in West

Cox regression results showed that among the Virginia reported in 2007, the tumor pathological subgroup of most patients with Triple negative breast cancer was factors of age, stage, and grade, there were no elements invasive ductal carcinoma, which is similar to our study, independently associated with the overall survival. meaning that the tumor pathological subgroup of 84.7% of patients with Triple negative breast cancer was invasive Discussion ductal carcinoma [17]. In a study by Sen and colleagues in the Cancer is a major problem regarding the health Department of Surgery, School of Medicine, published in of the world. Among all types of cancer8_special among women, Calcutta in 2013, among patients with Triple negative breast cancer is the most prevalent. Given that half of the breast cancer, 75% were in Stage 3 and 80% in Grade 3 world’s populations are women, so many people in the of the disease, but compared to our study, this incidence world are at risk of developing this type of cancer. was different. In our study, 58.4% of the patients with Therefore, further studies in this area are needed. This Triple negative breast cancer were in Stage 2 and 52.2% type of cancer has several subtypes, among these being were in grade 2 of their disease [18]. the Triple negative type which is diagnosed by negative In our study, 2 and 5-year overall survival and 2 receptor of estrogen and progesterone and -HER2 and 5-year disease-free survival were assessed in the determined by immunohistochemical techniques, having a Triple negative and non-Triple negative groups by very poor prognosis among patients [10,11]. referring to the patients’ follow-up based on the contents As presented in previous studies, in addition to of their medical records, including dates of each visit and tumor subtypes, the patients’ age at diagnosis, stage and checking the status of patients (recurrence, death, good grade of disease, obesity, menopausal status, race, and condition) that were evaluated and recorded on each visit lymph node involvement are also important factors in the by the physician, and were compared among patients by determination of prognosis and survival of the patients using the Kaplan-Meier test. The results showed no JML_Volume[12,13]. difference between the Triple negative and non-Triple This study tried to include the patients who had negative groups in terms of overall survival and disease- performed the treatment recommended by the physician free survival. The results were similar to a study by Abu and had at least 6 months of follow-up, the patients not al-Khair and colleagues in Saudi Arabia in which 26 being different at the end of the course of chemotherapy patients with at least 3 years follow-up in the Triple

187 Journal of Medicine and Life Vol. 8, Special Issue 3, 2015 negative group and 33 patients with same age and Conclusion disease stage in the non-Triple negative group were selected and the result of a 3-year survival was similar in According to previous conducted studies, among two groups [6]. In our study, most (57.4%) of the patients all the types of breast cancer, the Triple negative has a with Triple negative breast cancer were aged > 40 years, poorer prognosis and a shorter survival among the meaning that the distribution between the two groups was patients in our study, the overall survival and disease-free not calculated as the same and the patients with Triple survival obtained was the same in two groups of Triple negative breast cancer were younger than those with non- negative and non-Triple negative, meaning that the cause Triple negative breast cancer, but based on the results of of this similarity was probably the presence of HER2 + Cox regression test, there was no significant relationship subgroup in the non-Triple negative group, which has led between age and overall survival and disease-free to the survival of patients in the non-Triple negative group, survival in the studied groups. which was similar to the Triple negative group. In addition, in the study performed by Boyle in If necessary, treatments effective on HER2 + France, the highest rate of Triple negative breast cancer receptor could be used more in the treatment of patients recurrence was during three years from diagnosis and the with non-Triple negative breast cancer. It is also rate of mortality was highly increased during 5 years from recommended that in future studies, menopausal status diagnosis and the African-American race was a risk factor and obesity and its effect on the survival of the patients in this cancer which in this race was 3 times more were surveyed and the results were compared with common than the other types of breast cancer. It can be results of previous studies, because in our study, it was concluded that perhaps the reason for the difference in not the main objective and it was not evaluated. Also, if determining the overall survival in the patients of our more studies were performed on the Triple negative study and the study of Boyle was the effect of race that breast cancer in Asia and also the evaluation of the ethnic required further studies in future [19]. status, we could have3_2015_draft a better comparison of the In a study performed by Lin and colleagues in incidence of this type of cancer in the Asian and Western Taiwan, the disease-free survival in the two groups of societies. Triple negative and non-Triple negative was similar to the iss one in our study, but the overall survival in the two groups was reported different [15].

References

1. Vincent T, DeVita Jr., Theodore S, 5. Yang Q, Liu HY, Liu D, Song YQ. similar outcome as triple-negative breast Lawrence T, Rosenberg S, DePinho R, Ultrasonographic features of triple- cancer. BMC Cancer. 2015; 15:138. Weinberg RD. Hellman and Rosenberg’s negative breast cancer: a comparison with 11. Prat A, Cheang MC, Martin M, Parker Cancer principles and practice of 8_specialother breast cancer subtypes. Asian Pac J JS, Carrasco E, Caballero R et al. oncology. 9th ed., 2011, Lippincott Cancer Prev. 2015; 16(8):3229-32. Prognostic significance of progesterone Williams & Wilkins. 6. Abulkhair O, Moghraby JS, Badri M, receptor-positive tumor cells within 2. Pollock E, Brunicardi F, Andersen D, Alkushi A. Clinicopathologic features and immunohistochemically defined luminal A Billiar T, Dunn D, Hunter J, Matthews prognosis of triple-negative breast cancer breast cancer. J Clin J, Raphael E. The Breast. In: Pollock E, in patients 40 years of age and younger in Oncol. 2013; 31(2):203-9. Brunicardi F, Andersen D, Billiar T, Dunn Saudi Arabia. Hematol Oncol Stem Cell 12. Braun L, Mietzsch F, Seibold P, D, Hunter J, Matthews J, Raphael E. Ther. 2012; 5(2):101-6. Schneeweiss A, Schirmacher P, Schwartz principal of surgery, 9th ed., 7. Pal SK, Childs BH, Pegram M. Triple Chang-Claude J et al. Intrinsic breast 2011, United States of America: McGraw- negative breast cancer: Unmet medical cancer subtypes defined by estrogen Hill Professional. needs. Breast Cancer Res Treat. 2011; receptor signalling-prognostic relevance 3. Bhargava R. Immunohistology of the 125:627-36. of progesterone receptor loss. Mod Breast carcinoma. In: David J, Esposito 8. Sahoo PK, Jana D, Mandal PK et al. Pathol. 2013; 26(9):1161-71. NN. Dabbs 2010: Dabbs Diagnostic Effect of lymph angiogenesis and 13. Viale G, Regan MM, Maiorano E, Immunohistochemistry: Theranostic and lymphovascular invasion on the survival Mastropasqua MG, Dell’Orto P, Genomic Applications, Expert Consult, 3rd pattern of breast cancer patients. Asian Rasmussen BB et al. Prognostic and ed., 2010, Philadelphia. Pac J Cancer Prev. 2014; 15:15-6287. predictive value of centrally reviewed 4. de Kruijf EM, van Nes JG, van de Velde 9. Zaky S, Lund M, May KA, Godette K, expression of estrogen and progesterone CJ, Putter H, Smit VT, Liefers GJ et al. Beitler J, Holmes L, O’Regan R et al. receptors in a randomized trial comparing JML_VolumeTumor-stroma ratio in the primary tumor is The negative effect of triple-negative letrozole and tamoxifen adjuvant therapy a prognostic factor in early breast cancer breast cancer on outcome after breast- for postmenopausal early breast cancer: patients, especially in triple- conserving therapy. Ann Surg Oncol. BIG 1-98. J Clin negative carcinoma patients. 2011; 18(10):2858-65. Oncol. 2007; 25(25):3846-52. Breast Cancer Res Treat. 2011; 10. Bae SY, Kim S, Lee JH, Lee HC, Lee 14. Dent R, Trudeau M, Pritchard K, Hanna 125(3):687-96. SK, Kil WH et al. Poor prognosis of single W, Kahn H, Sawka C et al. Triple- hormone receptor- positive breast cancer: Negative Breast Cancer: Clinical Features 188 Journal of Medicine and Life Vol. 8, Special Issue 3, 2015

and Patterns of Recurrence Clin Cancer outcome after breast-conserving therapy. study of triple negative breast carcinoma: Res. 2007; 13(15 Pt 1):4429-34. Ann Surg Oncol. 2011; 18(10):2858-65. experience of a tertiary care centre in 15. Lin C, Chien C, Chen L, Kuo S, Chang 17. Davis V, Rose D, Hazard H, Howard M, eastern India. J Indian Med Assoc. 2012; T, Chen D. Triple negative breast Adkins F, Partin J et al. Triple-Negative 110(10):686-9,705. carcinoma is a prognostic factor in Breast Cancer and Obesity in a Rural 19. Boyle P. Triple-negative breast cancer: Taiwanese women. BMC Cancer. 2009; Appalachian Population. Cancer epidemiological considerations and 9:192. Epidemiol Biomarkers Prev. 2008; recommendations. Ann Oncol. 2012; 23 16. Zaky S, Lund M, May KA, Godette K, 17(12):3319-24. Suppl 6:vi7-12. Beitler J, Holmes L et al. The negative 18. Sen S, Gayen R, Das S, Maitra S, Jha A, effect of triple-negative breast cancer on Mahata M. A clinical and pathological

3_2015_draft

iss

8_special

JML_Volume

189 Journal of Medicine and Life Vol. 8, Special Issue 3, 2015, pp.190-194

Prevalence of HIV infection among Qeshm Island population in 2013-2014, Iran

Holakouie N*, Kargar Kheirabad A**, Sajjadi MJ *, Gouklani H*** *Student Research Committee, Hormozgan University of Medical Sciences, Bandar Abbas, Iran, **Department of Virology, School of Public Health, Tehran University of Medical Sciences, Tehran, Iran, ***Molecular Medicine Research Center, Hormozgan University of Medical Sciences, Bandar Abbas, Iran

Correspondence to: Hamed Gouklani, PhD, Molecular Medicine Research Center, Hormozgan University of Medical Sciences, Bandar Abbas, Iran, Immam Hosein Boulevard, Bandar-Abbas, Iran, Phone: +98 (76) 33668476, Fax: +98 (76) 33685047, E-mail: [email protected]

Received: March 14th, 2015 – Accepted: June 18th, 2015

Abstract Introduction. Acquired immune deficiency syndrome (AIDS) is represented by a range of disorders of cellular and humoral immune dysfunction caused by human immunodeficiency virus (HIV) infection. Immune deficiency caused by HIV, leads to opportunistic infections and finally the progression of the infections cause the patient’s death. That is why we decided to realize this study, in order to evaluate the prevalence of HIV among the Qeshm Island inhabitants. Materials and Method. This cross-sectional study was conducted on 1500 subjects. The sampling method was the stratify-cluster combination. Ten head-clusters were randomly selected from each center and samples were collected3_2015_draft from within the blocks. After completing the questionnaire, including demographic the data and risk factors, blood samples were drawn from the brachial vein. The prevalence of HIV-Ab was assessed by ELISA method. Finally, the statistical analyses were performed by using the Statistical Program for Social Sciences software (SPSS) system version 16.0. The data were analyzed by Chi-square and descriptive statistical tests. iss Results. The overall prevalence of HIV infection was zero. Of the participants in this study, 511 (34.1%) were men and 989 (65.9%) were women. The average age was 32.6 years. 88% and 12% of the individuals were married and single, respectively. The education level of most subjects (66%) was the degree diploma. In terms of location, most of the subjects (75.2%) lived in the rural area. 136 (7.9%) had a history of travelling abroad and none of the subjects did not report a history of running away from home. Conclusion. The majority of the subjects lived in the rural area and were married women with high school education. Although there were subjects who had a history of sexually transmitted diseases (STD) or tattoos, HIV prevalence was zero. This gives hope to the health of our society in terms of HIV disease.

Keywords: epidemiology, HIV infections, Qeshm

Introduction 8_special10000 new cases are added annually. As a result, the rising trend of HIV infection was continued in Sub- AIDS stands for acquired immune deficiency Saharan Africa and South Asia. The incidence rate of syndrome. The disease is caused by the proliferation of AIDS disease is of 2.5 million per year worldwide [5] and Human Immune Deficiency Virus (HIV) in the hosts’ body. the incidence rate of HIV infection is of 19 cases per year HIV destructs the immune system of the body [1]. AIDS is [6]. a description of a disorder in the cellular and humoral HIV is transmitted via heterosexual and immunity due to the infection with HIV. The main target of homosexual relationship, blood transfusion and products, this virus is the T lymphocyte, which contains CD4 drug injection, infected pregnant mother, and finally receptors in their cellular membrane. The disease varies infection of the neonate during childbirth, prenatal period, from a mild viremia to a severe immune deficiency along or breastfeeding. Needle stick injuries or penetration of with life-threatening opportunistic infections and even sharp objects are transmission methods via skin and AIDS-related malignancies [2]. mucosal ways, and also sprinkle of blood and other body The first case of AIDS was reported in 1980 in discharges into the eye, nose, and mouth [7-9]. AIDS is the United States among a group of homosexual men the cause of 25 million deaths worldwide and it is JML_Volumeinfected with Kaposi’s sarcoma and pneumocystis estimated that about 40 million affected patients do not pneumonia [3,4]. 15 years after the first AIDS case, have access to anti-retroviral treatment [10]. pandemic HIV infection increased worldwide and in the Assessments demonstrate that several factors late 1995, there were 1.3 million HIV-infected individuals can increase the risk of epidemic HIV which is the among 193 countries. It is estimated that 24 million adults following: first, the prevalence of sexual transmitted and 1.5 million children are infected with HIV and about diseases (STD) is partially high, which demonstrate the Journal of Medicine and Life Vol. 8, Special Issue 3, 2015

unprotected extramarital sex [11]. Secondly, war, did not give their consent, or those who were not available displacement, and migration, which are mostly after two contact attempts have been made, were accompanied by high-risk sexual behaviors that can excluded from the study, and replaced with the next ran- increase the susceptibility of AIDS. Thirdly, injection drug dom subjects. Using this approach, a total of 50 clusters users (IDUs) are a way for HIV transmission among the with 1500 individuals were included in this survey. public population in several countries [12], and out of Participants were interviewed in their homes, other factors, sexual contact with multiple partners, not and a questionnaire on personal information was using condom consistently, lack of information regarding completed by a trained interviewer, for each subject. HIV risks, and negative attitudes toward safe sexual Participants were then asked to refer to the Health function can also be pointed [13]. Promoting Research Center, and they were provided with During the last few years, the disease was on the top of the health emergencies in Iran. According to the an introduction letter for blood sampling. One day after World Health Organization (WHO) forecasts, the rate of the interview, a 10 mL sample of venous blood was HIV infection in Iran will be of 10 percent in 2020. collected into ethylene di-amine tetra-acetic acid (EDTA) Therefore, Iran is recognized as one of the most risky bottles, after tourniquet application at the Health countries in the world [14]. Epidemic HIV is spreading Promoting Research Center and then transferred to the rapidly with different forms among various countries. In regional laboratory. the current conditions, the combination of preventive and Blood samples underwent qualitative evaluations therapeutic methods that emphasize on convenient to assess the repeated blood sampling. After the access to these methods, are being discussed. So far, separation of serum from blood samples in the local limited studies have been conducted on the prevalence of AIDS among the public population in Iran and it seems laboratory, by centrifugation, serums were frozen in -20°C that the importance of this issue is not considered and transferred to the central3_2015_draft laboratory of the Iranian adequately. According to the high importance of the Blood Transfusion Organization. Serum samples were disease and with reference to what has been said, we screened for HIV-Ab by ELISA while using a third aimed to assess the prevalence of HIV among the generation Kitiss (Biomeriex, Amsterdam). Positive samples residents of Qeshm Island. were referred for western blot test to be confirmed. The study was approved by the Ethical Method Committee of the Hormozgan University of Medical Sciences. A written informed consent was obtained from Using the random, cluster sampling approach, all of the participants and personal data were kept this cross-sectional study was carried out on 511 males confidential both during and after the study. and 989 females in Qeshm Island from southeast of Iran Collected data was entered in SPSS v.16 during 2013-2014. At the time of the implementation of software and analyzed by using descriptive statistics this study, the total number of people living in This Island (frequency, mean, percent, and standard deviation) and according to the latest national capitation survey was 130000. Our sample size (n=1500) by using8_special the following chi-square test. formula: Results

In the current study and in order to assess the seroprevalence of HIV-Ab, serum samples of 1500 subjects were analyzed for positivity by using the ELISA The Family Registry at public health centers method. None of samples was positive for HIV and all were considered as a sampling frame. Each public health subjects were healthy. The mean age of the participants center covered a separate region of the Island. Two in this study was 31.35 years. From the studied subjects, trained interviewers then visited the subjects’ homes and 34.1 percent (n=511) and 65.9 (n=989) percent were male provided them with information about the study and its and female, respectively. 24.8 (n=372) and 75.2 (n=1128) goals. Data were collected by using a check list that was percent of the participants were living in cities and designed according to similar studies and experts’ villages, respectively. 66% (n=990) were under diploma, opinion. The checklist included demographic data (age, 21.7% (n=325) had a diploma, 1.9% (n=29) had an JML_Volumegender, marital status, residency, Literacy, travelling to a associate degree, 8.2% (n=123) had a bachelor degree, foreign country and history of running away from home) and 2.2% (n=33) had a master degree and higher. 136 and risk factors (addiction, sexual contact, imprisonment, (7.9) participants had previously traveled to a foreign STD and Tattooing) for AIDS. country and 1364 participants (92.1%) did not travel to a The inclusion criteria consisted of being a foreign country. None of the participants reported a Qeshm inhabitant and providing a consent. Subjects who history of running away from home (Table 1). 191 Journal of Medicine and Life Vol. 8, Special Issue 3, 2015

Table 2. Demographic data of participants by Salehiet al. [18] on medical documents of blood donor Variable No. Percent volunteers during 2002 and 2005 in Isfahan and the Sex Male 511 38.1 results demonstrated that the HIV prevalence was zero Female 989 65.9 similar to the one in our study. In the study of Sharifiet al. Marital status [19] on the dentists of Qazvin city, the HIV prevalence Single 180 12 was zero. No HIV positive case was reported in the study Married 1320 88 of Ghafoorian-Broujerdniaet al. [20] on medical Residence Urban 372 24.8 documents of thalassemia patients referring to Shafa Rural 1128 75.2 Hospital of Ahvaz during 1999 and 2004. In another study Literacy conducted by Kasraeianet al. [21] on blood donor under diploma 990 66 volunteers of Shiraz Blood Transfusion Organization diploma 325 21.7 during 1998 and 2002, the HIV prevalence was 5.5 associate degree 29 1.9 bachelor 123 8.2 percent which was not consistent with the results of our master degree and higher 33 2.2 study. In the studies of Kolivand [22] in Kermanshah, travelling to a foreign country Taheri [23] in Rasht, and Masaeli [24] in Isfahan, the Yes 137 7.9 prevalence of HIV was 0.05, 0.008, and 0.018 percent, No 1363 92.1 history of running away from home respectively, which did not match the results of our study. Yes 0 0 Similar studies were performed in Italy [25] and the United No 1500 100 States of America [26], which demonstrated a significant decrease from 1995 to 2002, which could be attributed to Based on the findings in Table 2, three the change of life style. There was no positive HIV case participants had an addiction history and 1497 among the public population in the present study, which participants (99.8%) reported no addiction history. 0.3 could be due to cultural3_2015_draft and religious issues preventing percent (n=4) had a previous history of sexual contact and high-risk behaviors. 2 participants had a prison history. 2 percent (n=34) had a In the study of Bagheriet al. [27] on 1461 history of STD and 98 percent (n=1466) reported no STD patients withiss AIDS, 819 (56.5 percent) patients had a history. 4 percent (n=69) had a tattoo history and 96 previous history of tattoo. This fact implies that tattooing is percent (n=1431) of the participants reported no previous one of the most common ways for HIV transmission. tattoo history. However, among 69 (4.4 percent) participants of our study with a previous history of tattooing, the HIV Table 3. Risk factors associated with HIV infection prevalence was zero. In the study of Ghanbarzadehet al. Variable No. Percent [28] on the HIV prevalence among 199 female prisoners addiction history Opium 2 0.1 of Birjand, the HIV prevalence among 76 (38.2 percent) Heroin 2 0.1 prisoners with a previous history of tattooing was zero, Others 0 0 which was consistent with the results of the current study. None 1497 99.8 In the study of Dolan et al., although the tattooing History of sexual contact Yes 4 8_special0.3 prevalence was 30.1 percent, HIV prevalence was No 1496 99.7 reported to be zero, which was congruent with the results History of imprisonment in the present study. Different tattooing prevalence can be Yes 2 0.1 attributed to cultural and religious issues in the study No 1498 99.9 History of STD region. Yes 34 2 The frequency of prison history among the HIV No 1466 98 positive patients in the study of Keramatet al. [29] was History of Tattooing Yes 69 4 40.4 percent. In the study of Strazzaet al. [30], the HIV No 1431 96 prevalence among female prisoners was reported to be 13.9 percent. Consequently, residing in prison was one of the main risk factors due to inappropriate health Discussion conditions, malnutrition, higher affinity to drug abuse through injection, high-risk sexual behaviors, and as a The HIV prevalence was zero in the present result a higher probability of HIV transmission. In the study. In a study conducted by Rostamiet al. [15], in 2009, current study, two participants had a previous history of JML_Volumeamong the health center clients in Andimeshk, the HIV prevalence was also zero. HIV prevalence was also zero being in prison; however, they were not HIV positive. in the study of Haghsehnaset al. [16] on prisoners. Those participants with a previous history of being in Similarly, the HIV prevalence was zero in the study of prison, which was one of the main risk factors for HIV was Nabavizadehet al. [17] in 1999 among blood donors of limited in our study, which implied an ethical health of our Yasuj. A retrospective cross-sectional was also conducted community and was consistent with the studies of

192 Journal of Medicine and Life Vol. 8, Special Issue 3, 2015

Nokhodian [31] and Mohamed [32] who reported the HIV the participants in the present study were married, which prevalence to be equal to zero among prisoners. can be a reason for preventing high-risk sexual behaviors. In the study of Robinson et al. [33], 90 percent of the HIV positive cases were also affected by other STDs. Lagaet al. [34] demonstrated that the STD is an important Conclusion risk factor for HIV and the annual HIV incidence was 9.8 The majority of participants in the present study percent before the STD control, which approached to 4.8 lived in rural areas and were married women with below percent following the STD control. Ghyset al. [35] diploma education level. The prevalence of HIV was zero, revealed that the HIV incidence rate decreased from 16.3 despite the previous history of STD and tattooing. percent to 6.5 percent following the STD control. The Collectively, more efforts are needed to raise the public results of these studies verified that the STD is another awareness regarding the risks of tattooing and the important risk factor for the HIV transmission. The HIV education regarding the prevention of AIDS and other prevalence was zero in the present study, although 34 (2 sexually transmitted diseases. percent) participants reported a previous history of STD. In the study of Ghanbarzadehet al. [28] on female Limitations prisoners of Birjand, the HIV prevalence was reported to The following are the limitation of this study: be zero despite the high prevalence of STD, which could 1- Lack of cooperation the studied society in be due to the early visits to physicians, rapid diagnosis, presenting the required information and appropriate and timely treatment. As mentioned 2- Unavailability of scientific resources before, the HIV prevalence can be reduced through STD 3- Cost control. Moradiet al. [36] conducted a study in 1998 Acknowledgements 3_2015_draft which assessed the seroepidemiology of AIDS in Iran. This study was the result of a general physician Medical documents of 1953 patients with AIDS were thesis. We would like to thank all professors, Qeshm assessed and results demonstrated that 30.1 percent of inhabitants, health system authorities, and Hormozgan them had previously traveled to a foreign country. HIV University of issMedical Sciences who helped us during this prevalence was zero in the current study, although 136 study. (7.9 percent) participants had previously traveled to a foreign country. This can be due to the fact that most of

References

1. Varghese B, Maher JE, Peterman TA, Epidemic 2013. 2014, Geneva, point of HIV infection: updated results Branson BM, Steketee RW. Reducing Switzerland: UNAIDS. from the German HIV-1 Seroconverter Study. PloS one. 2014; 9(5):e95956. the risk of sexual HIV transmission: 8_special6. Koh Kwee Choy M. A Review of 11. Heikel J, Sekkat S, Bouqdir F, Rich H, quantifying the per-act risk for HIV on the HIV/AIDS Research in Malaysia. Med J Malaysia. 2014; 69:68. Takourt B, Radouani F et al. The basis of choice of partner, sex act, and 7. Solorio R, Norton-Shelpuk P, Forehand prevalence of sexually transmitted condom use. Sexually transmitted M, Martinez M, Aguirre J. HIV prevention pathogens in patients presenting to a diseases. 2002; 29(1):38-43. messages targeting young latino Casablanca STD clinic. European Journal 2. UNAIDS. Report on the Global AIDS immigrant MSM. AIDS research and of Epidemiology. 1999; 15(8):711-5. epidemic. 2004, Bangkok, Thailand. treatment. 2014; 2014:1-12. 12. Obermeyer CM. HIV in the Middle East. 8. Drake AL, Wagner A, Richardson B, BMJ. 2006; 333(7573):851-4. 3. Tabrizi G, Vatankhah M, Tabrizi S. 13. Jha UM, Raj Y, Venkatesh S, Dhingra Study of personality disorders in AIDS John-Stewart G. Incident HIV during pregnancy and postpartum and risk of N, Paranjpe RS, Saggurti N. HIV patients with high risk behaviors. mother-to-child HIV transmission: a epidemic among men who have sex with Scientific Journal of Iranian Blood systematic review and meta-analysis. men in India: national scenario of an Transfusion Organization. 2009; 6(4):292- PLoS medicine. 2014; 11(2):e1001608. unfinished agenda. HIV/AIDS. 2014; 300. 9. Beyera GK, Beyen TK. Epidemiology of 6:159. 14. Gheissari A. Contemporary Iran: 4. Mumtaz G, Hilmi N, McFarland W, exposure to HIV/AIDS risky conditions in economy, society, politics. 2009; Oxford Kaplan RL, Akala FA, Semini I et al. Are healthcare settings: the case of health facilities in Gondar City, North West University Press, 400. HIV epidemics among men who have sex Ethiopia. BMC Public Health. 2014; 15. Rostami MJM, Alimohammadi M. JML_Volume Prevalence of HBS, HCV and HIV in with men emerging in the Middle East and 14(1):1283. North Africa?: a systematic review and 10. Zu Knyphausen F, Scheufele R, individual referred to laboratory of Imam data synthesis. PLoS medicine. 2011; Kücherer C, Jansen K, Somogyi S, Ali hospital of Andimeshk city in 2009. Jentashapir Journal of Health Research. 8(8):e1000444. Dupke S et al. First line treatment 2011; 1(3):297-302. 5. HIV/AIDS JUNPo. Global Report: response in patients with transmitted HIV drug resistance and well defined time 16. Haghshenas MR, Mirmobini SM, UNAIDS Report on the Global AIDS Babamahmodi F. Survey of the role of

193 Journal of Medicine and Life Vol. 8, Special Issue 3, 2015

prevalence of tuberculosis and HIV in S. Transfusion transmitted disease in female prisoners to HIV infection. prisons of sari township in 1998-1999. Rasht blood donors. The Scientific Brazilian Journal of Medical and Journal of Mazandaran University of Journal of Iranian Blood Transfusion Biological Research. 2004; 37(5):771-6. Medical Sciences. 2000; 10(26):33-9. Organization. 2008; 4(5):337-43. 31. Nokhodian Z, Yazdani MR, Yaran M, 17. Nabavizadeh S, Haghbin S. Prevalence 24. Masaeli Z, Jaberi M, Magsudlu M. A Shoaei P, Mirian M, Ataei B et al. of blood transmitted infection in donors of comparison of seroprevalence of blood- Prevalence and risk factors of HIV, Yasuj Blood Transfusion Organization. borne infections among regular, sporadic, syphilis, hepatitis B and C among female Journal of Guilan University of Medical and first-time blood donors in Isfahan. prisoners in Isfahan, Iran. Hepatitis Sciences. 2000; 9(35,36):64-7. 2006. monthly. 2012; 12(7):442. 18. Salehi H, Salehi M, Ardestani MK, 25. Gonzalez M, Règine V, Piccinini V, 32. Mohamed HI, Saad ZM, Abd-Elreheem Khorvash F, Zadeh KM. Comparing the Vulcano F, Giampaolo A, Hassan HJ. EM, Abd-ElGhany WM, Mohamed MS, Blood Safety on the Blood Donors within Residual risk of transfusion‐transmitted Elnaeem EAA et al. Hepatitis C, hepatitis the Religious Ceremonies and Routine human immunodeficiency virus, hepatitis B and HIV infection among Egyptian Conditions. Journal of Isfahan Medical C virus, and hepatitis B virus infections in prisoners: seroprevalence, risk factors School. 2011; 28(122). Italy. Transfusion. 2005; 45(10):1670-5. and related chronic liver diseases. Journal 19. Sharifi M, Borhan Modjabi K, Salmani 26. Zou S, Notari I, Edward P, Stramer SL, of Infection and Public Health. 2013; M, Farhang R, Mostadjeri A, Alipour Wahab F, Musavi F et al. Patterns of 6(3):186-95. Heidary M. Prevalence of antibodies to age‐and sex‐specific prevalence of major 33. Robinson NJ, Mulder DW, Auvert B, hepatitis and AIDS viuses among dentists blood‐borne infections in United States Hayes RJ. Proportion of HIV infections in Qazvin. Iranian Journal of Medical blood donors, 1995 to 2002: American attributable to other sexually transmitted Microbiology. 2008; 2(2):55-61. Red Cross blood donor study. diseases in a rural Ugandan population: 20. Ghafoorian-Broujerdnia M, Transfusion. 2004; 44(11):1640-7. simulation model estimates. International Assarehzadegan M, Zandian Kh. 27. Bagheri P, Faramarzi H, Sabet M. The Journal of Epidemiology. 1997; 26(1):180- Seroprevalence of Hepatitis B, Hepatitis C Survey of Risk Factors in HIV Positive 9. and human immunodeficiency virus (HIV) Patients Covered by Shiraz University of 34. Laga M, Manoka A, Kivuvu M, Malele B, among Thalassemia patients refer to Medical Sciences. Journal of Isfahan Tuliza M, Nzila N et al. Non-ulcerative Ahwaz Shapha Hospital, 1999-2004. Medical School. 2011; 29(157). sexually transmitted diseases as risk Scientific Medical Journal. 2006; 5(2):528- 28. Ghanbarzadeh N, Nadjafi-Semnani M. A factors3_2015_draft for HIV-1 transmission in women: 37. Study of HIV and other sexually results from a cohort study. Aids. 1993; 21. Kasraeian L TjA. The frequency of HIV transmitted infections among female 7(1):95-102. infection in blood donors in Shiraz blood prisoners in Birjand. Journal of Birjand 35. Ghys PD, Diallo MO, Ettiegne-Traore V, transfusion organization from 1998 to University of Medical Sciences. 2006;iss Satten GA, Anoma CK, Maurice C et al. 2002. ZUMS Journal. 2003; 11(42):49-52. 13(3):9-15. Effect of interventions to control sexually 22. Kolivand M, Hashemimehr AS, 29. Keramat F, Eini P, Majzoobi M. transmitted disease on the incidence of Hashemimehr AS, Safari S, Safari S. Seroprevalence of HIV, HBV and HCV in HIV infection in female sex workers. Aids. Assessment of HIV prevalence in blood persons referred to hamadan behavioral 2001; 15(11):1421-31. donors in Kermanshah province, 2005. counseling center, West of Iran. Iranian 36. Moradi F, Nabaei B, Yeganeh B. The Journal of Kermanshah University of Red Crescent Medical Journal. 2011; epidemiology of AIDS in Iran from Medical Sciences. 2011; 14(4). 13(1):42. beginning until now. Tehran University 23. Taheri Azbarmi Z, Sh N, Joukar F, 30. Strazza L, Azevedo R, Carvalho H, Medical Journal. 2000; 58(4):79-88. Jafashad R, Haajikarimian K, Alinezhad Massad E. The vulnerability of Brazilian

8_special

JML_Volume

194 Journal of Medicine and Life Vol. 8, Special Issue 3, 2015, pp.195-198

Old age satisfaction regarding geriatric home services in Erbil city

Sangar MA*, Karem FA*, Alireza NN**, Muaf AK** *Hawler Medical University, Nursing College, Erbil, Kurdistan Region/ Iraq, **Department of Medical Surgical Nursing, School of Nursing and Midwifery, Tehran University of Medical Sciences, International Campus (TUMS-IC), Tehran, Iran

Correspondence to: Muaf Abdulla Karim, BScN, MScN, PhD candidate in Nursing, Department of Medical Surgical Nursing, School of Nursing and Midwifery, Tehran University of Medical Sciences, International Campus (TUMS-IC), Tehran, Iran, Ministry of Health, Kurdistan Region, Erbil/ Iraq, Phone: +9647504497296, +989145214619, E-mail: [email protected], [email protected]

Received: March 14th, 2015 – Accepted: June 18th, 2015

Abstract Background and objectives: Life satisfaction is a vital imaginary situation in the psychosocial study of aging. Life satisfaction is a multi-dimensional issue that depends on many objective and subjective characteristics. In this study, the achievements are based on socio-demographic characteristics and old age satisfaction toward services in Geriatric home. Methods: It is a cross sectional study which had been conducted in Geriatric home service in Erbil city during the period from 27/6/2014 to 4/2/2015. A questionnaire was made including sections for demographic characteristics, satisfaction with living conditions utilizing a face-to-face interview format. 25 males and females of old ages were interviewed. Each interview was used as method of data collection. Results: Twenty-five old aged persons participated in this study in the geriatric home center in3_2015_draft Erbil governorate. The majority of them were males; age group was 52-70 years and single. The average duration of staying was of 1-6 years (68%). Most of them did not have friends outside the geriatric home and could not get in contact with their family. Conclusion: Interventions need to be planned to improve life satisfaction among old people. Appropriate old age policies containing important solutions to the problems of the old people are important to make them feeliss the element of culture.

Keywords: old age, life satisfaction, geriatric home services, Erbil

Introduction countries where it is said to be the beginning of old age [3]. Life satisfaction continues to be an important Most of the developed countries have accepted construct in the psychosocial study of aging. It is one of the chronological age of 65 years as a definition of the subjective conditions of quality of life, which is the “elderly” or older person, but like many westernized most commonly approved and seems to be one of the concepts, this does not adapt well to the situation in facets of victorious aging, both of 8_specialthem being key Africa. While this definition is somewhat arbitrary, it is concepts in aging. many times associated with the age at which one can The economic structure, the erosion of societal begin to receive pension benefits. At the moment, there is values, weakening of social values, and social institutions no United Nations standard numerical criterion, but the such as the joint family were changed according to the UN agreed cutoff is 60+ years to refer to the older urbanization, modernization, and globalization. Research population [4,6]. reports were about life satisfaction, which is strongly Older people who are not able to manage the related to socio-demographic and psychosocial variables daily life by themselves may have a different view of life [2]. satisfaction than those with preserved self-care capacity. Changes in the human body might cause It may well be that the transition from being healthy and difficulty in life. Often, that is why people enter long-term independent of help self-care capacity alters the view of care communities. For some residents, aging was very aspects contributing to the activities of daily living to dangerous or depressing. Others adapted well. The way having to live with a reduced life satisfaction [1]. you work with residents can make them feel better about The modern socio economic system makes old themselves—and can make your work more pleasant [5]. age a serious social problem. Planned and purposeful The ageing process is of course a biological activities, which will constructively engage older persons JML_Volumesituation, which has its own dynamic; largely, it is not according to their capacity, must be organized. Those under the human’s control. However, it is also subject to aged who are suffering from illness need special services the constructions by which each society makes sense of in their old age homes [7,8]. old age. In the developed world, the chronological There is no huge geriatric home service in each duration plays a paramount role. The age of 60 or 65, is city in Kurdistan. There is only one public Geriatric home roughly equivalent to retirement ages in most developed in Erbil. The aim of the study was to identify the socio- Journal of Medicine and Life Vol. 8, Special Issue 3, 2015

demographic characteristics and old age satisfaction Female 3 12.0 toward services in geriatric home in Erbil city. Single 12 48.0 Married 10 40.0 Marital Status Methodology Divorce 1 4.0 Others 2 8.0 A cross-sectional study design was adapted to Illiterate 13 52.0 Level of Education identify the socio demographic characteristics and home Primary 12 48.0 care services satisfaction by older age. The duration was Address City 13 52.0 from September 1, 2014 to June 5, 2015. Half of the old Suburb 12 48.0 Muslim 23 92.0 age persons in the geriatric home center were excluded Religion because most of the disabled were not able to participate Christian 2 8.0 No 19 76.0 in the study. A total sample size of 25 was selected to use Having Children a face-to-face interview format. Yes 6 24.0 No A questionnaire which covered demographic 19 84.0 children characteristics of the older age (gender, age, education, 1-3 1 4.0 religion, having children, children, duration, number of Children friends in the same room, having a friend outside the 4-6 2 8.0 geriatric home, in-touch with family member) was 7-10 3 4.0 designed by the researchers and the second part of the <1Year 2 8.0 questionnaire covered the satisfaction of the home care 1-6Year 17 68.0 7-12Year 4 16.0 services. Duration 13-18 Permission was taken by the manager of the 3_2015_draft1 4.0 geriatric home center, then a verbal consent was taken Year from all the old aged persons who were able to participate >19Year 1 4.0 0-3 10 40.0 in the study before starting the interviews. Number of friends in the same 4-6 11 44.0 An interview was used as a method of data issroom 7-10 4 16.0 collection from both old aged genders. In addition, the Having friend outside of No 18 72.0 study was approved by the ethical committee of the geriatric home Yes 7 28.0 college of nursing in Erbil. Data were analyzed by using In-touch with family member No 16 64.0 the statistical package for social sciences (SPSS, version Yes 9 36.0 19).

Table 2 shows that 64% of participants were Results of the study satisfied, 32% were fairly satisfied and 1% of them were poorly satisfied with the health care services in the home Table 1 shows the majority of the sample, 56% center. With regard to the nutrition program stratification, (n=14), were between age group 52-708_special years old. 76% of them were satisfied, 20% of them were fairly Regarding the sex, most of the participants, 88% (n=22), satisfied and 4% were poorly satisfied. Most of them, were male, in terms of marital status, the majority of the 76%, were satisfied with the room services and 24% of participants, 48% (n=12), were single/ never married, the the participants were fairly satisfied. majority of them, 84% (n=19), did not have children. With With regard to the geriatric home environment, regard to the address, 52%( n=13), were from the city, 56% of them were fairly satisfied, 28% of the elderly regarding the duration of staying in the geriatric home people were poorly satisfied with the environment. centre, 68% (n=17) of them were between 1-6 years. 52% Regarding the availability of having bathing services, 88% (n=13) were the participants who never attended school. of them were satisfied, 12% of the participants were fairly 44% (n=11) of them, of 4-6 years old were living satisfied with all the services and 84% of them were together in same room, 72% (n=18) did not have friends satisfied with the general hygiene services and 60% of the outside the home center and 64% (n=16) did not have elderly people in the geriatric home center were satisfied any contact with their family. with the clothing services. Most of the elderly people, 80%, had a good Table 1. Socio demographic characteristics of the old age relationship with the health workers and the administration JML_Volume n=25 services. Sociodemographic data F % At the same time, 60% of the elderly people 33-51 2 8.0 were fairly satisfied with the general social activity and Age 52-70 14 56.0 entertainment program in the geriatric home center. With 71-89 9 36.0 regard to the safety measure, 48% of them were fairly Sex Male 22 88.0

196 Journal of Medicine and Life Vol. 8, Special Issue 3, 2015

satisfied, 40% of them were poorly satisfied and 12% of needs, 56% of them were fairly satisfied, 36% of the the elderly people were satisfied. participants were poorly satisfied and 8% of the elderly Regarding the stratification from the people were satisfied with the services. transportation for the geriatric home resident for daily

Table 2. Geriatric home services. Satisfaction according to residents: N=25

Items Good Fair Poor MS F % F % F % Health Services 16 64.0 8 32.0 1 4.0 1.40 Nutrition Program 19 76.0 5 20.0 1 4.0 1.28 Room services 19 76.0 6 24.0 0 0.0 1.24 Geriatric home environment 4 16.0 14 56.0 7 28.0 2.12 Bathing 22 88.0 3 12.0 0 0.0 1.12 Hygiene 21 84.0 3 12.0 1 4.0 1.20 Clothing 15 60.0 8 32.0 2 8.0 1.48 Relation with Health workers 20 80.0 4 16.0 1 4.0 1.24 Relationship with administration services 20 80.0 5 20.0 0 0.0 1.20 Social activity/ Entertainment 3 12.0 15 60.0 7 28.0 2.16 Safety measure 3 12.0 12 48.0 10 40.0 2.28 Transportation 2 8.0 14 56.0 9 36.0 2.28 3_2015_draft Discussion to follow them up, they came to that home, the study being in agreement with study of [10,12,14], who Traditionally, in Iraqi Kurdistan, as in many other mentioned thatiss the elderly men came to the geriatric Mediterranean countries, older people in need have often home to see the services and because there was no one lived with other family members, but nowadays the to supervise and follow them up in their life. situation is beginning to change. This includes migration, Some results indicated that the majority of them urbanization, war, changing culture and increasingly were satisfied with most health services such as (Nutrition divergent values between young and old generations, and Program 76%, Room services 76%, Bathing services social and economic deprivation. 88%, Hygiene 84%, Clothing 60%, and Relationship with According to the policy of Geriatric Home Center the administration services 80%) so, these services were in Erbil, the age of elders who attend the home center for good. These results were in agreement with the studies females should be 55 years and above, and males 65 and done by [13,15], who mentioned that services were more above but sometimes, there is some exclusion depending important to satisfy the elderly men and women in the on the situation of the elder. 8_specialGeriatric home. The current study showed that the majority of Other results indicated that there were poor them were between the group age 52-70 years, which services in the geriatric home, such as Geriatric home represented, males, who never got married. This result environment, Social activity/ Entertainment, Safety agreed with the study done in Jordan in which 29.3% of measures, and Transportation services, so, these results the elders in the nursing home were single [8]. were in agreement with the study done by [11,16,17], who Education has an important role in designing the mentioned that poor services, and the quality of food and future of the community. Regarding the elders’ education socialization were an effect on satisfaction among level, most of them, 52%, were illiterate. This result residents in the Geriatric home. agreed with the study which showed that the majority of Providing comfortable and clean bedroom, elders, 25 (35.2%), did not receive any formal education. treating residents with respect, providing sufficient and Illiteracy was 19.7% in women subjects, and 15.5 % in suitable food, having an in-geriatric home specialist men [9]. physician, an adequate number of nurses and having From the city center and Muslim, most of them more recreational activities in the geriatric home are did not have children, nearly 84%, while most of them had important for all the elderly. These actions developed the friends in the same room and outside the home and most need for the geriatric homes to improve their quality of JML_Volumeof them were in touch with family, and the longest service. The engagement in daily activities is important for duration of stay of old adults in the Geriatric home was the residents in the geriatric homes. Other than the usual between 1-6 years, 68%, so, the interpretation of these leisure activities, it is necessary to encourage the public to results is the following: the standard age of old males was visit the geriatric home center. School, university / college 65 years and because most of them did not have children students, and volunteer people can arrange for their

197 Journal of Medicine and Life Vol. 8, Special Issue 3, 2015

members to visit the geriatric home and have some the Geriatric home services including (nutrition, room programs for the elderly. Thus, the community will be services, bathing, hygiene, clothing, and relationship with more aware of the issues related to the support and care staff in the home) while they are not satisfied with some of the elderly. items of services such as environment, social activities, entertainment, safety measures and transportation.

Conclusion Recommendation Encouragement of the Ministry of Work and Interventions need to be planned to improve life Social Affairs to improve services in the Geriatric home satisfaction among old people. Appropriate old age especially regarding environment, social activities, policies containing important solutions to the problems of entertainment, safety measures and transportation the old people are important to make them feel the services as it was concluded in the result of study. element of culture. Most of the elders are satisfied with

References

1. Demers K. Try this: Best practices in 6. Beyaztas F, Kurt G et al. Life 13. Lee. Predictors of adjustment to nursing nursing care to older adults. satisfaction level of elderly people: a field home life of elderly residents:a cross-sect Hearingscreening. Medsurg Nurse. 2004; study in Sivas, Turkey. J Pak Med Assoc. ional survey. Nursing Department. Dong- 13. March 2012; 62,3:221. A University. 2010; 47(8),57-64. 2. Dubey A et al. A Study of Elderly Living 7. King A. Hearing and the elderly: a simple 14. Ozer M. A Study on the Life Sat isfact ion in Old Age Home and Within Family Set- cure. Geriatric Medicine. 2004; 34. of3_2015_draft Elderly Individual Living in Family up in Jammu. Kamla-Raj. Stud Home 8. Naylor M. Delirium and depression often Environment and Nursing Home Ege Com Sci. 2011; 5(2):93-98. overlooked. American Journal of Nursing. University School of Nursing, Department 3. Gorman M, Randel J et al. The ageing 2003; 116. of Public Health Nursing, 2004, Bornova, and development report: poverty, 9. Porter B. Six things I learned when issMom Izmir/ Turkey, 33-36. independence and the world’s older was ill. RN. July 2005; 43-45. 15. Paliwal, Mathur. Life Satisfaction and Its people. 2000, London, Earth Scan 10. Bondevik M, Skogstad A. Loneliness Correlates Among Aging Adults Human Publications Ltd. among the oldest old, a comparison Development, P.G. Department of Home 4. World Health Organization WHO. between residents living in nursing homes Science, 2007. Definition of an older or elderly person. and residents living in the community. 16. Praad, Rani. Older Persons, and Proposed Working Definition of an Older International Journal of Aging and Human Caregiver Burden and Satisfaction in Person in Africa for the MDS Project. Development. 1996; 43,181–197. Rural Family Context, Department of 2015. 11. Bowling A. Measuring Health. A Review Social Work, Andhra University, http://www.who.int/healthinfo/survey/agei of Life Measurement Scales. 1997, Open Visakhapatnam 530003, A.P. Indian ngdefnolder/en/. University Press, Buckingham. Journal of Gerontology. 2007; 21,2:216- 5. Khader. Quality of Life in the Nursing 12. Bowling A, Grundy E. Activities of daily 232 Homes in Jordan: Perspectives of living: changes in functional ability in 17. Wu Tang Y. Psychosocial Factors Residents. Care Management three samples of elderly and very Associated with Acceptance of Old Age Journals 12/ 2011; 12(4):169-82. 8_specialelderlypeople. Age and Ageing. 1997; Home Placement: A Study of Elderly doi: 10.1891/1521-0987.12.4.169. 26,107–114. Chinese in Hong Kong. 2004; 23(4),487- 504,18.

JML_Volume

198 Journal of Medicine and Life Vol. 8, Special Issue 3, 2015, pp.199-207

Effect of evidence-based approach on the customer orientation (Case study: Physicians Health Centers in Isfahan province in 2014)

Esfahani NG*, Maharati Y** *Health vice Chancellery of Isfahan Medical University, Isfahan University of Medical Sciences, Isfahan, Iran, **Faculty of Economic and Administrative Sciences, Ferdowsi University of Mashhad, Mashhad, Iran

Correspondence to: Nosrat Ghadamizadeh Esfahani, Master of Science in Information Technology Management, Health vice Chancellery of Isfahan Medical University, Isfahan University of Medical Sciences, Isfahan, Iran, Isfahan, Iran, Phone: +989131257054, E-mail: [email protected]

Received: March 14th, 2015 – Accepted: June 18th, 2015

Abstract Introduction: The aim of this study was to investigate the evidence-based approach to customer-orientation care physicians in the province, them being the target group. Research method: This is a descriptive-analytical and cross-sectional design, which was performed in 2014. The statistical society in this study comprised 212 doctors in the health centers. The employed physicians selected 200 patients through a simple random sampling. The measurement tool was the researcher made questionnaire whose validity and reliability were confirmed. In this study, the structural equation modeling and partial least square method were used to test the assumptions and fitness model and the structural model was fit as acceptable. 3_2015_draft Findings: The results indicated four cases related to attitude, a behavior which was intended to treat; common sources of evidence were used to retrieve information according to the best evidence and the lack of barriers to the performance of customer orientation approach of evidence-based effects were significant. Two dimensions of the doctor’s knowledge, the lack of barriers, and the finding of the evidence of dimensions regarding the customer orientation approach were basediss on evidence that had no significant effect. Conclusion: The use of evidence-based education not only improved knowledge, attitude, and skills of the doctors, but also enabled them to respond to the needs of clients in making better decisions and providing a higher quality of care, by reducing treatment costs for patients, attracting patients’ satisfaction, and ultimately having a better efficacy for patients and organizations. Keywords: approach based on evidence, customer orientation, knowledge management, medicine based on evidence

Introduction described evidence-based medicine as an integrating clinical expertise with the best clinical evidence from Since the first contact doctors are in health systematic research available to the best possible centers, therefore, patients in public8_special centers are management of foreign patients [5]. Firstly, the need to considered one of the most important groups in providing learn the skills of Evidence-Based Medicine (EBM) is a key role in the use of the evidence-based approach in represented by a very high volume of medical information their daily activities and clinical decision-making [1]. and is rapidly increasing. Secondly, physicians may need Combining the best scientific evidence, needs and values, less time to devote to study. In addition, studies showed the environment, corporate resources, as well as human that the efficiency workshops are common, so they need resources, can provide appropriate evidence-based to learn methods in order to continue education during decisions [2]. The job of the employees’ is the lifetime [6]. involvement and training in providing effective services to the needs of the customer satisfaction [3]. B. Customer orientation: with the competition in the global arena and in this period, the correct use of Theoretical literature research: resources is regarded as one of the most challenging A. Evidence Based practice: Evidence can be elements of management and the relationships between information or facts that show the definition of default or a the employees and customers are regarded as one of the belief that is true, valid, or not valid (Concise Oxford). The organization’s resources. The organizations should try JML_Volumeamount of funds required for the regional evidence is new concepts of modern marketing, which means the art relevant and specific issues should also be. UNFPA is an of finding, keeping and developing customer needs and evidence-based approach that is defined as a “systematic new demands created for customers in order to avoid the effort to provide the best empirical evidence in decision- exercise of power, but also using participation and making for planning, implementation, and monitoring and understanding to manage relationships with customers evaluation program” [4]. David Lawrence Sackett and provide them to ensure their profitability [7].

199 199 Journal of Medicine and Life Vol. 8, Special Issue 3, 2015

Managers should find the time and tools available to their practice, the improvement of their knowledge, skills, and employees to an evidence-based approach in their daily the quality of care should also be considered [12]. activities application. Managers should be able to In a study of Kermanshahi and Parvinian, the structure and culture the evidence-based practice in their nurses’ views on barriers of implementing evidence-based own organization [8]. Customer relationship management care were examined and the results showed that nurses by using information technology and organizational had barriers in implementing the evidence-based care for changes tries to re-engineer processes and turn them into management and included the insufficient number of staff customer-centric processes [9]. and managers’ awareness of the importance of evidence- based care. In the personal-care dimension, the lack of C. The relationship between the evidence-based enough time of nurses to study the research was one of practice and the customer orientation on knowledge the most important barriers [13]. management strategy, total quality management and The results of the study of Salehi and Abedi customer focus have a special place. The purpose of this regarding the implementation of evidence-based strategy is to achieve a superior service that seeks to performance on the nurses showed that in terms of create a culture of customer orientation with the performance in the field of evidence-based nursing, the identification of the needs and expectations of customers majority of the staff working in this area was weak, the and measure their satisfaction to the knowledge, researchers were motivated and the organization attitudes, skills and behaviors that the employees nurture supported this weakness [14]. to achieve its ultimate goal of customer orientation [10]. In a semi-experimental study entitled “The By providing the necessary resources and impact of evidence-based clinical training on the quality of evidence, removing barriers to employment, promoting the patient care and satisfaction”. It was found that the the culture of participation and sharing of staff, staff evidence-based education was used to promote training encourages and motivates doctors to switch to knowledge, skills and enhance3_2015_draft the quality of patient care the use of EBM, to take the appropriate decisions in the [15]. treatment; the same customer satisfaction being the There are a few studies performed on the ultimate goal which can be achieved. Therefore, the main physicians’ knowledgeiss about EBM in the Middle East. In hypothesis of this study was determined: an evidence- 2004, a study of AL Baghil and AL Almaie showed that based approach of the doctors on the effective customer only 40 percent of Saudi Arabia primary health care orientation. physicians have learnt something regarding EBM [16]. In another study conducted in the UK, it was History of research reported that 40% of the general physicians had The results of the study of Heiwe et al. in the information about the search methods based on evidence field of attitudes, knowledge and behavior of health care and 71 percent of the time, they lacked the most professionals, showed that the groups have a positive important factor in the decision of not having to use attitude towards the evidence-based practice in their evidence-based medicine [17]. decision making and clinical practice. The majority of Other studies showed that physicians need a them had the power to analyze and evaluate8_special the existing clear understanding of the terms used in evidence-based medicine. In a study in the field of awareness and the use evidence, guidelines, and instructions that were available. of evidence-based medicine among residents of Shiraz Most of the obstacles regarding their performance University of Medical Sciences conducted by Amini et al., problems were expressed. Finally, the researcher it was shown that residents with positive attitudes toward supported the Chief Executive Officer concerning the medicine based on evidence and the access to Internet factors affecting the evidence-based performance, for clinical decision making, practically did not use evidence-based and outcome performance and evidence-based medicine and were unaware of specific satisfaction of patients and contributed to productivity [11]. websites. The reason may be that they were not trained in In a qualitative study performed in the field of this field [18]. evidence-based understanding of nurses, it was A study of Dalheim et al. on the factors affecting the development of evidence-based practice of working concluded that the evidence from research was used in nurses concluded that the nurses and colleagues’ nursing. Nurses needed to understand the value and experience was used in evidence-based practice. importance of the research and the application of its However, because of the obstacles, evidence from JML_Volumeresults was difficult, the addition to the emphasis on the research was rarely used. The most important obstacles concept of evidence-based care being suggested, as well in Evidence-Based Practice lacked time and skills to as the production of methods, recovery and the evaluation search, records management, research, nursing age, and of research evidence in nursing education programs. a number of years as far as the working nurses were Incentive policies for nurses with evidence-based concerned [19].

200 200 Journal of Medicine and Life Vol. 8, Special Issue 3, 2015

In a study of MacDermid and Graham on a group In a study of Morris and Maynard in the field of of practicing midwifery profession after a period of training evidence-based care in midwifery, it was proved that the in EBP, it was found that participants in the study were overall objective was the one of empowering the extremely excited regarding the EBP, at the same time evidence-based care in identifying and understanding the believing that this approach enhanced the critical thinking needs of patients, clients, and midwifery practitioners, in skills, increased confidence and a better care of the decision-making and the application of scientific findings patients [20]. in the final midwifery care [21].

Table 1. Benefits of using evidence-based practice based on qualitative and quantitative results of studies from 2000 to 2010 Evidence-Based practice Benefits Row Improving the quality of services and health care and finding the need [4-22] 1 Increasing public participation and teamwork and brainstorming skills among staff [3-25] 2 In response to the client’s decision-making skills and power to serve the needs of clients and evidence into the best 3 performance [3-22] Reduce the gap between theory courses passed in the university and practical work [23] 4 Increase the power of critical thinking and problem-solving skills and services (knowledge, skills and performance) [3-22] 5

Reduce the cost of treatment, reduce the length of hospital stay (time management) [4,26] 6 Increased patient satisfaction regarding the care [24] 7 Increased sense of confidence and flexibility in staff [25,27] 8 Increase accountability of employees [22,24,26] 3_2015_draft 9 Increase learning skills, use of information technology, especially the use of the Internet [22,28] 10 Skills increase training and transfer of scientific information to clients [23] 11

According to rows 1,3,6,7 and 11 in Table 1, it Conceptual researchiss model: can be said that in previous investigations, the relationship between evidence-based and customer- oriented approach was proven, but none of them specifically investigated the relationship between these two variables. Therefore, we considered the causal relationship between the two variables in this study.

Research hypotheses

Hypothesis 1: Attitudes of physicians8_special in the field of evidence-based approach, which have a significant positive effect on customer satisfaction. Hypothesis 2: The behavior of physicians based on evidence-based approach, which has a significant positive effect on customer satisfaction. Hypothesis 3: The lack of barriers in investigating and finding evidence of a significant positive effect on Fig. 1 Effect of an evidence-based approach to customer satisfaction. customer service (Case study: medical health centers Hypothesis 4: Getting familiar with the evidence-based in Isfahan) approach to customer focus and a significant positive effect. Research method Hypothesis 5: Lack of barriers in the performance of the In terms of nature and purpose, the present JML_Volumebest evidence of a significant positive effect on customer study is functional and in terms of method of data satisfaction. collection, it represents a descriptive survey of the Hypothesis 6: Sources of evidence commonly used to relationship between the causal variables. Doctors retrieve customer information have a significant positive working in the health centers of the province 1 and 2 effect. represented the statistical society studied in this research. The sample was random, the sampling method giving the 201 201 Journal of Medicine and Life Vol. 8, Special Issue 3, 2015

minimum requirements for 200 physicians working in behavior of physicians on evidence-based practice (5 health centers 1 and 2 of Isfahan province. 200 items), lack of barriers regarding the performance based questionnaires were distributed between respondents and on the best evidence (4 items), knowledge (4 items), lack the same 200 questionnaires were suitable for analysis, of barriers regarding investigation and evidence (5 identifying a numerous statistical analysis and evidence- questions), sources of evidence common for data based practice to measure the customer satisfaction recovery (4 items). The third part of the questionnaire was questionnaire prepared. The first part of the questionnaire related to customer questions (3 items) [1-30]. included demographic characteristics and the second part In Table 2, the number of measures designed to evidence-based practice, which consisted of 30 measure variables, Cronbach’s alpha coefficient, and questions. The evidence-based practice consisted of six reliability of combined variables were presented. levels, attitudes and behavioral intention (5 items),

Table 2. Cronbach’s alpha coefficient and reliability of combined research variables Reliability Cronbach alpha code Variable 0.909 0.875 ATI Attitude toward evidence-based practice 0.785 0.676 BHV Behavioral intention and behavior 0.799 0.663 EVI No obstacles regarding the investigation and evidence 0.821 0.736 KNO Introduction to Evidence-Based Practice 0.818 0.717 PER No barriers related to change based on the best evidence 0.761 0.616 RES Evidence sources commonly used for data recovery 0.713 0.604 CUS Customer Orientation

As it could be observed from all the variables in this study, Cronbach’s alpha3_2015_draft coefficient was of at least 0.6, 0.65, remarkably higher. To assess the validity (convergent), the exploratory factor analysis was used for factor analysis, index KMO, Bartlett test, and convergent validity [4-32].

Table 3. Number of measures designed to assess the validity of each variable iss Sampling Approximate Freedom Bartlet Factorial criteria Items Name of variable χ2 value degree significance loading KMO 0.674 ATI1 0.634 ATI2 Attitude toward evidence- 0.837 545.506 15 0.000 0.784 ATI3 based practice 0.692 ATI4 0.520 ATI5 0.3 BHV1 0.350 BHV2 Behavioral intention and 0.676 212.308 15 0.000 0.579 BHV4 behavior 8_special0.454 BHV5 0.408 BHV6 0.662 PER1 0.661 PER2 Lack of barrier relates to 0.613 210.630 6 0.000 change based on the best 0.482 PER3 evidence 0.377 PER4 0.375 KNO1 0.597 KNO2 0.602 KNO3 0.678 KNO4 Introduction to Evidence 0.664 210.226 6 0.000 0.330 EVI2 Based Practice 0.425 EVI3 0.506 EVI4 JML_Volume 0.353 EVI5 0.464 EVI6 0.481 RES1 0.426 RES2 Evidence sources commonly 0.609 264.172 28 0.000 0.456 RES4 used for data recovery 0.335 RES5

202 202 Journal of Medicine and Life Vol. 8, Special Issue 3, 2015

Sampling Approximate Freedom Bartlet Factorial criteria Items Name of variable χ2 value degree significance loading KMO 0.373 CUS1 0.553 21.386 3 0.000 0.581 CUS2 Customer Orientation 0.421 CUS3

Bartlett and KMO test results showed that the (credit) converge in the PLS model, the mean-variance index values were desirable. KMO standard variable rate extracted (AVE) was used. As it can be seen in Table 4 of more than 0.5 and less than 0.05 for the CLS was also below, all the average variance extracted was of more determined by Bartlett test. Items that amounted less than than 0.5, therefore, an appropriate model of convergent 0.03 and which were not compatible with other items were validity was highlighted [33-35]. excluded from the analysis. To check the validity of the

Table 4. Convergent validity of the constructs of research variables

validity RES PER KNO EVI CUS BHV ATI Convergent validity

0.654 0.637 0.548 0.502 0.557 0.532 0.667 (AVE) Average of extracted variance

To assess the reliability of each of the markers in the latent variable PLS3_2015_draft model, the load factor of each indicator was determined. The value of each hidden variable load factor markers had to be greater than or equal to 3.0.

Table 5. The value of latent variables load factor markers iss Variable P values CUS RES PER KNO EVI BHV ATI Row marker <0.05 0.840 ATI1 1 <0.05 0.797 ATI2 2 <0.05 0.904 ATI3 3 <0.05 0.824 ATI4 4 <0.05 0.707 ATI5 5 <0.05 0.477 BHV1 6 <0.005 0.543 BHV2 7 <0.005 0.844 BHV4 8 <0.005 8_special 0.693 BHV5 9 <0.005 0.666 BHV6 10 <0.05 0.625 EVI2 11 <0.05 0.796 EVI3 12 <0.05 0.775 EVI4 13 <0.05 0.620 EVI6 14 <0.05 0.752 KNO1 15 <0.05 0.854 KNO2 16 <0.05 0.622 KNO3 17 <0.05 0.684 KNO4 18 <0.05 0.882 PER1 19 <0.05 0.818 PER2 20 <0.05 0.610 PER3 21 <0.05 0.576 PER4 22 <0.05 0.774 RES1 23 <0.05 0.6 RES2 24 JML_Volume<0.05 0.801 RES4 25 <0.05 0.465 RES5 26 <0.05 0.555 CUS1 27 <0.05 0.758 CUS2 28 <0.05 0.697 CUS3 29

20 3 203 Journal of Medicine and Life Vol. 8, Special Issue 3, 2015

As it could be seen in the above table, all the relationship between two variables was based on the best measures related to the latent variable that housed more evidence and the lack of barriers to changing customer than 40%, were marked as shaded. Therefore, the model orientation, being of 0.496 (Fig. 2). could measure latent variables that were indicators of Given the probability (p-value), it had a less reliability in the field. All the amounts of the indicators significant level of 0.05. In fact, a significant number was were likely to be less than 0.05 and the validity of out of range (1.96, -1.96) (Fig. 3). It can be concluded research tools were appropriate. that the path coefficients were significant, having errors of 0.05; meaning a lack of barriers in investigating and Findings finding evidence of a significant impact on customer 100 respondents in the Health Center of Isfahan orientation. In connection with the sixth research city [1] and 100 [2] of the city health center were hypothesis, the path coefficient for the relationship employed (95 males and 105 females). 193 respondents’ between two variables common sources of evidence used education level was Ph.D. and 7 were experts. Regarding to retrieve customer orientation information, was 0.016 the position, the organization was responsible for 63 [2]. health centers, 120 health care centers and 17 family Given the probability (p-value), it had a physicians. Fig. 2 showed the relationship between the 2 significant level of more than 0.05. In fact, a significant variables, the path coefficient of performance evidence- number was out of range (1.96, -1.96) (Fig. 3). It can be based approach and customer of 0.303 respectively. concluded that the path coefficients were significant; Given the probability (p-value), it had a less having errors of 0.05, meaning that the most common significant level of 0.05. In fact, a significant number was sources of evidence used to retrieve customer orientation out of range (1.96, -1.96) (Fig. 3). It can be concluded data had a significant influence. that the path coefficients were significant, at a significant level of 0.05, meaning that the approach of evidence- 3_2015_draft based practice had a significant impact on customer satisfaction. With respect to the second hypothesis of the study, the coefficient of correlation between the two iss variables of tracking customer behavior and behavioral intention was calculated to be of 0.510 (Fig. 1). Given the probability (p-value), it had a less significant level of 0.05. In fact, a significant number was out of range (1.96, -1.96) (Fig. 3). It can be concluded that the path coefficients were significant, at a significant level of 0.05, meaning that the purpose and behavior of the customer impact were significant. In connection with the third hypothesis study, the coefficient of correlation Fig. 2 The research model in the standard estimate was calculated between the two variables, no obstacles being encountered on the path of finding evidence and customer orientation and being of -0.0678_special (Fig. 2). Given the probability (p-value), it had a significant level of more than 0.05. In fact, a significant number was in the range (1.96, -1.96) (Fig. 3). It can be concluded that this was not a significant factor (0.05) path error, meaning the lack of barriers regarding investigation and finding no evidence of a significant impact on customer orientation. In connection with the fourth research hypothesis, the path coefficient was calculated for the relationship between two variables Introduction to Evidence Based Practice and customer orientation and its value was -0.072 (Fig. 2). Fig. 3 The research model in significant mode parameters Given the probability (p-value), it had a significant level of more than 0.05. In fact, a significant number was in the range (1.96, -1.96) (Fig. 2). It can be JML_Volumeconcluded that this was not a significant factor (0.05) path Assessment of the indices model fitting at a significant level; meaning that the familiarity with the To check the quality or reliability of the model, practice of evidence-based customer orientation did not which included a credit check share index and index have a significant effect. In connection with the fifth credit check, redundancy was used. In Table 8, the research hypothesis, the path coefficient for the values of each of the indicators of the independent

204 204 Journal of Medicine and Life Vol. 8, Special Issue 3, 2015

variables were affiliated mediators. As it can be seen, the findings of this study. In terms of performance, the indicators were positive and higher than zero. majority of staff in the field of evidence-based nursing was weak, the research staff was motivated, and the Table 7. Share indices (CV Com) and redundant index (CV organization supported this weakness [14]. Red) Unlike the model that predicted a causal CV Red CV Com Variable relationship, there was no research that examined the 0.504 0.504 Attitude toward evidence-based practice related barriers and found no evidence of measures 0.174 0.174 Behavioral intention and behavior rejected by the customer orientation. With regard to the No obstacles to the investigation and 0.185 0.185 measures used in this section, such as having enough evidence time to find the evidence needed to have the confidence, 0.247 0.247 Introduction to Evidence Based Practice having the necessary skills in the field of evidence-based No barriers related to change based on 0.265 0.265 the best evidence practice, facilities, proficiency in English, it could be Evidence sources commonly used for concluded that the existence of these barriers would be 0.135 0.135 data recovery the best evidence that doctors can access. A large 0.376 0.035 Customer orientation number of respondents and lack of time was the most important factor in the decision of not using evidence- based medicine. In 2004, Hanson and colleagues noted Discussion and Conclusion that only 1.9 percent of the physicians and other doctors use specific methods to find the evidence they need to According to the results of the study, a learn to evaluate the evidence [36]. hypothesis of a causal relationship between the attitudes The previous researches noted other similar of the physicians on evidence-based practice was obstacles such as lack of time, lack of skills to search, the accepted by the customer orientation. The study results age of employees, level3_2015_draft of experience, lack of a showed that physicians have a positive attitude towards systematic training, their motivation and lack of an evidence-based practice and believe in the physicians’ organizational support personnel [11,13,17,19]. submission of evidence-based practice in high-quality Unlikeiss the model, a causal relationship between services to provide better and faster health services, practitioners in the field of evidence-based practice and giving the best response to the needs of the recipients of customer orientation was observed and the fourth health care services and satisfaction customer orientation hypothesis was rejected. The study results also showed impact that made up the health care system. The results that the awareness of target groups used the low of the previous research also indirectly suggested that this knowledge of employees in different job categories in this approach was based on evidence-based practice to have area [2,8-16]. an impact on the customer orientation [11,18]. It can be concluded that physicians studied the According to the second hypothesis regarding need for spending programs and training courses based the impact of behavioral intention, the behavior based on on approach evidences, the importance of the work and evidence-based practice to customer orientation was being familiar with the advantages of using evidence- evident, the physicians were studied, and the behaviors based approach. Therefore, it was recommended through were associated with evidence-based practice8_special in order to workshops and educational meetings and the creation of give the best answer to the clients. These behaviors an interaction with the care centers based on evidence included problem-solving skills, filling gaps in professional and past experience with regard to the facilities given to performance by using the best evidence, using guidelines this important issue. According to the findings of the fifth and instructions in response to the client needs and skills research hypothesis, the absence of barriers in the of the professional practice due to new evidence. As a performance of the best evidence was accepted by the result, the number of previous researches also indirectly customer. According to the results and outcome of Heiwe referred to the issue of the treatment based on evidence- et al. study, it can be stated that despite some obstacles, based practice which affected the customer orientation such as the lack of time, the approach based on evidence [11,15]. in the clinical practice, the conclusion that the best Amini and colleagues research results were evidence will be able to take better decisions and provide different from the findings of the current study, and, the a better quality of care was reached [11]. researchers concluded that the residents in the study had The sixth hypothesis, regarding the existence of a positive attitude towards evidence-based medicine and a positive relationship between the sources of evidence the access to the Internet for clinical decision making, commonly used to retrieve the information on the JML_Volumepractically of evidence-based medicine, and, they did not customer, was accepted. The provision of the evidence use it because they did not consider a systematic training resources needed such as manuals and instructions for in this field [18]. access to the Internet, studying the data, training courses The results of the study of Salehi and colleagues and intelligence information from colleagues shared a regarding the implementation of evidence-based very important role in the use of evidence-based performance on the nurses, were different from the 2 05 205 Journal of Medicine and Life Vol. 8, Special Issue 3, 2015

approach in the study group. The organization will provide would facilitate a greater efficiency and ultimately improve the conditions and resources so that employees are the organization and attract customers and clients. As directed towards the use of this approach. physicians base their actions on the scientific evidence in The results of this study showed that there is a the health area, they will be able to make better decisions significant causal relationship between the dimensions and provide a higher quality of care, so as to reduce the such as “attitude”, “intent to conduct and behavior”, “lack cost of treatment, patients gaining the satisfaction and the of barriers to change based on the best evidence”, “the effectiveness of the organization. The results of this current evidence sources used for information retrieval”, research showed that physicians make an evidence- and the evidence-based approach to “customer” in the based, customer-focused approach of the organization. group. However, there was no significant causal relationship between the 2 dimensions, “lack of barriers Recommendations and finding the evidence” and “Introduction to Evidence In the end, it was suggested that similar studies Based Practice”, the evidence-based approach to in different working groups in the health care system, “customer orientation” in the group of physicians studied. were appropriate and compatible with the circumstances By providing the necessary training so that the staff could in our country, the development of care being based on provide the facilities to encourage and motivate the staff, the achieved evidence-based practice. the use of evidence-based approach could be used and it

References

3_2015_draft 1. Sadeghi M, Khanjani N, Motamedi F. Philadelphia: F. A. Davis Company. method clinical education on patients Knowledge, Attitude and Application of http://www.fadavis.com. care quality and their satisfaction. Evidence-Based Medicine (EBM) 9. Injazz JCH, Popovich K. Journal Iranian Quarterly of Education among Residents of Kerman Medical Understanding customer relationshipiss Strategies. 2012; 4(4):189-93. Sciences University. Iranian Journal of management (CRM): People, process 16. ALBaghil N, ALAlmaie SM. Physician Epidemiology. 2011; 7(3):20-6. and technology. Business Process attitude towards evidence-based 2. Brownson RC, Baker E, Leet TL, Management Journal. 2003; 9(5):672– medicine in eastern Saudi Arabia. Ann Gillespie KN, True WR. Evidence- 88. Saudi Med. 2004; 24:425-8. Based Public Health. 2rd ed., New York, 10. Bahrami S, Rajaee Pour S, 17. Szatmari P. The art of evidence-based Oxford University Press, http:// Yarmohammadian MH. Strategic child psychiatry. Evid Based Ment www.oup.com. human resource management (theory, Health. 2003; 6(4):99-100. 3. Chneidre B, White SS, Paul MC. research and practice) of Isfahan 18. Amini M, Sagheb MM, Moghaddami Linking service climate and customer University of Medical Sciences in M, Shayegh S. Evaluation of perceptions of service quality: Test of a collaboration with the Research Center awareness and the use of evidence- causal model. Journal of Applied for Health Management and based medicine among residents of Psychology. 1998; 83:150-63. Economics, 2012. Shiraz University of Medical Sciences. 4. Planning Unit of the United Nations 8_special11. Heiwe S et al. Evidence-based Journal of Medical Education Population Fund, evidence-based practice: attitudes, knowledge and Development Center. 2007; 4(1):5-30. planning guide, translator Dariush lunar, behavior among allied health care 19. Dalheim A, Harthug S, Nilsen RM, Iran: UN Fund. professionals. International Journal for Nortvedt M. Factors influencing the http://iran.unfpa.org/images/photo/EBP_ Quality in Health Care. 2011; development of evidence-based Guidenote_in%20Farsi_-_Final.pdf. 23(2):198–209. practice among nurses: a self-report 5. Glasziou P, Del Mar CH. Evidence- 12. Adib Hajbaghery M. Iranian nurses survey. BMC Health Services based practice workbook. Bridging the perceptions of evidence-based Research. 2012; 12:367. gap between health care research and practice: A qualitative study. Feyz, http://www.biomedcentral.com/1472- practice. 2nd ed., 2010, Australia: Kashan University of Medical Sciences 6963/12/367. Blackwell. & Health Services. 1386; 2(11):44-52. 20. MacDermid JC, Graham ID. http://www.blackwellpublishing.com. 13. Kermanshahi S, Parvinian AM. Knowledge Translation: Putting the 6. Mansourian Y. The talk of the Week # Barriers to Implementation of “Practice” in Evidence-Based Practice. 1: Evidence-based LIS, LIS Iran News Evidence-Based Care: View points of Hand Clinics. 2009; 25(1):125-43. Network (Lizna), 17 November 2009, Nursing Staff Iranian. Journal of 21. Morris J, Maynard V. The feasibility of http://www.lisna.ir/Note. Medical Education. 2012; 12(2):84-92. introducing an evidence-based practice 7. Motamed H. Customer orientation role 14. Salehi SH, Mohmedie Karbalaie A, cycle into a clinical area: An evaluation in the organization, 13 Persian date Abedi HA. A Study of the of process and outcome. Nurse Shahrivar 1388, retrieved 2 Persian Implementation Rate of Evidence- Education in Practice. 2009; 9(3):190- JML_Volumedate Mehr 2013, Based Nursing Cares By Nurses in 98. http://zangtafakkor.persianblog.ir/post/1 State Hospitals in Ahwaz in 2011. 22. Profetto-McGrath J. Critical Thinking 8/. Journal of Evidence-based Care. 2011; and Evidence-Based Practice. Journal 8. Braveman B. Leading and managing 6(3):7-16. of Professional Nursing. 2005; occupational therapy services an 15. Madarshahian F, Hassanabadi M, 21(6):364-71. evidence-based approach. 2006, Khazayi S. Effect of evidence-based

20 6 206 Journal of Medicine and Life Vol. 8, Special Issue 3, 2015

23. Swinglehurst D. Evidence-based 28. Johnson N, List-Ivankovic J, Eboh 32. Nunnally JC. Psychometric Theory. guidelines: The theory and the WO, Ireland J, Adams D, Mowatt E 2nd ed., 1978, New York: McGraw- practice. Evidence-Based Healthcare et al. Research and evidence-based Hill. and Public Health. 2005; 9(4):308-14. practice: Using a blended approach to 33. Lee JN, Kim YG. Effect of partnership 24. Camacho Carr K. Developing an teaching and learning in quality on IS outsourcing success: evidence-based practice protocol: undergraduate nurse education. conceptual framework and empirical implications for midwifery practice. Nurse Education in Practice. 2010; validation. Journal of Management Journal of Midwifery & Women’s 10(1):43-7. Information Systems. 1999; 15(4):29- Health. 2000; 45(6):544-51. 29. Chuang CHH, Liao H. Strategic 61. 25. Carlisle C, Calman L, Ibbotson T. human resource management in 34. Wixom BH, Watson HJ. An empirical Practice-based learning: The role of service context: Taking care of investigation of the factors affecting practice education facilitators in employees and customers. Personnel data warehousing success. MIS supporting mentors. Nurse Education Psychology. 2010; 63(1):153-96. Quarterly. 2001; 25(1):17-41. Today. 2009; 29(7):715-21. 30. Rice K, Hwang J, Abrefa-Gyan T, 35. Fornel C, Lacker D. Evaluating 26. Waters D, Rychetnik L, Crisp J, Powell K. Evidence-Based Practice structural equation models with Barratt A. Views on evidence from Questionnaire: A Confirmatory Factor unobservable variables and nursing and midwifery opinion Analysis in a Social Work Sample. measurement error: Algebra and leaders. Nurse Education Today. Advances in Social Work. 2010; statistic. Journal of Marketing 2009; 29(8):829-34. 11(2):158-73. Research. 1981; 18(3):382-88. 27. Fullerton JT, Thompson JB. 31. Joybari L. A questionnaire: 36. Hanson BP, Bhandari M, Audige L, Examining the evidence for The knowledge and attitude toward Helfet D. The need for education in International Confederation of evidence-based medicine, nursing evidence-based orthopedics: an Midwives’ essential competencies for students from the classroom to the international survey of AO course midwifery practice. Midwifery. 2005; community blog, June 2008, http: participants. Acta Orthop Scand. 21(1):2-13. //jouybari.blogfa.com/post/1211. 2004; 75(3):328-9.

3_2015_draft

iss

8_special

JML_Volume

2 07 207 Journal of Medicine and Life Vol. 8, Special Issue 3, 2015, pp.208-211

Noise pollution effect in flour factory on workers’ hearing in Lamerd City

Mohammadizadeh M*, Ahmadi SH*, Sekhavati E**, Ahani-Jegar K** *Department of Environmental Management, Collogue of Natural Resources, Islamic Azad University, Bandar Abbas Branch, Bandar Abbas, Iran, **Larestan School of Medical Sciences, Larestan, Iran

Correspondence to: Eghbal Sekhavati, PHD candidate in Environmental Engineering, Larestan School of Medical Sciences, Larestan, Iran, New City, Larestan, Fars, Iran, Mobile phone: +989176086008, E-mail: [email protected]

Received: March 14th, 2015 – Accepted: June 18th, 2015

Abstract Introduction: Noise pollution is one of the most important problems in industry that has an effect on the auditory system and other physiological parameters, as well as persons in noise exposure situations. While noise-induced hearing loss is preventable, once acquired, hearing loss is permanent and irreversible. Methodology: In this research, noise in different parts of Flour Factory in Lamerd were measured by the audiometer, which showed that the workers’ exposure was higher than the state standard; therefore, the hearing test (audiometer) was done on the workers and its results were analyzed by using SPSS version 16. 3_2015_draft Findings: Overall, Pearson correlation r = 0.453 was established between work records and the hearing loss among all workers with meaningful level p≤0.05. Furthermore, T-test was used to investigate noise influence on workers involved in noisy halls (average more than 85 db) and mean=26. 71 and standard deviation=11.72 were obtained (p≤0.05), which was higher than 25db (as the normal threshold of hearing). iss Conclusion: The results of audiometry and T-test showed that the noise pollution has an effect on the hearing of people working in noisy halls.

Keywords: air pollution, workers’ exposure, hearing rate, flour factory

Introduction One of the industries in which workers are exposed to noise pollution (noise over-limit) due to the The need for industry in various communities presence of noisy machines, is the flour production has led to constructing different production factories and factory. The existence of mills and huge suction and industries [1]. Environment pollution is 8_speciala secondary and blower machines made a lot of noise and naturally, it unwanted product of different industrial activities that has seems that this noise affects the workers’ hearing. exposed the environment to further danger [2]. Noise The position, control, and reduction in the pollution is one of the most important problems of the exposure time are regarded as necessary measures. industries that influence the auditory system and other Performing proper control methods can hold the noise of physiological parameters of the human’s body, as well as workplace at a standard level [11]. persons in noise exposure situations [3]. This effect and Mac Donald’s consulting engineers group its rate are different based on the individual and investigated the noise pollution in Tehran city in 1977 for environmental characteristics. Important individual the first time, based on which, the noise rate in Tehran characteristics are age, work experience, race, nutrition, city was reported at 55- 85 db [12]. and diseases [4]. In addition, the exposure to noise can Investigating the workers’ hearing status in noisy cause social and psychological problems [5]. While noise- halls of Tehran Azmayesh Factory [13], showed that noise induced hearing loss is preventable, once acquired, the has a significant influence on the workers’ ears, especially hearing loss is permanent and irreversible [6]. About 30 in 4000 Hz frequency; such that only 48.3% of the million workers in the USA are exposed to dangerous workers had a normal hearing. JML_Volumenoise level [7,8] because of which hundreds of million In addition, in a study conducted by Qotbi et al. dollars per year have been estimated for the hearing loss [14,15] on noise exposure rate and permanent noise- due to noise pollution [9]. Statistics of the World Health induced hearing of workers of Shadri spinning factory in Organization estimates 4 million dollars as daily damage Yazd city, the results showed that noise and work records [10]. had a positive relationship with their hearing loss. Journal of Medicine and Life Vol. 8, Special Issue 3, 2015

In a research done on the workers of Taban related to war, to prevent improper research results. loom factory in Yazd city, it was revealed that the hearing Hearing measurement test was performed for 28 workers loss due to NIHL, assuming a constant work record, for a while observing the following conditions: unit increase in the intensity of sound, noise induced - Visiting an in and anti acoustic noise room hearing loss (NIHL) increased by an average of 0.18. - Measuring the hearing rate after rest and before beginning the next work shift - Audiometric test in frequencies 500, 1000, 2000, Methodology 3000, 4000, 6000, 8000 Hz NIHL was calculated for each ear separately and At first, resources producing further noise were for both ears. determined by doing field and library studies about the NIHL for both ears was obtained as it follows [ ]: flour production process in the factory. 4 ( 5) + ( ) Then all parts of the factory were zoned = according to the area and center of each zone, and were 6 NIHL : general𝑁𝑁𝑁𝑁𝑁𝑁𝑁𝑁𝑁𝑁 and permanent∗ 𝑁𝑁𝑁𝑁𝑁𝑁𝑁𝑁𝑁𝑁loss of both ears determined as a station for measuring noise. Next noise 𝑁𝑁𝑁𝑁𝑁𝑁𝑁𝑁𝑁𝑁t NIHL : permanent loss of strong ear (db) intensity of each station was measured and recorded in b NIHL : permanent loss of weak ear (db) network A by using an audiometric device modeled TES- p Statistical analysis was done by using SPSS 1351 which was calibrated by a calibrator device TES- version 16. 1352 and totally 234 areas were measured. The average noise of halls and halls with noise over-limit was characterized. Findings To do the audiometric test, a screening audiometric device marked Pejvak Ava model ASA 84 Among 234 measured3_2015_draft sections, 41.4% (97 was used. stations) were placed in a hazardous zone (more than 85 Personnel were visited three times and before entering db) and 34.1% (80stattions) in a precaution zone (65- 85 the work shift. db), 24.3% (57 stations) in a secure zone (lower than 65 db). All the stationsiss of hazardous zone were placed in both production and sifter halls, since there were noisy machines like mills, suction machines, and air compressors. Since the legal exposure rate to noise was 85 db for 8 work hours according to the Iran technical protection and professional health committee (obtained from American standard ACGIH) and workers of the factory worked for 8 hours every day. Stations in which noise intense rate was of more than 85 db were determined as areas with noise over-limit (having noise pollution). 8_specialAmong 28 people, who have done the hearing test (audiometer), 14 people were exposed to noise over- limit level in two production halls and sifter halls and the rest were exposed to noise over-limit level in other sections. Measuring the results of noise for different units in Nasr-e- Fig. 1 Moment of measuring noise in production hall Lamerd Flour Factory was highlighted in Table 1

according to the normal limit of noise in Iran. Among 29 working persons, an individual was excluded from the study due to having hearing problems

Table 1. Results of noise measuring in different units of Flour Factory in Lamard based on the legal standard of noise in Iran Number of Danger Secure Name of unit Precaution area station area area number percent number percent number percent JML_Volume Production hall 72 66 92 6 8 - - Sifter hall 31 31 100 - - - - Husk hall 72 - - 72 100 - - Administrative unit 14 - - 1 7 13 93 laboratory 6 - - - - 6 100

209 Journal of Medicine and Life Vol. 8, Special Issue 3, 2015

Sentry room 9 - - - - 9 100 Support unit 30 - - 1 3.3 29 96.7 total 234 97 41.4 80 34.1 57 24.3

Table 2. Age, work experience, noise severity, and rate of hearing loss related to noise (NIHL) information regarding the workers of the Flour Factory in Lamard NIHL NIHL exposure to more 85 db than exposure NIHL NIHL

Work experienceWork (years) two ears of havingears two an workers Noise intensity (db) intensity Noise

Right ear ear Right of all workers two ears of ears two all workers Left ear of of ear Left all workers Age (years)

minimum 24 3 56 1.5 0.5 0.9 8.2 maximum 59 21 99.5 48.5 42.53_2015_draft 42.7 42.7 mean 35.8 9.5 82.3 19.3 17.8 17.1 26.5

Standard deviation 7.69 5.4 11.9 14.6iss 13.6 13.5 11.7

To investigate the effect of work record on NIHL, The Pearson correlation coefficient was r=0.646 the regression relation was obtained as it follows, with the between the age and NIHL in workers of production unit significance level p value≤0.05: with a significance level p≤0.05, in whom the average noise was of 85 db for 8 working hours. NIHL= 3.407+ 5.247* work record The Pearson correlation coefficient was r=0.552 between the age and NIHL in workers of production and In studying the relationship between the work sifter units with a significance level p≤0.05 in which the record and NIHL, it was determined that among 5 people average noise was of 85 db for 8 working hours. worked in very noisy units with work records8_special for less than To investigate the noise effect on the working 10 years, 4 persons had a normal hearing and 1 person personnel in noisy halls (average of more than 85 db), t- had a partial loss. It seemed that, the noise effect on that test was used and the mean 26.71 and standard deviation person was more intense than on his coworkers because of 11.72 were obtained (p≤0.05). These figures of his age (49 years old). It is worth mentioning that the represented more than 25 db (minimum average of effect of age on hearing was considered in calculating the people that did not experience any hearing damage) and NIHL. this showed the noise effect on hearing of people working Another point was that, among 9 people working in noisy halls. Also, this average was of 7.08 in other in noisy units (production and sifter halls) with 10 years workers who worked in units with an average noise of less experience and more, 7 people (78%) had a partial than 85 db. hearing loss, 1 person (11%) had a moderate hearing loss and 1 person (11%) had a normal hearing level. During the study, we found that a person with a normal range of Discussion and conclusion hearing used earplug regularly; however, the other The maximum noise rate was in production and workers of these two units did not use earplugs regularly. the sifter halls and other halls were less noisy according In sum, the Pearson correlation r=0.453 was JML_Volume to the distance from these two halls. The audiometric done between the work record and the hearing loss results showed that the average of hearing loss in

among all workers with a significance level p≤0.05. workers of two noisy units was higher than the other units The studies showed that, there was a meaningful and the total average, which indicated the relation correlation between the age of all workers and NIHL. between the increase of environment noise intensity and

Pearson correlation coefficient was r= 0.394 in p≤0.05. reduction of hearing rate. In addition, there was a 210 Journal of Medicine and Life Vol. 8, Special Issue 3, 2015

significant relationship between age and work record of hearing loss [19]. The relation between the hearing people working in the Flour Factory of Lamrard and NIHL; reduction and age and work experience has been proven while the comparison of its results with the other in a study done in Ethiopia [20], but in the study of Fariba researches in this area supported this matter. Researches Asghari et al. [21], no strong relationship was seen done by Mohammad Heydarian Moghaddam [16] showed between the hearing loss and work experience and there that, there was a direct relationship between age, work may be different reasons according to various elements in record, and daily work hours with a reduction in the noise effect. hearing rate. Parviz Poorkhanzadeh [17] also showed that This study is the result of M.A. thesis in Islamic there was a significant relationship between the hearing Azad University of Bandar Abbas. loss and the rise of noise intensity and increase of exposure time, which our research results supported. In a Acknowledgement study by Santana and Ferrite, a positive significant Finally, we deem it necessary to thank the relationship was obtained between age, hearing loss, and manager and workers of Nasr-e-Lamerd Flour Factory occupational exposure to noise [18]. A study of Hong and and the experts of the Health Center in Lamerd for their Kim showed that, there was a meaningful relation cooperation and sincere assistance in doing this study. between the occupational exposure to noise and the

References

1. Nasiri P. Master of Public Health, Third 8. Shirali GA, Zare Sakhvidi MJ. A Spinning Factory Using Task Base Edition, Computerized medicine and framework for determining effectiveness Method(TBM).3_2015_draft Journal of Occupational health Committee, (Ministry of Health, of noise control method using fuzzy Health. 2011; 8(3). cure and Medical Education), 2008, approach. Journal of Jundishapour Health 15. Halvani GH, Zare M, Barkhordari A. The Tehran. Sciences. 2012; 4(4): 59-64. relationship between sound and Hearing 2. Shane M. Planning and Management of 9. National Institute for Occupational Safetyiss loss in Taban-e-Yazd textile workers. Control and reduction of environmental and Health. Criteria for a Recommended Journal of Birjand Medical University. pollutants In Steel Industry To achieve Standard Occupational Noise Exposure 2009; 15(4). Desired safety, health and environment Revised Criteria. 1998, DHHS (NIOSH) 16. Parvizpoor D, Akbarekhanzade F. Study (Case: Steel Kavian Co), Thesis of Master Publication, 98-126. of the hearing loss and environment noise degree, unit of Olum va Tahghighat-e- 10. Motalebi Kashani M, Hanani M. The in metal industry in Workers. Journal of Ahvaz, 2009, Iran. effect of training of work correct Medical Council of Islamic Republic of 3. Tajik R, Ghadami A, Ghamari F. A procedure on the rate workers exposure Iran. 1981; 2(8):93-99. Survey on the Effects Of Noise Pollution with noise at Macaroni manufacture in 17. Hong OS, Kim MJ. Factors associated on the Workers Hearing At The One of Kashan. The first national symposium of With Hearing loss among Workers of the Arak Industries. Journal of Tabib-e- noise, health, and development. Mashhad airline industry in Korea. ORL Head Neck Shargh. 2008; 10(4). Medical University. 2-3 Marc 2003. Nurse. 2001; 19(1):7-13. 4. Golmohammadi R. Noise and Vibration 11. Ghodsi Pour H. Analytical Hierarchy 18. Ferrite S, Sanata V. Joint effects of Engineering, Second Edition, 2003, Process(AHP). Tehran: Amir Kabir smoking, noise exposure and age on Daneshjoo Publication Hamedan, 139, 8_specialUniversity Publication. 2006, 83-85. hearing loss. Occup Med (Lond). 2005; 142. 12. Kiani Sadr M, Nasiri P, Sekhavatjoo 55(1):48-53. 5. Nasiri P, Zare M, Golbabaee F. A MS, Abbaspour M. Assessment of noise 19. Golmohammadi R. Assesment Of noise Survey on the Noise Pollution In Lavan oil pollution in Khorramabad city to Offering Pollution and NIHL in Stonemason zone and Effect Determination of Sound its Control and Reduction Solutions. Workers of Malayer. Journal of Salamate sources limitation On Reduced noise Journal of Ecology. 2011; 35(50):83-96. Kare Iran. 2005; 2(4):29-37. level. Journal of Occupational Health. 13. Safavi Naeeni SA, Fath Ololumi M, 20. Balachew A, Berhane Y. Noise-induced 2007; 4(3,4). Fattahi Bafghi A. A Survey On Hearing hearing loss among textile workers. 6. Mir Mohammadi SJ, Baba Haji Meybodi status of noisy places Workers In Tehran Ethiop J Health Dev. 1999; 13:69-75. F, Noorani F. Survey On Workers Hearing Azmayesh Factory. Journal of Research 21. Asghari F, Fotouhi A, Sharifian SA, threshold In Meybod Tile Company. In Medicine. 2005; 29(3):239-243. Karimi AR. Evaluation of occupational Journal of Yazd Shahid Sadooghi Medical 14. Ghotbi M, Monazzam M, Khanjani N, hearing loss in fire fighters. Journal of University. 2008; 16(1):8-13. Halvani GH, Salmani Nodooshan M, School of Public Health And Institute of 7. Dobie R. Economic Compensation for Jafari Nodooshan R. A Survey On noise Public Health researchers. 2003; 5(2):27- hearing loss. International medicine and exposure and Permanent hearing loss On 36. environmental health. 1995; 10(3):663-8. The Workers Of The Shadris-e-Yazd

JML_Volume

211 Journal of Medicine and Life Vol. 8, Special Issue 3, 2015, pp.212‐217

Population attributable risk of congenital heart defects. Risk factors among newborns in Yazd, Iran

Taheri M*, Dehghani A*, Noorishadkam M**, Tabatabaei SM*** *Faculty of Health, Department of Biostatistics & Epidemiology, Shahid Sadoughi University of Medical Sciences ,Yazd, Iran, **Hospital of Shahid Sadoghi, Department of Neonatal, Research Centre for premature neonate Shahid Sadoughi University of Medical Sciences, Yazd, Iran, ***Faculty of Paramedical Science, Student Research Committee, Shahid Beheshti University of Medical Sciences, Tehran, Iran

Correspondence to: Ali Dehghani, Assistant Professor of Epidemiology, Faculty of Health, Department of Biostatistics & Epidemiology, Research Centre for Premature Neonate, Shahid Sadoughi University of Medical Sciences, Yazd, Iran, Department of Biostatistics & Epidemiology, Research Centre for Premature Neonate, Shahid Sadoughi University of Medical Sciences, Yazd, Iran, Mobile phone: +989133536206, E-mail: [email protected]

Received: March 14th, 2015 – Accepted: June 18th, 2015

Abstract Background: Congenital heart defects are cardiac problems that develop prior to birth and influence the structure and function of the newborns’ heart. Different types of defects can range from mild (e.g. a small hole between the heart chambers) to severe (like a flaw or weakness in a part of the heart). Material & Method: This case-control study was conducted to determine PAR congenital heart defects risk factors among newborns from 2012 to 2013 in Yazd hospitals. The defects were identified through echocardiography and recorded according to the 10th Revision of International Classification of Diseases (ICD10). The total number of patients was 96,3_2015_draft of whom 14 were excluded due to the lack of cooperation or insufficient data. One hundred and sixty five sex and region matched controls selected through random sampling were included in the study, as well. Population Attributable Risk (PAR) was used to evaluate and measure the priorities of the risk factors. Finally, the Levin formula was used to calculate the adjusted population attributable fraction. Result: Adjusted odds ratios were calculated for the risk factors. The results showediss that the highest odds ratio belonged to the maternal history of stillbirth, lack of multivitamin use before pregnancy, maternal obesity, and overweight. The calculation of the adjusted Population Attributable Fraction in risk factors showed that the highest proportion of the causes of congenital heart malformations was associated with overweight and obesity. Conclusion: This study showed several factors that could affect the congenital heart defects. It was observed that although overweight and obesity had a weaker association than the other two factors, they had a higher prevalence and a greater attributable risk.

Keywords: Population Attributable Risk, congenital heart defects, Yazd, Iran

Introduction 8_specialcongenital heart diseases also suffer from physical problems [5,6]. Although a small percentage of the Congenital heart defects are cardiac problems defects are attributed to genetic issues [3,4], there is little that develop prior to birth and influence the structure and evidence that non-genetic factors cause the defects [7], function of the newborns’ heart. Different types of defects and no studies have focused on the factors influencing can range from mild (e.g. Atrial Septal Defect) to severe the disease, that is why prevention of congenital heart (e.g., hypoplastic left heart syndrome) conditions [1]. defects has almost been stopped due to the lack of data Depending on the type and severity of congenital on modifiable factors [7]. However, various studies have heart defects, they can be asymptomatic or symptomatic shown the effect of conditions such as maternal diabetes, discoloration of the nails, lips, tachypnea, respiratory maternal febrile illness, congenital rubella, maternal distress, or poor feeding [1]. epilepsy, folic acid, vitamin A, various drugs, age of the The cause of congenital heart defects in mother, age of the father, parental education level, history newborns is unknown; some of the defects occur due to of stillbirth, maternal obesity, Turner syndrome, oral cleft, genetic or chromosomal changes; they could be caused age at birth, and maternal phenylketonuria. by a combination of genetic defects and other In USA, the disease is the most common birth JML_Volumecardiovascular risk factors such as exposure to defect which claims the lives of about one percent of the environmental factors, maternal nutrition, and maternal live births or 40,000 births each year [2,8,9]. The drug use [1,2]. incidence of some types of congenital heart defects, Congenital heart defects are related to the particularly mild, has grown while the other types have genetic status in 15% of the cases [3,4]. It is well known remained constant, Ventricular Septal Defect being the that almost 20 to 30% of the people who suffer from most common case [10]. A study in 2002 showed that

Journal of Medicine and Life Vol. 8, Special Issue 3, 2015 650,000 out of 1.3 million adults lived with congenital (ICD10). The total number of patients was 96, of whom 14 heart defects. In this estimation, the prevalence at birth were excluded due to the lack of cooperation or and the number of the surviving cases without treatment insufficient data. One hundred and sixty five sex and was used [11]. region matched controls selected through random Eighteen in every 10,000 births in the United sampling were included in the study to compare the risk States suffer from severe cardiac abnormalities [12]. factors. During the years 1999 to 2006, 41,494 deaths were A self-administered checklist approved by reported due to congenital heart defects; nearly half of the experts was used to ensure the validity of the information. deaths occurred before one year of age [13]. More than The data was collected via the records of neonates born one year survival rate in patients with myocardial injury in the hospitals, family health records in urban health has improved over time but its mortality is still high [14]. databases, and contact with the neonates’ parents by The highest rate of death in children under one month old collaborators working in hospitals and health care centers. and approximately 2.40% of the total deaths are due to Demographic characteristics such as sex, and congenital heart defects in the first 27 days of life [15]. congenital problems including cleft lip and cleft palate In 2004, $1.4 billion were spent on congenital were identified according to the clinical presentation of the heart defects and nearly $511 million on the severe forms neonates admitted to the hospitals. in the US, which was about 37% of all hospital costs [16]. Demographic characteristics of the mothers such In 2005, the medical care of a child with congenital heart as age at conception were extracted from family health defects cost about $100,000 with medical insurance; the records and classified according to age classifications in costs being even higher in severe types [17]. Several similar articles (under 18, 18-35, and over 35 years). prevalence rates of this disease have been reported Paternal age at conception was extracted from family worldwide [2,18,19], but the generally accepted estimate health records and classified according to the similar was about 8 in every one thousand live births [20]. The articles (below 40 and above3_2015_draft 40 years). prevalence has increased in time, from 6 cases per BMI was calculated by using the height and 10,000 live births (95% CI, 4-8) during 1930 to 1934 to 9.1 weight based on information that was recorded in the cases per thousand live births after 1995. Since then, this family healthiss records (up to the first two weeks of prevalence did not change until 2011. For this reason, pregnancy) and was calculated and classified according public health costs due to this disease are on the rise [19]. to the international classification (less than 18.5 = Among the continents, Asia has the highest and underweight, 24.9 to 18.5 = normal, 29.9 to 25 = Africa has the lowest incidence with 93 (95% CI, 89-93) overweight, more than 30 = obese) [23]. Family health and 19 cases per 10,000 live births (95% CI, 11-35), records were used to evaluate social factors including respectively [19]. occupation (housewife, employed), education (illiterate There is a significant association between the and elementary, middle school, high school diploma, incidence of the defects and the economic status; the associate degree, or higher), reproductive characteristics highest incidence rates have been reported in high- including stillbirth (yes, no), maternal medical history income countries (8 per thousand live births) (95%CI 7.9- including diabetes according to IGT and OGTT test results 8.1) [21]. People who suffer from this8_special disorder require (yes, no; type 1, type 2, and gestational diabetes), and special expertise and long-term care [22]. multivitamin use during pregnancy (yes, no; before Given the importance of these anomalies and pregnancy, during pregnancy). their effects on the economic and psychological factors Chi-square was used to compare the prevalence and costs of the community, the health system, and the of risk factors between cases and controls. To determine families, and also due to their impact on the one-year whether the examined risk factors had significant effects mortality rate (IMR), which is an important indicator of on congenital heart defects, logistic regression was used. health and community development, and since no study The factors controlling the misrepresentation of all factors has investigated the factors influencing these disorders, were entered into the logistic regression models. we decided to design a study to evaluate the effect of Population Attributable Risk (PAR) is one of the known environmental factors on the disease and calculate most important factors in public health that is closely the contribution of each of these factors. associated with epidemiological evaluations and measures and priority risk factors in the society were calculated. Population Attributable Fraction (PAF) is a Materials and Methods proportion of disease in the population attributed as a risk factor potentially preventable by elimination of exposure This case-control study was conducted to JML_Volume to that factor [ ] and finally to calculate the adjusted determine the population attributable risk of congenital 24 Population Attributable Fraction, Levin formula given heart defects risk factors among newborns during 2012 below being used. and 2013 in Yazd hospitals. The defects were identified through echocardiography and recorded according to the 10th Revision of International Classification of Diseases

213 Journal of Medicine and Life Vol. 8, Special Issue 3, 2015 highest frequency, respectively. Moreover, 10 (12.2%) 1 Pop AR% == patients had oral cleft type (cleft palate, cleft lip or both). 11 Seventeen patients died before one year of age. where OR indicates the odds ratio adjusted for The mean maternal and paternal age at the time all risk factors and Pe represents the associated of conception was 28.71 ± 5.43 and 33.54 ± 5.73 years in prevalence risk factors in the control group. the case group and 26.61 ± 4.76 and 30.73 ± 5.39 years in the control group, respectively. To assess the social factors related to parents of Results newborns with congenital malformations, the following results were obtained: 95.1% of the mothers were Between 2012 and 2013, a total of 21,867 births housewives and the rest were employed, which was occurred, including 96 neonates suffering from congenital almost similar to the occupational status of the mothers in heart malformations with an incidence rate of the control group (91% were housewives and 9% were approximately 4 per 1000 births per year. About 43.9% of employed). Also, 28% of the fathers were workers, 22% the newborns with these anomalies were girls and the were employed, and 50% were self-employed in the case remaining were boys. group; the results were similar in the control group (23% As for registered defects, ventricular septal were workers, 18.8% were employed, and 58.2% were defect (19.5%), patent ductus arteriosus (12%), patent self-employed) (Table 1). ductus arteriosus + atrial septal defect (7.3%) had the

Table 1. Distribution of congenital heart defects according to ICD-10 codes Abnormalities according to ICD-10 code Number Percent Q21 (ventricular septal defect) 3_2015_draft16 19.5 Q21/ Q25.6 (ventricular septal defect/ Stenosis of Pulmonary Artery) 3 3.7 Q21/ Q25 (ventricular septal defect/ Patent Ductus Arteriosus) 3 3.7 Q25 (patent ductus arteriosus) 10 12.2 Q25.1 (Coarctation of Aorta) iss 4 4.9 Q23 (Congenital Stenosis of Aortic Valve) 5 6.1 Q21.1 (Atrial Septal Defect) 9 11 Q24.9 (Congenital malformation of Heart, Unspecified) 5 6.1 Q25.6 (Stenosis of Pulmonary Artery) 4 4.9 Q24.9/ Q21 (patent ductus arteriosus/ atrial septal defect) 3 3.7 Q25/ Q21.1 (patent ductus anteriosus/ Atrial Septal Defect) 6 7.3 Q21.3 (Tetralogy of Fallot) 3 3.7 Q21.1/ Q25 / Q21( Atrial Septal Defect/ patent ductus arteriosus/ ventricular septal defect) 1 1.2 Q21.2/ Q21/ Q25 (Atrioventricular Septal Defect/ Atrial Septal Defect) 1 1.2 Q21/ Q21.1 (Atrial Septal Defect/ patent ductus arteriosus) 2 2.4 Q25/ Q25.1/ Q21.1 (ventricular septal 8_specialdefect/ Coarctation of Aorta/ patent ductus arteriosus) 1 1.2 Q21/ Q22.1 (Atrial Septal Defect/ Congenital Pulmonary Valve Stenosis) 1 1.2 Q21/ Q25/ Q22 (Atrial Septal Defect/ Ventricular Septal Defect/Pulmonary Valve Atresia) 1 1.2 Q24.5 (Malformation of Coronary Vessels) 1 1.2 Q22.1/ Q21.1 (Congenital Pulmonary Valve Stenosis/ Patent ductus arteriosus) 1 1.2 Q25/ Q25.6 (ventricular septal defect/ Stenosis of Pulmonary Artery) 1 1.2 Q21.2/ Q22.4 (Atrioventricular Septal defect/ Congenital Tricuspid Stenosis) 1 1.2 Total 82 100

In the case group, 37.1% of the mothers had a Based on the results of the univariate logistic cesarean section and 62.2% had a normal vaginal regression, the odds ratio of the risk factors was delivery versus 71.5% a normal vaginal delivery and calculated, which showed that the highest proportions 28.5% a caesarean section in the control group. were a history of stillbirth in mothers, maternal obesity, It was reported that 13.4% of the mothers in the lack of multivitamin use before pregnancy, and maternal case group and 8.5% of the mothers in the control group age at conception (Table 2 and 3). JML_Volumeused medications during the pregnancy.

Table 2. Risk factors of congenital heart malformations in the case and control groups N (%) Risk factors Exposure Total (%) Chi square P value Case Control History of stillbirth in No 76 (92.7) 163 (98.8) 239 (96.8) 6.514 0.011

214 Journal of Medicine and Life Vol. 8, Special Issue 3, 2015 women Yes 6 (7.3) 2 (1.2) 8 (3.2) No 74 (90.2) 159 (96.4) 233 (94.3) Maternal Diabetes 3.837 0.05 Yes 8 (9.8) 6 (3.6) 14 (5.7) Taking multivitamins before No 12 (14.6) 6 (3.6) 18 (7.3) 9.806 0.002 pregnancy Yes 70 (85.4) 159 (96.4) 229 (92.7) 18> 3 (3.7) 13 (7.9) 16 (6.5) 18-24.9 28 (34.1) 88 (53.3) 116 (47) Body Mass Index 15.89 0.001 25-29.9 32 (39) 50 (30.3) 84 (30.4) 30< 19 (23.3) 14 (8.5) 31 (12.6) NO 72 (87.8) 160 (97) 232 (93.9) Mother’s age (over 35 years) 8.066 0.005 Yes 10 (12) 5 (3) 15 (6.1) Father’s age (over 40 years) No 73 (89) 159 (96.4) 232 (93.9) 5.173 0.028

Table 3. Crude odds ratio of the risk factors of congenital heart defects Risk Factors Odds Ratio 95% CI P Value History of stillbirth in mother 6.34 1.269-32.620 0.025 Maternal Diabetes 2.865 .960-8.554 0.059 Not taking multivitamins before 4.543 1.639-12.592 0.004 pregnancy Overweight 2.011 1.088-3.719 0.26 Obesity 4.625 1.869-9.569 0.006 Mother’s age at conception (over 35 4.444 1.466-13.472 0.008 years) Father’s age at conception (over 40 3_2015_draft 3.267 1.121-9.520 0.030 years)

Then, the adjusted odds ratios were calculated for risk factors. The results showed that the highest odds ratios belonged to a history of stillbirth in mothers, lack of multivitamin use before isspregnancy, maternal obesity and overweigh. The calculation of adjusted Population Attributable Fraction of the risk factors showed that the highest proportion of the causes of congenital heart malformations was associated with overweight and obesity (Table 4).

Table 4. Adjusted odds ratio and population attributable risk fraction of congenital heart defects Risk Factors Odds Ratio 95% CI P value PAF%* History of stillbirth in mother 7.846 1.242-49.563 0.028 8.5 Maternal Diabetes 1.978 .531-1.649 0.281 - Not Taking multivitamin before 4.381 1.468-13.077 0.008 7.6 pregnancy Overweight 2.091 1.094-3.994 0.026 19.7 Obesity 3.015 1.234-7.365 0.015 24.8 Mother’s age at conception (over 35 8_special 3.084 .822-11.562 0.095 - years) Father’s age at conception (over 40 .061 .13-2.791 0.516 - years)

*Population Attributable Fraction 95%CI 1.1-2.7) reported similar results. These results Discussion suggested that the maternal age was a potential risk In this study, the risk factors reported in other factor for a child with congenital heart defects [7]. studies were assessed and our results were compared In our study, the majority of the mothers were with their findings. Several risk factors were housewives in both cases and controls. A study simultaneously examined and the adjusted population conducted by Lynnk Cary et al. in 2002 showed that the attributable risk index was calculated. majority of the mothers in both cases and controls were The results showed that the mean age of the employed (about 63.3% of the cases and 83.3% of the mothers was higher in the case group than the control controls). Generally, occupation did not seem to be an group. Then, after categorizing the mothers into two important risk factor. JML_Volumegroups, 30 years and younger, significant differences Although the maternal history of stillbirth was were observed between the cases and the controls. assessed in a few studies, it was one of the factors Consistent with these results, other studies, such as a examined in our study and the results indicated a study conducted by Jenitta Reefhuis et al. in 2000 relatively strong association between this risk factor and (OR=1.12, 95%CI 1.03-1.22) [25] and another study the disease (OR=6.43, P=0.025). Moreover, a study performed by Kathy J. Jenkins et al. in 2007 (OR=1.7, conducted by Kathy J. Jenkins et al. in 2007 showed that 215 Journal of Medicine and Life Vol. 8, Special Issue 3, 2015 a history of stillbirth in mothers might be a risk factor for maternal diabetes could result in the birth of a child with subsequent abnormal childbirth (OR=5.61, 95%CI 1.94- heart defects. The reason why this finding was not 16.2) [7]. statistically significant could be the small number of the The next evaluated risk factor was the lack of the subjects (OR=2.86, P=0.059). However, other studies use of multivitamin supplements containing folic acid showed a significant relationship between the cardiac before pregnancy. It was observed that the odds ratio of defects and maternal diabetes. A study conducted in 1992 the lack of multivitamin use before pregnancy had a by Ramos Attroyo showed a relationship between significant relationship with giving birth to a child with congenital heart defects and insulin-dependent diabetes heart defects (OR=4.54, p=0.004). As we sought to (OR=5.5, 95%CI 1.2-24.8), diabetes type 2 (OR=2.9, calculate the adjusted population attributable risk, this 95%CI 1.2-7.2), and gestational diabetes (OR=1.9, 95%CI factor was considered as “lack of use” against mothers 1.1-3.4) in the mothers [31]. who used multivitamin supplements containing folic acid. A survey carried out by Becerra JE et al. in 1990 Several studies assessed the impact of multivitamin use showed diabetes mellitus as a risk factor for heart defects and found that taking multivitamins can be a protective (RR=20.6, 95%CI 2.5-168.5) [32]. factor against the risk of congenital heart defects. For The mean paternal age at the time of conception example, a study conducted in 2009 by Raluca is associated with congenital heart defects; hence, we LonsecuIttu et al. showed that the fortification of assessed this factor and our hypothesis was accepted agricultural products with folic acid significantly reduced (OR=3.267, p=0.030). Consistent with this finding, a study the risk of congenital heart defects (RR=0.94 95%CI 0.90- conducted in 2000 by Bassili et al. showed that paternal 0.97) [26]. age above 40 years was associated with congenital heart The study performed in 2007 by Kathy J. Jenkins defects (OR=2.7, 95%CI 1.5-4.85) [33]. et al. showed that taking folic acid would prevent The above-mentioned results were obtained congenital heart defects (RR=0.42, 95%CI 0.319-0.98) from the crude odds 3_2015_draftratios. After this analysis, all [7]. Another study by Lorenzo D. Botto in 2000 found that variables were entered into the logistic regression model taking multivitamin supplements could help prevent and the adjusted odds ratios were calculated with the congenital heart defects [27]. Enter method.iss Four risk factors from the above-mentioned The reason for not using multivitamin before variables including obesity, overweight, lack of the use of pregnancy in most of the mothers in this study was the multivitamin supplements containing folic acid, and a lack of information on its benefits or unintended history of stillbirth were statistically significant. The results pregnancy. suggested that other factors might exist due to the Overweight and obesity was an important risk confounding factors or the impact that these factors had factor in most non-infectious diseases, and this defect on each other. was not an exception. In the present study, overweight The calculation of the population attributable risk, and obese mothers in the first two weeks of pregnancy which is an indicator of public health closely related with were identified by using the International Classification of epidemiology, indicated that four factors together were BMI, which showed a significant association between responsible for 60.6% of the congenital heart defects in overweight and obesity and birth defects. The intensity of the society. The highest population attributable risk association was calculated for overweight8_special (OR=2.01, belonged to obesity, (24.8%), overweight (19.7%), history P=0.26) and obesity (OR=4.62, P=0.000). Consistent with of stillbirth (8.5%), and lack of the use of multivitamin these results, a meta-analysis conducted in 2009 by supplements containing folic acid (7.6%). Since PAR is Katherine J. Stothard showed that maternal obesity had a associated with the intensity of the relationship between significant relationship with heart defects in children risk factors and the outcomes as well as the prevalence of (OR=1.2, 95%CI 1.09-1.3) [27]. A study conducted in risk factors, it was observed that although overweight and 2002 by Margaret L. Watkins also showed that overweight obesity was associated with a weaker intensity than the (OR=2, 95%CI 1-3.8) and obesity (OR=2,95%CI 1.2-3.1) other two factors, they had a higher prevalence and were the risk factors of heart defects in children [28]. higher attributable risk. Another study conducted in 2002 by Marie I. It should be noted that the attributable risk is a Cedergen confirmed our results; in this study, overweight theoretical concept, mostly used for planning and (OR=1.18, 95%CI 1.09-1.27) and obesity (OR=1.41, prioritizing preventive interventions. In practice, risk 95%CI 1.22-1.64) were identified as risk factors for this factors can never be eliminated in the community. In other disease [29]. words, it is not possible to eliminate the effect of one The findings of a study by Janes L Millls in 2001 factor while the other factors are kept constant. JML_Volumewere in line with these results, as she reported overweight (OR=1.15, 95%CI 1.07-1.23) was a risk factor for congenital heart defects [30]. Conclusions It seemed that diabetes also served as a risk This study showed that several factors could factor for congenital heart defects. Our study showed that affect congenital heart defects. Odds ratio is an indicator

216 Journal of Medicine and Life Vol. 8, Special Issue 3, 2015

that demonstrates the strength of the association between exposure and outcome while the prevalence of risk factor has a significant and positive impact on the PAR. References

1. Congenital Heart Defects: Centers for of heart defects. Pediatrics. 2001; Changing mortality in congenital heart Diseases Control and prevention. 107(3):e32-e. disease. Journal of the American College http://www.cdc.gov/ncbddd/heartdefects/in 11. Congenital Heart Defects: Centers for of Cardiology. 2010; 56(14):1149-57. dex.html. Diseases Control and prevention. 22. Somerville J. Grown-up congenital heart 2. Hoffman JI, Kaplan S. The incidence of http://www.cdc.gov/ncbddd/heartdefects/d disease-medical demands look back, look congenital heart disease. Journal of the ata.html. forward 2000. The Thoracic and American College of Cardiology. 2002; 12. Congenital Heart Defects: Centers for cardiovascular surgeon. 2001; 49(01):21- 39(12):1890-900. Diseases Control and Prevention. 6. 3. Hartman RJ, Rasmussen SA, Botto LD, http://www.cdc.gov/ncbddd/pediatricgeneti 23. World Health Organization: Obesity. 2008. Riehle-Colarusso T, Martin CL, Cragan JD cs/CCHDscreening.html. http://www.who.int/topics/obesity/en/. et al. The contribution of chromosomal 13. . Gilboa SM, Salemi JL, Nembhard WN, 24. Rockhill B, Newman B, Weinberg C. abnormalities to congenital heart defects: Fixler DE, Correa A. Mortality Resulting Use and misuse of population attributable a population-based study. Pediatric From Congenital Heart Disease Among fractions. Am J Public Health. 1998; cardiology. 2011; 32(8):1147-57. Children and Adults in the United States, 88:15l19. 4. Poulsen NG, Boyd HA, Wohlfahrt J, 1999 to 2006. Clinical Perspective. 25. Reefhuis J, Honein MA. Maternal age and Jensen PK, Melbye M. Recurrence of Circulation. 2010; 122(22):2254-63. non chromosomal birth defects, Atlanta— congenital heart defects in families. 14. Oster ME, Lee KA, Honein MA, Riehle- 1968–2000: Teenager or thirty something, Circulation. 2009; 120(4):295-301. Colarusso T, Shin M, Correa A. Temporal who is at risk?. Birth Defects Research 5. Limperopoulos C, Majnemer A, Shevell Trends in Survival Among Infants With Part A: Clinical and Molecular Teratology. MI, Rosenblatt B, Rohlicek C, Critical Congenital Heart Defects. 2004; 70(9):572-9. Tchervenkov C. Neurodevelopmental Pediatrics. 2013; 131(5):e1502-e8. 26. IonescuIttu3_2015_draft R, Marelli AJ, Mackie AS, status of newborns and infants with 15. Congenital Heart Defects: Centers for Pilote L. Prevalence of severe congenital congenital heart defects before and after Diseases Control and prevention. heart disease after folic acid fortification of open heart surgery. The Journal of http://www.cdc.gov/ncbddd/features/heart grain products: time trend analysis in pediatrics. 2000; 137(5):638-45. defects-keyfindings.html. iss Quebec, Canada. BMJ: British Medical 6. Shillingford AJ, Glanzman MM, Ittenbach 16. Rouse B, Azen C. Effect of high maternal Journal. 2009; 338. RF, Clancy RR, Gaynor JW, Wernovsky blood phenylalanine on offspring 27. Botto LD, Mulinare J, Erickson JD. G. Inattention, hyperactivity, and school congenital anomalies and developmental Occurrence of congenital heart defects in performance in a population of school-age outcome at ages 4 and 6 years: the relation to maternal multivitamin use. children with complex congenital heart importance of strict dietary control American Journal of Epidemiology. 2000; disease. Pediatrics. 2008; 121(4):e759- preconception and throughout pregnancy. 151(9):878-84. e67. The Journal of Pediatrics. 2004; 28. Watkins ML et al. Maternal obesity and 7. Jenkins KJ, Correa A, Feinstein JA, Botto 144(2):235-9. risk for birth defects. Pediatrics. 2003; L, Britt AE, Daniels SR et al. Noninherited 17. Mart Hosp Frías M, Frias J, Bermejo E, 111:1152-1158. risk factors and congenital cardiovascular Rodríguez Pinilla E, Prieto L, Frias J. 29. Cedergren MI, Kmi KBA. Maternal obesity defects: current knowledge a scientific Pre gestational maternal body mass index and infant heart defects. Obesity statement from the American Heart predicts an increased risk of congenital research. 2003; 11(9):1065-71. Association Council on Cardiovascular malformations in infants of mothers with 30. Mills JL et al. Maternal obesity and Disease in the Young: endorsed by the 8_specialgestational diabetes. Diabetic Medicine. congenital heart defects: a population- American Academy of Pediatrics. 2005; 22(6):775-81. based study. The American Journal of Circulation. 2007; 115(23):2995-3014. 18. Hoffman J. Incidence of congenital heart Clinical Nutrition. 2010; 91(6):1543-1549. 8. Oster ME, Riehle Colarusso T, Simeone disease: I. Postnatal incidence. Pediatric 31. Ramos-Arroyo MA, Rodriguez Pinilla E, RM, Gurvitz M, Kaltman JR, McConnell M cardiology. 1995; 16(3):103-13. Cordero JF. Maternal diabetes: the risk for et al. Public Health Science Agenda for 19. van der Linde D, Konings EE, Slager MA, specific birth defects. Eur J Epidemiol. Congenital Heart Defects: Report From a Witsenburg M, Helbing WA, Takkenberg 1992; 8:503992;8. Centers for Disease Control and JJ et al. Birth Prevalence of Congenital 32. Becerra JE, Khoury MJ, Cordero JF, Prevention Experts Meeting. Journal of Heart Disease Worldwide. A Systematic Erickson JD. Diabetes mellitus during the American Heart Association. 2013; Review and Meta-Analysis. Journal of the pregnancy and the risks for specific birth 2(5):e000256. American College of Cardiology. 2011; defects: a population-based case-control 9. Reller MD, Strickland MJ, Riehle- 58(21):2241-7. study. Pediatrics. 1990; 85:1–85. Colarusso T, Mahle WT, Correa A. 20. van der Bom T, Zomer AC, Zwinderman 33. Bassili A, Mokhtar S, Dabous N, Zaher S, Prevalence of congenital heart defects in AH, Meijboom FJ, Bouma BJ, Mulder BJ. Mokhtar M, Zaki A. Risk factors for metropolitan Atlanta, 1998-2005. The The changing epidemiology of congenital congenital heart diseases in Alexandria, Journal of Pediatrics. 2008; 153(6):807- heart disease. Nature Reviews Egypt. European Journal of Epidemiology. 13. Cardiology. 2010; 8(1):50-60. 2000; 16(9):805-14. 10. Botto LD, Correa A, Erickson JD. Racial 21. . Khairy P, Ionescu-Ittu R, Mackie AS, JML_Volumeand temporal variations in the prevalence Abrahamowicz M, Pilote L, Marelli AJ.

217 Journal of Medicine and Life Vol. 8, Special Issue 3, 2015, pp.218-225

Exploring the religious and spiritual coping experience of patients with cancer: A qualitative study in the Iranian context

Esmaeili R*, Hesamzadeh A**, Bagheri-Nesami M**, Berger VL*** *Orthopedic Research Center, Nasibeh Faculty of Nursing & Midwifery, Mazandaran University of Medical Sciences, Sari, Iran, **Nasibeh Faculty of Nursing & Midwifery, Mazandaran University of Medical Sciences, Sari, Iran, ***Acute Inpatient Rehabilitation Hospital, Houston, Texas, USA

Correspondence to: Ravanbakhsh Esmaeili, Ph.D., Department of Medical-Surgical Nursing, Faculty of Nursing & Midwifery, Mazandaran University of Medical Sciences, Sari, Iran, Faculty of Nursing & Midwifery, Vesal St., Postal Code: 4816715793, Sari, Iran, Phone: +981133367343, Fax: +981133368915, E-mail: [email protected]

Received: March 14th, 2015 – Accepted: June 18th, 2015

Abstract Background and Aim: Lately, the religious and spiritual (R/ S) aspect of health care has been receiving an increased attention in the scientific literature. The study aims to explore the components of R/ S coping in cancer patients in Iran. Materials and Methods: The design of this study was based on a qualitative research using content analysis. Sixteen patients with different types of cancer participated in the study. Data was generated through in-depth interviews and the content analysis was used to determine themes and sub-themes. 3_2015_draft Results: Three themes emerged from the data analysis: 1) Maintaining/ improving self-esteem, 2) Positive appraisal/ Being optimistic, and 3) Self-sustaining. In the participants’ view, the general theme was found to be the “improving calmness”. Conclusions: Positive R/ S coping strategies were used by the patients and most cancer patients tried to achieve calmness through R/ S coping. The results of the study can be used to plan medical and nursingiss approach towards increasing the quality of R/ S care both in the acute and the long-term settings.

Keywords: spiritual coping, oncology care, cancer patients, religion

Introduction adolescents believe in God while 85–95% of them state that religion is important in their life [8]. There is a growing interest towards the role and Studies examining the religious coping in importance of religion and spirituality in the context of medically ill patients have found that between 34% and health, illness, and healthcare practice [1]. There is a 86% of the patients have reported using their R/ S mounting evidence that R/ S aspects of life8_special are associated cognition and activities in coping with their illness [1]. In with health and wellness. Researchers have attempted to addition, between 50% and 95% of the cancer patients understand the effect of protective resources such as R/ S consider religion and spirituality personally important and beliefs and practices on health behaviors [2]. Spirituality is have experienced spiritual needs [9]. One group, for considered a great experience of harmony in which the whom spirituality is an important aspect requiring a organism functions with the greatest possible perfection deeper understanding consists of the cancer patients [10]. [3]. This represents a holistic human characteristic which Most cancer patients receiving a diagnosis of cancer had is essential for the human health and wellbeing [4]. The an appalling experience [11]. In a qualitative study of term “spiritual” has multiple meanings and applications, cancer patients, it was found that most of the patients had and often the R/ S dimensions are conflated, engendering an experience of personal disturbance, describing a the risk of superficial or doctrinaire approaches to feeling of hopelessness and unclear picture of the disease spirituality [3]. Spirituality represents one’s ability to seek in future [12]. In fact, faced with the ambiguity of the purpose and meaning, to make the connection, and to present and the numerous uncertainties concerning the pursue a transcendental value [5]. Religion is an future, many cancer patients rely on their spiritual beliefs expression of spirituality and can be regarded as the set as a source of strength [3]. Psychological distress occurs JML_Volumeof values, beliefs, and practices that people adapt to meet frequently at the end of life. Therefore, maintenance or spiritual needs [6]. Terms such as religiosity, development of a sense of spiritual well-being might be religiousness, and spirituality are often used considered a crucial aspect of coping with terminal illness interchangeably [7]. The R/ S issues are obviously [13]. Spirituality is associated with human strength to important to adolescents, it is estimated that 95% of the improve coping with pain, stress, and cancer [14]. Journal of Medicine and Life Vol. 8, Special Issue 3, 2015

Religious coping is defined as ‘‘the use of The present research further explains the current cognitive and behavioral techniques, in the face of debate on the placement of the cancer patients’ spiritual stressful life events, that arise out of one’s religion or care through the exploration of spiritual coping spirituality’’ [1]. constructing concepts from the views of these patients in Although physicians and nurses have begun to the Iranian context. consider a person’s spirituality a meaningful and important aspect of holistic care, they often fail to recognize this aspect of their patients’ needs [10]. The Materials and Methods role of spirituality as a process of adjustment and a means of coping is important; it is an important Study Design This qualitative study involves the content component of responsibility for health care providers in analysis method for the ability to offer a systematic coding modern medical rehabilitation [ ]. Despite a demand for 15 and categorize an approach by which exploring a large spiritual care that is present in every health care setting, amount of textual information is possible and the reader is rehabilitation patients often have significant spiritual care provided with a particular view [ ]. From this position, the needs related to their conditions [ ]. The studies on 23 16 researcher is able to make valid inferences from the data spirituality in the nursing literature are obtained from in their context, with the purpose of providing knowledge empiricists who focus on perceptions and practices of and novel insights [ ]. Graneheim and Lundman’s (2004) patients concerning spiritual needs or care [ ]. 24 4 approach was used for analyzing data as it provided a Quantitative studies involving cancer patients and clear insight about the concepts related to qualitative investigating religiousness have yielded mixed results analysis and proposed measures throughout the steps of [ ]. Thune-Boyle and col. (2006), mentioned that the 17 the research [ ]. importance of religious coping with cancer, especially 25 Sample across different cultures remains unclear [ ]. In a 3_2015_draft 1 The sample consisted of 16 patients (11 females qualitative study by Taleghani and colleagues (2006), on and 5 males) who voluntarily participated in the study and coping strategies in Iranian cancer patients, it was found had a diagnosis of cancer. The participants were between that the patients used a religious approach to deal with 27 and 77 yearsiss of age ( ), all patients were cancer and the authors concluded that religious faith Table 1 recruited by purposive sampling from one subspecialty plays a major role facing a diagnosis of cancer [ ]. This 18 hospital, one subspecialty cancer clinic and one cancer finding was congruent with the research performed by patients aid center, affiliated to Mazandaran University of Howard and col. (2007), who showed in their qualitative Medical Sciences, Sari, Iran, during the time interval of meta-synthesis research that cancer patients cope with May to October 2013. cancer through spirituality [ ]. The majority of cancer 19 The inclusion criteria for the patients were: (a) patients receiving palliative care consider themselves diagnosed with cancer, (b) older than 20 years, (c) able to spiritual and religious [ ]. These findings suggest the 20 answer the questions and express their experiences and need for a more detailed investigation into the dimensions (d) willing to participate in the research. During the initial of religious coping in cancer patients. Further research is contact, participants were informed of the nature and required to determine the best ways of identifying spiritual purpose of the study and the potential risks and benefits, needs and providing support to patients8_special in different and after having their verbal consent for participation, the settings and at different stages of the disease [ ]. In their 21 place and time of the interview were arranged. The international survey, Selman and col. (2014) indicated recruited patients were assured that they can withdraw at that there is a worldwide tendency for research in the any time and confidentiality was preserved. domain of spiritual care [22].

Table 1. Demographic characteristics of the study participants Participants Age Time since diagnosis Marital status Gender Type of cancer Education b number (year) (Month) a 1 F 35 Breast 6 Sp BS 2 M 67 Stomach 8 M Diploma 3 F 39 Breast 12 M Diploma 4 M 51 Colon 9 M Diploma 5 M 32 Lymphoma 8 M AA 6 F 58 Leukemia 4 M AA JML_Volume7 F 77 Lymphoma 7 W Diploma 8 F 27 Thyroid 11 M Diploma 9 F 75 Colon 8 W Elementary 10 F 52 Colon 10 M Diploma 11 F 40 Liver 9 M Diploma 12 F 42 Breast 2 M AA 13 M 33 Testis 5 M Diploma 219 Journal of Medicine and Life Vol. 8, Special Issue 3, 2015

14 F 50 Breast 8 M Elementary 15 M 60 Lymphoma 13 M BS 16 F 53 Colon 1 M MS a Marital status: M = married, Sp = separated, W = widow b Education: MS = Master of Science, BS = Bachelor of Science, AD = Associate Degree.

Data collection Results After obtaining the ethical approval of Mazandaran University of Medical Sciences, the The data analysis of all sixteen interviews investigators gained access to the potential participants. evidenced results in the three themes of R/ S coping: (1) At the beginning of each interview, simple questions were Maintaining/ improving self-esteem (2) Positive appraisal/ asked to obtain the participants’ demographic data and to being optimistic (3) Self-sustaining (Table 2). These three prepare the atmosphere for the following questions. An themes were explained separately with evidence of interview guide was developed by the researchers, which examples from the data. All participants were identified by included the following questions: Do you want to tell me numbers, which were assigned in a chronological manner. how you manage your illness, what things have helped you deal with your illness? Follow-up questions were Table 2. Results of interviews content analysis including generated to explore the patients’ experience regarding general theme, themes, sub-themes the R/ S aspects of coping during the in-depth interviews. Most interviews lasted for 40-80 minutes and were audiotaped for a later transcription. Patient recruitment was continued until data saturation. Data Analysis 3_2015_draft The audiotaped recordings were transcribed verbatim. Data analysis commenced after the data were obtained from the initial interviews. Each transcribed interview was read and reread several times to obtain a iss sense of the whole interview and analyzed line-by-line, word by word to determine code units. Similar codes were assigned to the related sub-theme and each sub-theme was allocated to the related themes in order to manifest the content of the text. The general theme was developed to link the underlying meanings in the themes [25]. Trustworthiness The criteria of Lincoln and Guba (1985) were used in this study to ensure trustworthiness. Credibility was established toward variations in the participants’ age, type of cancer, occupation, gender, and8_special education, in order to provide a broad description of the phenomena. Theme 1: Maintaining/ improving self-esteem The researchers had a prolonged engagement with the A cancer patient’s R/ S coping strategy through study fields and the writing field notes contributed to data maintaining or improving self-esteem refers to the quality. Peer checking was conducted by two experts who patients’ attempt to strengthen communication both with verified the coding and categorization process. There self and God. were members who checked nine interview drafts. These Reinforcing communication with self. were returned to the participants to confirm that the Most of the participants spoke of their striving to researchers were presenting their actual perceptions. talk to themselves to gain assurance. Ethical considerations “I told myself never mind, if God doesn’t want, The study was approved by the Research Ethics anything will happen. They (doctors) tell someone that Committee of Mazandaran University of Medical Sciences you’ll live a hundred years, but he won’t be living one day in Sari, Iran. Permission was obtained prior to the and they tell to another one that you’ll live one day, but he enrollment in the study fields. All participants were will be alive a hundred years”. (Participant #6, female, 30 informed about the aims and nature of the research as years old). well as the possibility to withdraw from the study at any “I told myself that all human beings die one day, JML_Volumestage, without being penalized. Consent for participation in the study and audiotape recordings were obtained. All any person might get sick and I got sick too” (Participant the participants were assured that their confidentiality 12, female, 75 years old). would be protected in the study. Reinforcing communication with God

220 Journal of Medicine and Life Vol. 8, Special Issue 3, 2015

All the participants referred to communication religious lament for one month”. (Participant #2, male, 67 with God. Several declared that they talked directly to Him years old). and sought help from God. “You know, praying, reading the Quran and “I really talk to God very much. When I am alone, performing Namaz (a kind of Islamic praying) day and I talk to God in my loneliness, which gives me a lot of night do not get me fed up. I perform my Namaz on time” comfort. Now, I have more communication with God, very (Participant #4, female, 40 years old). much”. (Participant #5, female, 42 years old). Avoiding intrusive thoughts “Telling, ‘my God, my God’, became more Several participants expressed that the religious frequent compared with the past. I talked to my God. Now belief helped them evade irritating feelings and thoughts. I have more attention towards God, maybe three times or “I left myself with God; everything that happens maybe ten times more” (Participant #3, female, 52 years old). would be my fate, everything that God wishes” “I am only paying attention to God. I am asking (Participant #10, female, 77 years old). those who do not believe in God, what do they do on this “Reading the Quran calms me and I felt that God occasion and how can they tolerate this situation?” helped me more. This makes me feel well”. (Participant (Participant #16, female, 53 years old). #8, female, 27 years old). Theme 2: Positive appraisal/ being optimistic “I understood that doctors are only tools. A large number of participants added that they Everything is in the hand of God. I left everything to God”. tried to cope with their disease by means of positive (Participant #9, male, 30 years old). appraisal and being optimistic. They strived to give hope Improving calmness to themselves and interpret the disease positively. Enhancing calmness is the general theme as Giving hope to self. emerged from data analysis. All the participants used their Some of the participants had a dream of remedy own way of spiritual coping strategies to reach a and most of them gave hope to themselves. satisfactory level of calmness.3_2015_draft Trying to reach calmness “That night I said, show me yourself Imam Reza has been mentioned by the participants directly or (a holy person in Islamic history). The same night I dreamt indirectly. Imam Reza who called me ‘go and do your surgery”. “I enjoyiss communicating with God; it is very (Participant #3, female, 52 years old). effective; it had a direct influence on the disease”. “I make my effort as far as I can, on my feet, the (Participant #9, male, 30 years old). rest remains to God, whom He knows”. (Participant #10, “I have always wanted God to make me better, female, 77 years old). Positively reframing the disease to make me well. Reading the Quran helped me forget A few small numbers of participants had a what I have (cancer)”. (Participant #8, female, 27 years positive interpretation of their disease. old). “I say that maybe God has closed a door against “I told God, You gave pain and you provided a me, but he will open hundreds of doors for me”. cure, and then do not delay my cure. In spite of this, I am (Participant #7, female, 27 years old). pleased with his content”. (Participant #12, female, 75 “I said that God offered this disease to me to go years old). to a doctor and have a surgery”. (Participant #15, female, 50 years old). 8_special Theme 3: Self-sustaining Discussion In the opinion of the majority of the participants, performing religious rituals and avoiding intrusive In this study, the participants expressed their thoughts are two instruments to cope with the cancer experience of R/ S coping strategies. The process disease. analysis and the interpretation of their narratives revealed Performing religious rituals that cancer patients believed that they were able to reach All participants mentioned that performing calmness through their religious aspect of spiritual coping religious rituals such as praying, going to the religious that included: Maintaining/ improving self-esteem, Positive ceremony, visiting shrines, reading the Quran and appraisal/ Being optimistic and Self-sustaining. It was religious words, had an alleviating effect for them. Several evident that coping with cancer was a multi-dimensional of these religious rituals were also performed by the process and the results of the present study showed that patients’ family members. spiritual coping was also multi-dimensional and involved “I pray days and nights, everyone prays for me” values, belief, and a variety of activities. (Participant #1, female, 58 years old). The findings revealed that the majority of the JML_Volume“My daughter always prays for me, she said participants tried to cope with their disease through ‘Mum, I pray for you”. (Participant #8, female, 27 years maintaining/ improving self-esteem. Strengthening old). communication with self and with God were two major “I went to Qum and Mashhad (two holy cities in strategies that helped them deal with their disease. Iran with two famous shrines) to visit the shrines. I read a Self-esteem is an important personal resource, strongly associated with the psychological functioning

221 Journal of Medicine and Life Vol. 8, Special Issue 3, 2015

[26]. Evidence suggests that self-esteem is a primary positive philosophical/ spiritual outlook were more likely to indicator of health and illness coping [27]. In cancer have good health habits [33]. This condition can be the patients, self-esteem may buffer the stress they key to long-term cancer adjustment [34]. According Gall’s experience. (2000) research results, religious coping behavior was However, because most studies on cancer found to correlate with various cognitive appraisals of the patients studied self-esteem as an outcome variable, little current cancer situation, and the God facets of is known about the role of self-esteem in patients’ benevolence, challenge, and presence were positively psychological adjustment [26] and coping. Self-esteem related to perceiving the illness as having some gain and plays a central role in the ability of breast cancer survivors importance/ meaning to life. Optimistic coping styles to thrive and continue to live “normal” lives [27]. The included the use of positive thinking, maintaining a opportunity to engage in guided discussions about the positive outlook, and making positive comparisons [35]. current and future impact of cancer in one’s life may Optimism acted as a resource that maintained a positive provide a buffer against the adverse effects associated mood, protecting individuals from the potential negative with the arduous treatment and management of cancer effects of cancer and cancer treatment [36]. Lauver and [28] and this discussion can be done inside the person’s Tak (1995) found that optimism was associated with a mind and with God. In a qualitative study conducted by less delay and anxiety in care seeking and with Rahnama (2012), spirituality from the cancer patients’ expectations of desirable outcomes of care seeking in point of view was defined as the relationship with God, cancer patients [37]. Studies of optimism in cancer including “mentioning God”, as well as an inner patients have shown that it was positively related to relationship with God and the self [29]. In their qualitative emotional well-being [38,39]. Hope was described as an research on breast cancer patients, Lynn Gall and essential element in human life. Having things to hope for Cornblat (2002) found that the majority of participants with was an important coping strategy for terminally ill cancer breast cancer described a relationship with a higher patients [40]. 3_2015_draft entity, usually identified as God, that had an important Aquino and Zago (2007) asserted that their study and active role in their adjustment to cancer and most of participants had the “hope for the second opportunity” and these patients had actively turned to and relied on God for the religious beliefsiss fulfill ed the need for hope in the future support and guidance [30]. Aflakseir and Coleman (2011) [41]. also believe that religious teachings in an Islamic context Rahnama et al. claimed that their study encourage people to trust and turn to God in times of participants mentioned that religious beliefs about the need and for guidance [31]. possibility of improvement by God’s will and miracles Surbone and Baider (2010) believe that were also among the religious resources – fueling their reflecting on spirituality is similar to reflecting on “self- hope of survival [29]. Irving and colleagues (1998) found identity”. In the process of self-development, an in their study that hope is a means of maintaining a accomplished person or persons still in search for their “fighting spirit” for coping with cancer [42]. identity may all ask similar spiritual questions and draw Cognitive reframing (the ability to reinterpret strength from spiritual sources, often kept private and problems as manageable and as sources of opportunity hidden from others. Through spirituality,8_special we connect with rather than a threat) may lead to a more positive mood something located both within and beyond us [3]. In their state [43]. According to Lutgendorf et al. (2002), cancer qualitative research, Thomas and Retsas (1999) showed patients who coped with their disease using positive that cancer patients tried to “create meaning” and reframing reported better functional, emotional, and “discover self” in their experience giving them a sense of physical well-being, and higher overall quality of life [44]. empowerment and confidence [10]. In contrast with this Thornton and Perez (2006) also reported that for cancer positive view towards a relationship with God and self, the survivors, coping by using positive reframing was “spiritual struggle” was described as “the expressions of associated with higher levels of posttraumatic growth. conflict, question, and doubt regarding matters of faith, Concomitantly with the passage of time since cancer God, and religious relationships” which were of three treatment initiation, several patients learnt to reframe the types: interpersonal, intrapersonal, and divine. uncertainty of survivorship into an opportunity for personal Intrapersonal spiritual struggles were characterized by growth [45]. questions and doubts about spiritual beliefs and issues. According to the results of the present study, Finally, divine spiritual struggles included tensions in the nearly all the participants used self-sustaining strategies individual’s relationship with the divine (or God). to cope with their disease. According to a self-sustaining Moreover, spiritual struggles tended to be less common model that was initially introduced for young adults, JML_Volumethan the positive religious coping [32]. adolescent patients adapt to the difficulties of the cancer Based on the findings of this study, positive experience (cognitive discomfort) by initiating certain appraisal/ being optimistic were recognized as spiritual behavioral and cognitive coping strategies (distraction). coping strategies. In agreement with the present study, in The self-sustaining process was defined as a natural the study of Kurtz et al. (1995), cancer patients who had a progression through which adolescents who are

222 Journal of Medicine and Life Vol. 8, Special Issue 3, 2015

experiencing serious health threats move to comfort appeared to be a relatively stable resource for most themselves and to achieve competence in resolving cancer patients that were intricately intertwined in the health threats [46]. Although this phenomenon was first fabric of the way they understood and approached introduced for youngsters with cancer, it seems that more cancer. The relationship with God served a variety of research is needed to clarify the role of this element in functions for these patients, including increasing adults who suffer from cancer. calmness [30]. In their review article, Visser et al. (2010) Similarly to the current study, in a study mentioned that typical R/ S practices such as meditation conducted by Rahnama (2012), the participants described and prayer were found to be associated with decreased that they had done religious activities including “saying blood pressure, increased immune functioning, increased prayers (Namaz)”, “visiting the shrines and holy places”, heart rate variability, and most important in this context, a “mentioning God” [29]. Guz and colleagues (2012), general sense of calmness and relaxation [52]. mentioned in their research findings that cancer patients Patients with cancer in rehabilitation settings engaged in several religious and spiritual activities such require hope and support to help them improve their well- as praying and visiting a tomb [47]. Aquino and Zago being. The R/ S issues seem to be very significant in the (2007), revealed in their research that the cancer patients process of coping for many cancer patients. The emphasized the religious behavior such as collective or participants’ experience in the present study individual pray, praying the rosary, going to church, demonstrated that all of them put stress on the positive talking to the minister [41]. aspects of R/ S coping strategies that helped them cope Re-exposure to cues associated with cancer with their disease. The results of this report appeared to diagnosis and treatment can result in strong aversion be remarkable, as they described positional R/ S responses that include intrusive thoughts, nightmares, components of coping with cancer in patients. and avoidance of reminders of diagnosis and treatment Furthermore, health practitioners, especially rehabilitation [48]. The intrusive thoughts experience has been linked to nurses could assist their3_2015_draft cancer patients cope with their greater psychological distress and poorer quality of life in life-threatening illness through delivering the needed cancer patients both during treatment and during post- conditions and providing suitable environments for using treatment [49]. It was also found that more intrusive those R/ S resourcesiss to deal with their disease. thoughts about death were associated with increased Although this research was done on Muslim symptoms of depression [48]. Lepore and Helgeson Iranian patients with no emphasis on a particular type of (1998) showed that there is a strong negative relation cancer, the results have the potential to be considered a between intrusive thoughts and mental health among source of promise in both research and practice fields and prostate cancer patients who felt socially constrained in it is recommended to do similar studies on a particular talking about cancer compared to patients who felt type of cancer and in other religions and contexts. unconstrained [50]. We found that improving calmness is the main Acknowledgments theme that emerged from our data analysis. The authors would like to acknowledge the Compatible with the present research, the assistance of the Deputy of Research and Technology of research result of Lundberg and Trichorb (2001) showed Mazandaran University of Medical Sciences for funding that the most common feelings of cancer8_special patients of both the research (grant number: 92-14). The genuine genders at first knowledge about their treatment were participation of the patients in the study is also “acceptance and calmness” [51]. According to Lynn Gall appreciated. and Cornblat (2002), the R/ S belief in a higher power

References

3. Surbone A, Baider L. The spiritual 6. Vachon ML. Meaning, spirituality, and 1. Thune-Boyle IC, Stygall JA, Keshtgar dimension of cancer care. Critical wellness in cancer survivors. Seminars in MR et al. Do religious/ spiritual coping Reviews in Oncology/ Hematology. 2010; Oncology Nursing. 2008, Elsevier, 218- strategies affect illness adjustment in 73,228-35. 25. patients with cancer? A systematic review 4. Chiu L. Spiritual resources of Chinese 7. Rew L, Wong YJ. A systematic review of of the literature. Social Science & immigrants with breast cancer in the USA. associations among religiosity/spirituality JML_VolumeMedicine. 2006; 63,151-64. International Journal of Nursing Studies. and adolescent health attitudes and 2. Rew L, Wong YJ. A systematic review of 2001; 38,175-84. behaviors. Journal of Adolescent Health. associations among religiosity/ spirituality 5. Yong J, Kim J, Han SS et al. 2006; 38,433-42. and adolescent health attitudes and Development and validation of a scale 8. Cotton S, Zebracki K, Rosenthal SL et behaviors. Journal of Adolescent Health. assessing spiritual needs for Korean al. Religion/ spirituality and adolescent 2006; 38,433-42. patients with cancer. Journal of palliative health outcomes: a review. Journal of care. 2007; 24,240-6. Adolescent Health. 2006; 38,472-80.

223 Journal of Medicine and Life Vol. 8, Special Issue 3, 2015

9. Balboni TA, Vanderwerker LC, Block 23. Grbich C. Qualitative data analysis: An breast cancer. Brain, behavior, and SD et al. Religiousness and spiritual introduction. 2007, Sage. immunity. 2008; 22,969-81. support among advanced cancer patients 24. Elo S, Kyngäs H. The qualitative content 36. Matthews EE, Cook PF. Relationships and associations with end-of-life treatment analysis process. Journal of Advanced among optimism, well-being, self- preferences and quality of life. Journal of Nursing. 2008; 62,107-15. transcendence, coping, and social support Clinical Oncology. 2007; 25,555-60. 25. Graneheim U, Lundman B. Qualitative in women during treatment for breast 10. Thomas J, Retsas A. Transacting self- content analysis in nursing research: cancer. Psycho-Oncology. 2009; 18,716- preservation: a grounded theory of the concepts, procedures and measures to 26. spiritual dimensions of people with achieve trustworthiness. Nurse Educ. 37. Lauver D, Tak Y. Optimism and Coping terminal cancer. International Journal of Today. 2004; 24:105–112. with A Breast Cancer Symptom. Nursing Nursing Studies. 1999; 36,191-201. 26. Schroevers MJ, Ranchor AV, Research. 1995; 44,202-7. 11. Risberg T, Wist E, Kaasa S et al. Sanderman R. The role of social support 38. Friedman LC, Kalidas M, Elledge R et Spiritual healing among Norwegian and self-esteem in the presence and al. Optimism, social support and hospitalized cancer patients and patients' course of depressive symptoms: a psychosocial functioning among women religious needs and preferences of comparison of cancer patients and with breast cancer. Psycho-Oncology. pastoral services. European Journal of individuals from the general population. 2006; 15,595-603. Cancer. 1996; 32,274-81. Social Science & Medicine. 2003; 57,375- 39. Matthews EE, Cook PF. Relationships 12. Esmaeili R, Ahmadi F, Mohammadi E et 85. among optimism, well-being, self- al. Life Threatening: The Most Important 27. Mustian KM, Katula JA, Gill DL et al. Tai transcendence, coping, and social support Concern of Patients Confronting Cancer Chi Chuan, health-related quality of life in women during treatment for breast Diagnosis. Hayat. 2012; 18,12-22. and self-esteem: a randomized trial with cancer. Psycho-Oncology. 2009; 18,716- 13. McClain CS, Rosenfeld B, Breitbart W. breast cancer survivors. Supportive Care 26. Effect of spiritual well-being on end-of-life in Cancer. 2004; 12,871-6. 40. Clayton JM, Butow PN, Arnold RM et al. despair in terminally-ill cancer patients. 28. Lee V, Robin Cohen S, Edgar L et al. Fostering coping and nurturing hope when The Lancet. 2003; 361,1603-7. Meaning-making intervention during discussing the future with terminally ill 14. Yong J, Kim J, Han S-S et al. breast or colorectal cancer treatment cancer3_2015_draft patients and their caregivers. Development and validation of a scale improves self-esteem, optimism, and self- Cancer. 2005; 103,1965-75. assessing spiritual needs for Korean efficacy. Social Science & Medicine. 41. Aquino VV, Zago MMF. The meaning of patients with cancer. Journal of palliative 2006; 62,3133-45. religious beliefs for a group of cancer care. 2007; 24,240-6. 29. Rahnama M, Khoshknab MF, Maddahiss patients during rehabilitation. Revista 15. Webb JR. Spiritual factors and SSB et al. Iranian cancer patients' latino-americano de enfermagem. 2007; adjustment in medical rehabilitation: perception of spirituality: a qualitative 15,42-7. Understanding forgiveness as a means of content analysis study. BMC Nursing. 42. Irving LM, Snyder CR, Crowson JJJ. coping. Journal of Applied Rehabilitation 2012; 11,19. Hope and Coping with Cancer by College Counseling. 2003; 34,16-24. 30. Lynn Gall T, Cornblat MW. Breast Women. Journal of Personality. 1998; 16. Rieg LS, Mason CH, Preston K. Spiritual cancer survivors give voice: a qualitative 66,195-214. Care: Practical Guidelines for analysis of spiritual factors in long-term 43. Porter L, Clayton M, Belyea M et al. Rehabilitation Nurses. Rehabilitation adjustment. Psycho-Oncology. 2002; Predicting negative mood state and Nursing. 2006; 31,249-56. 11,524-35. personal growth in African American and 17. Zwingmann C, Wirtz M, Muller C et al. 31. Aflakseir A, Coleman PG. Initial white long-term breast cancer survivors. Positive and Negative Religious Coping in development of the Iranian religious Annals of Behavioral Medicine. 2006; German Breast Cancer Patients. Journal coping scale. Journal of Muslim Mental 31,195-204. of Behavioral Medicine. 2006; 29,533-47. 8_specialHealth. 2011; 6,44-61. 44. Lutgendorf SK, Anderson B, Ullrich P 18. Taleghani F, Yekta ZP, Nasrabadi AN. 32. McConnell KM, Pargament KI, Ellison et al. Quality of life and mood in women Coping with breast cancer in newly CG et al. Examining the links between with gynecologic cancer. Cancer. 2002; diagnosed Iranian women. Journal of spiritual struggles and symptoms of 94,131-40. Advanced Nursing. 2006; 54,265-72. psychopathology in a national sample. 45. Thornton AA, Perez MA. Posttraumatic 19. Howard AF, Balneaves LG, Bottorff JL. Journal of Clinical Psychology. 2006; growth in prostate cancer survivors and Ethnocultural women's experiences of 62,1469-84. their partners. Psycho-Oncology. 2006; breast cancer: a qualitative meta-study. 33. Kurtz ME, Wyatt G, Kurtz J. 15,285-96. Cancer Nursing. 2007; 30,E27-E35. Psychological and sexual well-being, 46. Hinds PS. Fostering coping by 20. Delgado-Guay MO, Hui D, Parsons HA philosophical/ spiritual views, and health adolescents with newly diagnosed cancer. et al. Spirituality, Religiosity, and Spiritual habits of long-term cancer survivors. Seminars in Oncology Nursing. 2000; Pain in Advanced Cancer Patients. Health Care for Women International. 16,317-27. Journal of Pain and Symptom 1995; 16,253-62. 47. Guz H, Gursel B, Ozbek N. Religious and Management. 2011; 41,986-94. 34. Lynn Gall T, Cornblat MW. Breast Spiritual Practices Among Patients with 21. Yardley S, Walshe C, Parr A. Improving cancer survivors give voice: a qualitative Cancer. Journal of Religion and Health. training in spiritual care: a qualitative analysis of spiritual factors in long-term 2012; 51,763-73. study exploring patient perceptions of adjustment. Psycho-Oncology. 2002; 48. Devine D, Parker PA, Fouladi RT et al. JML_Volumeprofessional educational requirements. 11,524-35. The association between social support, Palliative Medicine. 2009; 23,601-7. 35. Witek-Janusek L, Albuquerque K, intrusive thoughts, avoidance, and 22. Selman L, Young T, Vermandere M et Chroniak KR et al. Effect of mindfulness- adjustment following an experimental al. Research Priorities in Spiritual Care: based stress reduction on immune cancer treatment. Psycho-Oncology. An International Survey of Palliative Care function, quality of life and coping in 2003; 12,453-62. Researchers and Clinicians. Journal of women newly diagnosed with early-stage 49. Lewis JA, Manne SL, DuHamel KN et al. Pain and Symptom Management. 2016. Social support, intrusive thoughts, and

224 Journal of Medicine and Life Vol. 8, Special Issue 3, 2015

quality of life in breast cancer survivors. Social and Clinical Psychology. 1998; and support. Cancer Nursing. 2001; Journal of Behavioral Medicine. 2001; 17,89-106. 24,469-75. 24,231-45. 51. Lundberg PC, Trichorb K. Thai Buddhist 52. Visser A, Garssen B, Vingerhoets A. 50. Lepore SJ, Helgeson VS. Social Patients With Cancer Undergoing Spirituality and well-being in cancer constraints, intrusive thoughts, and mental Radiation Therapy: feelings, coping, and patients: a review. Psycho-Oncology. health after prostate cancer. Journal of satisfaction with nurse-provided education 2010; 19,565-72.

3_2015_draft

iss

8_special

JML_Volume

225 Journal of Medicine and Life Vol. 8, Special Issue 3, 2015, pp.226-228

Prevalence of Methylenetetrahydrofolate Reductase C677T Polymorphism in women with Polycystic Ovary Syndrome in southeast of Iran

Naghavi A*, Mozdarani H*, Garshasbi M*, Yaghmaei M** *Department of Medical Genetics, Faculty of Medical Sciences, Tarbiat Modares University, Tehran, Iran, **Department of Obstetrics and Gynecology, Faculty of Medical Sciences, Shahid Beheshti University, Tehran, Iran

Correspondence to: Dr. Hossein Mozdarani, PhD, Department of Medical Genetics, Faculty of Medical Sciences, Tarbiat Modares University, P.O. BOX.14115-331, Tehran, Iran, Tehran, Chamran Highway Jalal-eHighway, Al-e-Ahmad, Iran, Phone: +982182883831, +989121374831, Fax: +982188006544, E-mail: [email protected]

Received: March 14th, 2015 – Accepted: June 18th, 2015

Abstract Background: Methylenetetrahydrofolate reductase is an important regulatory enzyme in folate metabolism that is necessary for some biological mechanisms. Mutations in the MTHFR gene could reduce the enzyme activity. Aim: The aim of this study was to assess the prevalence of the most common polymorphism, C677T, in women with polycystic ovary syndrome in the southeast of Iran. 3_2015_draft Methods: This case–control study was performed on 112 PCOS women and 196 healthy controls. Single nucleotide polymorphisms were genotyped by using the polymerase chain reaction–restriction fragment length polymorphism (PCR–RFLP). Results: We found that for C677T, the prevalence of C/ C, C/ T, and T/ T genotypes was 54.5%, 34%, and 11.5%, respectively. The frequency of TT genotype was significantly higher in PCOS women compared to controls.iss Conclusions: the presence of 677T allele could be a risk factor for PCOS susceptibility in the southeast of Iran.

Keywords: Methylenetetrahydrofolate reductase, C677T polymorphism, Polycystic Ovary Syndrome

Introduction rs1801131). Both these polymorphisms could reduce the enzyme activity. The C677T (Ala222Val) polymorphism in Polycystic ovary syndrome (PCOS) is one of the exon 4 causes an Alanine to Valine substitution in the N- most common endocrine disorders affecting 5% to 10% of terminal catalytic domain. This variant results in a the women in reproductive age according to the thermolabile protein with enzymatic activity which is Rotterdam criteria. PCOS is characterized8_special by two of the decreased by 70% in the homozygote state (TT genotype) following abnormalities: hyperandrogenism, and 35% in the heterozygote state (CT genotype) [8,9]. oligomenorrhea or amenorrhea and polycystic ovaries. The A1298C (Glu429Ala) substitution is in the regulatory PCOS is associated with obesity, type 2 diabetes, domain of the MTHFR enzyme and may alter the enzyme metabolic syndrome, heart disease, and endometrial function [10-11]. cancer risk [1,2]. The exact etiology and pathophysiology In the present study, the prevalence of MTHFR of PCOS has not been completely identified. However, C677T polymorphism in PCOS patients in the Southeast there is strong evidence for a genetic base for it [3]. of Iran was analyzed and compared with healthy controls. Several studies were performed on the association between PCOS and genetic factors. There are several reports about the association between MTHFR Materials and methods polymorphisms and PCOS in which their results are Subjects characteristics inconsistent [4-7]. In this case-control study, 308 women including MTHFR is an important regulatory enzyme in 112 patients with polycystic ovarian syndrome and 196 folate metabolism that is necessary for some of the healthy individuals from Obstetrics and Gynecology biological mechanisms. This enzyme catalyzes the JML_Volume Center of Emam-Ali Hospital in Zahedan, Iran, were reduction of 5, 10-methylenetetrahydrofo-late to 5- recruited. This survey was approved by the Ethics methyltetrahydrofolate. The MTHFR gene located on the , Committee of Tarbiat Modares University and the short arm of chromosome 1 (1p36.3), is composed of 11 consensus forms were collected for all the individuals. exons. Two common allelic variants in MTHFR gene are C677T (A222 V, rs1801133) and A1298C (E429A, PCOS was defined according to the Rotterdam criteria. Journal of Medicine and Life Vol. 8, Special Issue 3, 2015

The control group included 196 unrelated age-matched Statistical analysis: all statistical analyses were normal women. All PCOS patients and healthy controls performed with SPSS V-20. Demographic and clinical were nonsmokers. Patients who suffered from diabetes differences between the two groups were examined by mellitus, thyroid disorder, hyperprolactinemia, independent Student’s t-test, Mann Witney u test, or hypertension, Cushing’s syndrome, premature ovarian Fisher exact test whenever appropriate. Allele frequencies failure, acromegaly, virilising, adrenal, or ovarian tumors were estimated by the gene counting method. The odds were excluded from the study. ratio (OR) and 95% confidence intervals (CI) were also

the deviation of Genotype analysis estimated. The χ2 test was used for Blood samples were collected in tubes genotype distribution from Hardy-Weinberg equilibrium. containing disodium-EDTA as anticoagulant and stored at -20˚C until DNA extraction. Genomic DNA was extracted Results by standard kite. The C677T variant of MTHFR was amplified by using a forward primer 5- 308 women including 112 (36.4%) patients with GGTCAGAAGCATATCAGTCATGAG-3 and a reverse polycystic ovarian syndrome and 196 (63.6%) healthy individuals, were recruited. The demographic primer 5 – CTGGGAAGAACTCAGCGAACTCAG - 3 by characteristics of PCOS women and controls were shown the polymerase chain reaction (PCR). PCR conditions in Table 1. The PCOS patients and controls did not differ were denaturation at 95°C for 5 min, 30 cycles at 95°C for significantly with respect to age and ethnicity. The alleles 30s, 62°C for 30s, and 72°C 30s followed by extension at and genotypes frequency of MTHFR C677T 72°C for 7 min. polymorphism are presented in Table 2. No deviation The PCR products (494bp) were digested with from Hardy-Weinberg equilibrium3_2015_draft was observed in the Hinf I in 37°C overnight and electrophoresed on a 2% PCOS women and control group. agarose gel. The two fragments, 100bp and 394bp Table 1. Demographic characteristics of PCOS women and controls showed the homozygosity for the C allele, the three PCOS controls P value fragments, 100bp and 165bp and 229bp showed iss women (n=196) homozygosity for the T allele, and the four fragments, (n=62) 100bp, 165bp, 229bp and 394bp showed heterozygosity for the T allele and the C allele. Genotypes were Age (Years) 25.4 ± 5.2 26.4 ± 5.6 0.2 expressed as CC for homozygous normal, CT for Race, n (%) 0.6 heterozygous, and TT for homozygous mutant. Fars 43(69) 142(72) Balouch 19(31) 54(28)

Table 2. Alleles and genotypes frequency of 8_specialMTHFR C677T polymorphism PCOS women controls P value OR (95% CI) P value * OR (95% CI)* (n=112) (n=196) MTHR (C677T) CC, n (%) 61(54.5) 136(69.4) 1 CT, n (%) 38(34) 51(26) 0.055 1.7 (1–2.8) 0.06 1.7 (1–2.8) TT, n (%) 13(11.5) 9(4.6) 0.01 1.8 (1.1–2.8) 0.02 1.7(1.1-2.7) CT+TT, n (%) 51(45.5) 60(30.6) 0.009 2(1.2-3.1) 0.01 1.9(1.2-3.1) Allele C, n (%) 160(71) 336(82) T, n (%) 64(29) 56(18) <0.0001 2.4(1.6-3.6) - - *Adjusted for age and ethnicity

Although the frequency of the CT genotype of frequency of 677T allele was 29% and 18% in PCOS MTHFR C677T polymorphism was not statistically women and control groups respectively, which was different between PCOS and control women before and statistically different (p<0.0001). Moreover, the overall after adjusting age and ethnicity, the frequency of TT frequency of individuals with 677T allele (CT and TT JML_Volumegenotype was significantly higher in PCOS women genotypes) were significantly higher in the PCOS patients compared to controls before and after adjusting age and compared to controls (45.5 vs. 30.6%,) and the presence ethnicity and risk of PCOS was 1.7 fold higher in women of T allele could be a risk factor for PCOS susceptibility with TT genotype after adjusting age and ethnicity [OR, (OR, 1.9 [95% CI, 1.2 to 3.1]; P = 0.01). 1.7 (95% CI 1.1 to 2.7); P = 0.02]. In addition, the

227 Journal of Medicine and Life Vol. 8, Special Issue 3, 2015 Discussion PCOS susceptibility, and this relevance seemed to be more intense in Europeans than in Asians [16]. In other Different gene polymorphisms have been societies, varying results were found. Our findings were in recognized related with increased susceptibility for PCOS contrast with the results of Kazeruni et al. on the Iranian but due to the ethnic and environmental differences in population. Based on their results, the prevalence of populations, conflicting results have been obtained. Some C677T polymorphism was not found to be significantly authors have hypothesized the association of MTHFR different between the study groups [17]. In a case control variants, such as C677T and A1298C polymorphisms, study, Jain et al. showed that no homozygous mutation with PCOS [12-14]. The present study tried to assess the (TT) was found in the study population. Even if not association of MTHFR C677T polymorphism with PCOS statistically significant, there was a slightly higher in the southeast of Iran. prevalence of heterozygous (CT) genotype in women with 308 women including 112 patients with PCOS [6]. In a study by Karadeniz et al. [15], the MTHFR polycystic ovarian syndrome and 196 healthy individuals 677 CC genotypes had significantly higher proportions in were recruited. The results of the present study revealed the control group compared to the PCOS patients in the that patients with PCOS, had significantly higher Turkish population [18]. In another study by Choe et al. frequencies of TT in comparison with the healthy among the Korean population, the C677T polymorphism individuals. In a similar observation by Qi Q et al., a of MTHFR gene was not associated with PCOS. The significant association was revealed between MTHFR conflicting results regarding the associations between gene C677T polymorphism with PCOS, for which CT and MTHFR C677T polymorphisms and risks for PCOS may TT genotypes can increase the risk of PCOS [15]. be due to differences in racial and environmental factors. Another study indicated that the 677T allele increases the 3_2015_draft

References

iss 1. American College of Obstetricians and patients with polycystic ovary syndrome. polymorphisms of Gynecologists. ACOG practice bulletin. Endocrine. 2010; 38(1):127-133. methylenetetrahydrofolate reductase: a Polycystic ovary syndrome. Obstet 8. Yenicesu HI, Cetin M, Ozdemir O et al. pilot observational study. Hum Fertil. Gynecol. 2009; 114(4):936-949. A prospective case-control study analyzes 2007; 10(1):33-41. 2. Shannon M, Wang Y. Polycystic Ovary 12 thrombophilic gene mutations in 14. Bagos PG. Plasminogen activator Syndrome: A Common but Often Turkish couples with recurrent pregnancy inhibitor-1 4G/ 5G and 5,10-methylene- Unrecognized Condition. Journal of loss. American Journal of Reproductive tetrahydrofolate reductase C677T Midwifery & Women’s Health. 2012; Immunology. 2010; 63(2):126–136. polymorphisms in polycystic ovary 57(3):221-230. 9. Zetterberg H, Regland B, Palm´er M et syndrome. Molecular Human 3. Legro RS, Driscoll D, Strauss JF et al. al. Increased frequency of combined Reproduction. 2009; 15(1):19-26. Evidence for a genetic basis for methylenetetrahydrofolate reductase 15. Qi Q, Zhang H, Yu M et al. Association of hyperandrogenemia in polycystic ovary C677T and A1298C mutated alleles in methylenetetrahydrofolate reductase gene syndrome. Proc Natl Acad .1998; spontaneously aborted embryos. polymorphisms with polycystic ovary 95(25):14956-14960. 8_specialEuropean Journal of Human Genetics. syndrome. Zhonghua Yi Xue Yi Chuan 4. Lee YH, Song GG. Plasminogen activator 2002; 10(2):113–118. Xue Za Zhi. 2015; 32(3):400-4. inhibitor-1 4G/ 5G and the MTHFR 677C/ 10. Arruda VR, Von Zuben PM, Chiaparini 16. Fu LY, Dai LM1, Li XG et al. Association T polymorphisms and susceptibility to LC et al. The mutation Ala677Val in the of methylenetetrahydrofolate reductase polycystic ovary syndrome: a meta- methylene tetrahydrofolate reductase gene C677T polymorphism with polycystic analysis. Eur J Obstet Gynecol Reprod gene: a risk factor for arterial desease and ovary syndrome risk: a systematic review Biol. 2014; 175:8-14. venouse thrombosis. Thromb Haemost. and meta-analysis update. Eur J Obstet 5. Idali F, Zareii S, Mohammad-Zadeh A et 1997; 77:818-21. Gynecol Reprod Biol. 2014; 172:56-61. al. Plasminogen activator inhibitor 1 and 11. Kupfermin MJ, Eldor A, Steinman N, 17. Kazerooni T, Ghaffarpasand F, Asadi N methylenetetrahydrofolate reductase gene Many A et al. increased frequency of et al. Correlation between thrombophilia mutations in iranian women with genetic thrombophilia in women with and recurrent pregnancy loss in patients polycystic ovary syndrome. Am J Reprod complication of pregnancy. N Engl J Med. with polycystic ovary syndrome: a Immunol. 2012; 68: 400-407. 1994; 240:9-19. comparative study. J Chin Med Assoc. 6. Jain M, Pandey P, Tiwary NK et al. 12. Choi SW, Gu BH, Ramakrishna S et al. 2013; 76(5):282-288. MTHFR C677T polymorphism is Association between a single nucleotide 18. Karadeniz M, Erdogan M, Zengi A et al. associated with hyperlipidemia in women polymorphism in MTHFR gene and Methylenetetrahydrofolate reductase with polycystic ovary syndrome. J Hum polycystic ovary syndrome. Eur J Obstet C677T gene polymorphism in Turkish Reprod Sci. 2012; 5(1):52-56. Gynecol Reprod Biol. 2009; 145(1):85-88. patients with polycystic ovary syndrome. JML_Volume7. Karadeniz M, Erdogan M, Zengi A et al. 13. Palep-Singh M, Picton HM, Yates ZR, Endocrine. 2010; 38(1):127-33. Methylenetetrahydrofolate reductase Barth J, Balen AH. Polycystic ovary C677T gene polymorphism in Turkish syndrome and the single nucleotide

228 Journal of Medicine and Life Vol. 8, Special Issue 3, 2015, pp.229-233

Phenol degradation by Periodate in combination with Ultrasonic Irradiation

Seid-Mohamadi A*, Asgari G**, Shokoohi R**, Adabi S** *Social Determinants of Health Research Center, Department of Environmental Health Engineering, School of Public Health, Hamadan University of Medical Sciences, Hamedan, Iran, **Department of Environmental Health Engineering, School of Public Health, Hamadan University of Medical Sciences, Hamadan, Iran

Correspondence to: Shervin Adabi, MSc, Department of Environmental Health Engineering, School of Public Health, Hamadan University of Medical Sciences, Shahid Fahmideh Street, Hamadan, Iran Mobile phone: +989374196112, E-mail: [email protected]

Received: March 14th, 2015 – Accepted: June 18th, 2015

Abstract In this study, a successful degradation of phenol was achieved by a combination of processes, ultrasonic irradiation and periodate. The effect of pH, dosage of IO4-, dosage of initial phenol and ultrasonic irradiation time on the phenol degradation were examined. Furthermore, the effects of ion intensity on phenol degradation were examined. The results showed that the degradation rate increased in acidic conditions and a higher degradation was achieved in combination processes. This novel study also investigated the effect of ion intensity and the results showed that the principal intensity of solution is an inactive3_2015_draft variable on phenol degradation with these systems. A comparative study between IO4-/ US system and IO4- and US separately determined the COD removal and showed that an integrated approach of IO4-/ US system had the best execution.

iss Introduction Processes (AOPs) have been studied as efficient methods in last decades [5,6]. Methods like Fenton, Industries generate a considerable amount of radiolysis, photo catalytic oxidation, sonication, periodate polluted wastewater and they have recently produced a oxidation, ozonation, etc., are expedient because of their variety of concerning problems in the aqueous solutions potential to generate hydroxyl radicals in aqueous as a result of inadequate treatment operations [1]. solutions [7-9]. Of these methods, the Ultrasonic method Organic compounds have been used extensively in the is one of the most important approaches because it has a manufacturing processes. The presence of organic low cost and it is easy to handle. The basis of ultrasonic pollutants in aquatic solutions is one of the major social reaction is on hydroxyl generations that are produced by and environmental awareness. Groundwater and surface reactor and depend on the power of the reactor that waters are vulnerable to contamination8_special by industrial makes numerous frequencies [10]. The aquatic cavity wastewaters. Scientists have been concerned about the bubbles have been grown and impulse collapsed all nature of organic compounds and their harmful effect in molecules of gases and water vapour from the aqueous water sources. Therefore, governments have authorized similarly, the variety of radicals being generated according hard and fast laws to protect the environment in the last to Eq1 to Eq3 [11]. o o decades [2]. H2O+))) → OH + H (1) 0 Phenol, one of the most common compounds, O2+ ))) →2O (2) has been consumed in several industries such as OHo + Oo → OO (3) pharmaceuticals, pesticides, paint and dye industries, These phenomena caused the degradation of organic chemicals manufacturing, etc. As a consequence, organic compounds such as phenol in aqueous solutions. it was found in the effluence of these industries [3]. The The degradation proceeds mainly by two reaction effect of this organic compound was investigated in mechanisms: direct pyrolysis in and around the collapsing aqueous solutions and according to the EPA declaration, bubbles, and oxidation by OHo radicals [12]. Whether, it is a priority pollutant. Accordingly, the standard phenol is one of the stable organic compounds, the rate of concentration of phenol in the effluent stream is less than sonodegradation of that is obviously low. There are some JML_Volume1 ppm [4]. According to the recent research, many reports in recent studies that imply the combination methods have been studied to destroy phenol residuals in processes like periodate oxidation to achieve the aim [13]. the aqueous solutions albeit most of them have a variety Iodine oxide anionic species formed through the of limitations. Therefore, it is important to find an efficient bonding of the iodine atom with a different number of process to remove or degrade phenol residuals before the oxygen atoms are the hypoiodous anion (IO−), the iodic discharge to water sources. Advanced Oxidation anion (IO3−), the periodate anion (IO4−), the mesoperiodic Journal of Medicine and Life Vol. 8, Special Issue 3, 2015

anion (IO53−) and the paraperiodic anion (IO62−). The most stable ones in their salts and acids are the periodate and paraperiodic anions. The periodate ion is available in sodium salt (readily soluble) and in potassium salt of limited solubility [14]. The periodate anion reacts with various chemical compounds such as organic compounds. The oxidation reaction pathway depends on the chemical reaction variables [15]. Periodate has a good power to oxidize the organic compounds, especially in the presence of

hydroxyl, once this substance is activated, it changes into Fig. 1 Ultrasonic equipment 0 0 stronger radicals such as IO4 and IO3 . These radicals were produced in two stages: in the first stage, one of the chemical bands IO was attacked to one of the chemical 2. Spectrophotometer: model Uv/ Vis, made by Perkin Elmer. bonds OH, and then in the second stage, the chemical

bonds have formed a ring [16]. For these reasons, the Us/ IO4 system combination of sodium periodate with ultrasonic process Batch experiments were performed in a rotary have more power to remove the organic compounds such shaker at 25 ċ and 125 rpm. The s tock solution of phenol as phenol in aquatic solutions. 1000 mg/ l and priodate (213.89g/ mol) were prepared in Saidmohammadi et al. [17] investigated the deionized water prior to each batch experiment. The pH degradation of 2,4 dichlorophenolindophenol by values of all solutions 3_2015_draftwere set with (0.5N) sodium hydronized (NaOH) or sulfuric acid (H2SO4 95%). Several periodate, persulfate and hydrogen peroxide in the sets of the experiments were conducted to determine the presence of US. They predicted that in the presence of effects of various parameters on phenol degradation. In US, periodate is a good catalyst which enhanced the order to determine the effect of time on the phenol degradation. degradation, issit was studied at every 15 min, from 15 min Rashmi et al. [10] investigated the phenol to 120 min. To investigate the effect of pH on the phenol degradation with ultrasonic reactors and with hydrogen degradation, three pH regimes of aqueous solution at 3.0, 7.0, and 11.0 were studied. In the remaining experiments, peroxide, ozone and zero valent metals. Studies clearly the optimized pH was adjusted. To determine the effect of showed that the degradation of phenol is intensified the IO4 on phenol degradation, from 1 to 7 mMIO4 in the presence of the catalyst. specific phenol concentration (50 mg/ l) and to determine In this study, the enhancement in the rates of the effect of the initial phenol on this degradation skirt, 25 ultrasonic degradation of phenol in the aqueous solution to 200 mg/ l phenol were used. In order to investigate the with sodium periodate, to activate periodate, was studied. effect of ion on phenol degradation, amounts of calcium chloride of 1.03, 0.52, and 0.13 were used. To determine Eventually, the kinetics of oxidations in8_special all systems was the effect of ultrasound, the solution was irradiated with analyzed. Phenol removals in the reactions were ultrasound for 120 min; this process was continued until determined by using the Spectrophotometer. The COD the solution was irradiated for a predetermined period. test was also used for the analysis of phenol. The temperature of the solution was kept constant ˜ 31 ± 20C by using cold water circulating around the beaker.

Experiment Analytical techniques Phenol removals in the reactions were Materials determined by using the Spectrophotometer at 500 nm. Phenol (163 g/ mol) was obtained from MERCK, COD tests were also used for the analysis of phenol [18]. sodium periodate from MERCK, potassium Ferrocyanide (K3Fe(CN)6) and all the other regents were obtained from MERK and used as received. The analytical reagents Results and discussion grade or better chemicals as well as Milli-Q water were used in the experiment. Effect of pH In all the chemical reactions, pH is one of the JML_VolumeApparatus major factors that directly affect the whole chemical The following equipments were used in the operation [19]. Therefore, a set of experiments was study: designed to investigate the effect of pH on phenol degradation in IO4-/ US system. Experiments were carried 1. Ultrasonic equipment: LUC405 model, range of out at a pHs of 3.0, 7.0, and 11.0. The results are shown temperature 0 to 50oC, made in Korea. The in Fig. 2, and indicated that the phenol degradation was system is schematically presented in Fig. 1. 230 Journal of Medicine and Life Vol. 8, Special Issue 3, 2015

obviously increased at a pH of 3 and results showed that Effect of initial phenol concentration - the efficiency was of 85.20% after 120 min, nevertheless The study continued under an identical IO4 after 90 min the phenol degradation efficiency was almost concentration at an optimized pH was carried out in the constant and at 90 min, the efficiency was 83.80%. same ultrasonic frequency at an initial phenol of 25, 50, This fact happening due to hydroxyl radicals was 100, 150, and 200 mg/ l. During sonication, the efficiency caused by the generation by ultrasound in an acidic was 92, 87.8, 41.6, 36.6 and 10 after 90 min, as shown in condition; subsequently more IO4 and IO3 generated Eq4 Fig 4. With the mount up of the phenol concentrations, to Eq 7 [20]. 0 the efficiency decreased, whose reaction needed more 2IO4 →2IO8 (4) - - + periodate dosages and hydroxyl radicals [22]. 2IO5+H2O→IO3 +IO4 +2H +O2 (5) 0 2IO3 →2IO6 (6) - - + 2IO6 + H2O →IO3 +IO4 +2H (7)

3_2015_draft Fig. 4 Effect of initial phenol concentration on the - - degradation of phenol by IO4 / US system. pH =3, IO4 3mM, Fig. 2 Effect of pH on the degradation of phenol by IO4-/ US time 90 min - system. IO4 5mM, phenol 50 mg/ l iss Effect of ultrasonic and peridate solely Effect of periodate concentration Firstly, the rate of phenol degradation was Experiments were conducted to determine the investigated by using just ultrasonic at 50 mg/ l most effective periodate dosage for the degradation of concentration of the phenol and the obtained results were phenol in the presence of ultrasound waves. The shown in Fig. 5. As the figure illustrates, the rate of concentrations of periodate of 1, 2, 3, 4, 5, 6 and 7 mM degradation was 14% after 90 min. Secondly, the rate of were applied. The results are shown in Fig. 3 and phenol degradation was investigated just in presence of announced that phenol degradation efficiency was of peridate of 3 mM at 50 mg/ l concentration of phenol, and - 10%, 87.80%, 72% with IO4 ; 1, 3 and 7 mM respectively the results were shown in Fig. 5; the rate of degradation after 90 min. The phenol degradation efficiency was low was 19.6%. These experiments showed that the at little periodate concentrations as8_special if at higher application of sonication and periodate alone is not concentrations. These observations can be explained by capable of a full degradation of the phenol. Therefore, in the fact that periodate directly reacts with the hydroxyl in order to catch higher removal efficiency, the combination the solution, in low dosage less periodate reacts with of the oxidants and ultrasonic must be applied [23]. hydroxyl; instead in high dosage, hydroxyl engages in the interfering reactions of Eq. 8 [21].

0 - - 0 OH + IO4 → OH + IO4 (8)

JML_Volume

Fig. 3 The effect of periodate concentration mM on the Fig. 5 Effect of ultrasonic and peridate solely and the

degradation of phenol by IO4-/ US system. pH = 3, phenol combination on degradation of phenol. pH =3, phenol 50 - 50 mg/ l, time 90 min mg/ l, IO4 3mM, time 90 min

231 Journal of Medicine and Life Vol. 8, Special Issue 3, 2015

Effect of ion intensity on the degradation of phenol by - Fig. 6 The effect of ion intensity on the degradation of IO4 / US system phenol by IO4-/ US system. pH =3, phenol 50 mg/ l, IO4- For this system, three sets of experiments were 5mM, time 90 min done in this investigation. In this case, 0.13, 0.5, and 1.03 g/ l of CaCl were used and served as additions to aqueous solutions. The study continued under identical - IO4 concentrations at optimized pH and was carried out in Conclusions the same ultrasonic frequency at 90 min for this system at initial phenol concentrations of 50 mg/ l. This study showed that the use of ultrasonic The results shown in Fig. 6 indicated that the frequency with periodate, separately degraded phenol in phenol degradations were obviously increased at 1.03 g/ l aqueous solutions. Nevertheless, the rates of phenol - CaCl, as compared to 0.13 g/ l CaCl. This can be degradation in combination with systems like IO4 / US are explained by the ion effect created by CaCl, hence this more than separate systems. The study also showed that caused the movement of phenol molecules to the the system required an acidic pH for effective phenol interface of the cavities created by the sonication [3]. removal and the phenol degradation enhanced in low Nevertheless, the maximum rate of phenol degradation in concentration of the initial phenol. This study also showed - presence of CaCl in IO4 / US was 83.6%, as compared to that COD reduction was decreased since time pass. - the maximum rate of phenol degradation in the absence Moreover, IO4 was an effective substance that enhanced - - of CaCl; in IO4 / US it was 87.8%, provided that the ion the phenol degradation in IO4 / US system. Furthermore, intensity of solution is an inactive variable in both systems the study showed that the use of simple additives such as in phenol degradation. CaCl did not have any obviously positive effect on the phenol degradation. 3_2015_draft Acknowledgments The authors appreciate the support of Hamadan University of Medical Science, the Faculty of Health. iss

References 8_special

1. Naddeo V, Belgiorno V, Napoli R. 6. Asgari G, Seid Mohammadi A, 9. Kotronarou A, Mills G, Hoffmann MR. Behavior of natural organic mater during Mortazavi SB, Ramavandi, B. Ultrasonic irradiation of p-Nitrophenol in ultrasonic irradiation. Journal of Investigation on the pyrolysis of cow bone Aqueous Solution. J Phys Chem. 1991; Desalination. 2007; 210:175-182. as a catalyst for ozone aqueous 95:3630–3638. 2. Jasudkar D, Rakhunde R, Deshpande decomposition: Kinetic approach. J Anal 10. Chanda R, Ince HN, Gogatec PR, L, Labhasetwar P, Juneja HD. Arsenic Appl Pyrol. 2012. Bremnera DH. Phenol degradation using remediation from drinking water using 7. Molina R, Martínez F, Melero JA, 20, 300, and 520 kHz ultrasonic reactors Fenton’s reagent with slow sand filter-Bull. Bremner DH, Chakinala AG. with hydrogen peroxide, ozone and zero Environ. Contam. Toxcol. 2012; 89:1231– Mineralization of phenol by a valent metals. Separation and Purification 1234. heterogeneous ultrasound/Fe‑SBA‑15/H Technology. 2009; 67:103-109. 3. Effect of 11. Kidak R, Ince NH. Catalysis of advanced Naresh NM, Aniruuddha BP. sub 2/sub O sub 2/sub process: additives on ultrasonic degradation of oxidation reactions by ultrasound. A case Multivariate study by factorial design of phenol. Ultrasonic Sonochemistry. 2006; study with phenol. Journal of Hazardous experiments. Appl Catal B: Environ. 2006; 13:165-174. Materials. 2007; 146:630-635. 4. National primary drinking water standards. 66:198‑207. 12. Drijvers D, Van LH, Beckers M. JML_Volume2002. www.epa.gov/safewater/regs.html. 8. Gogate PR, Mujumbar S, Thampi J, Decomposition of phenol and 5. Ghaly MY, Härtel G, Mayer R, Wilhelm AM, Pandit AB. Destruction of trichloroethylene by the Uv/ H2O2/CuO Haseneder R. Photochemical oxidation of phenol using sonochemical reactors- process. Water Research. 1999; 33:1187- p‑chlorophenol by UV/ H2O2 and scale-up aspects and comparison of novel 1194. configuration with conventional reactors. 13. Yehia FZ, Eshaq Gh, Rabie AM, Mady photo‑Fenton process. A comparative Purifi Tech. 2004; 34:25–34. AH, ElMetwally AE. Phenol degradation by advanced Fenton process in study. Waste Manag. 2001; 21:41‑7.

232 Journal of Medicine and Life Vol. 8, Special Issue 3, 2015

combination with ultrasonic irradiation. 17. Almasi H. The study of H2O2, IO4, SO4 and Photobiology. Journal of Chemistry. Egyptian Journal of Petroleum. 2015; in presence of US for degradation of 2008; 194(2):212-9. 2:135-142. phenol from aqueous solution. 2015, 21. Lin C, Lee LT, Hsu LJ. Performance of 14. Durrant PJ, Durrant B. Introduction to Hamadan Iran: Univ. Hamadan. UV/S2O82− process in degrading polyvinyl Advanced Inorganic Chemistry, 2th 18. APHA, AWWA, WEF, Standard Methods alcohol in aqueous solutions. Journal of Edition, 1970, Longman Group Limited, for the Examination of Water and Photochemistry and Photobiology. A: London, 954–957. Wastewater, 19th Edition, 1995, Chemistry. 2013; 252(1):1-7. 15. Athanasios GV, Nicholaos PE. Washington DC. 22. Huang KC, Zhao Z, Hoag GE, Dahmani Periodate oxidation and its contribution to 19. Laszlo K, Podkościelny P, Dabrowski A, Block PA. Degradation of volatile instrumental methods of micro-analysis. A A. Heterogeneity of activated carbons organic compounds with thermally review Periodate oxidation and its with different surface chemistry in activated persulfate oxidation. contribution to instrumental methods of adsorption of phenol from aqueous Chemosphere. 2005; 61(4):551-60. micro-analysis—A review. Analytica solutions. Applied Surface Science. 2006; 23. Laszlo K, Dabrowski A. Heterogeneity of Chimica Acta. 2009; 652:85–127. 256 (16):5287-5294. polymer-based active carbons in the 16. Tiziani S, Sussich F, Cesa`ro A. The 20. Tang X, Weavers LK. Using absorption of aqueous solutions of phenol kinetics of periodate oxidation of photoactivated periodate to decompose and 2.3.4- trichlorophenol. Lungmoir. carbohydrates 2. Polymeric substrates. TOC from hydrolysates of chemical 2003; 19:5287-5294. Carbohydrate Research. 2003; 338:1083- warfare agents. Journal of Photochemistry 1095.

3_2015_draft

iss

8_special

JML_Volume

233

Instructions to authors for prepairing and submitting manuscripts for peer-review and publishing

Journal of Medicine and Life publishes original Manuscripts must be organized in this order: Title Page, work from various areas of medicine: original articles, Abstract, Introduction, Materials and Methods, Results, special articles, case presentations, reviews of other Discussion, Acknowledgments, Sources of funding, published articles, significant medical news, letters to the Disclosures, References, Tables – 1 per page consecutively editor and more. Moreover, it publishes manuscripts from numbered in Arabic form, and Figures – one per page different fields of research: Basic and Clinical (medicine, consecutively numbered in Arabic form, with Figure Legends. dentistry, pharmacy). In addition, there is room for The word limits noted for each manuscript category include all hospital activities, congresses, workshops, and notes on sections of the manuscript: Title Page, Abstract, Text, scientific agendas among its pages. Acknowledgment and COI Sections, References, Figure Publishing a new journal in the European area, Legends, and Tables. Online Supplements and the list of non- which focuses on concerns about medicine and life standard abbreviations and non-standard acronyms are without scientific or national borders, and, in the same excluded from the word limit. Materials submitted, including time, promoting the concept of life quality improvement, figures, cannot be returned to authors regardless of the represents an intensive preoccupation at “Carol Davila” disposition of the article. University of Medicine and Pharmacy, Bucharest. The editors encourage the authors to provide the People from the Romanian academic environment, names of at least five potential reviewers from outside medical and social environments alike, and colleagues their institution who have not been collaborators or from other countries are encouraged to contribute to the coauthors within the last three years and have not life of this journal. Our expectations are high, meaning provided advice or critique of the submitted manuscript. that the special concern for Romanian medicine and new Authors may list up to a maximum of three concepts of modern medicine will come out from the reviewers they wish 3_2015_draftto exclude. Please note that papers pages of this journal. However, these new concepts of sent for peer-reviewing do not contain the author’s modern medicine are based on reasons and are names and affiliations. connected with the improvement of life quality by means Anyiss submission will not be processed unless it of medical practice, sustained by evidence. has a signed authorship. This will avoid eventual Biochemistry, Biophysics, Modern Anatomy, Molecular, conflicts between authors. and Cellular Biology will always find generous publishing Authors are advised to provide recent references (2000 room in the journal, as a proof of the interest in showing and recently), and from peer-reviewed journals. Papers that medicine today stands for fundamental medical with references before 2000 are discouraged. research. The authors are also encouraged to submit reviews on their previous papers published in Journal of Medicine and Life in The process of sending the articles order to increase both visibility of the Journal and the authors. The authors are encouraged to send articles that Two copies of the article will be mailed to the have not been published before in other journals or which editorial team at the following address: Prof. Florian Popa, are not considered for publication in any other journal. Editor-in-chief of “Journal of Medicine8_special and Life” Moreover, the names of the authors should be Bucharest 35, PO Box 35-39 Romania written according to the Medline form; first the surname It is also mandatory to email the documents and and then the initial (s) of the surname (s). Example: figures to [email protected] „Wallace K, Mitchel DA, Ricardi V.”. All materials will be mailed safely. Submitted manuscripts must not contain previously published material and must not Title Page be under simultaneous consideration for publication elsewhere in whole or in part in any language (except as an The title page (page 1) should contain: abstract). Manuscripts must conform to "Uniform Requirements for Manuscripts Submitted to Biomedical  Full title, comprehensive, but short to a maximum of Journals" (http://www.icmje.org). 45 characters. Please read the instructions below carefully.  First author’s surname and short title (not to exceed Manuscripts that do not adhere to the submission 50 characters, including spaces). guidelines will be returned to the authors. Email the  Authors’ names, academic degrees, and affiliations. Authorship Responsibility and Copyright Transfer  Name and complete address of corresponding Agreement Form to the editorial office author (include street name and address as well as JML_Volume([email protected]). Each author must complete a post office box, and address for reprints if different separate AR (Authorship Responsibility) form. Forms may from correspondence). also be faxed. Upload online any potentially overlapping work  Fax number, telephone number, and email address that is in preparation, has been previously submitted or of corresponding author. published, or is in-press. Upload online any article currently in-  The total word count of the manuscript (including press, which is cited in the References. Upload online any Title Page, Abstract, Text, References, Tables and abstracts related to the submitted work that are published or Figures Legends). submitted for publication. After the Title Page insert a second one keeping

Instructions to authors for prepairing and submitting manuscripts for peer-review and publishing only the title of the manuscript without anything that sufficient information for the reader to understand the basic could indicate the identity of the authors. methodology. There is no preset space allocation for the description of methods. Because of space restrictions, it is Abstract and Key Words recommended that in the print version the Methods section be limited to essential new information. Methods that are The Abstract must be organized in four sections: essentially the same as those presented in previous  Rationale (hypothesis) – the reason for doing the publications should be cited or succinctly summarized rather study than detailed in the print version.  Objective (aim) – the purpose of the study For animals used in experiments, state the species,  Methods and Results – brief description of methods strain, number used, and other pertinent descriptive and presentation of results characteristics. When describing surgical procedures on  Discussion – interpretation and significance of the animals, identify the preanesthetic and anesthetic agents observations, emphasizing new information used and state the amount or concentration and the route and Abstract length is limited to 250 words. Abbreviations must be defined at first mention in the abstract, frequency of administration for each. The use of paralytic and again at first mention in the main manuscript text. agents, such as curare or succinylcholine, is not an Do not cite references in abstract, and limit use of acronyms acceptable substitute for anesthetics. For other invasive and abbreviations. procedures on animals, report the analgesic or tranquilizing After the Abstract, insert three to five keywords for use as drugs used. If none were used, provide justification for such indexing terms, separated by semicolons. These words exclusion. Generic names of drugs must be given. may later be copyedited to conform to journal style. Manuscripts that describe studies on humans must indicate that the study was approved by an institutional review Abbreviations committee and that 3_2015_draftthe subjects gave informed consent. Please provide sex-specific and/or racial/ethnic-specific data, Create a list of non-standard abbreviations and non- when appropriate, in describing outcomes of epidemiologic standard acronyms used in the manuscript text. analyses oriss clinical trials; or specifically state that no sex- The list should be included in the manuscript and placed after based or racial/ethnic-based differences were present. the abstract, before the Introduction. The list should be Reports of studies on both animals and humans must indicate entitled “Abbreviations.” Its content will not count toward the that the procedures followed were in accordance with word limit. institutional guidelines. One must prove that experiments on All abbreviations and acronyms should be expanded upon first live vertebrates are ethically accepted and are following usage in the text, and thereafter the abbreviation/acronym national and international rules for animal laboratories. should be used. Any information that may lead to the identification of a patient must be excluded from the content of the article. Text When photos of admitted patients are sent, they must have their consent and authors take full responsibility of the  Main headings include Introduction, Methods, material. If materials contain medical research on human Results, and Discussion (IMRAD form).8_special subjects, the author must enclose a declaration that confirms  For Case Reports limit the text, including references, consent of all those subjects, in conformity with World’s at a maximum of 2000 words; for Original Papers the Medical Association Declaration, issued in Helsinki. text limit, including references, to a maximum of 15 double-spaced pages. Acknowledgements  Manuscripts must be DOUBLE LINE SPACED, including references and figure legends, using Arial, The Acknowledgments section should include any font size 11. personal thanks to individuals who assisted in the  Leave 2 cm margins on all sides. performance of the studies and/or in the preparation of the  Number all pages--including Figures with legends manuscript. and Tables. Authors must provide written permission from all individuals Use SI units of measure in all manuscripts. For who are listed in the Acknowledgments section of the example, molar (M) should be changed to mol/L; mg/dL to manuscript, because readers may infer their endorsement of mmol/L; and cm to mm. Units of measure previously reported data and conclusions. as percentages (i.e. hematocrit) are expressed as a decimal The corresponding author must sign the fraction. Measurements currently not converted to SI units in Acknowledgment Section of the Copyright Transfer JML_Volumebiomedical applications are blood and oxygen pressures, Agreement, certifying that (1) all persons who have made enzyme activity, H+ concentration, temperature, and volume. substantial contributions to the manuscript (i.e., data The SI unit should be used in text, followed by the collection, analysis, or writing or editing assistance), but who conventionally used measurement in parentheses. do not fulfill authorship criteria, are named with their specific contributions in the Acknowledgments section of the Methods manuscript; (2) all persons named in the Acknowledgments section have provided the corresponding author with written The print version of the Methods should provide permission to be named in the manuscript; and (3) if an

Instructions to authors for prepairing and submitting manuscripts for peer-review and publishing

Acknowledgments section is not included, no other persons 375-378. besides the authors have made substantial contributions to The references will not contain internet sources. this manuscript. All references which are originally taken from an international database (i.e. Scopus, MedLife, etc.), should Sources of Funding respect the same order of the elements mentioned above, but should necessarily contain a “doi” after the year of the The Sources of Funding section should include all publication, instead of the page numbers of the paper. sources of research support, including public and private Example: Langlois J, Rutland-Brown W, Wald M. The entities, commercial or institutional support, and any epidemiology and impact of traumatic brain injury: a brief substantial contributions by individuals. overview. 2006; doi:10.1111/j.1464410X.2009.08495.x. All references which are originally taken from books, Disclosures should contain the following details in this specific order: name(s) and surname(s) of the author(s), chapter of the book In the Disclosures section, authors must disclose any (if applicable), the title of the book, year of publication, the city and all relationships that could be perceived as real or of publication, the name of the publishing house, first page, apparent conflict(s) of interest. If authors have nothing to last page (of the source). Example: Hojat M. Does empathy disclose, they must state "None." Conflicts of interest pertain predict career choice and professional success? to relationships with and/or ownership interests in Empathy in Patient Care, 2006, New York, Springer pharmaceutical companies, biomedical device manufacturers, Verlag, 205-209 or other corporations whose products or services are related We recommend you to use only peer-reviewed to the subject matter of the article. Relationships include, but journals. are not limited to, employment by an industrial concern, 3_2015_draft ownership of stock, membership on a standing advisory Figures council or committee, being on the board of directors, or being publicly associated with the company or its products. Acceptableiss electronic figure file formats for Ownership interest includes any stock, stock option, publication are: .jpg and .tiff partnership, membership or other equity position in an entity Color figures must be in CMYK mode, not RGB mode. regardless of the form of the entity, or any option or right to Color figures and line drawings must be at least 600 dpi acquire such position, and any rights in any patent or other resolution. Grayscale and black/white figures must be at least intellectual property. Other areas of real or perceived conflict 300 dpi resolution. of interest could include receiving honoraria or consulting fees Combination color, grayscale and line art must be 600 dpi or or receiving grants or funds from such corporations or higher. individuals representing such corporations. The use of digital media for image acquisition and processing introduces the potential for inadvertent distortion of data. To References prevent such distortion, data should neither be added to, nor removed from, an image by digital manipulation. Figures References are included in the8_special word limit. assembled from multiple images must indicate the separation References must conform to Pubmed requirements. of the parts by lines. Authors must ensure accuracy of reference data. Verify all Linear adjustment of contrast, brightness or color must be entries against original sources. applied equally to all parts of an image. All authors must be listed in each reference. Do Authors must be prepared to submit the original, unaltered not use "et al". files from which the submitted figures were derived, if Cite references in numerical order according to first requested by the editorial office. mention in the text. Graphics downloaded from the Web are not acceptable for Personal communications, unpublished print. Web graphics, usually in GIF or JPEG format, have a observations, and submitted manuscripts are not legitimate resolution of only 72 dpi, which does not meet the standard for references and must be cited in the text only (not in the peer review nor publication. reference list) as "(author name, unpublished data, [year])." All Authors are responsible for the cost of printing color figures submitted manuscripts that are pertinent to the manuscript (the black and white figures are free, the color figures have an under consideration must accompany the submission. extra tax). Personal communications and unpublished Figure parts should be clearly labeled. Letters and labels must observations must be accompanied by a letter from the be uniform in size and style within each figure and, when JML_Volumesource approving use of the information. possible, between figures. The font size must be 10 point or All references will be written in the following order: higher. name (of the author), surname (of the author), title of the Symbols and abbreviations must be defined in the figure or its article, source (name of the book, magazine, etc), year of legend. publication, volume, issue (if applicable), first page, last page Avoid headings on the figure. Heading information should (of the source). Example: Langlois J, Rutland-Brown W, appear in the figure legend. Wald M. The epidemiology and impact of traumatic brain Provide a short title (in the legend, not on the figure itself) and injury: a brief overview.J Head Trauma Rehabil. 2006; 21: an explanation in brief but sufficient detail to make the figure

Instructions to authors for prepairing and submitting manuscripts for peer-review and publishing intelligible without reference to the text (unless a similar contain copyright transfer to Journal of Medicine and Life. The explanation has been given in another figure). full responsibility for all written information in the article Figure legends are included in the word limit. belongs to authors.

Tables Conflict of Interest Policy

Include table(s) in the main manuscript document as Authors are responsible for the published materials text, not as an image. Table(s) are included in the word limit. and other conflicts of interests regarding subjects included in Number tables using Arabic numerals, and supply a brief, their work. Authors must mention all the funding received for informative title for each table. Table text must be consistent research and other financial or personal connections linked to in size and style with main manuscript text. the article, in their work. Supply brief column headings. Indicate footnotes in this order: *, †, ‡, §, ||, #, ** Order of publication Use only horizontal borders above, and below the column headings and at the bottom of the table. Use extra space to The order in which the articles appear in the journal is delineate rows and columns. determined by: Abbreviations/symbols used in a table but not 1. date of arrival already defined in the main text must be defined in the table 2. editorial priorities or table legend. 3. compliance with the above mentioned recommendations Do not use colors for tables, use only default .1 black borders. 4. peer-review recommendations Tables must be placed 1 per page at the end of 3_2015_draft the manuscript, after the references. Priorities can be decided for some articles, requested either by the editors or by being of special interest. Copyright information iss A letter signed by the main author of the article, which will be sent via mail together with the manuscript, will

For urgent communications (phone, fax, mail), the following address may be used as well: “Carol Davila” University Press 8 Eroilor Sanitari Blvd., District. 5, Bucharest, Romania 8_specialPhone/Fax: +40 21 318.07.59 E-mail: [email protected]

JML_Volume