43600761.Pdf

Total Page:16

File Type:pdf, Size:1020Kb

Load more

View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Radboud Repository PDF hosted at the Radboud Repository of the Radboud University Nijmegen The following full text is a publisher's version. For additional information about this publication click this link. http://hdl.handle.net/2066/153094 Please be advised that this information was generated on 2017-12-05 and may be subject to change. Impact of Malaria Preexposure on Antiparasite Cellular and Humoral Immune Responses after Controlled Human Malaria Infection Joshua M. Obiero,a* Seif Shekalaghe,b Cornelus C. Hermsen,a Maxmillian Mpina,b Else M. Bijker,a Meta Roestenberg,a* Karina Teelen,a Peter F. Billingsley,c B. Kim Lee Sim,c Eric R. James,c Claudia A. Daubenberger,d,e Stephen L. Hoffman,c b a a Salim Abdulla, Robert W. Sauerwein, Anja Scholzen Downloaded from Radboud University Medical Center, Department of Medical Microbiology, Nijmegen, The Netherlandsa; Ifakara Health Institute, Bagamoyo Research and Training Center, Bagamoyo, Tanzaniab; Sanaria Inc., Rockville, Maryland, USAc; Swiss Tropical and Public Health Institute, Department of Medical Parasitology and Infection Biology, Basel, Switzerlandd; University of Basel, Basel, Switzerlande To understand the effect of previous malaria exposure on antiparasite immune responses is important for developing successful immunization strategies. Controlled human malaria infections (CHMIs) using cryopreserved Plasmodium falciparum sporozo- ites provide a unique opportunity to study differences in acquisition or recall of antimalaria immune responses in individuals from different transmission settings and genetic backgrounds. In this study, we compared antiparasite humoral and cellular im- http://iai.asm.org/ mune responses in two cohorts of malaria-naive Dutch volunteers and Tanzanians from an area of low malarial endemicity, who were subjected to the identical CHMI protocol by intradermal injection of P. falciparum sporozoites. Samples from both trials were analyzed in parallel in a single center to ensure direct comparability of immunological outcomes. Within the Tanzanian cohort, we distinguished one group with moderate levels of preexisting antibodies to asexual P. falciparum lysate and another that, based on P. falciparum serology, resembled the malaria-naive Dutch cohort. Positive P. falciparum serology at baseline was associated with a lower parasite density at first detection by quantitative PCR (qPCR) after CHMI than that for Tanzanian volunteers with negative serology. Post-CHMI, both Tanzanian groups showed a stronger increase in anti-P. falciparum anti- body titers than Dutch volunteers, indicating similar levels of B-cell memory independent of serology. In contrast to the Dutch, on February 28, 2017 by UNIVERSITEITSBIBLIOTHEEK Tanzanians failed to increase P. falciparum-specific in vitro recall gamma interferon (IFN-␥) production after CHMI, and in- nate IFN-␥ responses were lower in P. falciparum lysate-seropositive individuals than in seronegative individuals. In conclu- sion, positive P. falciparum lysate serology can be used to identify individuals with better parasite control but weaker IFN-␥ re- sponses in circulating lymphocytes, which may help to stratify volunteers in future CHMI trials in areas where malaria is endemic. n 2012, Plasmodium falciparum malaria caused an estimated 207 where malaria is endemic, since it bypasses the need for infecting Imillion cases and 627,000 deaths, of which 90% occurred in local Anopheles mosquitoes with P. falciparum or importing P. children under 5 years of age and in pregnant women in sub- falciparum-infected mosquitoes to the trial site. The first PfSPZ Saharan Africa (1). Major control efforts have been implemented Challenge trial in malaria-naive Dutch volunteers demonstrated with some success (2, 3), but malaria eradication will likely require an infectivity rate of 83% after intradermal injections, indepen- a safe and highly protective vaccine. Subunit vaccines have thus far dent of the dose given (23). Recently, PfSPZ Challenge was used shown moderate efficacy at best. RTS,S is the only vaccine candi- for the first time during a CHMI trial in healthy adult male Tan- date in phase 3 trials but, despite averting substantial numbers of malaria cases (4), shows only 30 to 50% reduction in clinical dis- ease after 12 months depending on both age and malaria endemic- ity and even less after 18 months (5–7). These results stress the Received 10 December 2014 Returned for modification 26 January 2015 need for more effective second-generation vaccines. Key require- Accepted 9 March 2015 ments are not only the identification of novel immunogens but Accepted manuscript posted online 16 March 2015 also a better understanding of protection-related immune re- Citation Obiero JM, Shekalaghe S, Hermsen CC, Mpina M, Bijker EM, Roestenberg M, Teelen K, Billingsley PF, Sim BKL, James ER, Daubenberger CA, Hoffman SL, sponses. This includes the effect of previous malaria exposure on Abdulla S, Sauerwein RW, Scholzen A. 2015. Impact of malaria preexposure on immune responses upon reexposure or vaccination (8, 9). antiparasite cellular and humoral immune responses after controlled human During the past 3 decades, controlled human malaria infection malaria infection. Infect Immun 83:2185–2196. doi:10.1128/IAI.03069-14. (CHMI) trials have become an indispensable tool not only in as- Editor: J. H. Adams sessing the efficacy of candidate vaccines (10, 11) but also in eval- Address correspondence to Robert W. Sauerwein, [email protected], uating immune responses induced by exposure to the malaria par- or Anja Scholzen, [email protected]. asite (12–15). CHMI trials have so far been performed in countries * Present address: Joshua M. Obiero, University of California Irvine, Department of Medicine, Division of Infectious Diseases, Irvine, California, USA; Meta were malaria is not endemic in previously unexposed individuals Roestenberg, Leiden University Medical Center, Department of Infectious (11, 16–19). A logical next step is to study the potential differences Diseases, Leiden, The Netherlands. in the acquisition, maintenance, or recall of immune responses in Supplemental material for this article may be found at http://dx.doi.org/10.1128 individuals from different transmission settings and genetic back- /IAI.03069-14. grounds (20, 21). The availability of aseptic, purified, cryopre- Copyright © 2015, American Society for Microbiology. All Rights Reserved. served, live P. falciparum sporozoites (PfSPZs; PfSPZ Challenge) doi:10.1128/IAI.03069-14 (22) opens up opportunities to carry out CHMI trials in countries May 2015 Volume 83 Number 5 Infection and Immunity iai.asm.org 2185 Obiero et al. zanian volunteers, resulting in similar infection rates (24). As a isolation lysis buffer to serve as an internal control. For quantification of follow-up, we here present results of the malaria-specific humoral PhHV, the primers GGGCGAATCACAGATTGAATC and GCGGTTCC and cellular immune responses in Tanzanians and Dutch volun- AAACGTACCAA and the probe Cy5-TTTTTATGTGTCCGCCACCATC teers who were inoculated intradermally with the same number of TGGATC were used. live PfSPZs during these CHMI studies. P. falciparum (NF54 strain) standard curves for both qPCR assays were prepared in Nijmegen by titration of ring-stage-infected red blood cells (RBC) in uninfected human blood. The two qPCR assays in both sites MATERIALS AND METHODS were confirmed to yield the same results when quantifying the P. falcipa- Human ethics statement. The Dutch trial (23) was approved by the Cen- rum content in sequential samples from four CHMI volunteers. tral Committee for Research Involving Human Subjects of The Nether- Parasite material for immunological analysis. The P. falciparum Downloaded from lands (NL31858.091.10) and registered at Clinicaltrials.gov, identifier NF54 strain used in both CHMI trials is the parental strain of the 3D7 NCT 01086917. The Tanzanian trial (24) was approved by institutional clone (27 ). P. falciparum (NF54 strain) blood-stage parasites were cul- review boards of the Ifakara Health Institute (IHI/IRB/No25), the Na- tured in RPMI 1640 containing 10% human Aϩ serum and a 5% hemat- tional Institute for Medical Research Tanzania (NIMR/HQ/R.8a/Vol.IX/ ocrit erythrocyte suspension in a semiautomated culture system and reg- 1217), the Ethikkommission beider Basel (EKBB), Basel, Switzerland ularly screened for mycoplasma contamination. For in vitro stimulation (EKBB 319/11), and the Tanzanian Food and Drug Administration (ref- assays, asynchronous parasites harvested at a parasitemia of approxi- erence no. CE.57/180/04A/50) and registered at Clinicaltrials.gov, identi- mately 10 to 20% were purified by centrifugation on a 63% Percoll density fier NCT 01540903. All study teams complied with the Declaration of gradient to obtain mature asexual stages. This resulted in concentrations Helsinki and good clinical practice, including monitoring of data, and all of parasitemia levels of about 80 to 90%, consisting of more than 95% http://iai.asm.org/ volunteers gave written informed consent. schizonts/mature trophozoites. P. falciparum-infected RBC (PfRBC) were Clinical trial design. Samples for immunological analysis were ob- washed twice in RPMI, cryopreserved in glycerol-containing freeze me- tained from two CHMI trials (23, 24). dium, and used upon thawing in stimulation assays. Mock-cultured unin- The first trial, performed at Radboud University Medical Center,
Recommended publications
  • US 2005/0100532 A1 Hoffman Et Al

    US 2005/0100532 A1 Hoffman Et Al

    US 20050100532A1 (19) United States (12) Patent Application Publication (10) Pub. No.: US 2005/0100532 A1 Hoffman et al. (43) Pub. Date: May 12, 2005 (54) APPARATUSES AND METHODS FOR THE (60) Provisional application No. 60/370,581, filed on Apr. PRODUCTION OF HAEMATOPHAGOUS 5, 2002. ORGANISMS AND PARASITES SUITABLE FOR WACCNE PRODUCTION Publication Classification (75) Inventors: Stephen L. Hoffman, Gaithersburg, (51) Int. Cl." ............................. A01N 63/04; C12N 1/10 MD (US); Thomas C. Luke, (52) U.S. Cl. ......................... 424/93.4; 424/93.5; 43/107; Brookville, MD (US) 435/258.2 (57) ABSTRACT Correspondence Address: DAVID S. DOLBERG Disclosed are apparatuses and methods for the production of 37 TERRACEAVE. attenuated aseptic parasites in haematophagous insects gen erally, and production of Plasmodium species Sporozoites in RICHMOND, CA 94.801 (US) Anopheles Species mosquitoes specifically; apparatuses and Assignee: SANARIA, INC. methods for the production of Strains of haematophagous (73) insects with desired properties Such as hypoallergenicity or Appl. No.: 10/958,163 hyperinfectivity; methods of producing a parasite Strain that (21) is capable of withstanding cyropreservation at temperatures (22) Filed: Oct. 4, 2004 close to freezing, apparatuses and methods for the injection of an attenuated parasite vaccine, production of parasites and haematophagous insects that are free from contamina Related U.S. Application Data tion by unwanted biological agents, apparatuses for the reconstruction of complex parasitic life cycles aseptically to (63) Continuation-in-part of application No. PCT/US03/ avoid the contamination of the parasite or the insect vector 10797, filed on Apr. 7, 2003. host with unwanted biological agents. Patent Application Publication May 12, 2005 Sheet 1 of 11 US 2005/0100532 A1 On Or y Patent Application Publication May 12, 2005 Sheet 2 of 11 US 2005/0100532 A1 Or 9.
  • Vaccines Summit-2021 September 20-22, 2021 | Online Meeting

    Vaccines Summit-2021 September 20-22, 2021 | Online Meeting

    Vaccines Summit-2021 September 20-22, 2021 | Online Meeting Sponsors Scientia Meetings Website: https://scientiameetings.com/conferences/vaccines/ Ph: 1-815-595-8049; Email: [email protected] DAY 1: SEPTEMBER 20, 2021 (MONDAY) Keynote Presentations EST (Eastern Time Zone) 08:55-09:00 Introduction: Opening Ceremony Session Chair: David Weiner, Executive Vice President, Director, Vaccine & Immunotherapy Center, The Wistar Institute Presentation Title: The Evolution of Vaccinology 09:00-09:30 Stanley Plotkin, Consultant and Emeritus Professor of the University of Pennsylvania, Vaxconsult, LLP Presentation Title: Exciting progress with malaria vaccines 09:30-10:00 Adrian V. Hill, Director, The Jenner Institute, Nuffield Department of Medicine, University of Oxford Presentation Title: Synthetic DNA Approaches for Immunization and Immunotherapy 10:00-10:30 David Weiner, Executive Vice President, Director, Vaccine & Immunotherapy Center, The Wistar Institute Presentation Title: Study of Adaptive Responses to SARS CoV2 10:30-11:00 Alessandro Sette, Professor and Member, Infectious Disease and Vaccine Center, La Jolla Institute for Immunology Break 11:00-11:10 Session Chair: Gregory C. Gary, Duke Universtiy Presentation Title: mRNA-1273: A Summary of Current Data and a View to the Future 11:10-11:40 Jacqueline Miller, Senior Vice President, Therapeutic Area Head, Infectious Diseases, Moderna Presentation Title: Mitigating Future Pandemics: New Threats and Strategies to Consider 11:40-12:10 Gregory C. Gray, Duke University Presentation Title: COVID-19: Developing a Vaccine During a Pandemic 12:10-12:40 Dan Barouch, Director, Center for Virology and Vaccine Research, Beth Israel Deaconess Medical Center Presentation Title: PfSPZ vaccines: From concept to proof of principle to genetically attenuated late arresting 12:40-13:10 replication competent PfSPZ vaccine manufactured in bioreactors for use in malaria elimination campaigns Stephen L.
  • Attenuated Pfspz Vaccine Induces Strain-Transcending T Cells and Durable Protection Against Heterologous Controlled Human Malaria Infection

    Attenuated Pfspz Vaccine Induces Strain-Transcending T Cells and Durable Protection Against Heterologous Controlled Human Malaria Infection

    Attenuated PfSPZ Vaccine induces strain-transcending T cells and durable protection against heterologous controlled human malaria infection Kirsten E. Lykea,1, Andrew S. Ishizukab,1, Andrea A. Berrya, Sumana Chakravartyc, Adam DeZureb, Mary E. Enamab, Eric R. Jamesc, Peter F. Billingsleyc, Anusha Gunasekerac, Anita Manojc, Minglin Lic,d, Adam J. Rubenc, Tao Lic, Abraham G. Eappenc, Richard E. Staffordc,d, Natasha KCc,d, Tooba Murshedkarc, Floreliz H. Mendozab, Ingelise J. Gordonb, Kathryn L. Zephirb, LaSonji A. Holmanb, Sarah H. Plummerb, Cynthia S. Hendelb, Laura Novikb, Pamela J. M. Costnerb, Jamie G. Saundersb, Nina M. Berkowitzb, Barbara J. Flynnb, Martha C. Nasone, Lindsay S. Garverf, Matthew B. Laurensa, Christopher V. Plowea, Thomas L. Richiec, Barney S. Grahamb, Mario Roedererb, B. Kim Lee Simc,d, Julie E. Ledgerwoodb, Stephen L. Hoffmanc,2, and Robert A. Sederb,2,3 aCenter for Vaccine Development and Division of Malaria Research, Institute for Global Health, University of Maryland School of Medicine, Baltimore,MD 21201; bVaccine Research Center (VRC), National Institute of Allergy and Infectious Diseases, National Institutes of Health, Bethesda, MD 20892; cSanaria Inc., Rockville, MD 20850; dProtein Potential LLC, Rockville, MD 20850; eBiostatistics Research Branch, Division of Clinical Research, National Institute of Allergy and Infectious Diseases, National Institutes of Health, Bethesda, MD 20892; and fEntomology Branch, Walter Reed Army Institute of Research, Silver Spring, MD 20910 Edited by Louis H. Miller, NIH, Rockville, MD, and approved January 19, 2017 (received for review September 27, 2016) A live-attenuated malaria vaccine, Plasmodium falciparum sporo- schedule showed a 26% and 36% reduction in clinical malaria zoite vaccine (PfSPZ Vaccine), confers sterile protection against among 6–12-wk-olds and 5–17-mo-olds, respectively, through 3–4y controlled human malaria infection (CHMI) with Plasmodium falci- of follow-up (7).
  • Expres2ion Biotech Holding Sponsored Research Initiating Coverage 24 June 2021

    Expres2ion Biotech Holding Sponsored Research Initiating Coverage 24 June 2021

    ExpreS2ion Biotech Holding Sponsored Research Initiating Coverage 24 June 2021 Rising to the COVID-19 challenge ExpreS2ion Biotech is a contract research organization, which has been founded over 10 years ago. The company specializes in the production of complex proteins using its proprietary protein Target price (SEK) 60 expression platform. More recently, the company has been focusing Share price (SEK) 36 on the development of its pipeline, which includes several vaccine and therapeutic candidates. Out of this group, we regard the Forecast changes ABNCoV2 project (COVID-19 vaccine), carrying the highest near- % 2021e 2022e 2023e term potential. Its partner, Bavarian Nordic, plans to start Phase III Revenues NM NM NM trial later this year, pending funding. We expect an upward EBITDA NM NM NM EBIT adj NM NM NM potential rerating of SEK 50 per share, should the vaccine EPS reported NM NM NM successfully go through clinical development and receive regulatory EPS adj NM NM NM approval. We initiate coverage of ExpreS2ion Biotech with a Buy Source: Pareto rating, target price SEK 60 per share. Ticker EXPRS2.ST, EXPRS2 SS Sector Healthcare COVID-19 vaccine project carries the highest near-term potential Shares fully diluted (m) 27.6 Market cap (SEKm) 988 Despite the rapid success of a number of COVID-19 vaccines, there is Net debt (SEKm) -114 a need for improved vaccines that offer strong immunogenicity as Minority interests (SEKm) 0 well as ease of clinical administration, stability and adaptiveness of Enterprise value 21e (SEKm) 938 platform. Given impressive pre-clinical results, as well as solid interim Free float (%) 83 Phase I safety data, we believe ABNCoV2 has a significant opportunity to succeed through the rest of clinical development.
  • Cellular and Humoral Immunity in Malaria Pre-Exposed Tanzanian

    Cellular and Humoral Immunity in Malaria Pre-Exposed Tanzanian

    Cellular and humoral immunity in malaria pre-exposed Tanzanian children and adults following vaccination with RTS,S, the most advanced malaria vaccine, and after whole sporozoite based controlled human malaria infections INAUGURALDISSERTATION zur Erlangung der Würde eines Doktors der Philosophie vorgelegt der Philosophisch-Naturwissenschaftlichen Fakultät der Universität Basel von Maxmillian Gideon Mpina Aus Sumbawanga, Rukwa, United Republic of Tanzania Basel, 2018 Genehmigt von der Philosophisch-Naturwissenschaftlichen Fakultät auf Antrag von Prof. Dr. Marcel Tanner, Prof. Dr. Claudia Daubenberger, Prof. Dr. Steffen Borrmann Basel, den 13. December 2016 Prof. Dr. Jörg Schibler Dekan ……..to my beloved wife, children, parents, brothers and sisters. Table of Contents CHAPTER 1: Introduction ........................................................................................ 1 1.1. Malaria : Overview ........................................................................................... 1 1.1.1. The parasite .............................................................................................. 1 1.1.1.1. Plasmodium falciparum……………………………….…………….2 1.1.1.2. Plasmodium vivax ..………………………………………..2 1.1.1.3. Plasmodium ovale …………………………………………...3 1.1.1.4. Plasmodium malariae ……………………………………………..3 1.1.1.5. Plasmodium knowlesi………………………………………………..4 1.1.2. Epidemiology of Plasmodium falciparum .................................................. 4 1.1.3. Life cycle of Plasmodium falciparum malaria ...........................................
  • Malaria Vaccines: from Parasites to Prevention

    Malaria Vaccines: from Parasites to Prevention

    MALARIA VACCINES: FROM PARASITES TO PREVENTION Global Health: Voices from the Vanguard 11 Lecture Series University of Georgia Athens, GA January 20, 2009 Stephen L. Hoffman, M.D. [email protected] 01.20.09 SANARIA 1 MALARIA P. falciparum responsible for more deaths in children in the world than any other single infectious agent Thousands of children will die today of malaria, an estimated million in the next year. 01.20.09 SANARIA 2 SANARIA’S PRIMARY MISSION To develop, license, and deploy a vaccine based33 on attenuated Plasmodium falciparum sporozoites that reduces morbidity and mortality in infants and children in sub-Saharan Africa. 01.20.09 SANARIA 3 BEN KEAN Course in Tropical Medicine 44 Second Year of Medical School 01.20.09 SANARIA 4 SUMMER FELLOWSHIP COLOMBIA55 Year Off in Colombia, Ecuador, Peru 01.20.09 SANARIA 5 01.20.09 SANARIA 6 Experience Tropical Medicine First Hand 77 Typhoid Fever – 10 days in the hospital Amebic dysentery x 3 Giardiasis 01.20.09 SANARIA 7 Family Medicine Residency 88 Diploma in Tropical Medicine and Hygiene LSHTM 01.20.09 SANARIA 8 JOIN THE NAVY! 99 01.20.09 SANARIA 9 THE JOY OF MAKING AN IMPACT 01.20.09 SANARIA 10 01.20.09 SANARIA 11 01.20.09 SANARIA 12 13 01.20.09 SANARIA 14 01.20.09 SANARIA SEARCHING FOR A SHORTCUT TO A 15 15 CURE 15 01.20.09 SANARIA 16 01.20.09 SANARIA 01.20.09 SANARIA 18 01.20.09 SANARIA 19 01.20.09 SANARIA 20 01.20.09 SANARIA “Dad, check them for malaria.” 01.20.09 SANARIA 21 A VACCINE IS THE ANSWER 22 22 Need to Retool 01.20.09 SANARIA RISKY BUSINESS-CRASH LANDING KENYA 23 01.20.09 SANARIA COMBINING BUSINESS WITH PLEASURE 24 01.20.09 SANARIA 25 01.20.09 SANARIA THE ROAD TO SANARIA • Develop subunit vaccine for malaria – Many clinical trials of PfCSP vaccine • Conclusion – Single protein vaccine not adequate for military personnel – Immunize with irradiated sporozoites • Identify targets and immune mechanisms – Better subunit vaccine – Sequence the genome of P.
  • Genetically Attenuated Malaria Parasites As Vaccines

    Genetically Attenuated Malaria Parasites As Vaccines

    Expert Review of Vaccines ISSN: 1476-0584 (Print) 1744-8395 (Online) Journal homepage: http://www.tandfonline.com/loi/ierv20 Genetically attenuated malaria parasites as vaccines Ashley M. Vaughan & Stefan H. I. Kappe To cite this article: Ashley M. Vaughan & Stefan H. I. Kappe (2017) Genetically attenuated malaria parasites as vaccines, Expert Review of Vaccines, 16:8, 765-767, DOI: 10.1080/14760584.2017.1341835 To link to this article: https://doi.org/10.1080/14760584.2017.1341835 Accepted author version posted online: 14 Jun 2017. Published online: 16 Jun 2017. Submit your article to this journal Article views: 717 View related articles View Crossmark data Citing articles: 3 View citing articles Full Terms & Conditions of access and use can be found at http://www.tandfonline.com/action/journalInformation?journalCode=ierv20 EXPERT REVIEW OF VACCINES, 2017 VOL. 16, NO. 8, 765–767 https://doi.org/10.1080/14760584.2017.1341835 EDITORIAL Genetically attenuated malaria parasites as vaccines Ashley M. Vaughana and Stefan H. I. Kappea,b aCenter for Infectious Disease Research, Seattle, WA, USA; bDepartment of Global Health, University of Washington, Seattle, WA, USA ARTICLE HISTORY Received 4 April 2017; Accepted 9 June 2017 KEYWORDS Genetically attenuated parasite; malaria liver stage; Plasmodium; preerythrocytic; sporozoite; vaccine Despite the significant gains made with control efforts, malaria with RTS,S in phase III field trials in Africa was moderate and of continues to be a dominant infectious disease threat in many limited durability [4]. Thus, a future subunit malaria vaccine parts of the world [1]. Malaria in humans is caused by infection needs improvement, and this might be achieved by adopting with five distinct Plasmodium parasite species exhibiting com- different immunization schedules, optimization of the immu- plex biology that is controlled by genomes encoding for more nogen, the application of different vaccine technology plat- than 5000 genes.
  • I-Pfspz-C.20201210 Agenda Final.Xlsx

    I-Pfspz-C.20201210 Agenda Final.Xlsx

    International PfSPZ Consortium Meeting Day 1: Wednesday 09 December 2020 Time Subject Presenter(s) 07:15 Log on to Zoom 07:30 Welcome Peter Billingsley 07:35 Introduction and Overview of the Meeting Stephen Hoffman 07:45 In Memory of Dra. Angelines Nnang Eyene Nchama Vicente Urbano, Wonder Phiri Peter Kremsner, Alassane Dicko, H.E. 07:48 Opening remarks Diosdado Milang (Minister of Health, EG) Pathway to licensure for PfSPZ Vaccine 07:58 Overview of Sanaria strategy Thomas Richie 08:18 Safety endpoint: Meta analysis of PfSPZ Vaccine safety Preston Church 08:23 Malaria endpoint: PCR with validated biomarkers Sean Murphy 08:28 Malaria endpoint: Validation of the Thick Blood Smear Assay for clinical endpoint Pete Billingsley 08:33 Manufacturing for Phase 3 and licensure Kim Lee Sim 08:38 Progress with and timelines for FDA and EMA submissions Tooba Murshedkar Status of planned trials with Phase 3 PfSPZ Vaccine 08:43 Warfighter 3 Preston Church 08:48 TravSPZV1 Peter Kremsner, Judith Epstein 08:53 EGSPZV4 Said Jongo, Raul Chuquiyauri 09:03 Discussion Moderators: Patrick Duffy, Michael Good Ongoing and proposed additional clinical trials of PfSPZ Vaccine 09:23 Mali 4 vaccine efficacy Halimatou Diawara 09:30 LaSPZV1 Maxime Agnandji, Preston Chruch 09:37 Indonesia Erni Nelwan 09:44 Seasonal vaccination of children Stephen Hoffman 09:49 Discussion Moderators: Tina Oneko 10:00 Burkina Faso ‐ 18 month vaccine efficacy Sodiomon Sirima, Matthew Laurens Developing a vaccine for Women of Child Bearing Potential (WOCB) 10:07 General overview Sara Healy
  • Direct Venous Inoculation of Plasmodium Falciparum Sporozoites for Controlled Human Malaria Infection: a Dose-Finding Trial in Two Centres Mordmüller Et Al

    Direct Venous Inoculation of Plasmodium Falciparum Sporozoites for Controlled Human Malaria Infection: a Dose-Finding Trial in Two Centres Mordmüller Et Al

    Direct venous inoculation of Plasmodium falciparum sporozoites for controlled human malaria infection: a dose-finding trial in two centres Mordmüller et al. Mordmüller et al. Malaria Journal (2015) 14:117 DOI 10.1186/s12936-015-0628-0 Mordmüller et al. Malaria Journal (2015) 14:117 DOI 10.1186/s12936-015-0628-0 RESEARCH Open Access Direct venous inoculation of Plasmodium falciparum sporozoites for controlled human malaria infection: a dose-finding trial in two centres Benjamin Mordmüller1*, Christian Supan1,KimLeeSim2, Gloria P Gómez-Pérez3, Carmen Lucelly Ospina Salazar1, Jana Held1, Stefanie Bolte1, Meral Esen1, Serena Tschan1, Fanny Joanny1, Carlos Lamsfus Calle1,SaschaJZLöhr1, Albert Lalremruata1, Anusha Gunasekera2, Eric R James2,PeterFBillingsley2,AdamRichman2,SumanaChakravarty2, Almudena Legarda3,JoseMuñoz3, Rosa M Antonijoan4,5, Maria Rosa Ballester4,5,StephenLHoffman2†, Pedro L Alonso3† and Peter G Kremsner1† Abstract Background: Controlled human malaria infection (CHMI) accelerates development of anti-malarial interventions. So far, CHMI is done by exposure of volunteers to bites of five mosquitoes carrying Plasmodium falciparum sporozoites (PfSPZ), a technique available in only a few centres worldwide. Mosquito-mediated CHMI is logistically complex, exact PfSPZ dosage is impossible and live mosquito-based interventions are not suitable for further clinical development. Methods: An open-labelled, randomized, dose-finding study in 18–45 year old, healthy, malaria-naïve volunteers was performed to assess if intravenous (IV) injection of 50 to 3,200 aseptic, purified, cryopreserved PfSPZ is safe and achieves infection kinetics comparable to published data of mosquito-mediated CHMI. An independent study site verified the fully infectious dose using direct venous inoculation of PfSPZ. Parasite kinetics were assessed by thick blood smear microscopy and quantitative real time PCR.
  • Firm Client Sanaria Wins 2020 Patents for Humanities Award from USPTO and an Annual Vaccine Industry Excellence Award

    Firm Client Sanaria Wins 2020 Patents for Humanities Award from USPTO and an Annual Vaccine Industry Excellence Award

    Firm Client Sanaria Wins 2020 Patents for Humanities Award from USPTO and an Annual Vaccine Industry Excellence Award Washington D.C. (October 6, 2020) – Sterne, Kessler, Goldstein & Fox is proud to share that our client Sanaria has been granted a Patents for Humanities Award from the United States Patent and Trademark Office (USPTO). This award recognizes Sanaria’s PfSPZ malaria vaccine – a whole parasite vaccine for malaria with an effectiveness rate exceeding that of most malaria vaccines developed in recent years. Sterne Kessler handles the patent prosecution work for the related patents. Sanaria is one of three recipients in the Medicine category and one of six recipients overall for the USPTO recognitions. As noted in the agency’s press release, the Patents for Humanities program honors “game-changing innovations that address long-standing development challenges.” In addition to the USPTO recognition, Sanaria recently earned the Highly Commended Prophylactic Vaccine award for its PfSPZ vaccines at the 13th Annual Vaccine Industry Excellence Awards. This recognition was presented virtually at the 2020 World Vaccine Congress at a ceremony held last week. Director Bonnie Nannenga-Combs, Ph.D., who leads the patent prosecution efforts for the Sterne Kessler team that works with Sanaria remarked, “Sterne Kessler congratulates Sanaria on earning two well-deserved accolades for its life-saving malaria vaccine. We are proud to work with these innovators on patenting this important technology that contributes to the global prevention of a devastating disease.” View the full list of 2020 Patents for Humanity award recipients here, and learn more about the World Vaccine Congress here.
  • PDF Hosted at the Radboud Repository of the Radboud University Nijmegen

    PDF Hosted at the Radboud Repository of the Radboud University Nijmegen

    PDF hosted at the Radboud Repository of the Radboud University Nijmegen The following full text is a publisher's version. For additional information about this publication click this link. http://hdl.handle.net/2066/171457 Please be advised that this information was generated on 2021-09-26 and may be subject to change. Am. J. Trop. Med. Hyg., 94(3), 2016, pp. 663–673 doi:10.4269/ajtmh.15-0621 Copyright © 2016 by The American Society of Tropical Medicine and Hygiene Safety, Immunogenicity, and Protective Efficacy of Intradermal Immunization with Aseptic, Purified, Cryopreserved Plasmodium falciparum Sporozoites in Volunteers under Chloroquine Prophylaxis: A Randomized Controlled Trial Guido J. H. Bastiaens, Maurits P. A. van Meer, Anja Scholzen, Joshua M. Obiero, Mansoureh Vatanshenassan, Tim van Grinsven, B. Kim Lee Sim, Peter F. Billingsley, Eric R. James, Anusha Gunasekera, Else M. Bijker, Geert-Jan van Gemert, Marga van de Vegte-Bolmer, Wouter Graumans, Cornelus C. Hermsen, Quirijn de Mast, André J. A. M. van der Ven, Stephen L. Hoffman,† and Robert W. Sauerwein*† Department of Medical Microbiology, Radboud University Medical Center, Nijmegen, The Netherlands; Sanaria Inc., Rockville, Maryland; Department of Internal Medicine, Radboud University Medical Center, Nijmegen, The Netherlands Abstract. Immunization of volunteers under chloroquine prophylaxis by bites of Plasmodium falciparum sporozoite (PfSPZ)–infected mosquitoes induces > 90% protection against controlled human malaria infection (CHMI). We studied intradermal immunization with cryopreserved, infectious PfSPZ in volunteers taking chloroquine (PfSPZ chemopro- phylaxis vaccine [CVac]). Vaccine groups 1 and 3 received 3× monthly immunizations with 7.5 × 104 PfSPZ. Control groups 2 and 4 received normal saline.
  • Review Rationale and Plans for Developing a Non-Replicating, Metabolically Active, Radiation-Attenuated Plasmodium Falciparum Sporozoite Vaccine Thomas C

    Review Rationale and Plans for Developing a Non-Replicating, Metabolically Active, Radiation-Attenuated Plasmodium Falciparum Sporozoite Vaccine Thomas C

    The Journal of Experimental Biology 206, 3803-3808 3803 © 2003 The Company of Biologists Ltd doi:10.1242/jeb.00644 Review Rationale and plans for developing a non-replicating, metabolically active, radiation-attenuated Plasmodium falciparum sporozoite vaccine Thomas C. Luke1 and Stephen L. Hoffman2,* 1Uniformed Services University of the Health Sciences, Bethesda, MD 20814, USA and 2Sanaria Inc., Rockville, MD 20852, USA *Author for correspondence (e-mail: [email protected]) Accepted 17 July 2003 Summary Annually, malaria causes >300 million clinical cases and Three practical questions must be addressed before 1·million deaths, is responsible for the loss of >1% of gross manufacturing for clinical trials: (1) can one administer domestic product (GDP) in Africa and is a serious concern the vaccine by a route that is clinically practical; (2) can for travelers. An effective vaccine could have a dramatic one produce adequate quantities of sporozoites; and (3) impact on the disease. For 20 years, scientists have tried to can sporozoites be produced with the physical develop modern, recombinant ‘subunit’ malaria vaccines. characteristics that meet the regulatory, potency and This has been difficult. In fact, there is only one safety requirements of regulatory authorities? Once these recombinant protein vaccine on the market for any questions have been answered, Sanaria will demonstrate disease, and no vaccines based on synthetic peptides, that the vaccine protects >90% of human recipients recombinant viruses, recombinant bacteria or DNA against experimental challenge with Pf sporozoites, can be plasmids. Most vaccines are based on attenuated or produced with an efficiency that makes it economically inactivated whole pathogens or material derived directly feasible, and protects >90% of African infants and from the infectious agent.