An Extirpated Lineage of a Threatened Frog Species Resurfaces in Southern California

An extirpated lineage of a threatened frog species resurfaces in southern California

A DAM R. BACKLIN,JONATHAN Q. RICHMOND,ELIZABETH A. GALLEGOS C LINTON K. CHRISTENSEN and R OBERT N. FISHER

Abstract Southern California has experienced widespread s, with extirpations known from San Diego, San amphibian declines since the s. One species, the Bernardino, Orange and Riverside counties. Rana draytonii Vulnerable California red-legged frog Rana draytonii,is is categorized as Vulnerable on the IUCN Red List now considered to be extirpated from most of southern (Hammerson, ) and listed as threatened by the U.S. California. In February  a population of R. draytonii Fish and Wildlife Service. was discovered in the southern foothills of the San The last extant population of R. draytonii known from Bernardino Mountains of Riverside County, California, this four-county area occurred on the Santa Rosa Plateau near the edge of the species’ historical distribution. This in western Riverside County, where it was extirpated in population belongs to an mtDNA lineage that was pre- the early s. In February , however, two individuals sumed to be extirpated within the USA but is still extant of R. draytonii were observed at Whitewater Preserve, in Baja California, Mexico. This discovery increases the c.  km east–north-east of the Santa Rosa Plateau in the potential for future, evolutionarily informed translocations southern foothills of the San Bernardino Mountains. We within the southern portion of this species’ range in present results of a subsequent survey at The Wildlands California. Conservancy’s Whitewater Preserve and a preliminary genetic analysis to identify the closest living relatives of Keywords Amphibian conservation, frog, Rana draytonii, these frogs. southern California The Whitewater Preserve lies in Whitewater Canyon at the he California red-legged frog Rana draytonii is the base of the San Bernardino Mountains in Riverside County,  largest native frog (length .–. cm) (Hayes & California (Fig. ). Before The Wildlands Conservancy ac- T  Miyamoto, ;Stebbins&McGinnis,) in the United quired the property in through a partnership with States west of the Mississippi River and was heavily Friends of the Desert Mountains and The Coachella exploited as a food resource during the Gold Rush era Valley Mountains Conservancy, it was a privately owned (Jennings & Hayes, ). More recently, R. draytonii and trout farm that consisted of several artificial ponds built in  other amphibians in southern California have suffered de- . These concrete- and earthen-lined ponds are filled clines as a result of habitat loss, presence of non-native spe- from wells, and French drains control the rate and direction cies, and pesticide pollution (Jennings & Hayes, ; Fisher of flow. Adjacent terrestrial habitat varies from paved stone & Shaffer, ; Davidson et al., ; Fellers, ; Backlin sidewalks with public access to natural surroundings with et al., ; Thomson et al., ), and are actively managed restricted access. to stabilize populations and promote conservation. The A few days after the first sightings of R. draytonii at the range of R. draytonii extends from Mendocino County Whitewater Preserve we conducted a visual daytime search north of the San Francisco Bay and Butte County in the for frogs, tadpoles and egg masses, followed by a night-time Sierra Nevada, south along the coastal mountains of eye shine search for adult frogs. Captured frogs were California into northern Baja California, Mexico weighed, measured (snout-to-urostyle length), and geore- (Peralta-Garcia et al., ; Thomson et al., ). In south- ferenced using a global positioning system. Survey work   ern California, dramatic declines have occurred since the was authorized by a U.S. Fish and Wildlife Service (a)( ) (A) Recovery Permit (TE--) and a California Department of Fish and Wildlife Scientific Collecting Permit (SCP). ADAM R. BACKLIN (Corresponding author) and ELIZABETH A. GALLEGOS U.S. To improve our understanding of the origin of these Geological Survey, Western Ecological Research Center, San Diego Field Station-Santa Ana Office, 1801 East Chestnut Avenue, Santa Ana, CA 92701, frogs, we extracted DNA from a small toe clip using a USA. E-mail [email protected] Qiagen DNeasy Kit (Qiagen Inc., Valencia, USA) and JONATHAN Q. RICHMOND and ROBERT N. FISHER U.S. Geological Survey, Western Sanger-sequenced a region of the cytochrome b mitochon- Ecological Research Center, San Diego Field Station, 4165 Spruance Road, San drial gene ( base-pairs), which has been used to good ef- Diego, California, USA fect for identifying regionally specific mtDNA clades CLINTON K. CHRISTENSEN The Wildlands Conservancy, Whitewater Preserve,  Whitewater, California, USA (Richmond et al., ). Sequencing was performed on a  Received  March . Revision requested  May . xl DNA Analyzer at Genewiz (La Jolla, California, Accepted  July . First published online  November . USA). We used DnaSP . (Librado & Rozas, )to

Oryx, 2018, 52(4), 718–722 © 2017 Fauna & Flora International. This is a work of the U.S. Government and is not subject to copyright protection in the United States. Downloaded from https://www.cambridge.org/core. IP address: 170.106.40.40, on 01 Oct 2021 at 23:49:21, subject to the Cambridge Core terms of use, availabledoi:10.1017/S0030605317001168 at https://www.cambridge.org/core/terms. https://doi.org/10.1017/S0030605317001168 Extirpated frog discovered in California 719

FIG. 1 The location of Whitewater Canyon in Riverside County, California, USA, and other sites in California and Mexico where the California red-legged frog Rana draytonii is known to occur, including the Santa Rosa Plateau, from where the species was recently extirpated.

match the haplotype sequence against a large cytochrome b mtDNA lineage that was considered to be extirpated in database representing the full range of R. draytonii California. Until now, the only members of this lineage in (GenBank accession: MG). California were from the recently extirpated Santa Rosa Our survey revealed only one R. draytonii adult, captured Plateau population (Shaffer et al., ; Richmond et al., on  February  (snout–urostyle length = . mm; ). Because this haplotype extends from the San weight = . g). No tadpoles or egg masses were detected. Bernardino Mountains south into the Sierra San Pedro A week previously, Whitewater Preserve staff detected one Mártir of Baja California, it is reasonable to assume that large adult, which was not captured, and one noticeably Whitewater and Sierra San Pedro Mártir R. draytonii are smaller adult, which was captured, photographed and representative of the lineage that was present historically released. Based on certain aspects of colour pattern across southern California. This finding is consistent with (Marlow et al., ) and body size, we are confident that the biogeography of southern California given that these these two frogs were different individuals than the one we sites form portions of the Peninsular Ranges, and the fact captured in this survey (Plate ). that many species co-occurring in the Peninsular Ranges The cytochrome b haplotype from Whitewater is show a common phylogeographical history (Vandergast identical to a haplotype recovered from the Santa Rosa et al., ). Plateau population, in Riverside County, California, and Our findings suggest that Whitewater Canyon may be an to all extant R. draytonii populations in northern Baja appropriate donor site for re-introducing R. draytonii to ex- California, Mexico (Table ). This haplotype differs tirpated sites in southern California. Following guidance from the closest known R. draytonii populations in the from the U.S. Fish and Wildlife Service Recovery Plan for Santa Monica Mountains by  mutations (uncorrected R. draytonii (USFWS, ) and previous translocation ef- p-distance = −.) and from the northern San Gabriel forts (Rathbun & Schneider, ), successful repatriation Mountains by  mutations (uncorrected p-distance = .; programmes for R. draytonii have already taken place at Fig. ). Pinnacles National Park (P. Johnson, pers. comm.), The discovery of R. draytonii in Whitewater Canyon re- Golden Gate National Recreation Area (D. Fong, pers. duces a c.  km gap between the southernmost population comm.) and in the Santa Monica Mountains National within the USA (Santa Monica Mountains) and the north- Recreation Area (K. Delaney, pers. comm.), with similar ernmost population in Baja California, Mexico (Arroyo San efforts currently being pursued at Yosemite National Park Rafael; Fig. ), and re-establishes the presence of a unique (R. Grasso, pers. comm.).

Oryx, 2018, 52(4), 718–722 © 2017 Fauna & Flora International. This is a work of the U.S. Government and is not subject to copyright protection in the United States. Downloadeddoi:10.1017/S0030605317001168 from https://www.cambridge.org/core. IP address: 170.106.40.40, on 01 Oct 2021 at 23:49:21, subject to the Cambridge Core terms of use, available at https://www.cambridge.org/core/terms. https://doi.org/10.1017/S0030605317001168 720 A. R. Backlin et al.

PLATE 1 The first (a) and second (b) R. draytonii individuals captured at the Whitewater Preserve in Whitewater Canyon, Riverside County, California (Fig. ); (c) R. draytonii from Arroyo Santo Domingo in Baja California (Fig. ); (d) R. draytonii from East Las Virgenes Canyon in the Santa Monica Mountains, Ventura County, California (Fig. ). (Photograph credits: (a) CKC; (b) EAG; (c) JQR; (d) ARB)

TABLE 1 Representative cytochrome b haplotypes for Rana draytonii in southern California (invariable sites removed from the  base- pair sequence; * identifies nucleotide sites in the haplotype sequence where the character states are unique to the Baja mtDNA lineage). Haplotypes are arranged from south to north (–) and extend from Arroyo San Rafael in the Sierra San Pedro Martir of Baja California to the Cuyama River in northern Santa Barbara County, California.

Haplotype Sequence Locations ** * ****** * ** * * Hap_1 CTAGTTGCGCATTTTTGCTTGTAGTT Santa Rosa Plateau, Whitewater Canyon, Arroyo San Rafael Hap_2 TCGGTTATATCCCCCCGTCTCCGATC East Las Virgenes Canyon, Santa Monica Mountains Hap_3 TCAGTTGTATCCCCTCATTTCCAATC Santa Clara River (Aliso & San Francisquito Canyons) Ventura River Hap_4 TCAACTGTATCCCCTTGTTCCCAACC Vandenberg Air Force Base Hap_5 TCAGCCGTATCCCCTTGTTCCCAACC Cuyama River

The recent discovery of R. draytonii at the Whitewater the raccoon population in recent years could have alleviated Preserve raises some question about their source. The for- predation constraints, and heavy rains during winter mer presence of trout and a large raccoon population may – might have facilitated downstream dispersal have kept the frogs below a detectability threshold, given from sites with potentially suitable habitat c. .–. km that non-native predatory fish and a host of small mammals upstream. We cannot rule out the possibility that R. drayto- (including raccoons) are known to prey on this species nii were artificially transplanted into these ponds, but this (Fellers, ). Trout removal and managed thinning of would have required that frogs were moved from either

Mexico or an unknown site in southern California with the FISHER, R.N. & SHAFFER, H.B. () The decline of amphibians appropriate genetic background. Genome sequencing will in California’s Great Central Valley. Conservation Biology, , – provide more definitive information on the source of the in- . HAMMERSON,G.() Rana draytonii.InThe IUCN Red List of dividual captured in our survey in the coming months. Threatened Species : e.TA. Http://dx.doi.org/. Nonetheless, the evidence presented here and the documen- /IUCN.UK..RLTS.TA.en [accessed  ted historical presence of R. draytonii in nearby areas August ]. (VertNet, ) favours the hypothesis that these frogs are HAYES, M.P. & MIYAMOTO, M.M. () Biochemical, behavioral and native. body size differences between Rana aurora and R. a. draytonii. Copeia, , –. Current management at the Whitewater Preserve is de- JENNINGS, M.R. & HAYES, M.P. () Pre- overharvest of veloping a strategy to conserve this population, and since California red-legged frogs (Rana aurora draytonii): the our survey effort, two additional frogs have been observed inducement for bullfrog (Rana catesbeiana) introduction. on the property. Plans to continue monitoring the site are Herpetologica, , –.  also underway. While the fate of R. draytonii remains uncer- JENNINGS, M.R. & HAYES, M.P. ( ) Decline of native ranid frogs in the desert southwest. In Herpetology of the North American tain the potential for former trout farming practices to be Deserts: Proceedings of a Symposium (eds P.R. Brown & J. shifted to frog farming for translocation efforts in southern W. Wright), pp. –. Southwestern Herpetologists Society, California merits consideration. Ironically, the one practice Van Nuys, USA. that may have been responsible for the species’ decline at LIBRADO,P.&ROZAS,J.() DnaSP v: a software for this site may potentially be used to save it. comprehensive analysis of DNA polymorphism data. Bioinformatics, , –. MARLOW, K.R., WISEMAN, K.D., WHEELER, C.A., DRENNAN, J.E. & JACKMAN, R.E. () Identification of individual foothill Acknowledgements yellow-legged frogs (Rana boylii) using chin pattern photographs: a non-invasive and effective method for small population studies. This work was supported by the U.S. Geological Survey’s Herpetological Review, , –. (USGS) Science Support Partnership (SSP) with the U.S. PERALTA-GARCIA, A., HOLLINGSWORTH, B.D., RICHMOND, J.Q., Fish and Wildlife Service (USFWS) and the USGS VALDEZ-VILLAVICENCIO, J.H., RUIZ-CAMPOS, G., FISHER, R.N. et al. () Status of the California red-legged frog (Rana draytonii) Ecosystems Mission Area. We thank the Whitewater in the state of Baja California, México. Herpetological Conservation Preserve staff, particularly Jack Thompson and Jose and Biology, , –. Cortez for site access and field assistance. Rebecca Gordon RATHBUN, G.B. & SCHNEIDER,J.() Translocation of California (USFWS) and Jack Crayon (California Department of Fish red-legged frogs (Rana aurora draytonii). Wildlife Society Bulletin,  – and Wildlife) provided support for the survey effort. This is , . RICHMOND, J.Q., BACKLIN, A.R., TATARIAN, P.J., SOLVESKY, B.G. & contribution  of the USGS Amphibian Research and FISHER, R.N. () Population declines lead to replicate patterns of Monitoring Initiative. The use of trade names does not internal range structure at the tips of the distribution of the imply endorsement by the U.S. Federal Government. California red-legged frog (Rana draytonii). Biological Conservation, , –. SHAFFER, H.B., FELLERS, G.M., VOSS, S.R., OLIVER, J.C. & PAULY,G. B. () Species boundaries, phylogeography and conservation Author contributions genetics of the red-legged frog (Rana aurora/draytonii) complex. Molecular Ecology, , –. ARB, EAG and CKC conducted field surveys. CKC discov- STEBBINS, R.C. & MCGINNIS, S.M. () Field Guide to Amphibians ered this R. draytonii population. JQR performed genetic and Reptiles of California. University of California Press, Berkeley analysis. ARB, JQR and RNF framed the information in a and Los Angeles, USA. broader conservation context. ARB and JQR wrote the THOMSON, R.C., WRIGHT, A.N. & SHAFFER, H.B. () California article. Amphibian and Reptile Species of Special Concern. University of California Press, Oakland, USA. USFWS (UNITED STATES FISH AND WILDLIFE SERVICE)() Recovery Plan for the California Red-legged Frog (Rana aurora References draytonii). USFWS, Portland, USA. VANDERGAST, A.G., BOHONAK, A.J., HATHAWAY, S.A., BOYS,J.&  BACKLIN, A.R., HITCHCOCK, C.J., GALLEGOS, E.A., YEE, J.L. & FISHER, R.N. ( ) Are hotspots of evolutionary potential FISHER, R.N. () The precarious persistence of the Endangered adequately protected in southern California? Biological Sierra Madre yellow-legged frog Rana muscosa in southern Conservation, , –. California, USA. Oryx, , –. VERTNET () Http://portal.vertnet.org [accessed  June ]. DAVIDSON, C., SHAFFER, H.B. & JENNINGS, M.R. () Declines of the California red-legged frog: climate, UV-B, habitat, and pesticides hypotheses. Ecological Applications, , –. Biographical sketches FELLERS, G.M. () Rana draytonii.InAmphibian Declines: The Conservation Status of United States Species (ed. M. Lannoo), ADAM BACKLIN is an ecologist studying conservation of herpetofaunal pp. –. University of California Press, Berkeley, USA. and freshwater fish in the western USA. J ONATHAN R ICHMOND’ S

research focuses on the conservation genetics of threatened and en- Wildlands Conservancy Ranger and is interested in conservation dangered reptile and amphibian species in western North America and wildlife photography. R OBERT F ISHER’s research focuses on and on Pacific Islands. ELIZABETH GALLEGOS is a wildlife biologist the impacts of urbanization and wildfires on southern California. studying endangered and threatened amphibians, and is interested He also studies the evolution and conservation biology of Pacific in the conservation of herpetofauna. CLINTON CHRISTENSEN is a Island herpetofauna.