DOCSLIB.ORG

A Second Gene, Vpreb in the X5 Locus of the Mouse, Which Appears to Be Selectively Expressed in Pre-B Lymphocytes

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text

Load more

The EMBO Journal vol.6 no.8 pp.2267-2272, 1987 A second gene, VpreB in the X5 locus of the mouse, which appears to be selectively expressed in pre-B lymphocytes Akira Kudo and Fritz Melchers respectively. Exon I shows no strong homology to any known Basel Institute for Immunology, Postfach, CH-4058 Grenzacherstrasse 487, gene. The putative protein encoded by the X5 gene, although not Basel, Switzerland yet identified, is a potential candidate for heterodimer formation Communicated by F.Melchers with IgH chains and thereby, may influence the function which H chains play in pre-B cell development. We describe here, The murine gene X5 is selectively expressed in pre-B lym- 4.6 kb upstream of X5 another gene named VpreB1 composed of phocytes. Of the three exons encoding X5, exons II and III two exons which is selectively expressed in pre-B cell lines as show strong homologies to immunoglobulin X light (L) chain 0.85 kb mRNA. The putative protein encoded by this gene is gene segments, i.e. to Jx intron and exon, and Cx exon se- a potential candidate for association with the X5 protein and quences respectively. We have now found, 4.6 kb upstream may, therefore, also influence the role of H chains in pre-B cell of X5, another gene composed of two exons which is selec- development. tively expressed in pre-B cell lines as a 0.85 kb mRNA poten- tially coding for a protein of 142 amino acids including a 19 Results amino acid-long signal peptide. The 5' sequences of this gene show homologies to sequences encoding the variable regions Isolation of the VpreBJ cDNA clone pZ121 of x and X L chains and of heavy (H) chains. The deduced In a search for possible exons upstream of X5 with functions in amino acid sequence contains the consensus cysteine residues the regulation of expression of this gene, we probed total RNA as well as other consensus amino acids at positions which preparations of 70Z/3 pre-B cell lines (X5+) and of EL4 thymic characterize immunoglobulin (Ig) domains. We call the se- lymphoma cell lines (X5 ) by Northern blot analysis with dif- cond gene ferent radiolabelled segments of the 7pB12 genomic clone (Kudo VpreB. The 3' end of VpreB encoding the 26 car- et boxyl terminal amino acids shows no homology to any known al., 1987) containing the X5 gene plus 10 kb upstream of it nucleotide sequence. (Figure 3). The BamHI-XbaI fragment of the 5' region of 7pB12 The putative protein encoded by VpreB was found to hybridize to 70Z/3, but not to is a potential candidate for association with the putative pro- EIA total RNA tein encoded by X5, and thereby a candidate for association with H chains in pre-B cells. Southern blot analysis of DNA t N 'rtNcJo from liver (germ line) and 70Z/3 pre-B cell lines reveals two J CD I genes which hybridize to the VpreB gene. We call VpreBl the 11 t- r0 gene which is found 5' of X5. The other gene, called VpreB2, which has not yet been located within the genome, shows 97% nucleotide sequence homology to VpreB1 in an area of 1 kb which covers the coding region of the gene. Both VpreBl and VpreB2 appear not to be rearranged during B cell development. Key words: gene organization/Ig super gene farnily/X5/pre-B cell Introduction 0.85kb-- a -1.2 kb The development of B lymphocytes from pluripotent stem cells is one of the best studied lineages of eukaryotic cell differentia- tion (Tonegawa, 1983; Melchers et al., 1977). Different stages of this development are defined by rearrangements of gene segments encoding immunoglobulin (Ig) H and L chains, by the expression of cell surface markers, and by reactions of cells to stimuli and growth factors. Transformed cell lines and tumors exist which represent these different stages. They have facilitated -vpre B1 A5 the identification of a gene, called X5, (Sakaguchi and Melchers, 1986) which is selectively expressed in pre-B cells, but not in Fig. 1. Northern analysis of 10 jig total RNA from 70Z/3 pre-B lymphoma and from ELM thymic lymphoma cells probed with the BamHI-XbaI frag- mature B cells or Ig-secreting plasma cells, nor in any other cell ment of 7pB12 (see Figure 3, subclone a) and with the X5 KpnI-PstI frag- lineage tested thus far (Sakaguchi et al., 1986). The X5 gene is ment (see Figure 3, subclone b). The same filter was hybridized first with expressed as a 1.2 kb mRNA coding for a 209 amino acid-long the oligo-labelled pZ121, washed with 0.1 x SSC, 0.1% SDS at 500C, ex- protein which includes a potential 30 amino acid-long signal pep- posed to X-ray film (Kodak XS-1) then the radiolabelled probe was washed et Of the three exons off at 0.1 x SSC, 0.1I% SDS at 95°C, and thereafter exposed to the second tide (Kudo al., 1987). encoding X5, ex- oligolabelled probe, pZ183-1 (X5) (Sakaguchi and Melchers, 1976) again ons II and Ill show strong homologies to X light (L) chain gene washed in 0.1 x SSC, 0.1% SDS at 500C, and again exposed to X-ray segment, i.e. to J> intron and exon, and Cx exon sequences, film. ( IRL Press Limited, Oxford, England 2267 A.Kudo and F.Melchers LItLIFOwitturie.rE3S '-4[ l. -K;rlil rx'-, IiInreagetni _' JI -I US I! SC , - 0 .. .- w m Y ->> f' ._- - ~ ~~~~ , .oric ;0_*,4t Fig. 2. Quantitative Northern dot blot analysis of pZl21 (VpreBl) transcripts in cell lines. Serial 2-fold dilutions were blotted on nitrocellulose filters for hybridization with the oligo-labelled EcoRI-AccI fragment of pZl21. Filters were first probed with the radiolabelled pZl21 cDNA (I) then washed and thereafter probed with radiolabelled (3-actin probe (Alonso et al., 1986), (II) 'Conc.' indicates RNA amounts between 1 and 5 jg per dot. EcoR v PstI KpnI PstI AccI pZ121 5# r 1 3' 4 4- 1 OO I 1 OObp Vpre B1 A5 a b 'A _- X E S B X B P K pEE F E 1 7pB12 5 4 i 4 ._ 4 4 i . .4 i _ 4 . 31 I I I Ki m g/Bg1;' I kb' 7pB12-2 -g 1K $ I 1 -*.- -- + . 4 . No 100bp Fig. 3. Restriction map and sequence strategies of the pZ121 cDNA clone and the genomic subclone 7pB12-2, both containing VpreBl. The 3.5 kb BamHI-XbaI fragment 7pB12-2 was subcloned into PUC-18 and a more detailed restriction map was determined. Restriction sites are B, BamHI; Bg, Bgll; P, PstI; E, EcoRI; K, KpnI; S, SalI; X, XbaI. The positions of the two exons in the VpreBI gene are indicated with I and II. The arrows indicate the direc- tion of sequencing lengths of the sequences as determined after subcloning fragments into M13 vectors. a and b show the 3.5 kb 7pB12 BamHI-XbaI frag- ment and the 0.7 kb 7pB12 PstI-KpnI fragment which were used as VpreBI and X5 specific probes in Northern blot analyses. 2268 VpreB genes selectively expressed in pre-B cells 7pB12-2 GATCTGCTTATTTGGGGCTCAGCCTCTCAAGGGGAGTTGAGGTCACTCTCCCTCAGGGAGACAAGCCCGCAGTCCTGGGTTCTGGCCCATGACGTTCCAGCAGGTGCTTCCTCCCAGAAT 120 7pB70-1 ---------C-G-----------------G-------------------------------TG-----A------------------------T-------------------------- 7pB12-2 GCTTCCCTGGGTCAAACCCAGAGCCACAAAGGC TTCCATTAGACCATTCTGGTAAG TGACAGAGTCACAGAGCCCAGAAAGCC TGGGAGGGTGGTGAGCAGGAACCAGGGGTGCAG TGAC 240 pZ121 7pB70-1 -----------------------------------------------------------------T--------------A--------------------------------------- -19 M A WS T s v L L M 7pB12-2 CCTCTCCCCAAAGCAGGGAGGAGAG TGCTTCCCAGC TGGTCAGGGCCCAGGAGCAG TGGCTGTAGGGGGCAGGG TGCTGCAGGTCTGGAGCCATGGCCTGGACG TCTGTCCTGCTCATGC 360 pZ121 7pB70-1 -----------------A----A---------------------T------------------------------------------------------------------------- -10 -1 +1 L L A Y L T 4G C G P Q 7pB12-2 TGCTGGCCTATCTCACAGGTAAGGAAACTCTTGGGGCCCAGGGC TTCT TTGCTCCTCCT ATGGCCTTGCTCTGCCCCAG TGATGGACATGC TTCTATCT TCTCAGGTTGTGGCCCTCAGC 480 pZ121 7pB70-1 --------C-C------------ G-----------T---------c---C--------c----------------------------------------------------------- (H) +10 +20 +30 +40 P M V H Q P P L A S S S L G A T I R L S C T L S N D H N I G I Y S I Y W Y Q Q R 7pB12-2 CCATGGTGCATCAGCCACCAT TAGCATCT TCT TCCCTTGGAGCCACCATCCGCCTCTCCTGTACCCTGAGCAACGACCATAACATTGGCAT TTACAGCATTTACTGGTACCAGCAGAGGC 600 pZ121 7p870-1 (S) +50 +60 +70 +80 P G H P P R F L L R Y F S H S D K H Q G P D I P P R F S G S K D T T R N L G Y L 7pB12-2 CGGGCCACCCTCCCAGGT TCCTGCTGAGA TACTTCTCACACTCAGACAAGCACCAGGG TCCCGAT ATCCCACC TCGCTTCTCCGGGTCCAAAGATACGACCAGGAACC TGGGGTATCTGA 720 pZ121 7pB70-1 (A) +90 +100 +110 +120 S I S E L Q P E D Q A V Y Y C A V G L R S Q E K K R M E R E W E G E K S Y T D L 7pB12-2 GCATCT CTGAACTGCAGCC TGAGGACGAGGCTG TGTATTACTGTGCCGTGGGGC TCCGGAGCCAGGAAAAGAAGAGGATGGAGAGGGAG TGGGAAGGAGAAAAGTCG TATACAGATTTGG 840 pZ121 ----------------------------------___-----------------------------------------__--------------------------------- _------ 7pB70-1 -------------------------------------------.C--TC-----------------.C-----------A--------.A---------------------------------- (H) G S* 7pB12-2 GATCTTAGGCTCTGGAGACATTCAGACCCTGAACTGAAGACAGAGTTTGCTTTGCTCGGCTAGTCTGGTATGGGAAGGAGGGGTAGAACGTGAGGTTTTGCAGAGCCTAGAAGATGGAAT 960 pZ121 7pB70-1 --- -------------- ----- ----- ------------------C---- ------------------- -------------------T---G- -C ----------------------G- 7pB12-2 TATGCAGCTTTTCCTTGTTCTGCGGTGTTGCTATGAGCCCCCATTGGAGGCTGGATTGTAGAATTAAAGCTGTTTTTACTGAATTTGGTCTGG 1053 pZ121 --------------------------------------------------------------------------------- poly A -20 7pB70-1 --------------------------------------------C-----------C-------------------------G---------- Fig. 4. Nucleotide sequence and deduced amino acid sequence of the VpreBl and VpreB2 gene. For VpreBl nucleotide sequences of both the genomic form (7pB12-2) as well as of the cDNA (pZl2l) are given. The cDNA sequences are identical with the genomic sequences and are, therefore, only indicated by dashes (-) and follow the genomic sequence in numbering. Numbering of amino acid residues starts with -19 as the first position of the leader and proceeds to +1 as the first position of the putative mature protein. The sequence overlined by closed circles (eeeeeee) shows the poly(A) addition signal sequence (Proudfoot and Brownlee, 1976).
Recommended publications
  • NIH Public Access Author Manuscript Immunogenetics

    NIH Public Access Author Manuscript Immunogenetics

    NIH Public Access Author Manuscript Immunogenetics. Author manuscript; available in PMC 2013 August 01. NIH-PA Author ManuscriptPublished NIH-PA Author Manuscript in final edited NIH-PA Author Manuscript form as: Immunogenetics. 2012 August ; 64(8): 647–652. doi:10.1007/s00251-012-0626-0. A VpreB3 homologue from a marsupial, the gray short-tailed opossum, Monodelphis domestica Xinxin Wang, Zuly E. Parra, and Robert D. Miller Center for Evolutionary & Theoretical Immunology, Department of Biology, University of New Mexico, Albuquerque, NM, 87131, USA Robert D. Miller: [email protected] Abstract A VpreB surrogate light (SL) chain was identified for the first time in a marsupial, the opossum Monodelphis domestica. Comparing the opossum VpreB to homologues from eutherian (placental mammals) and avian species supported the marsupial gene being VpreB3. VpreB3 is a protein that is not known to traffic to the cell surface as part of the pre-B cell receptor. Rather, VpreB3 associates with nascent immunoglobulin (Ig) chains in the endoplasmic reticulum. Homologues of other known SL chains VpreB1, VpreB2, and λ5, which are found in eutherian mammals, were not found in the opossum genome, nor have they been identified in the genomes of non-mammals. VpreB3 likely evolved from earlier gene duplication, independent of that which generated VpreB1 and VpreB2 in eutherians. The apparent absence of VpreB1, VpreB2, and λ5 in marsupials suggests that an extra-cellular pre-B cell receptor containing SL chains, as it has been defined in humans and mice, may be unique to eutherian mammals. In contrast, the conservation of VpreB3 in marsupials and its presence in non-mammals is consistent with previous hypotheses that it is playing a more primordial role in B cell development.
  • Human and Mouse CD Marker Handbook Human and Mouse CD Marker Key Markers - Human Key Markers - Mouse

    Human and Mouse CD Marker Handbook Human and Mouse CD Marker Key Markers - Human Key Markers - Mouse

    Welcome to More Choice CD Marker Handbook For more information, please visit: Human bdbiosciences.com/eu/go/humancdmarkers Mouse bdbiosciences.com/eu/go/mousecdmarkers Human and Mouse CD Marker Handbook Human and Mouse CD Marker Key Markers - Human Key Markers - Mouse CD3 CD3 CD (cluster of differentiation) molecules are cell surface markers T Cell CD4 CD4 useful for the identification and characterization of leukocytes. The CD CD8 CD8 nomenclature was developed and is maintained through the HLDA (Human Leukocyte Differentiation Antigens) workshop started in 1982. CD45R/B220 CD19 CD19 The goal is to provide standardization of monoclonal antibodies to B Cell CD20 CD22 (B cell activation marker) human antigens across laboratories. To characterize or “workshop” the antibodies, multiple laboratories carry out blind analyses of antibodies. These results independently validate antibody specificity. CD11c CD11c Dendritic Cell CD123 CD123 While the CD nomenclature has been developed for use with human antigens, it is applied to corresponding mouse antigens as well as antigens from other species. However, the mouse and other species NK Cell CD56 CD335 (NKp46) antibodies are not tested by HLDA. Human CD markers were reviewed by the HLDA. New CD markers Stem Cell/ CD34 CD34 were established at the HLDA9 meeting held in Barcelona in 2010. For Precursor hematopoetic stem cell only hematopoetic stem cell only additional information and CD markers please visit www.hcdm.org. Macrophage/ CD14 CD11b/ Mac-1 Monocyte CD33 Ly-71 (F4/80) CD66b Granulocyte CD66b Gr-1/Ly6G Ly6C CD41 CD41 CD61 (Integrin b3) CD61 Platelet CD9 CD62 CD62P (activated platelets) CD235a CD235a Erythrocyte Ter-119 CD146 MECA-32 CD106 CD146 Endothelial Cell CD31 CD62E (activated endothelial cells) Epithelial Cell CD236 CD326 (EPCAM1) For Research Use Only.
  • Supplementary Table 1: Adhesion Genes Data Set

    Supplementary Table 1: Adhesion Genes Data Set

    Supplementary Table 1: Adhesion genes data set PROBE Entrez Gene ID Celera Gene ID Gene_Symbol Gene_Name 160832 1 hCG201364.3 A1BG alpha-1-B glycoprotein 223658 1 hCG201364.3 A1BG alpha-1-B glycoprotein 212988 102 hCG40040.3 ADAM10 ADAM metallopeptidase domain 10 133411 4185 hCG28232.2 ADAM11 ADAM metallopeptidase domain 11 110695 8038 hCG40937.4 ADAM12 ADAM metallopeptidase domain 12 (meltrin alpha) 195222 8038 hCG40937.4 ADAM12 ADAM metallopeptidase domain 12 (meltrin alpha) 165344 8751 hCG20021.3 ADAM15 ADAM metallopeptidase domain 15 (metargidin) 189065 6868 null ADAM17 ADAM metallopeptidase domain 17 (tumor necrosis factor, alpha, converting enzyme) 108119 8728 hCG15398.4 ADAM19 ADAM metallopeptidase domain 19 (meltrin beta) 117763 8748 hCG20675.3 ADAM20 ADAM metallopeptidase domain 20 126448 8747 hCG1785634.2 ADAM21 ADAM metallopeptidase domain 21 208981 8747 hCG1785634.2|hCG2042897 ADAM21 ADAM metallopeptidase domain 21 180903 53616 hCG17212.4 ADAM22 ADAM metallopeptidase domain 22 177272 8745 hCG1811623.1 ADAM23 ADAM metallopeptidase domain 23 102384 10863 hCG1818505.1 ADAM28 ADAM metallopeptidase domain 28 119968 11086 hCG1786734.2 ADAM29 ADAM metallopeptidase domain 29 205542 11085 hCG1997196.1 ADAM30 ADAM metallopeptidase domain 30 148417 80332 hCG39255.4 ADAM33 ADAM metallopeptidase domain 33 140492 8756 hCG1789002.2 ADAM7 ADAM metallopeptidase domain 7 122603 101 hCG1816947.1 ADAM8 ADAM metallopeptidase domain 8 183965 8754 hCG1996391 ADAM9 ADAM metallopeptidase domain 9 (meltrin gamma) 129974 27299 hCG15447.3 ADAMDEC1 ADAM-like,
  • Flow Reagents Single Color Antibodies CD Chart

    Flow Reagents Single Color Antibodies CD Chart

    CD CHART CD N° Alternative Name CD N° Alternative Name CD N° Alternative Name Beckman Coulter Clone Beckman Coulter Clone Beckman Coulter Clone T Cells B Cells Granulocytes NK Cells Macrophages/Monocytes Platelets Erythrocytes Stem Cells Dendritic Cells Endothelial Cells Epithelial Cells T Cells B Cells Granulocytes NK Cells Macrophages/Monocytes Platelets Erythrocytes Stem Cells Dendritic Cells Endothelial Cells Epithelial Cells T Cells B Cells Granulocytes NK Cells Macrophages/Monocytes Platelets Erythrocytes Stem Cells Dendritic Cells Endothelial Cells Epithelial Cells CD1a T6, R4, HTA1 Act p n n p n n S l CD99 MIC2 gene product, E2 p p p CD223 LAG-3 (Lymphocyte activation gene 3) Act n Act p n CD1b R1 Act p n n p n n S CD99R restricted CD99 p p CD224 GGT (γ-glutamyl transferase) p p p p p p CD1c R7, M241 Act S n n p n n S l CD100 SEMA4D (semaphorin 4D) p Low p p p n n CD225 Leu13, interferon induced transmembrane protein 1 (IFITM1). p p p p p CD1d R3 Act S n n Low n n S Intest CD101 V7, P126 Act n p n p n n p CD226 DNAM-1, PTA-1 Act n Act Act Act n p n CD1e R2 n n n n S CD102 ICAM-2 (intercellular adhesion molecule-2) p p n p Folli p CD227 MUC1, mucin 1, episialin, PUM, PEM, EMA, DF3, H23 Act p CD2 T11; Tp50; sheep red blood cell (SRBC) receptor; LFA-2 p S n p n n l CD103 HML-1 (human mucosal lymphocytes antigen 1), integrin aE chain S n n n n n n n l CD228 Melanotransferrin (MT), p97 p p CD3 T3, CD3 complex p n n n n n n n n n l CD104 integrin b4 chain; TSP-1180 n n n n n n n p p CD229 Ly9, T-lymphocyte surface antigen p p n p n
  • Supplementary Material DNA Methylation in Inflammatory Pathways Modifies the Association Between BMI and Adult-Onset Non- Atopic

    Supplementary Material DNA Methylation in Inflammatory Pathways Modifies the Association Between BMI and Adult-Onset Non- Atopic

    Supplementary Material DNA Methylation in Inflammatory Pathways Modifies the Association between BMI and Adult-Onset Non- Atopic Asthma Ayoung Jeong 1,2, Medea Imboden 1,2, Akram Ghantous 3, Alexei Novoloaca 3, Anne-Elie Carsin 4,5,6, Manolis Kogevinas 4,5,6, Christian Schindler 1,2, Gianfranco Lovison 7, Zdenko Herceg 3, Cyrille Cuenin 3, Roel Vermeulen 8, Deborah Jarvis 9, André F. S. Amaral 9, Florian Kronenberg 10, Paolo Vineis 11,12 and Nicole Probst-Hensch 1,2,* 1 Swiss Tropical and Public Health Institute, 4051 Basel, Switzerland; [email protected] (A.J.); [email protected] (M.I.); [email protected] (C.S.) 2 Department of Public Health, University of Basel, 4001 Basel, Switzerland 3 International Agency for Research on Cancer, 69372 Lyon, France; [email protected] (A.G.); [email protected] (A.N.); [email protected] (Z.H.); [email protected] (C.C.) 4 ISGlobal, Barcelona Institute for Global Health, 08003 Barcelona, Spain; [email protected] (A.-E.C.); [email protected] (M.K.) 5 Universitat Pompeu Fabra (UPF), 08002 Barcelona, Spain 6 CIBER Epidemiología y Salud Pública (CIBERESP), 08005 Barcelona, Spain 7 Department of Economics, Business and Statistics, University of Palermo, 90128 Palermo, Italy; [email protected] 8 Environmental Epidemiology Division, Utrecht University, Institute for Risk Assessment Sciences, 3584CM Utrecht, Netherlands; [email protected] 9 Population Health and Occupational Disease, National Heart and Lung Institute, Imperial College, SW3 6LR London, UK; [email protected] (D.J.); [email protected] (A.F.S.A.) 10 Division of Genetic Epidemiology, Medical University of Innsbruck, 6020 Innsbruck, Austria; [email protected] 11 MRC-PHE Centre for Environment and Health, School of Public Health, Imperial College London, W2 1PG London, UK; [email protected] 12 Italian Institute for Genomic Medicine (IIGM), 10126 Turin, Italy * Correspondence: [email protected]; Tel.: +41-61-284-8378 Int.
  • Signaling Pathways in the Male Rat Bone Dharani M

    Signaling Pathways in the Male Rat Bone Dharani M

    Physiological Reports ISSN 2051-817X ORIGINAL RESEARCH Different exercise modalities have distinct effects on the integrin-linked kinase (ILK) and Ca2+ signaling pathways in the male rat bone Dharani M. Sontam1,2, Elwyn C. Firth1,2,3, Peter Tsai4, Mark H. Vickers1,2 & Justin M. O’Sullivan1,2 1 The Liggins Institute, University of Auckland, Auckland, New Zealand 2 Gravida: National Centre for Growth and Development, University of Auckland, Auckland, New Zealand 3 Department of Sport and Exercise Science, University of Auckland, Auckland, New Zealand 4 School of Biological Sciences, University of Auckland, Auckland, New Zealand Keywords Abstract Cortical bone, exercise, gene expression, mechanotransduction, RNA-Seq. Mechanical loading is essential to maintain optimal skeletal health. Despite the fact that early-life exercise has positive, long-lasting effects on the mus- Correspondence culo-skeletal system, the response of the musculo-skeletal system to sponta- Elwyn C. Firth, Liggins Institute, 85 Park neous low-impact exercise has been poorly studied. Previously, we identified Road, Grafton, Auckland 1023, New subtle morphological changes in the femoral diaphysis of exercised animals Zealand. compared to nonexercised controls. We hypothesized that significant changes Tel: +64-9-923-6856 Fax: +64-9-373-8763 in gene expression of cells should precede significant measurable phenotypic E-mail: e.fi[email protected] changes in the tissues of which they are part. Here, we employed RNA-Seq to and analyse the transcriptome of the cortical bone from the femoral mid-diaphysis Justin M. O’Sullivan, Liggins Institute, 85 Park of prepubertal male Sprague-Dawley rats that were assigned to control Road, Grafton, Auckland 1023, New (CON); bipedal stance (BPS); or wheel exercise (WEX) groups for 15 days.
  • Genetic Defects in B-Cell Development and Their Clinical Consequences H Abolhassani,1,2 N Parvaneh,1 N Rezaei,1 L Hammarström,2 a Aghamohammadi1

    Genetic Defects in B-Cell Development and Their Clinical Consequences H Abolhassani,1,2 N Parvaneh,1 N Rezaei,1 L Hammarström,2 a Aghamohammadi1

    REVIEWS Genetic Defects in B-Cell Development and Their Clinical Consequences H Abolhassani,1,2 N Parvaneh,1 N Rezaei,1 L Hammarström,2 A Aghamohammadi1 1Research Center for Immunodeficiencies, Pediatrics Center of Excellence, Children’s Medical Center, Tehran University of Medical Sciences, Tehran, Iran 2Division of Clinical Immunology, Department of Laboratory Medicine, Karolinska Institutet at Karolinska University Hospital Huddinge, Stockholm, Sweden n Abstract Expression of selected genes in hematopoietic stem cells has been identified as a regulator of differentiation of B cells in the liver and bone marrow. Moreover, naïve B cells expressing surface immunoglobulin need other types of genes for antigen-dependent development in secondary lymphoid organs. Many advanced molecular mechanisms underlying primary antibody deficiencies in humans have been described. We provide an overview of the mutations in genes known to be involved in B-cell development and their clinical consequences. Key words: Genetic disorder. B-cell development. Primary antibody deficiencies. Clinical phenotypes. n Resumen Se ha identificado la expresión de genes seleccionados en las células pluripotenciales de médula ósea como reguladores de la diferenciación de las células B en el hígado y en médula ósea. Sin embargo, las células B naïve que expresan inmunoglubulinas de superficie, necesitan otros tipos de genes para su desarrollo en los órganos linfoides secundarios dependienteS de antígeno. Se han descrito muchos mecanismos moleculares avanzados que subrayan las inmunodeficiencias en humanos y esta revisión constituye una visión general de la mutación en todos los genes conocidos involucrados en el desarrollo de las células B y sus consecuencias clínicas. Palabras clave: Alteraciones genéticas. Desarrollo de las células B.
  • Downloaded on 27 May 2020

    Downloaded on 27 May 2020

    bioRxiv preprint doi: https://doi.org/10.1101/2021.04.07.438755; this version posted April 7, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Title: Cells of the human intestinal tract mapped across space and time Elmentaite R1, Kumasaka N1, King HW2, Roberts K1, Dabrowska M1, Pritchard S1, Bolt L1, Vieira SF1, Mamanova L1, Huang N1, Goh Kai’En I3, Stephenson E3, Engelbert J3, Botting RA3, Fleming A1,4, Dann E1, Lisgo SN3, Katan M7, Leonard S1, Oliver TRW1,8, Hook CE8, Nayak K10, Perrone F10, Campos LS1, Dominguez-Conde C1, Polanski K1, Van Dongen S1, Patel M1, Morgan MD5,6, Marioni JC1,5,6, Bayraktar OA1, Meyer KB1, Zilbauer M9,10,11, Uhlig H12,13,14, Clatworthy MR1,4, Mahbubani KT15, Saeb Parsy K15, Haniffa M1,3, James KR1* & Teichmann SA1,16* Affiliations: 1. Wellcome Sanger Institute, Wellcome Genome Campus, Hinxton, Cambridge CB10 1SA, UK. 2. Centre for Immunobiology, Blizard Institute, Queen Mary University of London, London E1 2AT, UK 3. Biosciences Institute, Faculty of Medical Sciences, Newcastle University, Newcastle upon Tyne NE2 4HH, UK. 4. Molecular Immunity Unit, Department of Medicine, University of Cambridge, MRC Laboratory of Molecular Biology, Cambridge, CB2 0QH, UK 5. European Molecular Biology Laboratory, European Bioinformatics Institute, Wellcome Genome Campus, Cambridge, CB10 1SD, UK. 6. Cancer Research UK Cambridge Institute, University of Cambridge, Cambridge, UK 7. Structural and Molecular Biology, Division of Biosciences, University College London WC1E 6BT, UK 8.
  • Lymphomyeloid Contribution of an Immune-Restricted Progenitor

    Lymphomyeloid Contribution of an Immune-Restricted Progenitor

    Cell Stem Cell Article Lymphomyeloid Contribution of an Immune- Restricted Progenitor Emerging Prior to Definitive Hematopoietic Stem Cells Charlotta Bo¨ iers,1,2 Joana Carrelha,3 Michael Lutteropp,3 Sidinh Luc,3 Joanna C.A. Green,3 Emanuele Azzoni,4 Petter S. Woll,3 Adam J. Mead,3 Anne Hultquist,1 Gemma Swiers,4 Elisa Gomez Perdiguero,5 Iain C. Macaulay,3 Luca Melchiori,3 Tiago C. Luis,3 Shabnam Kharazi,1 Tiphaine Bouriez-Jones,3 Qiaolin Deng,6 Annica Ponte´ n,7 Deborah Atkinson,3 Christina T. Jensen,3 Ewa Sitnicka,1 Frederic Geissmann,5 Isabelle Godin,8 Rickard Sandberg,6 Marella F.T.R. de Bruijn,4 and Sten Eirik W. Jacobsen3,4,9,* 1Haematopoietic Stem Cell Laboratory, Lund Stem Cell Center, Lund University, 221 84 Lund, Sweden 2Molecular Medicine and Gene Therapy, Lund Stem Cell Center, Lund University, 221 84 Lund, Sweden 3Haematopoietic Stem Cell Laboratory, Weatherall Institute of Molecular Medicine, John Radcliffe Hospital, University of Oxford, Headington, Oxford OX3 9DS, UK 4MRC Molecular Haematology Unit, Weatherall Institute of Molecular Medicine, John Radcliffe Hospital, University of Oxford, Headington, Oxford OX3 9DS, UK 5Center for Molecular and Cellular Biology of Inflammation, Division of Immunology Infection & Inflammatory Diseases, King’s College London, London SE1 1UL, UK 6Department of Cell and Molecular Biology, Karolinska Institutet and Ludwig Institute for Cancer Research, 171 77 Stockholm, Sweden 7Cardiovascular group, Lund Stem Cell Center, Lund University, 221 84 Lund, Sweden 8Institut National de la Sante´ et de la Recherche Me´ dicale, INSERM 1009, Universite´ Paris-Sud, Orsay, 94805 Villejuif, France 9Department of Cell and Molecular Biology, Wallenberg Institute for Regenerative Medicine and Department of Medicine, Center for Hematology and Regenerative Medicine, Karolinska Institutet, 171 77 Stockholm, Sweden *Correspondence: [email protected] http://dx.doi.org/10.1016/j.stem.2013.08.012 SUMMARY stem cell (Orkin and Zon, 2008a).
  • Precursors in Human Bone Marrow Identifies Autonomously Proliferating B Cell a Feeder-Free Differentiation System

    Precursors in Human Bone Marrow Identifies Autonomously Proliferating B Cell a Feeder-Free Differentiation System

    A Feeder-Free Differentiation System Identifies Autonomously Proliferating B Cell Precursors in Human Bone Marrow This information is current as Helene Kraus, Sandra Kaiser, Konrad Aumann, Peter of September 26, 2021. Bönelt, Ulrich Salzer, Dietmar Vestweber, Miriam Erlacher, Mirjam Kunze, Meike Burger, Kathrin Pieper, Heiko Sic, Antonius Rolink, Hermann Eibel and Marta Rizzi J Immunol published online 30 December 2013 http://www.jimmunol.org/content/early/2013/12/30/jimmun Downloaded from ol.1301815 Supplementary http://www.jimmunol.org/content/suppl/2013/12/30/jimmunol.130181 Material 5.DCSupplemental http://www.jimmunol.org/ Why The JI? Submit online. • Rapid Reviews! 30 days* from submission to initial decision • No Triage! Every submission reviewed by practicing scientists by guest on September 26, 2021 • Fast Publication! 4 weeks from acceptance to publication *average Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2013 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. Published December 30, 2013, doi:10.4049/jimmunol.1301815 The Journal of Immunology A Feeder-Free Differentiation System Identifies Autonomously Proliferating B Cell Precursors in Human Bone Marrow Helene Kraus,*,† Sandra Kaiser,* Konrad Aumann,‡ Peter Bo¨nelt,* Ulrich Salzer,* Dietmar Vestweber,x Miriam Erlacher,{ Mirjam Kunze,‖ Meike Burger,# Kathrin Pieper,* Heiko Sic,* Antonius Rolink,** Hermann Eibel,* and Marta Rizzi* The peripheral B cell compartment is maintained by homeostatic proliferation and through replenishment by bone marrow precursors.
  • Mouse CD Marker Chart Bdbiosciences.Com/Cdmarkers

    Mouse CD Marker Chart Bdbiosciences.Com/Cdmarkers

    BD Mouse CD Marker Chart bdbiosciences.com/cdmarkers 23-12400-01 CD Alternative Name Ligands & Associated Molecules T Cell B Cell Dendritic Cell NK Cell Stem Cell/Precursor Macrophage/Monocyte Granulocyte Platelet Erythrocyte Endothelial Cell Epithelial Cell CD Alternative Name Ligands & Associated Molecules T Cell B Cell Dendritic Cell NK Cell Stem Cell/Precursor Macrophage/Monocyte Granulocyte Platelet Erythrocyte Endothelial Cell Epithelial Cell CD Alternative Name Ligands & Associated Molecules T Cell B Cell Dendritic Cell NK Cell Stem Cell/Precursor Macrophage/Monocyte Granulocyte Platelet Erythrocyte Endothelial Cell Epithelial Cell CD1d CD1.1, CD1.2, Ly-38 Lipid, Glycolipid Ag + + + + + + + + CD104 Integrin b4 Laminin, Plectin + DNAX accessory molecule 1 (DNAM-1), Platelet and T cell CD226 activation antigen 1 (PTA-1), T lineage-specific activation antigen 1 CD112, CD155, LFA-1 + + + + + – + – – CD2 LFA-2, Ly-37, Ly37 CD48, CD58, CD59, CD15 + + + + + CD105 Endoglin TGF-b + + antigen (TLiSA1) Mucin 1 (MUC1, MUC-1), DF3 antigen, H23 antigen, PUM, PEM, CD227 CD54, CD169, Selectins; Grb2, β-Catenin, GSK-3β CD3g CD3g, CD3 g chain, T3g TCR complex + CD106 VCAM-1 VLA-4 + + EMA, Tumor-associated mucin, Episialin + + + + + + Melanotransferrin (MT, MTF1), p97 Melanoma antigen CD3d CD3d, CD3 d chain, T3d TCR complex + CD107a LAMP-1 Collagen, Laminin, Fibronectin + + + CD228 Iron, Plasminogen, pro-UPA (p97, MAP97), Mfi2, gp95 + + CD3e CD3e, CD3 e chain, CD3, T3e TCR complex + + CD107b LAMP-2, LGP-96, LAMP-B + + Lymphocyte antigen 9 (Ly9),
  • B Cell Receptor Signaling in Receptor Editing and Leukemia

    B Cell Receptor Signaling in Receptor Editing and Leukemia

    B CELL RECEPTOR SIGNALING IN RECEPTOR EDITING AND LEUKEMIA A DISSERTATION SUBMITTED TO THE FACULTY OF THE GRADUATE SCHOOL OF THE UNIVERSITY OF MINNESOTA BY LAURA BAILEY RAMSEY IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY MICHAEL A. FARRAR, ADVISER JULY 2009 © Laura Bailey Ramsey 2009 i Acknowledgements I would like to thank my family and friends for all their support, for without it I would not have accomplished all that I have. I would especially like to thank my husband Colin, for supporting me through the tough times and celebrating with me during the happy times. I am eternally grateful to my parents and grandparents for their support and unconditional love. These last five years would not have been the same without the support of my “Minnesota Mom,” Lyn Glenn. They have all encouraged me to accomplish my dreams, and without them I would not have been able to do it. I would like to thank the Behrens lab for all their support and patience with me when I started graduate school. They introduced me to the world of immunology and B cells, and for that I am forever grateful. Tim Behrens was a great mentor and project director for the first two years of my graduate career. Brian Schram and Keli Hippen were especially helpful in teaching me all about B cells. Jason Bauer, Thearith Koeuth, and Emily Gillespie have taught me many things about microarrays and continue to support me at the University of Minnesota. Jessica Oehrlein and Amanda Vegoe took wonderful care of my mice.