The EMBO Journal vol.6 no.8 pp.2267-2272, 1987 A second gene, VpreB in the X5 locus of the mouse, which appears to be selectively expressed in pre-B lymphocytes Akira Kudo and Fritz Melchers respectively. Exon I shows no strong homology to any known Basel Institute for Immunology, Postfach, CH-4058 Grenzacherstrasse 487, gene. The putative protein encoded by the X5 gene, although not Basel, Switzerland yet identified, is a potential candidate for heterodimer formation Communicated by F.Melchers with IgH chains and thereby, may influence the function which H chains play in pre-B cell development. We describe here, The murine gene X5 is selectively expressed in pre-B lym- 4.6 kb upstream of X5 another gene named VpreB1 composed of phocytes. Of the three exons encoding X5, exons II and III two exons which is selectively expressed in pre-B cell lines as show strong homologies to immunoglobulin X light (L) chain 0.85 kb mRNA. The putative protein encoded by this gene is gene segments, i.e. to Jx intron and exon, and Cx exon se- a potential candidate for association with the X5 protein and quences respectively. We have now found, 4.6 kb upstream may, therefore, also influence the role of H chains in pre-B cell of X5, another gene composed of two exons which is selec- development. tively expressed in pre-B cell lines as a 0.85 kb mRNA poten- tially coding for a protein of 142 amino acids including a 19 Results amino acid-long signal peptide. The 5' sequences of this gene show homologies to sequences encoding the variable regions Isolation of the VpreBJ cDNA clone pZ121 of x and X L chains and of heavy (H) chains. The deduced In a search for possible exons upstream of X5 with functions in amino acid sequence contains the consensus cysteine residues the regulation of expression of this gene, we probed total RNA as well as other consensus amino acids at positions which preparations of 70Z/3 pre-B cell lines (X5+) and of EL4 thymic characterize immunoglobulin (Ig) domains. We call the se- lymphoma cell lines (X5 ) by Northern blot analysis with dif- cond gene ferent radiolabelled segments of the 7pB12 genomic clone (Kudo VpreB. The 3' end of VpreB encoding the 26 car- et boxyl terminal amino acids shows no homology to any known al., 1987) containing the X5 gene plus 10 kb upstream of it nucleotide sequence. (Figure 3). The BamHI-XbaI fragment of the 5' region of 7pB12 The putative protein encoded by VpreB was found to hybridize to 70Z/3, but not to is a potential candidate for association with the putative pro- EIA total RNA tein encoded by X5, and thereby a candidate for association with H chains in pre-B cells. Southern blot analysis of DNA t N 'rtNcJo from liver (germ line) and 70Z/3 pre-B cell lines reveals two J CD I genes which hybridize to the VpreB gene. We call VpreBl the 11 t- r0 gene which is found 5' of X5. The other gene, called VpreB2, which has not yet been located within the genome, shows 97% nucleotide sequence homology to VpreB1 in an area of 1 kb which covers the coding region of the gene. Both VpreBl and VpreB2 appear not to be rearranged during B cell development. Key words: gene organization/Ig super gene farnily/X5/pre-B cell Introduction 0.85kb-- a -1.2 kb The development of B lymphocytes from pluripotent stem cells is one of the best studied lineages of eukaryotic cell differentia- tion (Tonegawa, 1983; Melchers et al., 1977). Different stages of this development are defined by rearrangements of gene segments encoding immunoglobulin (Ig) H and L chains, by the expression of cell surface markers, and by reactions of cells to stimuli and growth factors. Transformed cell lines and tumors exist which represent these different stages. They have facilitated -vpre B1 A5 the identification of a gene, called X5, (Sakaguchi and Melchers, 1986) which is selectively expressed in pre-B cells, but not in Fig. 1. Northern analysis of 10 jig total RNA from 70Z/3 pre-B lymphoma and from ELM thymic lymphoma cells probed with the BamHI-XbaI frag- mature B cells or Ig-secreting plasma cells, nor in any other cell ment of 7pB12 (see Figure 3, subclone a) and with the X5 KpnI-PstI frag- lineage tested thus far (Sakaguchi et al., 1986). The X5 gene is ment (see Figure 3, subclone b). The same filter was hybridized first with expressed as a 1.2 kb mRNA coding for a 209 amino acid-long the oligo-labelled pZ121, washed with 0.1 x SSC, 0.1% SDS at 500C, ex- protein which includes a potential 30 amino acid-long signal pep- posed to X-ray film (Kodak XS-1) then the radiolabelled probe was washed et Of the three exons off at 0.1 x SSC, 0.1I% SDS at 95°C, and thereafter exposed to the second tide (Kudo al., 1987). encoding X5, ex- oligolabelled probe, pZ183-1 (X5) (Sakaguchi and Melchers, 1976) again ons II and Ill show strong homologies to X light (L) chain gene washed in 0.1 x SSC, 0.1% SDS at 500C, and again exposed to X-ray segment, i.e. to J> intron and exon, and Cx exon sequences, film. ( IRL Press Limited, Oxford, England 2267 A.Kudo and F.Melchers LItLIFOwitturie.rE3S '-4[ l. -K;rlil rx'-, IiInreagetni _' JI -I US I! SC , - 0 .. .- w m Y ->> f' ._- - ~ ~~~~ , .oric ;0_*,4t Fig. 2. Quantitative Northern dot blot analysis of pZl21 (VpreBl) transcripts in cell lines. Serial 2-fold dilutions were blotted on nitrocellulose filters for hybridization with the oligo-labelled EcoRI-AccI fragment of pZl21. Filters were first probed with the radiolabelled pZl21 cDNA (I) then washed and thereafter probed with radiolabelled (3-actin probe (Alonso et al., 1986), (II) 'Conc.' indicates RNA amounts between 1 and 5 jg per dot. EcoR v PstI KpnI PstI AccI pZ121 5# r 1 3' 4 4- 1 OO I 1 OObp Vpre B1 A5 a b 'A _- X E S B X B P K pEE F E 1 7pB12 5 4 i 4 ._ 4 4 i . .4 i _ 4 . 31 I I I Ki m g/Bg1;' I kb' 7pB12-2 -g 1K $ I 1 -*.- -- + . 4 . No 100bp Fig. 3. Restriction map and sequence strategies of the pZ121 cDNA clone and the genomic subclone 7pB12-2, both containing VpreBl. The 3.5 kb BamHI-XbaI fragment 7pB12-2 was subcloned into PUC-18 and a more detailed restriction map was determined. Restriction sites are B, BamHI; Bg, Bgll; P, PstI; E, EcoRI; K, KpnI; S, SalI; X, XbaI. The positions of the two exons in the VpreBI gene are indicated with I and II. The arrows indicate the direc- tion of sequencing lengths of the sequences as determined after subcloning fragments into M13 vectors. a and b show the 3.5 kb 7pB12 BamHI-XbaI frag- ment and the 0.7 kb 7pB12 PstI-KpnI fragment which were used as VpreBI and X5 specific probes in Northern blot analyses. 2268 VpreB genes selectively expressed in pre-B cells 7pB12-2 GATCTGCTTATTTGGGGCTCAGCCTCTCAAGGGGAGTTGAGGTCACTCTCCCTCAGGGAGACAAGCCCGCAGTCCTGGGTTCTGGCCCATGACGTTCCAGCAGGTGCTTCCTCCCAGAAT 120 7pB70-1 ---------C-G-----------------G-------------------------------TG-----A------------------------T-------------------------- 7pB12-2 GCTTCCCTGGGTCAAACCCAGAGCCACAAAGGC TTCCATTAGACCATTCTGGTAAG TGACAGAGTCACAGAGCCCAGAAAGCC TGGGAGGGTGGTGAGCAGGAACCAGGGGTGCAG TGAC 240 pZ121 7pB70-1 -----------------------------------------------------------------T--------------A--------------------------------------- -19 M A WS T s v L L M 7pB12-2 CCTCTCCCCAAAGCAGGGAGGAGAG TGCTTCCCAGC TGGTCAGGGCCCAGGAGCAG TGGCTGTAGGGGGCAGGG TGCTGCAGGTCTGGAGCCATGGCCTGGACG TCTGTCCTGCTCATGC 360 pZ121 7pB70-1 -----------------A----A---------------------T------------------------------------------------------------------------- -10 -1 +1 L L A Y L T 4G C G P Q 7pB12-2 TGCTGGCCTATCTCACAGGTAAGGAAACTCTTGGGGCCCAGGGC TTCT TTGCTCCTCCT ATGGCCTTGCTCTGCCCCAG TGATGGACATGC TTCTATCT TCTCAGGTTGTGGCCCTCAGC 480 pZ121 7pB70-1 --------C-C------------ G-----------T---------c---C--------c----------------------------------------------------------- (H) +10 +20 +30 +40 P M V H Q P P L A S S S L G A T I R L S C T L S N D H N I G I Y S I Y W Y Q Q R 7pB12-2 CCATGGTGCATCAGCCACCAT TAGCATCT TCT TCCCTTGGAGCCACCATCCGCCTCTCCTGTACCCTGAGCAACGACCATAACATTGGCAT TTACAGCATTTACTGGTACCAGCAGAGGC 600 pZ121 7p870-1 (S) +50 +60 +70 +80 P G H P P R F L L R Y F S H S D K H Q G P D I P P R F S G S K D T T R N L G Y L 7pB12-2 CGGGCCACCCTCCCAGGT TCCTGCTGAGA TACTTCTCACACTCAGACAAGCACCAGGG TCCCGAT ATCCCACC TCGCTTCTCCGGGTCCAAAGATACGACCAGGAACC TGGGGTATCTGA 720 pZ121 7pB70-1 (A) +90 +100 +110 +120 S I S E L Q P E D Q A V Y Y C A V G L R S Q E K K R M E R E W E G E K S Y T D L 7pB12-2 GCATCT CTGAACTGCAGCC TGAGGACGAGGCTG TGTATTACTGTGCCGTGGGGC TCCGGAGCCAGGAAAAGAAGAGGATGGAGAGGGAG TGGGAAGGAGAAAAGTCG TATACAGATTTGG 840 pZ121 ----------------------------------___-----------------------------------------__--------------------------------- _------ 7pB70-1 -------------------------------------------.C--TC-----------------.C-----------A--------.A---------------------------------- (H) G S* 7pB12-2 GATCTTAGGCTCTGGAGACATTCAGACCCTGAACTGAAGACAGAGTTTGCTTTGCTCGGCTAGTCTGGTATGGGAAGGAGGGGTAGAACGTGAGGTTTTGCAGAGCCTAGAAGATGGAAT 960 pZ121 7pB70-1 --- -------------- ----- ----- ------------------C---- ------------------- -------------------T---G- -C ----------------------G- 7pB12-2 TATGCAGCTTTTCCTTGTTCTGCGGTGTTGCTATGAGCCCCCATTGGAGGCTGGATTGTAGAATTAAAGCTGTTTTTACTGAATTTGGTCTGG 1053 pZ121 --------------------------------------------------------------------------------- poly A -20 7pB70-1 --------------------------------------------C-----------C-------------------------G---------- Fig. 4. Nucleotide sequence and deduced amino acid sequence of the VpreBl and VpreB2 gene. For VpreBl nucleotide sequences of both the genomic form (7pB12-2) as well as of the cDNA (pZl2l) are given. The cDNA sequences are identical with the genomic sequences and are, therefore, only indicated by dashes (-) and follow the genomic sequence in numbering. Numbering of amino acid residues starts with -19 as the first position of the leader and proceeds to +1 as the first position of the putative mature protein. The sequence overlined by closed circles (eeeeeee) shows the poly(A) addition signal sequence (Proudfoot and Brownlee, 1976).