Development and Characterization of SSR Markers for Trichloris Crinita Using Sequence Data from Related Grass Species

SSRRev. FCAmarkers UNCUYO for. Trichloris2018. 50(1): crinita 1-16. ISSN impreso 0370-4661. ISSN (en línea) 1853-8665.

Development and characterization of SSR markers for Trichloris crinita using sequence data from related grass species

Desarrollo y caracterización de marcadores moleculares SSR para Trichloris crinita usando secuencias de gramíneas filogenéticamente cercanas

Perla Carolina Kozub 1, Karina Barboza 2, Juan Bruno Cavagnaro 1, Pablo Federico Cavagnaro 2, 3

Originales: Recepción: 04/12/2017 - Aceptación: 07/05/2018

Abstract

Trichloris crinita is among the most important native forage grasses in arid regions of America. Despite its importance, molecular resources and sequence data are extremely scarce in this species. In the present study, SSR markers were developed using available DNA sequences from grass taxa phylogenetically-related to Trichloris (Eleusine coracana, Cynodon dactylon and ‘Cynodon dactylon x Cynodon transvaalensis’). Marker transferability was evaluated in a panel of eight T. crinita of expected size in T. crinita, whereas transferability to other grass speciesaccessions ranged and from five 12closely-related (in Chloris castilloniana species. Of )the to 28105 SSRs SSR (in primer Eleusine pairs coracana evaluated,). Six 16 of theamplified 16 SSR products markers successfully transferred to T. crinita (37.5%) were polymorphic, and were further used to assess genetic diversity in eight T. crinita accessions. The analysis revealed a total of 23 SSR alleles (3.83 alleles/locus), allowing the discrimination of all T. crinita accessions,

(and range) values for observed (Ho) and expected heterozygosity (He) were 0.53 (0.0-1.0)with pair-wise and 0.63 genetic (0.48-0.79), similarities respectively. ranging from 0.35 to 0.81 (Jaccard coefficient). Mean

Keywords Chloridoideae

• forage grass • genetic diversity • marker transferability • microsatellites 1 Universidad Nacional de Cuyo (UNCuyo). Facultad de Ciencias Agrarias (FCA). Instituto de Biología Agrícola de Mendoza (IBAM). Consejo Nacional de

de Coria. Mendoza M5528AHB. Argentina. Investigaciones Científicas y Técnicas (CONICET). Almirante Brown 500. Chacras

2 Consejo40 Km 96. Nacional San Carlos. de Investigaciones Mendoza 5567. Científicas Argentina. y [email protected]écnicas (CONICET); and 3 UniversidadInstituto Nacional Nacional de deTecnología Cuyo. Facultad Agropecuaria de Ciencias (INTA) Agrarias. E.E.A. Instituto La Consulta. de Horticultura. Ex ruta

Tomo 50 • N° 1 • 2018 1 P. C. Kozub et al.

Resumen

Trichloris crinita es una importante gramínea forrajera, nativa de regiones áridas del continente americano. A pesar de su importancia, no existen herramientas moleculares ni marcadores moleculares SSR (“simple sequence repeats”) a partir de secuencias nucleo- secuencias nucleotídicas disponibles para esta especie.Trichloris En este (Eleusine estudio, coracana se desarrollaron, Cynodon dactylon y ‘Cynodon dactylon x Cynodon transvaalensis’) y se evaluó su transferibilidad entídicas ocho de accesiones especies filogenéticamentede T. crinita y cinco cercanas especies a de gramíneas cercanamente emparen- esperado en T. crinita, mientras que la transferibilidad a otras especies varió entre 12 (entadas. Chloris De los castilloniana 105 pares de) y cebadores28 SSRs (en evaluados, Eleusine coracana16 amplificaron). De los productos 16 SSRs transferibles del tamaño a T. crinita, seis . - tieron diferenciarfueron todas polimórficos las accesiones y se de utilizaron T. crinita, para analizar el grado de diversidad entregenética pares en ocho de accesiones accesiones de de 0,35esta especie a 0,81 (Jaccard).El análisis Sereveló obtuvieron 23 alelos, valores los cuales medios permi de heterocigosidad observada y esperada de 0,53 y 0,63, conrespectivamente. valores de similitud genética

Palabras clave Chloridoideae •

gramínea forrajera • diversidad genética • transferibilidad • microsatélites Introduction

Trichloris crinita (Chloridoideae, phenotypes from natural populations, Poaceae) is one of the most important followed by their characterization based native grass species in arid regions of South on traits of interest, such as biomass America, due to its extensive area of distri- production (5), forage quality (7, 27), and bution (25), good forage quality (7, 27), drought resistance (12). Data from a recent and resistance to drought (13), tram- study (16), demonstrating that T. crinita is a pling and grazing by wild and domestic sexually-propagated autogamous species, animals (4). These characteristics and encourages the practice of conventional its competing aggressiveness among breeding strategies in the species. Along other native grasses (22), have led to with this, the possibility of developing a widespread utilization of T. crinita in molecular markers for assisting selection range grazing and revegetation projects in may accelerate T. crinita breeding goals. arid environments (24). Molecular resources in T. crinita are Despite its importance, advances in very scarce. To date, only two studies genetic research and breeding of T. crinita regarding the use of molecular markers have been limited, mainly due to the in this species have been published scarcity of molecular resources and the fact that the species mode of reproduction was unknown until very recently. The genetic(5, 16). Thediversity first study,in a T. publishedcrinita germplasm in 2006, main approach used to improve T. crinita collectionused AFLP (4), markers whereas for a characterizing more recent has been the selection of interesting study by Kozub et al. (2017) used simple

2 Revista de la Facultad de Ciencias Agrarias SSR markers for Trichloris crinita sequence repeats (SSR) markers for Objectives inferring about the mode of reproduction of this species. The present work reports 1) To develop SSR markers for on the development and evaluation, at Trichloris crinita using sequence data various levels, of the SSR markers used in from Eleusine and Cynodon species. the latter report. 2) To evaluate marker transferability SSRs are robust and informative across T. crinita-related taxa. PCR-based markers and they are generally 3) To assess SSR polymorphism and genetic diversity in T. crinita accessions. level of polymorphism, reproducibility andfavored codominant over AFLPs due inheritance to their higher (18). These markers have been successfully Materials and methods used for multiple genetic and breeding purposes in many crop species, including Source of sequence data, grapevine (19), carrot (6), alfalfa (12) and microsatellites search and primer design soybean (3). However, the development All the available genomic of SSR markers generally requires DNA sequences (GSS) of Eleusine coracana sequence data to search and detect SSR Cynodon dactylon (633 sequences; 0.4 Mbp), SSR. In the case of T. crinita, using sequence and ‘Cynodon dactylon x Cynodon databasesmotifs, and to designidentify primers SSRs is flankingnot feasible the transvaalensis (404 sequences; 0.2 Mbp) since very few sequences are available for were downloaded from the NCBI database ’ (92 sequences; 0.04 Mbp) the species (only 34 T. crinita sequences on April 15, 2016. These species were are available at the NCBI database). selected based on their phylogenetic The use of sequence data from related proximity to T. crinita and the availability taxa for developing SSR markers in a of sequences in the database. species lacking sequence information has been widely used in plants, with program MISA (31). Only perfect micro- variable degrees of success, generally satellites,SSR motifs with a were basic identified motif of 2-6 using nt, and the increasing success rate with the phylo- a minimum length of 12 nt (for di-, tri-, genetic proximity between SSR donor and tetranucleotides), 15 nt (for pentanu- and target species (15). This approach cleotides), and 18 nt (for hexanucleotides) has been particularly successful in the were considered. Poaceae family, where SSR markers were The position of the detected SSRs in developed for numerous orphan species, the genomic sequence was recorded, and using sequences from economically important cereal crops (34, 35). This designed. These SSR loci were selected strategy may also be effective for becauseprimers they pairs had flanking larger number 105 SSRs of repeat were developing SSR markers for T. crinita units, as this feature has been associated using the available sequence data from with higher polymorphism rate (6). phylogenetically related genera, such as Eleusine and Cynodon.

Tomo 50 • N° 1 • 2018 3 P. C. Kozub et al.

For primer design, the software Primer3 v.4.0.0 (32) was used, using parameters to generate amplicons dNTPs (2.5 mM each), 1 μl 5μM of each of 200-500 bp, and primer length of wereprimer, programmed 0.3 μl Taq as polymerase follows: initial at 3 dena U/μl- 22-30 nt with Tm of 55-62°C and GC turationand 2.5 μl at of 94°Cgenomic for 30DNA. sec, Thermocyclers followed by content of 30-50 %. Other parameters 40 cycles of 94°C for 45 sec, appropriate used the program default values. annealing temperature for 30 sec, and 72°C

Plant materials Agarose (3%) gel electrophoresis used Trichloris crinita accessions for 1 min; and a final step of 72°C for 4 min. for visualization of the amplicons. A (CynodonEight dactylon, Eleusine coracana, 100ethidium bp ladder bromide (Invitrogen) (4 ul/100 ml wasof TAE used buffer) as Eleusineand five indica, related Chloris grass gayana species, and size marker. Denaturing polyacrylamide Chloris castilloniana) from the Germplasm (6%) gel electrophoresis was run at Bank of Native Grasses (GBNG) at the 1500 V, 60 W and 40 mA for 3 hours. Argentine Institute for Research in Arid Silver staining was performed and the gels Regions (IADIZA) (Mendoza, Argentina), were photographed for later genotype were used in this study. Characteristics analysis. SSR allele sizes were estimated of these plant materials -used for marker by comparisons with a 100 bp DNA development, evaluation of marker trans- ladder (Invitrogen). ferability across species, and analysis of genetic diversity within T. crinita- are SSR marker analysis presented in table 1 (page 5). For analysis of marker transferability across species, 105 SSR primer pairs DNA extraction and PCR and gel were evaluated using as template for electrophoresis conditions PCRs genomic DNA from eight T. crinita For DNA extraction, fresh young leaves of a single plant from each accession were related grass species (table 1, page 5). harvested and immediately ground in PCRaccessions products and were five resolved phylogenetically- by agarose liquid nitrogen with a mortar. gel electrophoresis. An SSR marker The resulting powder (~20 mg) was was considered transferable to a target used for DNA isolation according to Murray and Thompson (1980). DNA concentration amplicons of expected size, were observed and purity were determined with a Picodrop inspecies that when species. positive For theamplifications accessions with and spectrophotometer (PicoPet 01), and DNA SSRs that failed to produce amplicons of integrity was evaluated by 0.9% agarose expected size or yielded no PCR products gel-electrophoresis. DNA samples were at all, a second round of PCRs was performed, and if the same results were observed, they were recorded as "negative dilutedPCR to reactionsa final concentration were performed of ~30 ng/µl in PCR reactions". and used as template in PCR amplifications.

20 μl final volume containing 11.6 μl water, 2 μl 10 × DNA polymerase buffer, 1.6 μl

4 Revista de la Facultad de Ciencias Agrarias SSR markers for Trichloris crinita

Table 1. Species and accessions used for SSR marker development, and analyses of marker transferability and genetic diversity Tabla 1.

Especies y accesiones utilizadas para el desarrollo de los marcadores SSR, Accession Number Species análisis de transferibilidad yComments diversidad / remarks genética. References (IADIZA-GBNG)

Medium biomass production. Medium Tc-3 (5, 9) Trichloris crinita drought resistance. High biomass production. Medium Tc-4 (5, 9) Trichloris crinita drought resistance.

Trichloris crinita Tc-7 High biomass production. (9)

Trichloris crinita Tc-8 (9)

Low biomass production. Tc-9 (2, 9) Trichloris crinita quality. Low biomass production. Good forage High biomass production. High drought Tc-12 (5, 9) Trichloris crinita resistance. Medium biomass production. Medium Tc-17 (5, 9) Trichloris crinita drought resistance. High biomass production. Medium Tc-24 (5, 9) Trichloris crinita drought resistance.

South American native grass. High forage Chloris castilloniana Chc-01 (32) quality. No available SSRs for this species.

ChlorisLillo & gayanaParodi Important forage grass native to Khunt (Rhodes Chg-01 tropical and subtropical Africa. No (33) grass) available SSRs for this species. SSR donor species / Native to Africa. Used Eleusine coracana - as cereal crop in arid/semi-arid regions. Ec-01 (finger millet) African native C4 grassweed of rain-fed Eleusine indica agriculture. Very few SSRs available for (34, 35) (goosegrass) this species. Ei-01 SSR donor species / Important Cynodon dactylon Cd-01 perennial grass, widely cultivated in - (Bermuda grass) warm regions.

C. dactylon x C. - SSR donor species. - transvaalensis *

Species used for marker development (i.e., SSR donor species) are indicated in bold. * ‘C. dactylon x C. transvaalensis’ was only used as a source of DNA sequence for marker development but was not included in the analyses of marker transferability and/ or genetic diversity. IADIZA-GBNG: Argentine Institute for Research in Arid Regions- Germplasm Bank of Native Grasses. C. dactylon x C. transvaalensis’ fue utilizada para el desarrollo de marcadores, pero no fue incluida en los análisis de Las especies utilizadas para el desarrollo de marcadores están indicadas en negrita. * ‘ IADIZA-GBNG: Instituto Argentino de Investigación en Regiones Áridas - Banco de Germoplasma de Pastos Nativos. transferibilidad y/o diversidad genética.

Tomo 50 • N° 1 • 2018 5 P. C. Kozub et al.

Hardy-Weinberg equilibrium. Three cate- (i.e., SSRs that produced amplicons of gories of He expectedSSRs size) with in positive all T. crinita amplifications accessions and the related grass species were established valuesto describe [low (He the ≤ polymorphism 0.3), moderate selected for further analysis of marker level(0.3 < at He each ≤ 0.5) SSR and locus. high It(0.5 must < He)] be notedwere polymorphism and genetic diversity. For that analyses of Ho and He was restricted to the T. crinita germplasm. generated and resolved by denaturing polyacrylamidethis, SSR amplification gel (6%) electrophoresis, products were run at 1500V, 60W and 40 mA for 3 hours. Results The gels were stained with silver nitrate and photographed for later analysis. SSR A total of 105 primer pairs were allele sizes were estimated by comparison with a DNA size ladder. genomic sequence of three grass species The genetic diversity analysis was phylogenetically-relateddesigned flanking SSRs to detectedTrichloris in performed on eight T. crinita accessions [Eleusine coracana (65 SSRs), Cynodon - dactylon (21 SSRs) and ‘C. dactylon x netically-related to Trichloris. The latter C. transvaalensis speciesand five were other included grass species in the phyloge analysis SSRs corresponded to di- (37%), tri- (27%), as putative out-groups. Marker data for tetra- (29%) and’ pentanucleotides(19 SSRs)]. The selected(7%). each locus and accession were recorded, and a binary matrix with information on SSR marker transferability across the presence or absence of SSR alleles grass species was constructed and used for estimating The number and percentage of trans- pair-wise genetic similarities among the ferable SSR markers from each donor species to T. crinita accessions and 5 other grasses are presented in table 2 (page 7). accessions (Jaccard coefficient) (28), using- In total, 16 markers, representing 15.2% laritiesthe software among XLSTAT the taxa v.2016.05.33324. was constructed of the SSRs tested, were transferable usingA dendrogramthe Unweighted reflecting Pair Group genetic Method simi to T. crinita (i.e with arithmetic Average (UPGMA) products of expected size in T. crinita accessions). Of these,., 16 markers seven SSRs amplified were Based on the SSR band patterns, developed from E. coracana, six from andprocedure considering with the T. XLSTAT crinita software. as a tetra - C. dactylon, and three from ‘C. dactylon ploid species (26), observed (Ho) x C. transvaalensis’. Table 3 (page 8-9), and expected (He) heterozygosity presents further information on the values were estimated for each marker, 16 SSRs that were successfully transferred according to Bever and Felber (1992) to T. crinita, including primer sequence, annealing temperature, repeat motif, 10,000 Monte Carlo simulations. He was expected and observed amplicon lengths, usedwith theas a programmeasure ATETRAof the level 1.0 of (33) polymor using- number of alleles, and observed (Ho) and phism in each locus, despite the absence of expected (He) heterozygosity values for each marker.

6 Revista de la Facultad de Ciencias Agrarias SSR markers for Trichloris crinita x ζ C 3 5 8 (%) Mean (15.4) (23.1) (12.1) (65), 3 5 6 C. dactylon 14 (9.2) Tc-24 (15.8) (23.8) (13.3) 3 5 6 14 Trichloirs crinita crinita Trichloirs accessions and E. coracana (9.2) Tc-17 (15.8) (23.8) (13.3) (21) and ‘ 3 4 5 12 (7.7) Tc-12 (15.8) (19.0) (11.4) C dactylon 3 6 7 16 Tc-9 (15.8) (28.6) (10.8) (15.2) (65), Trichloris crinita Trichloris 2 5 6 13 Tc-8 (9.2) (10.5) (23.8) (12.4) Trichloris crinita Trichloris E. coracana 3 4 5 12 Tc-7 (7.7) (15.8) (19.0) (11.4) ’ (19). 2 5 6 13 Tc-4 (9.2) (10.5) (23.8) (12.4) 2 4 5 11 (19) Tc-3 (7.7) (10.5) (10.5) ’ (19). C. transvaalensis x 6 10 10 26 (9.2) (52.6) (47.6) (24.7) Cynodon dactylon C. dactylon 3 4 5 C. transvaalensis five other grasses. five 12 (19) (7.7) (15.8) (11.4) Chloris y otras cinco gramíneas. y otras Number (%) of transferable SSRs Number (%) of transferable castilloniana (21) and ‘ 1 6 7 14 (5.3) (28.6) (10.8) (13.3) Chloris gayana dactylon porcentaje de SSRs positivos no fue calculado para esta especie. no fue calculado para positivos de SSRs porcentaje 2 2 24 28 (9.5) (10.5) (36.9) (26.6) Eleusine coracana ’ was only used as a source of sequence data for developing SSR markers, but was not included in the transferability assay, assay, not included in the transferability but was SSR markers, developing of sequence data for used as a source only ’ was 1 3 therefore, the number and percentage of positive SSRs were not calculated for this species. for not calculated were SSRs of positive the number and percentage therefore, 15 19 (18) (5.3) (14.3) (23.1) indica ’ fue utilizada para el desarrollo de marcadores pero no fue incluida en los análisis de transferibilidad, por lo tanto, el número y el número por lo tanto, no fue incluida en los análisis de transferibilidad, pero de marcadores el desarrollo ’ fue utilizada para Eleusine The percentage of positive SSRs amplified in each species was calculated on the basis of 105 total SSRs tested. tested. SSRs on the basis of 105 total calculated amplified in each species was SSRs of positive The percentage † 19 * (%) (47.6) (36.9) 10/21 24/65 Positive / Positive total SSRs SSRs total C. transvaalensis x El porcentaje de SSRs con amplificación positiva en cada especie fue calculado sobre la base de un total de 105 SSRs evaluados. de 105 SSRs la base de un total en cada especie fue calculado sobre con amplificación positiva de SSRs El porcentaje † C. transvaalensis x † Number (and percentage) of transferable SSR markers from each donor species to each donor species to from SSR markers of transferable Number (and percentage) . Número (y porcentaje) de marcadores SSR transferibles de cada especie donante a las accesiones de de cada especie donante SSR transferibles (y de marcadores . Número porcentaje) x C. dactylon Valores medios y porcentajes calculados sobre la base de número de SSR desarrollados a partir de cada una de las especies donantes a partir de cada una las especies donantes de SSR desarrollados la base de número calculados sobre medios y porcentajes Valores Total (%) Total C. dactylon C. dactylon E. coracana ζ * ‘ Table 2. Table C. dactylon Donor species Mean and percentage values calculated on the basis of the SSR markers developed from the donor species from developed on the basis of SSR markers calculated values Mean and percentage C. transvaalensis C. ζ Tabla 2 Tabla *‘

Tomo 50 • N° 1 • 2018 7 P. C. Kozub et al. , all i.e. 0 1 0 0 0 0 Ho 0.45 Trichloris crinita, crinita, Trichloris 0 0 0 0 , and number of He 0.59 0.79 0.22 1 5 6 1 1 1 1 A 59 ) are denoted in italics. denoted ) are Tm Tm (°C) 56.8 59.8 53.2 60.5 58.6 57.2 Trichloris crinita Trichloris ) para cada locus SSR en accesiones de ) para He Primer sequence (5'- 3') Primer sequence ) y esperada ( ) y esperada accessions. Ho F: AATATGGTATGCCTGAGATTCAAGCTCA F: R: GTTCCAATAATTGGTGGGTTCTGTAG F: AAAACGGGTCCATCCATGTTGATGC F: R: TAGGCTTCGTCACAGAATTTTATCTGCCT CAGAAAATCACAGTTCAGATTACTG F: R: AGTTCTTTTGTACCCTTTATAAGACATCT F: ACTCGAATGAGGGAGGCATTGCTACA F: R: CTTGTTTCTCAAGTAGCTCCTCTTGCC F: ACCATCATAGAGTCATGAGATGTAACCTT F: R: ATAGCTAGCTGAGGTCGATGTAGAAGCT F: ATGAGATGTAACCTTTGATGAAACAAACT F: TTTGACCCTCTTCTGTAGTGGTGGAAGCA R: CTAACACCATCATAGAGTCATGAGATGT F: R: CGATGTAGAAGCTTTTTGACCCTCTTCT 110 270 250 300 400 Obs. y las demás gramíneas) se indicaron con letras itálicas. con letras se indicaron y las demás gramíneas) 139-165 128-140 Trichloris crinita. Trichloris ) heterozygosity values estimated for each SSR locus in a collection of for estimated values ) heterozygosity size (bp) PCR product product PCR 243 191 179 303 240 197 230 Exp. He crinita Trichloris T. crinita T.

C. dactylon x C. dactylon x C. dactylon x C. dactylon Donor species C. transvaalensis C. transvaalensis C. transvaalensis Eleusine coracana Eleusine coracana Eleusine coracana Eleusine coracana ) and expected ( ) and expected se indicaron en negrita. Los SSRs que amplificaron exitosamente en todos los materiales del panel de transferibilidad transferibilidad de panel del materiales los todos en exitosamente amplificaron que SSRs Los negrita. en indicaron se collection are denoted in bold. SSRs that amplified successfully across all the taxa of the transferability panel ( of the transferability all the taxa across that amplified successfully in bold. SSRs denoted collection are Ho , todas las accesiones de , todas Motif i.e. Eleusine indica, Eleusine coracana, Chloris castilloniana, Chloris gayana, Cynodon dactylon Chloris gayana, Chloris castilloniana, Eleusine coracana, Eleusine indica, (AC)28 (TG)23 (TG)42 (TGA)8 (TGA)8 (TGA)8 ( (TGA)11 T. crinita crinita T. T. crinita T. SSR GSSR-2 GSSR-8 marker GSSR-51 GSSR-52 GSSR-53 GSSR-44 accessions, GSSR-11 Information for 16 genomic SSR markers (GSSRs) successfully transferred to to transferred successfully (GSSRs) 16 genomic SSR markers for Information T. crinita T. Información de los 16 marcadores SSR genómicos (GSSRs) que fueron exitosamente transferidos a transferidos exitosamente que fueron SSR genómicos (GSSRs) de los 16 marcadores Información alleles (A), and observed ( alleles (A), and observed número de alelos (A), y valores de heterocigosis observada ( observada de heterocigosis de alelos (A), y valores número Table 3. Table Polymorphic markers in the markers Polymorphic Tabla 3. Tabla Los marcadores polimórficos en polimórficos marcadores Los

8 Revista de la Facultad de Ciencias Agrarias SSR markers for Trichloris crinita ., all i.e Trichloris Trichloris , and number 0 0 0 0 0 Ho 0.61 0.83 0.50 0.31 0 0 0 0 He 0.66 0.70 0.49 0.56 0.48 4 1 3 1 1 2 3 1 2 A ) are denoted in italics. denoted ) are Tm Tm (°C) 59.5 61.5 60.7 59.8 58.9 57.6 56.4 54.5 60.2 Trichloris crinita Trichloris ) para cada locus SSR en accesiones de ) para He ) y esperada ( ) y esperada Primer sequence (5'- 3') Primer sequence Ho accessions. F: TAGGAATTCGCCGCCGAATCTTTCGAT F: R: TTGCCATTTGAAATAGGCTCCATCT F. TATGAATCACGAGGTCATCGCAGCA F. R: TTTTGCTTTCTGCAAGTCCTCATCAGGCG F: ATCGCCGAACATTGAGATGGACGA F: R: ACGTCATGTAGTGCGTGTATCGGTTACA CTCTGACTTGTTTAGGCCTAGTAGC F: R: TAGTTACCGGCGTGTGTGCTTGTATCGTT F: ACTGCCTACTTACTGTCAGCAAGGCAA F: R: GAGCAGGGGACTCAACAATATCTTA F: AAATGCTTGATTAGCTAAGGGGAGA F: R: TACGGTTCCCAGTTCGACACATTGTT TTGATTGATTCGTCTTACCATTTCCGC F: R: GAAACAAAACCATCCTCTACAGGT F: TTGATTGATTCGTCTTACCATTT F: R: ACAAAACCATCCTGTACAGGTCACA F: TATGAGAGAAACGAACCGGTAGGAGACT F: R: TACGGTTCCCAGTTCGACACATTGTT 350 400 180 Obs. y las demás gramíneas) se indicaron con letras itálicas. con letras se indicaron y las demás gramíneas) Trichloris crinita. Trichloris 540-550 600-610 170-180 170-180 180-190 187-190 ) heterozygosity values estimated for each SSR locus in a collection of for estimated values ) heterozygosity size (bp) He PCR product product PCR 294 298 642 180 164 187 184 181 187 crinita Trichloris Exp. T. crinita T. ) and expected ( ) and expected Donor species Cynodon dactylon Cynodon dactylon Cynodon dactylon Cynodon dactylon Cynodon dactylon Cynodon dactylon Eleusine coracana Eleusine coracana Eleusine coracana se indicaron en negrita. Los SSRs que amplificaron exitosamente en todos los materiales del panel de transferibilidad transferibilidad de panel del materiales los todos en exitosamente amplificaron que SSRs Los negrita. en indicaron se Ho collection are denoted in bold. SSRs that amplified successfully across all the taxa of the transferability panel ( of the transferability all the taxa across that amplified successfully in bold. SSRs denoted collection are ., todas las accesiones de ., todas i.e Eleusine indica, Eleusine coracana, Chloris castilloniana, Chloris gayana, Cynodon dactylon Chloris gayana, Chloris castilloniana, Eleusine coracana, Eleusine indica, ( Motif T. crinita crinita T. (GCA)6 (CATC)4 (GATC)4 (CACG)3 (CGGC)3 (TTGC)3 (TTGC)3 (GCGT)4 (AGCT)3 T. crinita T. Information for 16 genomic SSR markers (GSSRs) successfully transferred to to transferred successfully (GSSRs) 16 genomic SSR markers for Information SSR accessions, Información de los 16 marcadores SSR genómicos (GSSRs) que fueron exitosamente transferidos a transferidos exitosamente que fueron SSR genómicos (GSSRs) de los 16 marcadores Información marker GSSR-76 GSSR-80 GSSR-89 GSSR-90 GSSR-94 GSSR-93 GSSR-72 GSSR -77 GSSR-100 T. crinita T. número de alelos (A), y valores de heterocigosis observada ( observada de heterocigosis de alelos (A), y valores número of alleles (A), and observed ( of alleles (A), and observed Polymorphic markers in the markers Polymorphic Table 3 (cont.). Table crinita, crinita, Tabla 3 (cont.). Tabla Los marcadores polimórficos en polimórficos marcadores Los

Tomo 50 • N° 1 • 2018 9 P. C. Kozub et al.

The extent of marker transferability resis- in a sample set of eight T. crinita across grass species was associated with accessions varying in forage biomass the phylogenetic proximity between production and morphological traits donor and target species (table 2, page 7). (table 1, page 5). These polymorphic SSRs Thus, markers developed from E. coracana yielded a total of 23 alleles. The number sequences were more transferable to of alleles per SSR locus (A) varied from Eleusine species (~ 23-37% of transferable SSRs) than to Chloris (5-7%) heterozygosities (He) ranged from 0.48 to and Cynodon (6%). Similarly, SSRs 0.79,two towith six, mean with of a 0.63, mean whereas of 3.8. observed Expected developed from Cynodon sequence data heterozygosities (Ho) ranged from 0.0 to (i.e., from C. dactylon and ‘C. dactylon 1.0, with mean of 0.53 (table 3, page 8-9). x C. transvaalensis’) had highest trans- GSSR-11 (A = 6, He = 0.79) and GSSR-100 ferability to C. dactylon (~ 48-53% of (A = 2, He = 0. 48) were the most and the transferable SSRs), with reduced success least polymorphic markers, respectively. rate observed in Chloris (~ 5-29%) and Analysis of these types of data, including

Eleusine (~5-14%). He, Ho FIS) Overall, regardless of sequence source, were used in a previous study with these SSRs toand infer the about inbreeding the reproductive coefficient mode ( Eleusine indica, 28 in Eleusine coracana, of T. crinita. 1419 inSSR Chloris markers gayana amplified, 12 in Chlorissuccessfully castillo in- Considering all the markers (i.e., poly- niana, and 26 in Cynodon dactilon. Further morphic and monomorphic SSRs), the information on these SSR markers is mean number of alleles per locus was 2.12, with a range of one to six. Mean He was 0.28 Material - Tables S1-S5, including primer and ranged from 0.0 to 0.79, whereas mean sequence,presented inannealing Electronic temperature, Supplementary SSR Ho was 0.23 and ranged from zero to one motifs, amplicon lengths, and sequence (table 3, page 8-9). Nine SSRs (56%) had He source (donor species and sequence IDs values lower than 0.3 (low polymorphism), at NCBI). two SSRs (12%) exhibited values between Four SSR markers, namely GSSR-51, 0.3 and 0.5 (moderate polymorphism) and GSSR-52, GSSR-53, and GSSR-93 (table 3, He values higher than 0.5 (high level of polymorphism). size in all the accessions and species fiveGenetic SSRs (31%) diversity had and relatedness evaluatedpage 8-9), amplified (table 1, products page 5), of suggesting expected among T. crinita accessions was evaluated that they may be useful for comparative by estimating pair-wise genetic simi- analysis among Chloridoideae species. accessions. Genetic similarity (GS) values SSR polymorphism and genetic diversity rangedlarities (Jaccard from 0.35 coefficient) (between among Tc-3 and the in Trichloris crinita Tc-17, indicating that these were the two Six of the 16 SSRs (37.5%) that most genetically different accessions) to were successfully transferred to T. 0.81 (between Tc-3 and Tc-4, the geneti- crinita were polymorphic -as resolved cally closest accessions). The mean GS by polyacrylamide gel electropho- among all T. crinita accessions was 0.57.

10 Revista de la Facultad de Ciencias Agrarias SSR markers for Trichloris crinita

A phenogram, constructed on the basis Within T. crinita, all the accessions of six polymorphic SSRs depicted genetic were clearly discriminated. By clustering relations among T. crinita accessions and the accessions with more than 60% genetic similarity (GS=0.6), three groups T. crinita accessions were clearly separated of accessions were revealed. Cluster I fromfive relatedthe other grass grasses species (used (figureas outgroups), 1). All grouped 75% of the accessions, whereas including two close relatives of Trichloris groups II and III had one accession each. (Chloris castilloniana and Chloris gayana), indicating a coherent genetic clustering of the taxa.

Roman numbers indicate groups discriminated at 60% genetic similarity. For Trichloris crinita, taxa are indicated by the accession number, followed by a letter indicating whether they have high (H, > 120 g dry matter/plant), medium (M, between 60 and 120 g DM/plant), or low et al. (5). Trichloris crinita, se indica el número(L, less de accesión than 60 gseguido DM/plant) de una biomass letra que yield, indica according si es de to alta Cavagnaro (H, > 120 g materia seca/planta), Los números romanos indican grupos de accesiones con ≥ 60% de similitud genética. Para forrajera, de acuerdo con Cavagnaro et al. (5). media (M, entre 60 y 120 g MS/planta) o baja (L, menos de 60 g MS/planta) productividad de biomasa Figure 1. Phenetic relations among eight Trichloris crinita accessions and 5 phylogenetically-related grass species (outgroups) obtained from SSR marker data,

Figura 1. Trichloris crinita y 5 especies using UPGMA cluster analysis of the JaccardTrichloris similarity, obtenidas coefficient. sobre la base de Relaciones fenéticas entre ocho accesiones de de gramíneas filogenéticamente-relacionadas con datos de marcadores SSRs. El análisis de agrupamiento usó la metodología UPGMA y el coeficiente de similitud genética de Jaccard.

Tomo 50 • N° 1 • 2018 11 P. C. Kozub et al.

No clear association was found between However, these comparisons are not the clustering of the taxa and the accessions biomass production, as reported previously known to present higher transferability, - becausesurprising, coding since EST-derived regions are SSRs more are tering and the geographical origin of the conserved among related species, than taxausing (data AFLP not markers presented). (5), nor between clus SSRs developed from genomic sequence (GSSRs) (8, 9). Thus, transfer rates of the GSSRs developed in this study, although still Discussion relatively low, are comparable with cross- genera transferabilities of GSSRs reported previously in Apiaceae (22-42%) (6), on the development of SSR markers in Rosaceae (20%) (29), Asteraceae [17.6% TrichlorisThe present crinita study, an is important the first reportforage Helianthus annuus) grass from arid and semi-arid regions of Carthamus tinctorius America. Due to the lack of sequence data andbetween Fabaceae sunflower [~ 23-24% ( among mungbean for this species, the markers developed (andVigna safflower radiata (), common bean (Phaseolus)] (11), herein used available genomic sequences vulgaris), and soybean (Glycine max (GSS) from other phylogenetically- Six of the 16 SSRs successfully trans- related grasses of the Chloridoideae ferred were polymorphic in a collection)] (30). subfamily, namely Eleusine coracana, of eight phenotipically-diverse T. crinita Cynodon dactylon and ‘C. dactylon x accessions (table 1, page 5), revealing two C. transvaalensis’. Nearly 15% (16/105) to six alleles per SSR, with a mean of 3.83. of the total SSRs evaluated were success- The level of polymorphism at each fully transferred to T. crinita, with transfer locus was estimated by means of the rates ranging from 10.8% (for markers expected heterozygosity (He), instead of developed from E. coracana sequences) the ‘polymorphism index content’ (PIC) to 28.6 % (for C. dactylon markers). These traditionally used for estimating SSR poly- values are seemingly low, as compared morphism in diploid species, because esti- with previously reported cross-genera mation and interpretation of the PIC in SSR transfer rates within Poaceae polyploids, such as the tetraploid T. crinita, subfamilies. For example, transferability is particularly complex, as discussed by et al. (2007). These and other authors species, tef (Eragrostis tef) and bermuda grassof EST-SSRs (Cynodon between dactylon two), was Chloridoideae ~ 32% (35). correlationLiu (r = 0.9917, p < 0.01) between He(23) and have PIC reported in tetraploids, strong and suggesting significant Pooideae subfamily was also higher than in that He can be used effectively for esti- theSimilarly, present transferability study, with transfer of EST-SSRs rates in from the mating the level of polymorphism in SSR 27% [from wheat (Triticum aestivum) to loci in tetraploids. Thus, for the six poly- harding grass (Phalaris aquatica morphic markers of our study, the degree [from tall fescue (Festuca arundinacea) of polymorphism ranged from moderate to Kentucky bluegrass (Poa pratensis)] to 68% (He =0.48), in one SSR, to high (He = 0.56- as well as in Panicoideae, with 79-100% He of of transferred markers among maize,)], 0.63 (table 3, page 8-9). It must be noted sorghum and earl millet (35). that0.79), these in five polymorphic SSR loci, withSSRs awere mean used in a previous study for calculating inbreeding

12 Revista de la Facultad de Ciencias Agrarias SSR markers for Trichloris crinita

FIS) values in T. crinita proximity to Trichloris Chloris, Cynodon accessions, as a means for inferring about and Eleusine were associated with the thecoefficient species reproductive ( behavior (16). Trichloris cluster at GS values; of 0.18, 0.13, The relatively low number of polymorphic loci observed (6/16) may be Chloris and Trichloris are close relatives partially due to the autogamous nature and 0.05, the two respectively genera share (figure many 1, page morpho 11). - of T. crinita (16). Also, the sample set of logical features. This has led to contro- accessions selected for marker analysis versies of whether Chloris and Trichloris are in this study (table 1, page 5) may have the same genus (1) or whether they should limited the detection of more poly- be regarded as different genera (21). morphic SSRs. The results from the SSR cluster In other words, if larger and more analysis, demonstrating a clear sepa- genetically diverse T. crinita germplasm ration of all Trichloris accessions from were evaluated (e.g., in natural popula- the two Chloris species, at GS of 0.18 tions, or using germplasm collections from different geographical origins), additional values between all the Trichloris taxa polymorphic markers and new alleles may and(figure C. 1, castilloniana page 11), and the fact that GS be revealed. range = 0.12-0.17) and C. gayana The SSR analysis revealed considerable (mean GS = 0.15; genetic variation among T. crinita very low, support the separation of Chloris accessions, with pair-wise GS values and(GS meanTrichloris = 0.21; as two range distinct = 0.18-0.30) genera. were ranging from 0.35 to 0.81. These results In addition to the 16 SSRs transferred are in full agreement with those reported to T. crinita, 12 and 14 SSR markers could by Cavagnaro et al. (2006), indicating GS be transferred to Chloris castilloniana values of 0.31 to 0.92 among 20 T. crinita and Chloris gayana - tronic Supplementary Material-Tables , respectively (Elec (Jaccard)accessions was using used AFLP in both markers. studies, It must and markers developed for these orphan thatbe noted the eight that the accessions same GS used coefficient in the grassS1-S5). species. These Additionally, represent these the first markers SSR present study were among the plant mate- were polymorphic -and they were able rials used by Cavagnaro et al. (2006). to discriminate- between the two Chloris The SSR-based cluster analysis clearly separated all the grass genera into distinct The high resolution observed for thesespecies SSRs (figure in separating1, page 11). the two Chloris their genetic relatedness to Trichloris, and species (at a GM value < 0.50) suggest that amonggroups themselves, (figure 1, page in full 11), agreement and depicted with current phylogenetic and taxonomic rela- characterizing genetic diversity in intra- tionships in the Chloridoideae (10, 14). they may be useful for fingerprintingC. gayana and Thus, in decreasing order of phylogenetic C. castilloniana. specific plant collections of

Tomo 50 • N° 1 • 2018 13 P. C. Kozub et al.

The positive SSRs in Cynodon dactylon projects of Trichloris crinita and -perhaps- (26 SSRs), Eleusine coracana (28 SSRs) related grass species. Successful applica- and E. indica (19 SSRs), adds potentially tions of these markers for progeny testing new informative markers to the molecular toolkit of these species. were recently reported in a study aimed atand elucidating estimation the of reproductive inbreeding coefficients system of T. crinita (16). In addition, these SSRs can Conclusions be used for assisting breeding programs of this species. It is expected that the SSR markers developed in this study will be instru- mental in a number of genetic research

References

Chloris (Gramineae). Brigham Young University Science Bulletin Biological Series. 19: 1-133. 1. Anderson, D. E. 1974. Taxonomy of the genus

2. Bever, J. D.; Felber, F. 1992. The theoretical population genetics of autopolyploidy. Oxford Surveys in Evolutionary Biology. 8: 185-185. 3. Bruno, C.;Universidad Balzarini, M. Nacional 2010 Distancias de Cuyo. Mendoza. genéticas Argentina. entre perfiles 42(2): moleculares 171-182. obtenidos desde marcadores multilocus multialélicos. Revista de la Facultad de Ciencias Agrarias. native grasses of Mendoza. Pappophorum caespitosum and Trichloris crinita. Deserta. 4. Cavagnaro,7: 203-218.J. B.; Dalmasso, A. 1983. Response to different intensity and frequency of cutting in

among varieties of the native forage grass Trichloris crinita 5. Cavagnaro,morphological P. F.; Cavagnaro, characters, J. B.; Lemes, and J. quantitative L.; Masuelli, agronomicR. W.; Passera, traits. C. B. Genome. 2006. Genetic 49: 906-918. diversity based on AFLP markers,

6. Cavagnaro,carrot P. F.;- genomic Chung, distribution, S. M.; Manin, linkage S.; Yildiz, mapping, M.; Ali, genetic A.; Alessandro, diversity analysis M. S.; and Iorizzo marker M.; Senalik,transferability D. A.; Simon,across Apiaceae.P. W. 2011. BMC Microsatellite Genomics. 12:isolation 386. and marker development in

7. Cerqueira, E. D.; Sáenz, A. M.; Rabotnikof, C. M. 2004. Seasonalversus nutritive genomic value derived of native microsatellite grasses of Argentinemarkers for Calden genotyping Forest Range. wild andJournal cultivated of Arid Environments. barley. Genetic 59: Resources 645-656. and Crop 8. Chabane, K.; Ablett, G. A.; Cordeiro, G. M. 2005. EST Oryza and Evolution.other plant 52: species. 903-909. Molecular Genetics and Genomics. 268: 331-343. 9. Chen, X.; Cho, Y.; Mc Couch, S. 2002. Sequence divergence of rice microsatellites in

10. Columbus,(Gramineae): J. T.; Cerros-Tlatilpa, a preliminary R.; study Kinney, based M. on S.; nuclear Siqueiros-Delgado, ribosomal internal M. E.; transcribed Bell, H. L.; Griffith, M. P.; Refulio-Rodriguez, N. F. 2007. Phylogenetics of Chloridoideae

spacer and chloroplast trnL-F sequences.Transferability Aliso: A Journal of non-genic of Systematic microsatellite and Evolutionary Botany. 23: 565-579. 11. García-Moreno, M. J.; Velasco, L.; Pérez-Vich, B. 2010. and gene-based sunflower markers to safflower. Euphytica. 175: 145-150.

14 Revista de la Facultad de Ciencias Agrarias SSR markers for Trichloris crinita

12. Grandón,dormant N. G.; Alarcón, cultivars Y.; using Moreno, SSR M.markers V. Arolfo, and V.; agronomic Orodizzi, traits.A.; Basigalup, Revista deD. laH. FacultadGieco, J. O.;de Bruno,Ciencias C. Agrarias. 2013. Genetic Universidad diversity Nacional among dealfalfa Cuyo. genotypes Mendoza. (Medicago Argentina. sativa 45(2): L.) 181-195. of non-

three varieties of Trichloris crinita (Poaceae) a forage grass from the arid Monte region 13. Greco, S. A.; Cavagnaro, J. B. 2002 Effects of drought in biomass production and allocation in matK sequences. ofSystematic Argentina. Botany. Plant Ecology.26: 386-405. 164: 125-136. 14. Hilu, K. W.; Alice, L. A. 2001. A phylogeny of Chloridoideae (Poaceae) based on

15. Kalia, R. K.; Rai, M. K.: Kalia, S.; Singh, R., Dhawan, A. K. 2011. Microsatellite markers: An overviewReproductive of the biology recent progress of the in native plants. forage Euphytica. grass 177: Trichloris 309-334. crinita 16. Kozub, Chloridoideae).P. C.; Barboza, K.; Plant Galdeano, Biology. F.; 19: Quarin, 444-453. C. L.; Cavagnaro, J. B.; Cavagnaro, P. F. 2017. (Poaceae; autotetraploid alfalfa (Medicago sativa 17. Liu, Z. P.; Liu, G. S.; Yang, Q. C. 2007. A novel statistical method for assessing SSR variation in Forest Science. 58: 137-144. L.). Genetics and Molecular Biology. 30: 385-391. 18. Mahajan, R.; Gupta, P. 2012. Molecular markers: their use in tree improvement. Journal of de vid (Vitis vinifera 19. Martinez,la L.;Facultad Cavagnaro, de Ciencias P. F.; Masuelli, Agrarias. R. Universidad W. 2006. Caracterización Nacional de Cuyo. molecular Mendoza. de variedadesArgentina. 38(1): 77-86. L.) de calidad enológica por marcadores microsatélites. Revista de

Nucleic Acids Research. 8: 4321-4325. 20. Murray, M. G.; Thompson, W. F. 1980. Rapid isolation of high molecular weight plant DNA. Buenos Aires, Argentina. 21. Nicora, E. G.; Rúgolo de Agrasar, Z. E. 1987. Los géneros de gramíneas de América austral. on grazing capacity in Argentina. Journal of Range Management. 45: 480-482. 22. Passera, C. B.; Borsetto, O.; Candia, R. J.; Stasi, C. R. 1992. Shrub control and seedling influences different farms as revealed by microsatellite markers. Acta Genetica Sinica. 31: 591-595. 23. Qu, L. J.; Wu, G. Q.; Li, X. Y.; Yang, N. 2004. Conservation efficiency of local chicken breeds in

24. Quiroga, E.; Blanco, L.; Orionte, E. 2009. Evaluación de estrategias de rehabilitación de pastizales1: 201-239. áridos. Ecología Austral. 19: 107-117. 25. Roig, F. A. 1971. Flora y vegetación de la Reserva Forestal de Ñacuñán. La vegetación. Deserta. analysis of polyploidy. Taxon. 52: 736-746. 26. Roodt, R.; Spies, J. J. 2003. Chromosome studies in the grass subfamily Chloridoideae. II. An values in three ecotypes of Trichloris crinita, a native forage grass of the arid zones 27. Silva Colomer,of Argentina. J.; Cavagnaro, Proceedings J. B.; of Lemes, the XVI J.; International Medero, M. 1989.Grassland Productivity Congress. and Montpellier. nutritive France. 815-816.

28. Sneath, P.(SSR) H. A.; markers Sokal, R. forR. 1973. genetic Numerical mapping Taxonomy. of raspberry San Francisco. and blackberry. California. Journal of the 29. Stafne, E.American T.; Clark, Society J. R.; Weber, for Horticultural C. A.; Graham, Science. J.; Lewers, 130: 722-728. K. S. 2005. Simple sequence repeat

30. Tangphatsornruang,microsatellites S.; and Somta, gene P.; contents Uthaipaisanwong, from genome P.; shotgun Chanprasert, sequences J.; Sangsrakru, of mungbean D.; Seehalak,(Vigna radiata W.; Sommanas, W.; Tragoonrung, S.; Srinives, P. 2009. Characterization of

development and (L.) characterization Wilczek). BMC Plant of gene-derived Biology. 24: 137.SSR-markers in barley (Hordeum 31. Thiel, T.;vulgare Michalek, W.; Varshney, R.; Graner, A. 2003. Exploiting EST databases for the

L.). Theoretical and Applied Genetics. 106: 411-422.

Tomo 50 • N° 1 • 2018 15 P. C. Kozub et al.

Primer3-new capabilities and interfaces. Nucleic Acids Research. 40: e115. 32. Untergasser, A.; Cutcutache, I.; Koressaar, T.; Ye, J.; Faircloth, B. C.; Remm, M.; Rozen; S. G. 2012

33. Van Puyvelde, K.; Van Geert, A.; Triest, L. 2010. ATETRA, a new software program to analyse tetraploid microsatellite data: comparison with TETRA and TETRASAT. Molecular Ecologyfrom major Resources. cereal crops 10: 331-334. to minor grass species for germplasm characterization and 34. Wang, M.evaluation. L.; Barkley, Plant N. A.; Genetic Yu, J. Resources.K. 2005. Transfer 3: 45-57. of simple sequence repeat (SSR) markers

35. Zeid, M.; Yu, J. K.; Goldowitz, I.; Denton, M. E.; Costich, D. E.; Jayasuriya, C. 2010. Cross-amplification of EST-derived markers among 16 grass species. Field Crops Research. 118: 28-35. Acknowledgments

Nacional de Cuyo, Proyectos 06A/476 and 06A/569. Perla Carolina Kozub is a fellow of the The work was supported by grants from Secretaría de Ciencia, Técnica y Posgrado, Universidad

Consejo Nacional de Investigaciones Científicas y Técnicas (CONICET).

16 Revista de la Facultad de Ciencias Agrarias