DOCSLIB.ORG

Supplementary Information 1

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Supplementary Information 1 Supplementary Information A Generation of βKcnj11-/- mice 5’ untranslated 3’ untranslated Wild allele C.R Kcnj11fl/fl RIP-Cre+ C.R FRT FRT 3’ arm 5’ arm BGH IoxP+Neo allele C.R PGK Neo promoter polyA RIPCre+;Kcnj11fl/+ Kcnj11fl/fl fl/fl fl/fl 5’ arm 3’ arm Kcnj11 RIP-Cre+;Kcnj11 Floxed (fl) allele C.R 5’ arm 3’ arm Null (-) allele RIP-Cre+;Kcnj11fl/fl Kcnj11fl/fl C.R: Coding region (βKcnj11-/-) (Control) B Gene expression C Islet morphology Kcnj11fl/fl Kcnj11fl/fl βKcnj11-/- βKcnj11-/- Insulin/Glucagon/DAPI 2.5 1.6 n.s. fl n.s. fl/ 1.4 n.s. 2.0 1.2 ** 1.0 Kcnj11 gene expression 1.5 0.8 -/- 0.6 1.0 0.4 Kcnj11 0.5 0.2 Kcnj11 β (fold change of control) (fold change of control) Relative Relative gene expression 0.0 0.0 Scale bars: 100 μm Kcnj11 Abcc8 Ins1 Ins2 Heart Skeletal Brain Relative Relative muscle D Insulin content E ipGTT fl/fl ** Kcnj11fl/fl 600 Kcnj11 0.8 * -/- -/- n.s ** βKcnj11 ** βKcnj11 500 . 500 ** 0.6 n.s 400 ) 400 ** dL n.s 300 300 ** 0.4 * 200 (mg/ 200 Blood Blood glucose 0.2 ng/5 islets) Insulin content ( 100 100 Plasma insulin (ng/mL) Plasma 0 0 0 Kcnj11fl/fl βKcnj11-/- 0 30 60 90 120 0 15 30 0 15 30 Time (min) Time (min) F oGTT G Perfusion of pancreas H Glucagon Kcnj11fl/fl Veh fl/fl ) Tolb/Veh Kcnj11 Tolb 2.8 mM glucose fl/fl βKcnj11-/- Veh Kcnj11 500 100 μM tolbutamide 8 βKcnj11-/- βKcnj11-/- Tolb 10 n.s. 400 6 8 n.s. n.s. 300 Kcnj11fl/fl 6 βKcnj11-/- /5 islets) /5 4 200 pg 4 ( * 2 Blood Blood glucose (mg/dL 100 2 secretionGlucagon n.s. ** * * * 0 0 0 -30 0 30 60 90 120 Insulin secretion (ng/mL) 0 5 10 15 20 25 Glucose (mM) 1.67 16.7 8.4 8.4 Time (min) Time (min) Arginine (20 mM) + - Carbachol (100 µM) - + 1 Oduori et al. Supplementary Figure 1. (A) Generation of Kcnj11-/- mice. Left, Schematic diagram of Kcnj11 gene targeting. The targeting vector containedβ phosphoglycerol kinase (PGK) promoter/a neomycin (Neo) resistant selection cassette flanked by flippase recognition target (FRT) sites and loxP sites on either side of the exon of the Kcnj11 gene. The neomycin resistant (Neor) cassette (flanked by FRT sites) was added to the targeting vector for positive selection, and was deleted in mice using FLP-FRT recombination system. Targeted allele, floxed allele after flippase recombination and final allele with the targeted region deleted are shown. Right, Production of bKcnj11-/- mice by crossing Kcnj11fl/fl mice with RIP-Cre+; Kcnj11fl/fl mice. (B) Expressions of Kcnj11, Abcc8, Ins1, and Ins2 genes in the islets and Kcnj11 in the brain, heart, and skeletal muscles assessed by qPCR (n = 3 for each). Expression of each gene was normalized by that of Gapdh and presented as fold change of control. (C) Immunohistochemistry of the islets. Green, insulin; Red, glucagon. (D) Insulin content of the islets (n = 16 for both groups). (E) Intraperitoneal(ip) glucose tolerance test. Left, blood glucose. Right, plasma insulin (n = 7 for both groups). (F) oGTT following tolbutamide (Tolb) administration. Tolb (50 mg/kg) was orally administered to 6 h-fasted mice 20 min prior to glucose challenge (1.5 g/kg) (n = 6 per group). Veh, vehicle (0.5% carboxymethyl cellulose). (G) Effects of Tolb on insulin secretion from perfused pancreases in the presence of 2.8 mM glucose. Basal insulin secretion in Kcnj11-/- mice was significantly elevated compared to control (n = 4 for both groups). β (H) Glucagon secretion from the islets at high glucose (16.7 mM), low glucose (1.67 mM), and arginine or carbachol at 8.4 mM glucose (n = 5-6 for each condition). Statistical analyses were performed by 2-tailed Student’s unpaired t-test for (B), (D), and (H) or by 2-way ANOVA followed by Dunnett’s post hoc test for (E), (F), and (G). Data represent mean ±SEM. *p < 0.05, **p < 0.01 2 A oGTT B oGTT C oGTT n.s. ** n.s. ** ** ** ** ** ** ) ) ) ** 3 * 3 3 ** AUC (X 10 AUC (X 10 AUC (X 10 Veh Sita Veh Sita Sita Sita + Sita Sita + Veh Lira Veh Lira Kcnj11fl/fl βKcnj11-/- Ex9 Ex9 Kcnj11fl/fl βKcnj11-/- Kcnj11fl/fl βKcnj11-/- D ipGTT Kcnj11fl/fl Veh n.s. 600 Kcnj11fl/fl GLP-1 -/- * ** ) βKcnj11 Veh 500 -/- * βKcnj11 GLP-1 ** ) 400 3 300 200 AUC (X 10 100 Blood Blood glucose (mg/dL 0 -30 0 30 60 90 120 Veh GLP-1 Veh GLP-1 Time (min) Kcnj11fl/fl βKcnj11-/- E ipGTT Kcnj11fl/fl Veh 600 Kcnj11fl/fl GIP ** ) βKcnj11-/- Veh * 500 βKcnj11-/- GIP ) ** 400 3 300 200 AUC (X 10 100 Blood Blood glucose (mg/dL 0 -30 0 30 60 90 120 Veh GIP Veh GIP Time (min) Kcnj11fl/fl βKcnj11-/- 2.8 mM G 16.7 mM G 2.8 mM G F Perfusion of pancreas 10 nM GIP 80 2.8 mM G 8.8 mM G 2.8 mM G 12 70 60 10 Kcnj11fl/fl βKcnj11-/- 50 Kcnj11fl/fl 8 βKcnj11-/- 40 6 30 4 20 2 Insulin secretion (ng/mL) 10 Insulin secretion (ng/mL) 0 0 0 15 20 25 30 35 0 5 10 15 20 25 30 35 Time (min) Time (min) 3 Oduori et al. Supplementary Figure 2. (A) AUC during oGTT following sitagliptin (Sita) administration in Figure 2A (n = 5-8 per group). (B) AUC during oGTT following sitagliptin (Sita) and exendin-9 (Ex9) administration in Figure 2D (n = 6-10 per group). (C) AUC during oGTT following liraglutide (Lira) administration in Figure 2E (n = 7-12 per group). (D) ipGTT following exogenous administration of GLP-1 (left) and AUC (right) (n = 6-8 per group). (E) ipGTT following exogenous administration of GIP (left) and AUC (right) (n = 6-14 per group). (F) Effect of glucose alone on insulin secretion from perfused pancreases (n = 4 for both groups). (G) Effect of high GIP concentration (10 nM) on insulin secretion from perfused pancreases (n = 4 for both groups). GLP-1 or GIP (100 µg/kg, each) was intraperitoneally administered to mice 20 min before glucose challenge in (D) and (E). Veh, vehicle (water); AUC, area under the curve. Mice were fasted overnight before perfusion experiments commenced in (F) and (G). Statistical analyses were performed by 2-way ANOVA followed by Tukey’s post hoc test. Data represent mean ±SEM. *p < 0.05, **p < 0.01 4 A Incretin receptors B Adenylyl cyclases C Phosphodiestrases -/- fl/fl -/- -/- fl/fl βKcnj11 Kcnj11 βKcnj11 Kcnj11fl/fl βKcnj11 Kcnj11 Gene expression Gene Gene expression Gene Gene expression Gene D Kcnj11 gene sequence Wild-type sequence TATCCCTGAGGAATATGTGCTGACCCGGCTGGCAGAGGACCCTGCAGAGCCCAGGTACCGTACTCGAGAGAGGAGGGCCCGCTTCGTG Kcnj11-/-βCL1 allele 1: -13 TATCCCTGAGAAATA ------------- CTGGCAGAGGACCCTGCAGAGCCCAGGTACCGTACTCGAGAGAGGAGGGCCCGCTTCGTG Kcnj11-/-βCL1 allele 2: +37 TATCCCTGAGGAATATGTGCTGACCCGGCTGGCAGAGGACCCTGCAGAGCCCAGGTACCGTACTCGAGAGAGGAGGGCCCGCTTCGTG GTGCTGACCCGGCTGGCAGAGGACCCTGCAGAGCCAG Kcnj11-/-βCL2 allele 1: +80 (-5, +90) TATCCCTGAGGAATATGTGCTGACCCGGCTGGCAGAGGACCCTGCAGAGCCCAGGTACCGT----- CGAGAGGAGGGCCCGCTTCGTG GCTGACCCGGCTGGCAGACCCGGCTGGCAGAGGACCCTGCAGAGCCCAGGTGCTGACCCGGCTGGCAGAGGACCCTGCAGAGCCCAGGT Kcnj11-/-βCL2 allele 2: +124 (+168, -44) TATCCCTGAGGAATATGTGCTGACCCGGCTGGCAGAGGACCCTGCAGAGCCCAGGTACCGTACTCGAGAGAGGAGGGCCCGCTTCGTG GAAAATGGATATACAAGCTCCCGGGAGCTTTTTGCAAAAGCCTAGGCCTCCAAAAAAGCCTCCCCACTACTTCTGGAATAGCTCAGAGGCAGA GGCGGCCTCGGCCTCTGCATAAATAAAAAAAATTAGTCAGCCATGGGGCGGAGAATGGGCGGAACTGGGCGGAG E KATP channel activity F Insulin secretion Parental -/- -/- 100pA Control Diazoxide Tolbutamide Kcnj11 βCL1 Kcnj11 βCL2 ** ** Parental (MIN6-K8) Kcnj11-/- βCL1 * n.s. n.s. Kcnj11-/- βCL2 n.s. 5 ** content) (% ** Insulin secretion 4 Control (C) 3 Diazoxide (100µM) (D) Glucose (mM) 2.8 2.8 16.7 2.8 2.8 16.7 2.8 2.816.7 100 nM Glibenclamide - + - - + - - + - /pF) Tolbutamide (100µM) (T) Parental Kcnj11-/- βCL1Kcnj11-/- βCL2 nS 2 ( 1 Normalized conductance Normalized 0 CDTCDTCDT Parental Kcnj11-/- βCL1 Kcnj11-/- βCL2 cAMP G Insulin secretion H n.s. 12 ** ** 800 Parental 10 700 Kcnj11-/- βCL1 * ** /ng DNA) 600 8 ** * 500 6 fmol 400 4 * (% content) (% 300 ** * Insulin secretion 2 200 0 100 Glucose (11.1 mM) + + + + + + 0 cAMP content ( cAMP 0 0.1 0.5 1.0 GLP-1 (1 nM) - + - - + - GLP-1 (nM) - - + - - + 2.8 mM G mM 2.8 GIP (1 nM) G mM 2.8 Parental Kcnj11-/- βCL1 5 I PKC activity Phosphoserine- PKC substrates β-actin -/- Parental Kcnj11-/- βCL Parental Kcnj11 βCL Marker 1 2 3 4 5 6 1 2 3 4 5 6 1 2 3 4 5 6 1 2 3 4 5 6 (kDa) 1. 2.8 mM Glucose 200 2. 2.8 mM Glucose + 100 nM BIM-1 116 3. 2.8 mM Glucose + 1 nM GLP-1 97.4 4. 2.8 mM Glucose + 1 nM GLP-1 + 100 nM BIM-1 66 5. 2.8 mM Glucose + 5 µM Carbachol 6. 2.8 mM Glucose + 5 µM Carbachol + 100 nM BIM-1 45 BIM-1: Bisindolylmaleimide-1; a selective PKC inhibitor Densitometric analysis 8 J Intracellular calcium actin ratio actin - 6 2.4 2.2 4 380 2 /F 2 340 1.8 ΔF 0 1.6 1 2 3 4 5 6 1 2 3 4 5 6 1.4 ser PKC substrates/β PKC ser Parental Kcnj11-/- βCL1 0 1 2 3 4 P- Time (min) K Gs and Gq protein expression -/- Parental Kcnj11 βCL Parental Kcnj11-/- βCL Marker Marker Parental Kcnj11-/- βCL 1 2 1 2 1 2 1 2 Marker kDa kDa kDa 1 2 1 2 200 200 200 116 116 97.4 116 97.4 97.4 66 66 66 46 β-actin (MW 45 Gαq Gαs 46 46 kDa) (MW 45 (MW 45 31 kDa) kDa) 31 31 21.5 14.5 1.0 1.0 actin ratio actin 0.5 0.5 actin ratio actin Gαq/β- 0.0 Gαs/β- 0.0 1 1 CL CL β β - / - - / - Parental Parental Kcnj11 Kcnj11 6 Oduori et al. Supplementary Figure 3. Expressions of Glp-1r and Gipr (A), adenylyl cyclases (Adcy) (B), and phosphodiesterases (Pde) (C) in pancreatic islets assessed by qPCR (n = 3 for both mouse groups for each gene expression).
Load more

Recommended publications
  • A Minimum-Labeling Approach for Reconstructing Protein Networks Across Multiple Conditions
    A Minimum-Labeling Approach for Reconstructing Protein Networks across Multiple Conditions Arnon Mazza1, Irit Gat-Viks2, Hesso Farhan3, and Roded Sharan1 1 Blavatnik School of Computer Science, Tel Aviv University, Tel Aviv 69978, Israel. Email: [email protected]. 2 Dept. of Cell Research and Immunology, Tel Aviv University, Tel Aviv 69978, Israel. 3 Biotechnology Institute Thurgau, University of Konstanz, Unterseestrasse 47, CH-8280 Kreuzlingen, Switzerland. Abstract. The sheer amounts of biological data that are generated in recent years have driven the development of network analysis tools to fa- cilitate the interpretation and representation of these data. A fundamen- tal challenge in this domain is the reconstruction of a protein-protein sub- network that underlies a process of interest from a genome-wide screen of associated genes. Despite intense work in this area, current algorith- mic approaches are largely limited to analyzing a single screen and are, thus, unable to account for information on condition-specific genes, or reveal the dynamics (over time or condition) of the process in question. Here we propose a novel formulation for network reconstruction from multiple-condition data and devise an efficient integer program solution for it. We apply our algorithm to analyze the response to influenza in- fection in humans over time as well as to analyze a pair of ER export related screens in humans. By comparing to an extant, single-condition tool we demonstrate the power of our new approach in integrating data from multiple conditions in a compact and coherent manner, capturing the dynamics of the underlying processes. 1 Introduction With the increasing availability of high-throughput data, network biol- arXiv:1307.7803v1 [q-bio.QM] 30 Jul 2013 ogy has become the method of choice for filtering, interpreting and rep- resenting these data.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • The Schizophrenia Risk Gene Product Mir-137 Alters Presynaptic Plasticity
    The schizophrenia risk gene product miR-137 alters presynaptic plasticity The Harvard community has made this article openly available. Please share how this access benefits you. Your story matters Citation Siegert, S., J. Seo, E. J. Kwon, A. Rudenko, S. Cho, W. Wang, Z. Flood, et al. 2015. “The schizophrenia risk gene product miR-137 alters presynaptic plasticity.” Nature neuroscience 18 (7): 1008-1016. doi:10.1038/nn.4023. http://dx.doi.org/10.1038/nn.4023. Published Version doi:10.1038/nn.4023 Citable link http://nrs.harvard.edu/urn-3:HUL.InstRepos:24983896 Terms of Use This article was downloaded from Harvard University’s DASH repository, and is made available under the terms and conditions applicable to Other Posted Material, as set forth at http:// nrs.harvard.edu/urn-3:HUL.InstRepos:dash.current.terms-of- use#LAA HHS Public Access Author manuscript Author Manuscript Author ManuscriptNat Neurosci Author Manuscript. Author manuscript; Author Manuscript available in PMC 2016 January 01. Published in final edited form as: Nat Neurosci. 2015 July ; 18(7): 1008–1016. doi:10.1038/nn.4023. The schizophrenia risk gene product miR-137 alters presynaptic plasticity Sandra Siegert1,2, Jinsoo Seo1,2,*, Ester J. Kwon1,2,*, Andrii Rudenko1,2,*, Sukhee Cho1,2, Wenyuan Wang1,2, Zachary Flood1,2, Anthony J. Martorell1,2, Maria Ericsson4, Alison E. Mungenast1,2, and Li-Huei Tsai1,2,3,5 1Picower Institute for Learning and Memory, Massachusetts Institute of Technology (MIT), Cambridge, MA, USA 2Department of Brain and Cognitive Sciences, MIT, Cambridge, MA, USA 3Broad Institute of MIT and Harvard, Cambridge, MA, USA 4Department of Cell Biology, Harvard Medical School, Boston, MA 02115, USA Abstract Non-coding variants in the human MIR137 gene locus increase schizophrenia risk at a genome- wide significance level.
    [Show full text]
  • Supplementary Tables
    Supplementary Tables Supplementary Table S1: Preselected miRNAs used in feature selection Univariate Cox proportional hazards regression analysis of the endpoint freedom from recurrence in the training set (DKTK-ROG sample) allowed the pre-selection of 524 miRNAs (P< 0.5), which were used in the feature selection. P-value was derived from log-rank test. miRNA p-value miRNA p-value miRNA p-value miRNA p-value hsa-let-7g-3p 0.0001520 hsa-miR-1304-3p 0.0490161 hsa-miR-7108-5p 0.1263245 hsa-miR-6865-5p 0.2073121 hsa-miR-6825-3p 0.0004257 hsa-miR-4298 0.0506194 hsa-miR-4453 0.1270967 hsa-miR-6893-5p 0.2120664 hsa-miR-668-3p 0.0005188 hsa-miR-484 0.0518625 hsa-miR-200a-5p 0.1276345 hsa-miR-25-3p 0.2123829 hsa-miR-3622b-3p 0.0005885 hsa-miR-6851-3p 0.0531446 hsa-miR-6090 0.1278692 hsa-miR-3189-5p 0.2136060 hsa-miR-6885-3p 0.0006452 hsa-miR-1276 0.0557418 hsa-miR-148b-3p 0.1279811 hsa-miR-6073 0.2139702 hsa-miR-6875-3p 0.0008188 hsa-miR-3173-3p 0.0559962 hsa-miR-4425 0.1288330 hsa-miR-765 0.2141536 hsa-miR-487b-5p 0.0011381 hsa-miR-650 0.0564616 hsa-miR-6798-3p 0.1293342 hsa-miR-338-5p 0.2153079 hsa-miR-210-5p 0.0012316 hsa-miR-6133 0.0571407 hsa-miR-4472 0.1300006 hsa-miR-6806-5p 0.2173515 hsa-miR-1470 0.0012822 hsa-miR-4701-5p 0.0571720 hsa-miR-4465 0.1304841 hsa-miR-98-5p 0.2184947 hsa-miR-6890-3p 0.0016539 hsa-miR-202-3p 0.0575741 hsa-miR-514b-5p 0.1308790 hsa-miR-500a-3p 0.2185577 hsa-miR-6511b-3p 0.0017165 hsa-miR-4733-5p 0.0616138 hsa-miR-378c 0.1317442 hsa-miR-4515 0.2187539 hsa-miR-7109-3p 0.0021381 hsa-miR-595 0.0629350 hsa-miR-3121-3p
    [Show full text]
  • Syntaxin 16'S Newly Deciphered Roles in Autophagy
    cells Perspective Syntaxin 16’s Newly Deciphered Roles in Autophagy Bor Luen Tang 1,2 1 Department of Biochemistry, Yong Loo Lin School of Medicine, National University of Singapore, Singapore 117596, Singapore; [email protected]; Tel.: +65-6516-1040 2 NUS Graduate School for Integrative Sciences and Engineering, National University of Singapore, Singapore 119077, Singapore Received: 19 November 2019; Accepted: 6 December 2019; Published: 17 December 2019 Abstract: Syntaxin 16, a Qa-SNARE (soluble N-ethylmaleimide-sensitive factor activating protein receptor), is involved in a number of membrane-trafficking activities, particularly transport processes at the trans-Golgi network (TGN). Recent works have now implicated syntaxin 16 in the autophagy process. In fact, syntaxin 16 appears to have dual roles, firstly in facilitating the transport of ATG9a-containing vesicles to growing autophagosomes, and secondly in autolysosome formation. The former involves a putative SNARE complex between syntaxin 16, VAMP7 and SNAP-47. The latter occurs via syntaxin 16’s recruitment by Atg8/LC3/GABARAP family proteins to autophagosomes and endo-lysosomes, where syntaxin 16 may act in a manner that bears functional redundancy with the canonical autophagosome Qa-SNARE syntaxin 17. Here, I discuss these recent findings and speculate on the mechanistic aspects of syntaxin 16’s newly found role in autophagy. Keywords: ATG9; autophagy; autophagosome; SNARE; syntaxin 16; syntaxin 17; VAMP7 1. Introduction Vesicular membrane trafficking [1] and macroautophagy [2] are two highly conserved cellular membrane remodeling processes in eukaryotes. The former mediates the transfer of materials between membrane compartments, while the latter serves to degrade and recycle cytosolic as well as membranous cellular materials.
    [Show full text]
  • Effects of Neonatal Stress and Morphine on Murine Hippocampal Gene Expression
    0031-3998/11/6904-0285 Vol. 69, No. 4, 2011 PEDIATRIC RESEARCH Printed in U.S.A. Copyright © 2011 International Pediatric Research Foundation, Inc. Effects of Neonatal Stress and Morphine on Murine Hippocampal Gene Expression SANDRA E. JUUL, RICHARD P. BEYER, THEO K. BAMMLER, FEDERICO M. FARIN, AND CHRISTINE A. GLEASON Department of Pediatrics [S.E.J., C.A.G.], Department of Environmental and Occupational Health Sciences [R.P.B., T.K.B., F.M.F.], University of Washington, Seattle, Washington 98195 ABSTRACT: Critically ill preterm infants experience multiple to severe impairment occurring in close to 50% of ex- stressors while hospitalized. Morphine is commonly prescribed to tremely LBW infants (4). Autism, attention deficit disorder, ameliorate their pain and stress. We hypothesized that neonatal and school failure also occur more frequently in NICU stress will have a dose-dependent effect on hippocampal gene survivors (5). Although some degree of impairment might expression, and these effects will be altered by morphine treat- ment. Male C57BL/6 mice were exposed to five treatment condi- be inevitable, it is likely that the stress and treatments these tions between postnatal d 5 and 9: 1) control, 2) mild stress ϩ infants undergo impact neurologic outcome. Improved un- saline, 3) mild stress ϩ morphine, 4) severe stress ϩ saline, and derstanding of these factors will provide the basis of better 5) severe stress ϩ morphine. Hippocampal RNA was extracted treatments and subsequent improvement in outcomes. and analyzed using Affymetrix Mouse Gene 1.0 ST Arrays. Single Many preterm infants receive opiates for sedation or gene analysis and gene set analysis were used to compare groups analgesia during their NICU stay.
    [Show full text]
  • WO 2019/079361 Al 25 April 2019 (25.04.2019) W 1P O PCT
    (12) INTERNATIONAL APPLICATION PUBLISHED UNDER THE PATENT COOPERATION TREATY (PCT) (19) World Intellectual Property Organization I International Bureau (10) International Publication Number (43) International Publication Date WO 2019/079361 Al 25 April 2019 (25.04.2019) W 1P O PCT (51) International Patent Classification: CA, CH, CL, CN, CO, CR, CU, CZ, DE, DJ, DK, DM, DO, C12Q 1/68 (2018.01) A61P 31/18 (2006.01) DZ, EC, EE, EG, ES, FI, GB, GD, GE, GH, GM, GT, HN, C12Q 1/70 (2006.01) HR, HU, ID, IL, IN, IR, IS, JO, JP, KE, KG, KH, KN, KP, KR, KW, KZ, LA, LC, LK, LR, LS, LU, LY, MA, MD, ME, (21) International Application Number: MG, MK, MN, MW, MX, MY, MZ, NA, NG, NI, NO, NZ, PCT/US2018/056167 OM, PA, PE, PG, PH, PL, PT, QA, RO, RS, RU, RW, SA, (22) International Filing Date: SC, SD, SE, SG, SK, SL, SM, ST, SV, SY, TH, TJ, TM, TN, 16 October 2018 (16. 10.2018) TR, TT, TZ, UA, UG, US, UZ, VC, VN, ZA, ZM, ZW. (25) Filing Language: English (84) Designated States (unless otherwise indicated, for every kind of regional protection available): ARIPO (BW, GH, (26) Publication Language: English GM, KE, LR, LS, MW, MZ, NA, RW, SD, SL, ST, SZ, TZ, (30) Priority Data: UG, ZM, ZW), Eurasian (AM, AZ, BY, KG, KZ, RU, TJ, 62/573,025 16 October 2017 (16. 10.2017) US TM), European (AL, AT, BE, BG, CH, CY, CZ, DE, DK, EE, ES, FI, FR, GB, GR, HR, HU, ΓΕ , IS, IT, LT, LU, LV, (71) Applicant: MASSACHUSETTS INSTITUTE OF MC, MK, MT, NL, NO, PL, PT, RO, RS, SE, SI, SK, SM, TECHNOLOGY [US/US]; 77 Massachusetts Avenue, TR), OAPI (BF, BJ, CF, CG, CI, CM, GA, GN, GQ, GW, Cambridge, Massachusetts 02139 (US).
    [Show full text]
  • Lipid Droplets Protect Human Β Cells from Lipotoxic-Induced Stress and Cell
    bioRxiv preprint doi: https://doi.org/10.1101/2021.06.19.449124; this version posted June 20, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Lipid droplets protect human β cells from lipotoxic-induced stress and cell identity changes Xin Tong1 and Roland Stein1,2 1Department of Molecular Physiology and Biophysics, Vanderbilt University, Nashville, TN 2Corresponding author: [email protected]; Tel: 615-322-7026 1 bioRxiv preprint doi: https://doi.org/10.1101/2021.06.19.449124; this version posted June 20, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Abstract (200 words) Free fatty acids (FFAs) are often stored in lipid droplet (LD) depots for eventual metabolic and/or synthetic use in many cell types, such a muscle, liver, and fat. In pancreatic islets, overt LD accumulation was detected in humans but not mice. LD buildup in islets was principally observed after roughly 11 years of age, increasing throughout adulthood under physiologic conditions, and also enriched in type 2 diabetes. To obtain insight into the role of LDs in human islet β cell function, the levels of a key LD structural protein, perilipin2 (PLIN2), were manipulated by lentiviral-mediated knock-down (KD) or over-expression (OE) in EndoCβH2-Cre cells, a human cell line with adult islet β-like properties.
    [Show full text]
  • Figure S1. SYT1 and SYT3 Are Induced Under Abiotic Stress (Related to Figure 1)
    Figure S1. SYT1 and SYT3 are induced under abiotic stress (related to Figure 1). (A) Phylogenetic clustering of the Arabidopsis protein coding sequence of SYT1, SYT2, SYT3, SYT4, SYT5 and the Homo sapiens E-Syt1. Phylogenetic tree was inferred using the Neighbor-Joining method. The optimal tree with the sum of branch length = 3.26 is shown. The tree is drawn to scale, with branch lengths in the same units as those of the evolutionary distances used to infer the phylogenetic tree. The evolutionary distances were computed using the p-distance method and are in the units of the number of amino acid differences per site. This analysis involved 11 amino acid sequences. All ambiguous positions were removed for each sequence pair (pairwise deletion option). There were a total of 1752 positions in the final dataset. Evolutionary analyses were conducted using MEGA X (Kumar et al., 2018). (B) Gene expression profiles based on RNA-seq analysis of SYT1, SYT2, SYT3, SYT4, and SYT5 in vegetative tissues at different developmental stages from TRAVA database http://travadb.org/). Each dot represent a RNAseq value and the bar represent the median. (C) Gene expression profiles based on RNA-seq analysis of SYT1, SYT3, and SYT5 in eFP-seq Browser after various abiotic stresses (https://bar.utoronto.ca/eFP-Seq_Browser/).https://bar.utoronto.ca/eFP- Seq_Browser/). (D) Heatmap representing the expression responses to abiotic stress of SYT1, SYT3 and SYT5. Expression levels genes are represented as the fold-change relative to the control. Red represents a gene that is induced, and blue represents a gene that is repressed in response to the indicated abiotic stress.
    [Show full text]
  • Table S2.Up Or Down Regulated Genes in Tcof1 Knockdown Neuroblastoma N1E-115 Cells Involved in Differentbiological Process Anal
    Table S2.Up or down regulated genes in Tcof1 knockdown neuroblastoma N1E-115 cells involved in differentbiological process analysed by DAVID database Pop Pop Fold Term PValue Genes Bonferroni Benjamini FDR Hits Total Enrichment GO:0044257~cellular protein catabolic 2.77E-10 MKRN1, PPP2R5C, VPRBP, MYLIP, CDC16, ERLEC1, MKRN2, CUL3, 537 13588 1.944851 8.64E-07 8.64E-07 5.02E-07 process ISG15, ATG7, PSENEN, LOC100046898, CDCA3, ANAPC1, ANAPC2, ANAPC5, SOCS3, ENC1, SOCS4, ASB8, DCUN1D1, PSMA6, SIAH1A, TRIM32, RNF138, GM12396, RNF20, USP17L5, FBXO11, RAD23B, NEDD8, UBE2V2, RFFL, CDC GO:0051603~proteolysis involved in 4.52E-10 MKRN1, PPP2R5C, VPRBP, MYLIP, CDC16, ERLEC1, MKRN2, CUL3, 534 13588 1.93519 1.41E-06 7.04E-07 8.18E-07 cellular protein catabolic process ISG15, ATG7, PSENEN, LOC100046898, CDCA3, ANAPC1, ANAPC2, ANAPC5, SOCS3, ENC1, SOCS4, ASB8, DCUN1D1, PSMA6, SIAH1A, TRIM32, RNF138, GM12396, RNF20, USP17L5, FBXO11, RAD23B, NEDD8, UBE2V2, RFFL, CDC GO:0044265~cellular macromolecule 6.09E-10 MKRN1, PPP2R5C, VPRBP, MYLIP, CDC16, ERLEC1, MKRN2, CUL3, 609 13588 1.859332 1.90E-06 6.32E-07 1.10E-06 catabolic process ISG15, RBM8A, ATG7, LOC100046898, PSENEN, CDCA3, ANAPC1, ANAPC2, ANAPC5, SOCS3, ENC1, SOCS4, ASB8, DCUN1D1, PSMA6, SIAH1A, TRIM32, RNF138, GM12396, RNF20, XRN2, USP17L5, FBXO11, RAD23B, UBE2V2, NED GO:0030163~protein catabolic process 1.81E-09 MKRN1, PPP2R5C, VPRBP, MYLIP, CDC16, ERLEC1, MKRN2, CUL3, 556 13588 1.87839 5.64E-06 1.41E-06 3.27E-06 ISG15, ATG7, PSENEN, LOC100046898, CDCA3, ANAPC1, ANAPC2, ANAPC5, SOCS3, ENC1, SOCS4,
    [Show full text]
  • (12) United States Patent (10) Patent No.: US 7.873,482 B2 Stefanon Et Al
    US007873482B2 (12) United States Patent (10) Patent No.: US 7.873,482 B2 Stefanon et al. (45) Date of Patent: Jan. 18, 2011 (54) DIAGNOSTIC SYSTEM FOR SELECTING 6,358,546 B1 3/2002 Bebiak et al. NUTRITION AND PHARMACOLOGICAL 6,493,641 B1 12/2002 Singh et al. PRODUCTS FOR ANIMALS 6,537,213 B2 3/2003 Dodds (76) Inventors: Bruno Stefanon, via Zilli, 51/A/3, Martignacco (IT) 33035: W. Jean Dodds, 938 Stanford St., Santa Monica, (Continued) CA (US) 90403 FOREIGN PATENT DOCUMENTS (*) Notice: Subject to any disclaimer, the term of this patent is extended or adjusted under 35 WO WO99-67642 A2 12/1999 U.S.C. 154(b) by 158 days. (21)21) Appl. NoNo.: 12/316,8249 (Continued) (65) Prior Publication Data Swanson, et al., “Nutritional Genomics: Implication for Companion Animals'. The American Society for Nutritional Sciences, (2003).J. US 2010/O15301.6 A1 Jun. 17, 2010 Nutr. 133:3033-3040 (18 pages). (51) Int. Cl. (Continued) G06F 9/00 (2006.01) (52) U.S. Cl. ........................................................ 702/19 Primary Examiner—Edward Raymond (58) Field of Classification Search ................... 702/19 (74) Attorney, Agent, or Firm Greenberg Traurig, LLP 702/23, 182–185 See application file for complete search history. (57) ABSTRACT (56) References Cited An analysis of the profile of a non-human animal comprises: U.S. PATENT DOCUMENTS a) providing a genotypic database to the species of the non 3,995,019 A 1 1/1976 Jerome human animal Subject or a selected group of the species; b) 5,691,157 A 1 1/1997 Gong et al.
    [Show full text]
  • CORVET, CHEVI and HOPS – Multisubunit Tethers of the Endo
    © 2019. Published by The Company of Biologists Ltd | Journal of Cell Science (2019) 132, jcs189134. doi:10.1242/jcs.189134 REVIEW SUBJECT COLLECTION: CELL BIOLOGY AND DISEASE CORVET, CHEVI and HOPS – multisubunit tethers of the endo-lysosomal system in health and disease Jan van der Beek‡, Caspar Jonker*,‡, Reini van der Welle, Nalan Liv and Judith Klumperman§ ABSTRACT contact between two opposing membranes and pull them close Multisubunit tethering complexes (MTCs) are multitasking hubs that together to allow interactions between SNARE proteins (Murray form a link between membrane fusion, organelle motility and signaling. et al., 2016). SNARE assembly then provides additional fusion CORVET, CHEVI and HOPS are MTCs of the endo-lysosomal system. specificity and drives the actual fusion process (Ohya et al., 2009; They regulate the major membrane flows required for endocytosis, Stroupe et al., 2009). In this Review, we focus on the role of tethering lysosome biogenesis, autophagy and phagocytosis. In addition, proteins in endo-lysosomal fusion events. individual subunits control complex-independent transport of specific Tethering proteins can be divided into two main groups: long cargoes and exert functions beyond tethering, such as attachment to coiled-coil proteins (Gillingham and Munro, 2003) and microtubules and SNARE activation. Mutations in CHEVI subunits multisubunit tethering complexes (MTCs). MTCs form a lead to arthrogryposis, renal dysfunction and cholestasis (ARC) heterogenic group of protein complexes that consist of up to ten ∼ syndrome, while defects in CORVET and, particularly, HOPS are subunits resulting in a general length of 50 nm (Brocker et al., associated with neurodegeneration, pigmentation disorders, liver 2012; Chou et al., 2016; Hsu et al., 1998; Lürick et al., 2018; Ren malfunction and various forms of cancer.
    [Show full text]