UvA-DARE (Digital Academic Repository)
Cell-specific pattern recognition receptor signaling in antibacterial defense van Lieshout, M.H.P.
Publication date 2015 Document Version Final published version
Link to publication
Citation for published version (APA): van Lieshout, M. H. P. (2015). Cell-specific pattern recognition receptor signaling in antibacterial defense.
General rights It is not permitted to download or to forward/distribute the text or part of it without the consent of the author(s) and/or copyright holder(s), other than for strictly personal, individual use, unless the work is under an open content license (like Creative Commons).
Disclaimer/Complaints regulations If you believe that digital publication of certain material infringes any of your rights or (privacy) interests, please let the Library know, stating your reasons. In case of a legitimate complaint, the Library will make the material inaccessible and/or remove it from the website. Please Ask the Library: https://uba.uva.nl/en/contact, or a letter to: Library of the University of Amsterdam, Secretariat, Singel 425, 1012 WP Amsterdam, The Netherlands. You will be contacted as soon as possible.
UvA-DARE is a service provided by the library of the University of Amsterdam (https://dare.uva.nl) Download date:30 Sep 2021 Chapter 7
NLRP3 and ASC differentially affect the lung transcriptome during pneumococcal pneumonia
American Journal of Respiratory Cell and Molecular Biology 2014 Apr;50(4):699-712 DOI: 10.1165/rcmb.2013-0015OC
Miriam H.P. van Lieshout 1,2 Brendon P. Scicluna 1,2 Sandrine Florquin 3 Tom van der Poll 1,2,4
Academic Medical Center, University of Amsterdam, Amsterdam, the Netherlands: 1Center of Infection and Immunity Amsterdam 2Center of Experimental and Molecular Medicine 3Department of Pathology 4Division of Infectious Diseases Chapter 7
Abstract
Streptococcus (S.) pneumoniae is the most frequently isolated causative pathogen of community-acquired pneumonia, a leading cause of mortality worldwide. Inflammasomes are multiprotein complexes that play crucial roles in the regulation of inflammation. NLRP3 (Nod-like receptor family, pyrin domain containing 3) is a sensor that functions in a single inflammasome, whereas ASC (the adaptor apoptosis- associated speck-like protein containing a caspase activation and recruitment domain) is a common adaptor of several inflammasomes. We investigated the role of NLRP3 and ASC during S. pneumoniae pneumonia by comparing bacterial growth and spreading, and host innate immune responses in wild-type mice and mice deficient for either NLRP3 (Nlrp3-/-) or ASC (Asc-/-). Asc-/ - mice had increased bacterial dissemination and lethality compared to Nlrp3-/- mice, although the cytokine response was impaired in both mouse strains. By detailed analysis of the early inflammatory response in the lung by whole genome transcriptional profiling, we identified several mediators that were differentially expressed between Nlrp3-/- and Asc-/ - mice. Of these, interleukin-17, granulocyte-macrophage colony-stimulating factor and integrin alpha M were significantly attenuated in Asc-/- relative to Nlrp3- /- mice as well as a number of genes involved in the adaptive immune response. These differences may explain the increased susceptibility of Asc-/ - mice during S. pneumoniae infection and suggest that either ASC-dependent NLRP3-independent inflammasomes or inflammasome independent ASC functions may be involved.
124 NLRP3 and ASC differentially affect the lung transcriptome during pneumococcal pneumonia Introduction
Streptococcus (S.) pneumoniae is the most frequently isolated causative pathogen in patients with community-acquired pneumonia (1, 2) and a common cause of sepsis, especially in the context of pneumonia (3). Worldwide, the mortality rate associated with pneumococcal pneumonia ranges from 6 to >40% depending on the setting of outpatients or patients in general hospital wards or intensive cares (2). This, together with the increasing incidence of antibiotic resistance in S. pneumoniae (4), emphasizes the importance of expanding our knowledge of host defense mechanisms that influence the outcome of pneumococcal pneumonia. In recent years, the importance of Nod-like receptors (NLRs) for the antimicrobial response has become apparent (5, 6). NLRs are cytosolic receptors that can be part of large multi-protein complexes called inflammasomes. Interleukin-1 beta (IL-1β), one of the most potent proinflammatory cytokines (5, 6), is at a post-transcriptional level tightly regulated by these inflammasomes, together with the proinflammatory cytokine IL-18 (5, 6). Inflammasomes recognize a diverse set of inflammation- inducing stimuli including pathogen-associated molecular patterns (PAMPs) and damage-associated molecular patterns (DAMPs) and consist of a cytosolic sensor that (together with an adaptor protein) recruits pro-caspase-1, resulting in the generation of active caspase-1, the enzyme responsible for activation of pro-IL- 1β to mature IL-1β. The sensor protein can be either a member of the NLR or the pyrin and HIN domain-containging(PYHIN) family and, if the NLR sensor does not have a caspase activation and recruitment domain (CARD), ASC (the adaptor apoptosis-associated speck-like protein containing a CARD) is necessary to recruit and bind caspase-1 (6). NLRP3 (NLR family, pyrin domain containing 3) is one of the best studied members of the NLR family that can be activated by a large variety of signals, including pneumolysin, a major virulence factor of S. pneumoniae (7). Recently, the role of the NLRP3 and ASC inflammasome complexes in S. pneumoniae induced cell activation in vitro and infection in vivo was investigated (7-9). We here expanded these previous studies using a model of pneumococcal pneumonia and observed a remarkable susceptibility of especially Asc deficient (Asc-/-) mice when compared with Nlrp3-/- mice. Considering that the afore mentioned investigations on the role of the inflammasome during pneumococcal pneumonia predominantly focused on mechanistic studies in purified macrophages (7-9), we here aimed to characterize the initiation of the host response to pulmonary infection in mice deficient for inflammasome components in vivo in more detail by performing a genome-wide scan of transcriptional responses in lung tissue at an early time point after lower respiratory tract infection with S. pneumoniae. We identified a strong influence of the inflammasome components ASC and NLRP3 on the transcriptional response during pneumococcal pneumonia and in addition a differential gene expression pattern between Asc-/- and Nlrp3-/- mice.
125 Chapter 7
Methods
Mice Nlrp3-/- and Asc-/- mice (10) were backcrossed 9 times to a C57Bl/6 background. Age- and sex-matched wild type (WT) C57Bl/6 mice were from Harlan (Horst, the Netherlands). Mice were infected at 9-12 weeks. All experiments were approved by the Institutional Animal Care and Use Committee of the Academic Medical Center, University of Amsterdam, Amsterdam, the Netherlands.
Induction of pneumonia and tissue harvest Pneumonia was induced by intranasal inoculation with 1-2x107 CFU of S. pneumoniae D39 (serotype 2) (11). For two experiments isogenic pneumolysin- deficient D39 was used (11). Mice were followed for 14 days or euthanized at 6 or 48 hours, and bacterial outgrowth and cytokine levels were determined (11).
Cytokine assays Tumor necrosis factor-α (TNF-α), Interleukin (IL)-6, IL-10 and chemokine (C-C motif) ligand 2 (CCL2) were measured by a cytometric bead assay (BD Biosciences, San Jose, CA). IL-1β, Chemokine (C-X-C motif) ligand 1 and 2 (CXCL1 and 2), granulocyte-macrophage colony-stimulating factor (GM-CSF), granulocyte colony-stimulating factor (G-CSF) and IL-17A (cross-reactivity with IL-17A/F) were measured by ELISA (R&D Systems, Minneapolis, MN). Myeloperoxidase (MPO) ELISA was from HyCult Biotechnology, Uden, the Netherlands.
Histology Lungs were fixed in formalin and embedded in paraffin. 5 μm sections were stained with hemotoxylin and eosin. The following parameters were scored on a scale of 0 (absent) to 4 (very severe) by a pathologist blinded for experimental groups: interstitial damage, vasculitis, peri-bronchitis, oedema, thrombus formation and pleuritis. Granulocyte staining was performed (12).
RNA preparation and genome-wide transcriptional profiling RNA was isolated from lung homogenates using the Nucleospin RNA II kit (Machery- Nagel, Duren, Germany). 750ng of biotinylated cRNA was hybridized onto the Illumina MouseRef-8v2 Expression BeadChip (Eindhoven, the Netherlands). The samples were scanned using the Illumina iScan array scanner(Eindhoven, the Netherlands. Preparation of cRNA, chip hybridization, washing, staining and scanning were carried out at ServiceXS (Leiden, the Netherlands). The raw scan data were read using the beadarray package (version 1.12.1) (13), available through Bioconductor (14) in the R statistical environment (version 2.13.2; R Foundation for Statistical Computing, Vienna, Austria). All non-normalized and normalized data are available at the gene expression omnibus of NCBI (GEO) with accession number GSE42464. Details on bioinformatics are available in the online supplement.
126 NLRP3 and ASC differentially affect the lung transcriptome during pneumococcal pneumonia Quantitative real time PCR Total RNA was reverse transcribed using oligo (dT) primer and Moloney murine leukemia virus reverse transcriptase (Invitrogen, Breda, the Netherlands). Quantitative PCR of 4933427D14Rik, Nlrp3, Asc, Gdpd3, Csf2, Csf3, Trim 16, Zfp39, Unc 45b and Mid-1genes was performed. Data was analyzed using the LinRegPCR program (15). Results were normalized to Gapdh transcript. Primer pairs were designed to avoid overlap with array probes (Table S5).
Statistical analysis and bioinformatics Data are expressed as means ± standard error of mean or as box-and-whisker diagrams. Comparison between two groups was by Mann Whitney U test. For experiments with > 2 groups, the Kruskall-Wallis test was used as a pretest, followed by Mann Whitney U tests where appropriate. Proportions of positive cultures were compared by Fisher’s exact test. Kaplan-Meier survival plots were compared using log-rank test. For these analyses, GraphPad Prism (San Diego, CA) was used. p< 0.05 was considered statistically significant. Differential probe intensities on microarrays were identified using the R package limma (version 3.8.3) (16). Enrichment of functional annotations was performed by the DAVID Database (17). We report Benjamini and Hochberg (BH) multiple- comparison corrected p-values.
Results
Both NLRP3 and ASC contribute to the antibacterial response, but only ASC is crucial for survival during pneumococcal pneumonia
We first infected WT, Nlrp3-/-, and Asc-/- mice with S. pneumoniae via the airways and euthanized the mice at 6 or 48 hours for quantitative cultures of lungs, blood and spleen. For the predefined 6-hour time point, Nlrp3-/-, Asc-/- and WT mice were infected concurrently; the 48-hour time point was investigated in two separate experiments for Nlrp3-/- and Asc-/- mice (each with a matched WT group) because of difficulties in synchronizing their breeding. At 6 hours, the bacterial loads in the lungs of both Nlrp3-/- and Asc-/- mice were similar to those in WT mice (Figure 1A). However, whereas after 48 hours WT mice showed a reduction of bacterial loads, pulmonary bacterial counts in both Nlrp3-/- and Asc-/- mice remained significantly higher (both p< 0.05 versus WT mice). Both Nlrp3-/- and Asc-/- mice showed an earlier dissemination of pneumococci from the primary site of infection, as reflected by a significantly higher proportion of positive blood cultures 6 hours post infection when compared with WT mice: 50% of Nlrp3-/- and Asc-/- mice had a positive blood culture while blood cultures of all WT mice remained sterile (Figure 1B, both p <0.05 versus WT mice). Enhanced infection of distant organs was also indicated by higher bacterial loads in blood and spleens of Asc-/- mice 48 hours after infection (all p < 0.05 versus WT mice); notably, Nlrp3-/- mice did not show higher bacterial burdens in blood and spleen at this late time point. Previous studies have documented an important role for the S. pneumoniae virulence factor pneumolysin in activation of
127 Chapter 7
Figure 1: NLRP3 and ASC contribute to bacterial clearance of S. pneumoniae, but only ASC is important for survival. WT, Nlrp3 -/- and Asc-/- mice were inoculated with 1-2x107 CFU S. pneumoniae and sacrificed at designated time-points or monitored for survival. Bacterial loads in lung (A), blood (B) and spleen (C) 6 and 48 hours after infection in WT (white), Nlrp3-/- (dark grey) and Asc-/- mice (light grey) (n=6-9 per group). Data are expressed as box-and-whisker diagrams depicting the smallest observation, lower quartile, median, upper quartile, and largest observation. Survival of WT (white symbols), Nlrp3- /- (light grey symbols) and Asc-/- mice (dark grey symbols) (n=19-28 per group) expressed as Kaplan- Meier plot (D). * p < 0.05 compared to WT mice determined with Mann-Whitney U test. # p < 0.05 compared to WT mice determined with Fishers exact test, *** p < 0.001 for the comparison between Asc- /- and WT mice, and between Asc-/- and Nlrp3-/- mice as determined by Log-Rank test. ND = not done. the NLRP3 inflammasome in macrophages in vitro (7-9). In accordance, 48 hours after infection with an isogenic pneumolysin deficient S. pneumoniae D39 strain bacterial loads were similar in lungs and distant organs of Nlrp3-/- and Asc-/- mice when compared with WT mice (Figure S1). Thus, further experiments were done with WT S. pneumoniae exclusively. Next, we infected Nlrp3-/-, Asc-/- and WT mice with S. pneumoniae and followed them for 14 days in a survival experiment (Figure 1D). After 68 hours, mice in all groups started dying; however, in Asc-/- mice mortality was significantly higher and accelerated compared to WT mice: 50% of Asc-/- mice died within 4 days and <10% remained alive until the end of the experiment, while > 60% of WT mice survived (p < 0.001 for the difference between Asc-/- and WT mice). The mortality curve of Nlrp3-/- mice was similar to that of WT mice and their survival was significantly better than that of Asc-/- mice (p< 0.001 Nlrp3-/- compared to Asc-/- mice).
128 NLRP3 and ASC differentially affect the lung transcriptome during pneumococcal pneumonia Impact of NLRP3 and ASC deficiency on the early inflammatory response in the lungs after infection with S. pneumoniae
The early immune response to S. pneumoniae in the lower airways is of utmost importance for an adequate defense against uncontrolled bacterial multiplication (2, 18). The studies described here documented that Nlrp3-/- and Asc-/- mice displayed enhanced bacterial growth relative to WT mice during late stage pneumococcal pneumonia, which in Asc-/- mice was accompanied by enhanced bacterial dissemination and an increased lethality. Early after infection, at a time point (6 hours) when normal WT mice show a brisk inflammatory response in their lungs in this model (11), bacterial loads were still similar in lungs of Nlrp3-/-, Asc-/- and WT mice, allowing a detailed analysis of the impact of NLRP3 and ASC deficiency on the induction of innate immunity at the primary site of infection without bias caused by differences in bacterial loads (which have been shown to be a major denominator of the extent of lung inflammation during murine pneumococcal pneumonia) (19). Therefore, we measured several components of the inflammatory response in lung tissue harvested from Nlrp3-/-, Asc-/- and WT mice 6 hours post infection. Overall, Nlrp3-/- and Asc-/- mice showed reduced cytokine and chemokine levels in whole lung homogenates when compared with WT mice at this early time point (Table 1). Lung levels of IL-6, CXCL1, CXCL2 and CCL2 were significantly lower in both knockout strains; in addition, Nlrp3-/- mice showed significantly diminished IL-1β levels (p < 0.05 compared to WT mice) and Asc-/- mice had significantly lower TNF-α and IL-17 levels (p < 0.05 and 0.001 compared to WT mice respectively). Cytokine and chemokine levels were not significantly different betweenNlrp3 -/- and Asc-/- mice except for IL-17 that was significantly lower in lungs of Asc-/- mice (p < 0.05). In plasma, IL-6 and CCL2 levels were lower in Nlrp3-/- and Asc-/- mice at this early time point (Table S1). To obtain further insight into the role of NLRP3 and ASC in induction of lung inflammation during S. pneumoniae pneumonia, we prepared hemotoxylin and eosin stained slides and scored key histological features according to the scoring system described in the Methods section. All three mouse strains showed extensive signs of pneumonia, characterized by interstitial inflammation, pleuritis, vasculitis, bronchitis and edema 6 hours after infection (Figure 2A-C). However, neither total inflammation scores nor individual components of the inflammation scores were different between genotypes (Figure 2D). Similarly, the extent of neutrophil influx, as measured by the number of Lymphocyte antigen- 6G (Ly-6G) and Lymphocyte antigen-6C (Ly-6C) positive cells in lung tissue slides (Figure 2E-G) and the concentrations of MPO in whole lung homogenates (Figure 2H), did not differ between Nlrp3-/-, Asc-/- and WT mice.
129 Chapter 7
Table 1: Nlrp3-/- and Asc-/- mice have an impaired inflammatory response early after induction of pneumonia by S. pneumoniae.
Lung WT Nlrp3-/- Asc-/-
IL-1β 617 (35) 436 (42)** 558 (73)
TNF-α 2763 (322) 2115 (733) 1770 (479)*
IL-6 5259 (474) 1919 (471)** 1379 (252)***
IL-10 12 (1) 14 (2) 14 (2)
IL-17 73 (5) 85 (10) 53 (4)**^
CXCL1 50590 (4810) 13553 (2728)*** 19101 (3878)**
CXCL2 48971 (6592) 19857 (2493)** 23153 (4686)*
CCL2 5026 (280) 2309 (355)** 2363 (260)***
WT, Nlrp3-/- and Asc-/- mice were inoculated with 1-2x107 CFU S. pneumoniae and sacrificed 6 hours later. Homogenates were prepared from right lungs. Cytokine and chemokine levels are presented in pg/ml lung homogenate. Data are mean (SE) of 6-9 mice per group.* p < 0.05, ** p < 0.01, *** p < 0.001 vs WT mice. ^ p < 0.01 Asc-/- versus Nlrp3-/- mice.
Impact of NLRP3 and ASC deficiency on the late inflammatory response during pneumococcal pneumonia
We determined the extent of local and systemic inflammation at 48 hours post infection, i.e., shortly before the first deaths occurred. At this late time point, lung pathology scores were slightly lower relative to those documented at 6 hours (Figure 3), most likely reflective of the lower bacterial loads. Whereas, pathology scores were similar in Nlrp3-/- and WT mice, Asc-/- mice showed significantly lower scores. The initially impaired pulmonary cytokine/chemokine response of Nlrp3- /- and Asc-/- mice had disappeared. In fact, at this late time point the lung levels of cytokines and chemokines were higher in inflammasome deficient mice (likely as a consequence of their higher bacterial burdens), although only reaching statistical significance for IL-6 in Nlrp3-/- mice and CXCL2 for Asc-/- mice (Table 2). Similarly, plasma levels of cytokines and chemokines were higher in inflammasome deficient mice, reaching significance for TNFα and IL-6 inNlrp3 -/- mice (Table S2). Finally, we measured markers of cellular injury in plasma (urea, aspartate aminotransferase, alanine aminotransferase and lactate dehydrogenase) as a readout for distant organ damage (Table 3). Although the plasma concentrations of these markers tended to be higher in Nlrp3-/- and Asc-/- mice, differences between groups were not statistically significant.
130 NLRP3 and ASC differentially affect the lung transcriptome during pneumococcal pneumonia
Figure 2: Inflammatory response early after infection withS. pneumoniae. For legend, see page 132.
131 Chapter 7
Legend Figure 2 (page 131): Inflammatory response early after infection withS. pneumoniae. WT, Nlrp3 -/- and Asc-/- mice were inoculated with 1-2x107 CFU S. pneumoniae (n=6-9 per group); 6 hours after infection histological scores, determined as described in the Methods section, were similar in WT, Nlrp3-/- and Asc-/- mice (D). Panels A-C show representative lung histology of WT (A), Nlrp3-/- (B) and Asc-/- mice (C) H&E staining, original magnification 20x. Neutrophil influx did not differ between mouse groups as reflected by similar Ly6-G and Ly6-C lung surface positivity (H) and whole lung MPO levels (I). Panels E-G show representative images of Ly-6G and Ly-6C staining on lung slides from WT (E), Nlrp3-/- (F) and Asc-/- mice (G); Data are expressed as box-and-whisker diagrams depicting the smallest observation, lower quartile, median, upper quartile, and largest observation. Table 2: Lung levels of chemokines and cytokines 48 hours after induction of pneumonia by S. pneumoniae.
Lung WT Nlrp3-/- WT Asc-/-
IL-1β bd bd bd bd
TNF-α 228 (49) 411 (81) 715 (105) 1538 (467)
IL-6 228 (72) 810 (205)* 1086 (361) 1590 (477)
IL-10 10 (1) 12 (2) 18 (3) 262 (125)
CXCL1 4720 (503) 6381 (499) 5145 (936) 5969 (807)
CXCL2 2067 (141) 4820 (1360) 5297 (1397) 20032 (7193)*
CCL2 5910 (949) 9338 (834)* 7217 (942) 8278 (924)
WT, Nlrp3-/- and Asc-/- mice were inoculated with 1-2x107 CFU S. pneumoniae and sacrificed 48 hours later. Homogenates were prepared from right lungs. Cytokine and chemokine levels are presented in pg/ml lung homogenate. Data are mean (SE) of 6-9 mice per group. Below detection (bd), * p < 0.05 vs WT mice. Table 3: Parameters of organ and cellular injury 48 hours after induction of pneumonia by S. pneumoniae.
Plasma WT Nlrp3-/- WT Asc-/-
Urea (mmol/L) 9 (1) 24 (8) 9 (1) 9 (1)
ASAT (U/L) 112 (14) 242 (97) 119 (15) 470 (210)
ALAT (U/L) 14 (1) 11 (4) 13 (4) 12 (6)
LDH (U/L) 505 (128) 546 (185) 425 (73) 710 (187)
WT, Nlrp3-/- and Asc-/- mice (n=6-9 per group) were inoculated with 1-2x107 CFU S. pneumoniae and sacrificed 48 hours later. Plasma levels are presented as mean (SE).
132 NLRP3 and ASC differentially affect the lung transcriptome during pneumococcal pneumonia
Figure 3: Inflammatory response during late-stage infection with S. pneumoniae. WT, Nlrp3 -/- and Asc-/- mice were inoculated with 1-2x107 CFU S. pneumoniae (n=6-9 per group); 48 hours after infection histological scores, determined as described in the Methods section, were similar in Nlrp3-/- and WT mice but Asc-/- mice showed significantly lower scores (E). Panels A-D show representative lung histology of WT (A), Nlrp3-/- (B), WT (C) and Asc-/- mice (D) H&E staining, original magnification 20x. Data are expressed as box-and-whisker diagrams depicting the smallest observation, lower quartile, median, upper quartile, and largest observation.
133 Chapter 7
Genome-wide pulmonary transcriptional response in WT, Asc-/- and Nlrp3-/- mice in pneumococcal pneumonia
To further investigate the molecular basis of the observed differences in susceptibility between Asc-/- and Nlrp3-/- mice in pneumococcal pneumonia, we performed whole genome transcriptional profiling of lung tissues obtained 6 hours post infection, e.g. at a time that bacterial loads were still similar, from 3-4 female WT, Asc-/- and Nlrp3-/- mice and from matched uninfected controls using pan-genomic expression arrays. After pre-processing and quality control, 23742 transcripts were available for differential abundance analysis. First, we analyzed for gene expression differences between non-infected WT, Asc-/- and Nlrp3-/- mice. Pair-wise analysis (moderated t test) of WT and Nlrp3-/- mice revealed four differentially abundant transcripts (p < 0.05), namely, 4933427D14Rik (probe ID: ILMN_1245850), Zfp39 (probe ID: ILMN_1241611), Trim16 (probe ID: ILMN_2482494) and Pttg1 (probe ID: ILMN_2809167). These transcripts physically map to within ~20Mb of the Nlrp3 locus on chromosome 11 (Figure S2). No differences were detected for the (uninfected) WT and Asc-/- comparison. The genome-wide response to early S.pneumoniae infection was then assessed in WT mice. Pair-wise analysis of the gene expression profiles between uninfected and infected WT mice yielded 5346 differentially abundant transcripts (BH p <
0.05). Figure 4A illustrates the volcano plot (integrating nominal p-values and log2 fold change) of the transcriptional response to S. pneumoniae infection in WT mice. Considering a fold change ≥ 2 we detected 360 transcripts, while 20 transcripts were detected with a fold change ≤ 2. Notably, Nlrp3 transcript abundance was -7 significantly increased post-infection (p = 4.5x10 , log2 fold change = 2.1), whereas Asc transcript abundance was not different. Functional annotation enrichment of the gene transcripts that increased in abundance after S. pneumoniae infection is shown in Figure 4B. These annotation clusters include defense response (p = 4.4x10-34), regulation of cytokine production (p = 2.2x10-12), chemotaxis (p= 5.6x10- 12), cell death (p = 4.8x10-8), protein kinase cascade (p = 9.3x10-9) and regulation of adaptive immune response (p = 3.7x10-10) terms. Figure 4C shows the functional annotation enrichment results of those gene transcripts that decreased in abundance after S. pneumoniae infection. These clusters include the mitochondrial part (p = 8.2x10-10), mitochondrial envelope (p= 3.0x10-12), respiratory system development (p = 0.0098) and ion binding (p = 0.035) annotations. Next, we analyzed the pulmonary transcriptional response to early S. pneumoniae infection in Asc-/- and Nlrp3-/- mice. Using the f test approach (ANOVA) and considering a BH corrected p-value < 0.05 we detected 56 gene transcripts that differed in abundance between WT, Asc-/- and Nlrp3-/- mice (Table 4, see pages 138-141). By using an unsupervised hierarchical clustering approach we show that these transcripts clearly discriminate WT, Nlrp3-/- and Asc-/- mouse samples (Figure 5, see page 137). These genes significantly enrich (BHp < 0.05) functional annotation clusters that included regulation of cytokine secretion, extracellular space, and defense response. Prominent genes within these pathways include Csf2, Csf3, Il17f and Foxp3. By univariate analysis we delineated 20 transcripts (BH p < 0.05) that discriminate Nlrp3-/- and Asc-/- mouse genome-wide responses
134 NLRP3 and ASC differentially affect the lung transcriptome during pneumococcal pneumonia
Figure 4: Genome-wide pulmonary transcriptional response in WT mice in pneumococcal pneumonia. WT mice were inoculated with 1-2x107 CFU S. pneumoniae and genome-wide lung transcriptional responses were assessed 6 hours after infection (n=4) and compared with the lung transcriptome obtained in uninfected WT mice (n= 3). Volcano plot analysis (integrating nominal p-values and fold changes) of the transcriptional response after infection in WT mice, 5346 transcripts were differentially expressed (BH p-value<0.05; red line) (A). Pie chart representations (pie slices denote enrichment, E, scores for the particular significant cluster) of the transcripts in pneumoniap , Benjamini- Hochberg multiple comparison corrected p-values (B,C see page 136).
135 Chapter 7
Figure 4 (continued): Genome-wide pulmonary transcriptional response in WT mice in pneumococcal pneumonia.
136 NLRP3 and ASC differentially affect the lung transcriptome during pneumococcal pneumonia
Figure 5: Unsupervised hierarchical clustering heat map of top 56 differentially expressed genes among WT, Nlrp3-/- and Asc-/- mice. WT, Nlrp3 -/- and Asc-/- mice were inoculated with 1-2x107 CFU S. pneumoniae and genome-wide lung transcriptional responses were assessed 6 hours after infection and compared with the lung transcriptome obtained in uninfected mice (n=3-4 mice per strain for each condition). F statistics (ANOVA) of the expression profiles in the lungs of WT, Nlrp3-/- and Asc-/- mice yielded 56 differentially expressed genes (Benjamini-Hochberg p-value < 0.05) represented by an unsupervised hierarchical clustering heatmap plot. Rows correspond to genes while columns correspond to mouse samples. Red denotes high expression, blue denotes low expression. MGI official symbols are illustrated.
137 Chapter 7 0.000341 0.000315 0.000161 0.000142 0.000133 3.20E-05 3.00E-05 2.90E-05 2.61E-05 2.16E-05 6.38E-06 5.04E-06 4.64E-06 1.07E-07 BH p 2.21E-07 1.91E-07 9.01E-08 7.34E-08 6.33E-08 1.24E-08 1.03E-08 8.75E-09 6.76E-09 4.65E-09 1.10E-09 6.52E-10 4.00E-10 4.64E-12 p 28.76223 29.227 31.68581 32.38318 32.898 38.90442 39.62573 40.29537 41.34397 42.89634 49.31849 51.82589 54.25563 81.10563 F
-/- -/- FC 2 v Asc -1.51252 1.565271 1.419325 1.504794 -1.44621 1.809683 -0.92119 0.945934 -1.31683 -4.76544 -0.26768 -1.50699 -0.0022 -2.80188 log Nlrp3 v -/- FC 2 log 0.275962 -2.67972 -1.82175 0.088175 0.313151 -1.56012 -0.59139 -2.37021 -0.84308 4.624858 -1.76356 -0.67436 1.789564 0.165437 Asc WT mice after induction of pneumococcal pneumonia. -/- -/- FC 2 and Asc log v WT Nlrp3 -1.23656 -1.11445 -0.40243 1.59297 -1.13306 0.249558 -1.51257 -1.42428 -2.15991 -0.14058 -2.03124 -2.18135 1.787369 -2.63645 -/- Gene Symbol Unc45b Ngp Itgam 2210407C18Rik Zfp39 Asc Trim16 Prok2 Csf2 Gdpd3 Csf3 Nlrp3 Plac9 4933427D14Rik EntrezID 217012 18054 16409 78354 22698 66824 94092 50501 12981 68616 12985 216799 211623 74477 ProbeID ILMN_3153940 ILMN_1228832 ILMN_2696017 ILMN_1226767 ILMN_1241611 ILMN_29364764 ILMN_2482494 ILMN_3147259 ILMN_2749412 ILMN_2893879 ILMN_1217948 ILMN_1237471 ILMN_2710159 ILMN_1245850 Table 4: Differential transcriptional response in WT, Nlrp3 4: Differential transcriptional response in WT, Table
138 NLRP3 and ASC differentially affect the lung transcriptome during pneumococcal pneumonia 0.018898 0.017125 0.014566 0.010443 0.010443 0.009816 0.007612 0.007585 0.005577 0.005178 0.003951 0.003696 0.000611 0.000584 0.000439 BH p 2.76E-05 2.36E-05 1.95E-05 1.35E-05 1.35E-05 1.19E-05 8.87E-06 8.51E-06 6.02E-06 5.36E-06 3.75E-06 3.35E-06 4.75E-07 4.29E-07 3.03E-07 p 15.97045 16.31111 16.74478 17.58096 17.58899 17.88613 18.57409 18.67304 19.51646 19.80135 20.70172 20.99229 26.41031 26.71657 27.77398 F
-/- -/- FC 2 v Asc 0.604422 -1.07081 0.356068 0.032814 -1.3534 0.218423 0.926226 0.971456 0.880503 -1.18745 1.2356 1.484635 -0.61735 1.706197 -0.33081 log Nlrp3 v -/- FC 2 log 0.181671 -0.41878 -0.87112 1.06378 0.191912 0.665586 -1.82136 0.365524 -1.30856 -0.21191 0.218711 -0.76781 0.830906 -0.11472 1.763997 Asc WT -/- FC 2 log v WT Nlrp3 0.786093 -1.48959 -0.51505 1.096595 -1.16149 0.88401 -0.89513 1.33698 -0.42806 -1.39936 1.454311 0.716829 0.213559 1.591472 1.433187 Gene Symbol B9d1 Kdm6b Map3k8 Sh2d1b1 6330403K07Rik Cd27 Itgb2l Slamf9 Lif Pttg1 Itgae Il17f Inpp5f Thg1l D14Ertd449e EntrezID 27078 216850 26410 26904 103712 21940 16415 98365 16878 30939 16407 257630 101490 66628 66039 ProbeID ILMN_2713969 ILMN_3095624 ILMN_1245924 ILMN_2978617 ILMN_2594139 ILMN_1233589 ILMN_1258735 ILMN_2663249 ILMN_3137291 ILMN_2809167 ILMN_2699898 ILMN_2741201 ILMN_2785512 ILMN_2979430 ILMN_2693858
139 Chapter 7 0.034838 0.034613 0.033991 0.030217 0.030217 0.029714 0.02863 0.027686 0.027686 0.022122 0.021415 0.021071 0.020736 0.018898 0.018898 BH p 7.22E-05 7.02E-05 6.75E-05 5.87E-05 5.74E-05 5.51E-05 5.19E-05 4.90E-05 4.85E-05 3.72E-05 3.51E-05 3.36E-05 3.22E-05 2.85E-05 2.84E-05 p 13.93113 13.98752 14.06886 14.3575 14.40149 14.48708 14.61403 14.73513 14.756 15.31883 15.44467 15.5374 15.63157 15.89562 15.9093 F
-/- -/- FC 2 v Asc 1.456626 0.892131 1.381158 0.035168 0.594038 -0.70304 1.456414 -0.87937 -1.15674 0.712003 -0.73548 -1.37361 0.632426 -0.73973 1.275045 log Nlrp3 v -/- FC 2 log -1.18156 0.148384 -2.26747 -0.69725 0.272439 -0.05641 0.050678 0.750609 0.184316 -0.56994 0.612782 0.377567 -0.83329 0.879188 -0.42954 Asc WT -/- FC 2 log v WT Nlrp3 0.275066 1.040516 -0.88631 -0.66209 0.866477 -0.75945 1.507093 -0.12876 -0.97242 0.142067 -0.1227 -0.99604 -0.20086 0.139456 0.845506 Gene Symbol Ifng Rhox2d Camp Akap12 Incenp Gpx3 Sept3 Ppp1r14a Trim11 Fkbp9 Nkx2-1 Grap Tpbg Apip Foxp3 EntrezID 15978 434760 12796 83397 16319 14778 24050 68458 94091 27055 21869 71520 21983 56369 20371 ProbeID ILMN_2685712 ILMN_2917647 ILMN_2766604 ILMN_2624622 ILMN_1216213 ILMN_2715546 ILMN_1218471 ILMN_2659824 ILMN_2435814 ILMN_1249550 ILMN_1260212 ILMN_2617656 ILMN_1250696 ILMN_1234781 ILMN_2635132
140 NLRP3 and ASC differentially affect the lung transcriptome during pneumococcal pneumonia 0.049101 0.044614 0.043219 0.041967 0.041967 0.041467 0.041467 0.041467 0.041433 0.039324 0.039324 0.035953 BH p 2 transformed fold- transformed 2 Log FC, 2 log 0.000127 0.000114 0.000108 0.000103 0.000103 9.84E-05 9.72E-05 9.54E-05 9.30E-05 8.65E-05 8.57E-05 7.60E-05 p mice was evaluated by means of the f-test. -/- -value < 0.05. < p -value 12.79716 13.01888 13.11564 13.20866 13.21971 13.3038 13.32926 13.36526 13.41779 13.56195 13.58135 13.82476 F Nlrp3 and
-/- -/- -/- -value. Mouse Genome Informatics (MGI) official symbols official (MGI) Informatics Genome Mouse p -value. FC Asc 2 v Asc 0.258091 0.290217 0.504536 -0.8008 0.928968 0.921224 -2.30382 0.633271 0.508633 0.878169 1.051076 0.395484 log Nlrp3 v -/- FC infection in WT, infection in WT, 2 and genome-wide lung transcriptional responses were assessed 6 hours after log -0.51749 -1.08702 0.412132 0.563574 0.125884 -0.66049 0.405619 -1.2147 -1.02555 -0.79903 -0.94065 -1.16156 Asc WT -/- FC 2 S. pneumoniae S. pneumoniae log v WT Nlrp3 -0.2594 -0.79681 0.916668 -0.23723 1.054852 0.260737 -1.8982 -0.58143 -0.51691 0.07914 0.11043 -0.76608 CFU 7 , Benjamini-Hochberg multiple comparison corrected comparison multiple Benjamini-Hochberg p , Gene Symbol Stard7 Ptx3 Fgd2 Sh3rf2 Irgq Fem1c Mid1 Ralgds Slc27a4 Pde4d Fam149b Olfm4 -value. BH p -value. EntrezID 1199138 19288 26382 269016 210146 240263 17318 19730 26569 238871 105428 380924 , nominal p , mice were inoculated with 1-2x10
-/- Asc and -/- Nlrp3 ProbeID ILMN_2676066 ILMN_2662802 ILMN_2737903 ILMN_2942551 ILMN_2715466 ILMN_2724409 ILMN_3159435 ILMN_2689119 ILMN_2709355 ILMN_1236700 ILMN_2641270 ILMN_3161834 infection. Differential pulmonary infection. transcriptional Differential response to early Shown are the 56 genes that were different among the three genotypes with a Benjamini-Hochberg corrected a with genotypes three the among different were that genes 56 the are Shown WT, WT, change. F, F statistic. F F, change. are illustrated.
141 Chapter 7 to S.pneumoniae pulmonary infection (Table 5). As expected, Asc and Nlrp3 were amongst the discriminative transcripts. Quantitative real time PCR (qRT-PCR) analysis of Gdpd3, Unc45b, Mid1, (Figure S3) and Csf2 (Figure 6A) lend further weight to our genomics data, suggesting that components of the inflammasome macromolecular complex influence, at least in part, distinct transcriptional responses in pneumococcal pneumonia. Tables S4 and S5 show the univariate analyses for the comparison between WT and Nlrp3-/- mice, and WT and Asc-/- mice. In silico mapping of these differentially expressed genes (Tables S4 and S5) for cell-specific gene co-expression characteristics derived from the Toppgene suite (http://toppgene.cchmc.org) unmasked a significant association of the Nlrp3- /- mouse transcriptome with lung dendritic cells (online supplement, Table S6). No significant association was uncovered for the Asc-/- mice. The emerging role of Csf2 and Csf3, respectively encoding for the growth factors GM-CSF and G-CSF, in regulating lung-protective immunity against S. pneumoniae (20, 21), coupled with our differential gene expression analysis led us to further evaluate their protein abundance. G-CSF protein levels (Figure 6D) reflected both the array and qRT-PCR results for Csf3 transcript abundance (Table 4 and Figure 6C); G-CSF presented statistically significant lower abundance in lungs of Asc-/- when compared to WT mice (Figure 6D). No differences in G-CSF protein abundance were observed between Nlrp3-/- and Asc-/- mouse lung samples. Interestingly, GM- CSF was significantly lower inAsc -/- mice, but not in Nlrp3-/- mice (Figure 6B), which did not reflect the results obtained from either microarray analysis or qRT-PCR for Csf2 transcript abundance (Table 4 and Figure 6A): mRNA expression was only slightly decreased in Asc-/- compared to WT mice, but strongly decreased in Nlrp3- /- mice (Figure 6A).
142 NLRP3 and ASC differentially affect the lung transcriptome during pneumococcal pneumonia B 3.055198 3.42206 3.54952 3.662289 3.718067 5.235958 6.049902 6.176843 6.447499 6.976465 7.232193 7.274957 8.358301 14.17256 BH p 0.01862 0.012878 0.011908 0.01127 0.01127 0.002239 0.000926 0.000904 0.000753 0.000466 0.000422 0.000422 0.0002 1.17E-07 p 1.21E-05 7.78E-06 6.68E-06 5.84E-06 5.46E-06 8.70E-07 3.20E-07 2.73E-07 1.95E-07 1.01E-07 7.29E-08 6.90E-08 1.73E-08 5.06E-12 t -5.3602 -5.52507 5.58263 5.633688 -5.65899 6.361767 6.752563 -6.81456 6.947761 -7.21234 -7.34241 7.364298 -7.93374 -11.7189 v mice after induction of pneumococcal pneumonia. -/- -/- -/- FC 2 Asc Asc log Nlrp3 and -1.31683 -1.37361 1.375726 1.275045 -1.3534 1.484635 1.706197 -1.50699 1.504794 -4.76544 -1.51252 1.809683 -1.44621 -2.80188 -/- Nlrp3 Symbol Csf2 Grap Itgae Foxp3 6330403K07Rik Il17f Thg1l Nlrp3 2210407C18Rik Gdpd3 Unc45b Pycard Zfp39 4933427D14Rik Entrez ID 12981 71520 16407 20371 103712 257630 66628 216799 78354 68616 217012 66824 22698 74477 Probe ID ILMN_2749412 ILMN_2617656 ILMN_1217629 ILMN_2635132 ILMN_2594139 ILMN_2741201 ILMN_2979430 ILMN_1237471 ILMN_1226767 ILMN_2893879 ILMN_3153940 ILMN_2936476 ILMN_1241611 ILMN_1245850 Table 5: Differential transcriptional response between Table
143 Chapter 7 p , p < B -value. BH p -value. 2.057287 2.218402 2.30239 2.342876 2.735426 2.790114 BH p , nominal t statistic. p , 0.041447 0.035893 0.034125 0.034125 0.02403 0.023927 t , p 3.93E-05 3.25E-05 2.95E-05 2.81E-05 1.76E-05 1.65E-05 t 2 transformed fold-change. transformed 2 Log 4.916517 -4.98778 5.024978 -5.04292 -5.21736 -5.24174 FC, 2 mouse samples yielded 20 gene expression profiles (Benjamini-Hochberg v -/- -/- -/- FC 2 Asc Asc log Nlrp3 and -/- 1.299602 -2.30382 1.419325 -1.18745 -1.15674 -0.92119 Nlrp3 CFU S. pneumoniae and genome-wide lung transcriptional responses were assessed 6 hours after 7 -value. B, Beta probability (distribution). Mouse Genome Informatics (MGI) official symbols are illustrated. are symbols official (MGI) Informatics Genome Mouse (distribution). probability Beta B, p -value. Symbol statistics) of the A430084P05Rik Mid1 Itgam Pttg1 Trim11 Trim16 t transcriptional responses in pneumonia. log -/- Asc and -/- Entrez ID Nlrp3 327957 17318 16409 30939 94091 94092 mice were inoculated with 1-2x10 -/- and Asc -/- Probe ID ILMN_2847437 ILMN_3159435 ILMN_2696017 ILMN_2809167 ILMN_2435814 ILMN_2482494 Benjamini-Hochberg multiple comparison corrected comparison multiple Benjamini-Hochberg infection. Univariate analysis (moderated WT, Nlrp3 WT, 0.05) that discriminate that 0.05)
144 NLRP3 and ASC differentially affect the lung transcriptome during pneumococcal pneumonia
Figure 6: Validation of Csf2, Csf3 gene expression and lung protein levels of their respective products GM-CSF and G-CSF. WT, Nlrp3-/- and Asc -/- mice (n=6-8 per group) were inoculated with 1-2x107 CFU S. pneumoniae and sacrificed 6 hours later.qRT-PCR results for normalized lung expression of Csf2 (A) and Csf3 (C) genes (n=3-4 per group). GM-CSF (B) and G-CSF (D) were determined in lung homogenates using ELISA (n=6-9 per group). Data are expressed as mean ± standard error of the mean; * p < 0.05, *** p < 0.001 vs WT mice determined with Mann-Whitney U test.
Discussion
Inflammasomes are multiprotein complexes activated upon cellular infection or stress that play essential roles in the regulation of inflammation (5, 6). Many different inflammasomes have been discovered in recent years, each containing either a member of the NLR or PYHIN family. Whereas the function of NLRP3 is restricted to one NLR inflammasome, ASC is a common adaptor of several NLR inflammasomes. We here compared the roles of NLRP3 and ASC in innate immunity during respiratory tract infection caused by S.pneumoniae, the responsible pathogen in the majority of cases of community-acquired pneumonia (1, 2). Both NLRP3 and ASC were shown to contribute to antibacterial defense, as reflected by higher bacterial burdens at the primary site of infection in Nlrp3-/- and Asc-/- mice, the role of ASC clearly was more prominent, indicated by enhanced bacterial dissemination to distant body sites and increased lethality in mice lacking ASC but not in mice deficient for NLRP3. Focusing on the early immune response, we identified 20 transcripts in the lungs of infected animals that discriminated between Nlrp3-/- and Asc-/- mice. Of these, secreted growth factors and cytokines encoded by Csf2 (GM-CSF), Csf3 (G-CSF) and Il17f, integrin molecules Itgae and Itgam (CD11b), the transcriptional regulator Foxp3 and the protein folding chaperone Unc45b were prominent features. Moreover, our data provide an attractive role for transcripts of as yet unknown function, namely, 4933427D14Rik, 2210407C18Rik,
145 Chapter 7
6330403K07Rik and A430084P05Rik, in the distinct pulmonary transcriptional responses to pneumococci linked to specific components of inflammasome macromolecular complexes. Three recent investigations studied the role of NLRP3 and/or ASC in pneumococcal pneumonia (7-9). These studies reported enhanced bacterial growth in the lungs of Nlrp3-/- mice after infection with a serotype 2 pneumococcus (D39) (7, 8), which is consistent with our current results using the same strain, but not after infection with a serotype 3 S. pneumoniae (9); dissemination of pneumococci to distant body sites was not described (7-9). One study directly compared the roles of NLRP3 and ASC after intranasal infection with S. pneumoniae D39 given at a slightly higher dose (5 x 107 CFU) than used here (1-2 x 107 CFU), revealing a reduced resistance of both Nlrp3-/- and Asc-/- mice relative to WT mice but no differences between the two inflammasome deficient mouse strains with regard to pulmonary bacterial growth and mortality, although lethality tended to be higher amongst Asc-/- mice (8). The in vivo role of NLRP3 and ASC in the inflammatory response toS. pneumoniae was only studied to a limited extent; these previous reports rather focused on mechanisms involved in the activation of the NLRP3 inflammasome and caspase-1 by S. pneumoniae in macrophages in vitro, all demonstrating an important role for the pneumococcal virulence factor pneumolysin (7-9). Our investigation partially confirms and extends these earlier data: we show that neither ASC nor NLRP3 impact on bacterial growth after infection with pneumolysin deficientS. pneumoniae; that after infection with WT S. pneumoniae ASC but not NLRP3 reduces bacterial dissemination and lethality after induction of pneumococcal pneumonia; and in addition, we describe the early innate immune response in the lungs of Nlrp3-/-, Asc-/- and WT mice in great detail, making use of whole genome mRNA profiling. The higher susceptibility of Asc-/- mice is not unexpected, since ASC can form inflammasome complexes with other NLRs, as well as with Absent in melanoma 2 (AIM2), a cytosolic DNA sensor, suggesting a broader role for ASC, relative to NLRP3, in the host response to invading pathogens. Indeed, AIM2 was shown to be involved in IL-1β secretion and pyroptosis in macrophages in response to S. pneumoniae (8). However, to our knowledge there are no in vivo studies with Aim2- /- mice infected with S. pneumoniae. Notably, at 48 hours after infection Nlrp3-/- and Asc-/- mice demonstrated higher lung cytokine levels than WT mice, which most likely was caused by the higher bacterial loads in inflammasome deficient mice and indicating that neither NLRP3 nor ASC are required for the induction of cytokines by S. pneumoniae in the respiratory tract. In accordance, Nlrp3-/- mice were reported to have equal or elevated lung cytokine levels at 48 hours after induction of pneumonia by a serotype 3 pneumococcus (9). The most evident difference between Asc-/- and Nrlp3-/- mice at 48 hours was the fact that the former mouse strain displayed less lung inflammation at this late stage of infection, as determined by an established quantitative histology score, in spite of similar bacterial loads. At present it is unclear whether this distinction between strains contributed to the clear difference in survival. Biochemical markers for distant organ injury did not differ between inflammasome deficient mice. Our analysis of the pulmonary transcriptome induced by S. pneumoniae in WT mice (Figure 4), encompassing 5346 transcripts, can be subdivided into functional
146 NLRP3 and ASC differentially affect the lung transcriptome during pneumococcal pneumonia units of distinct biological processes. We observed an increase in abundance of transcripts involved in defense responses, cytokine regulation, chemotaxis and apoptosis (Figure 4B). A previous study reported a comparable transcriptional response in an aerosol-induced pneumococcal pneumonia model, although not extensively characterized through bioinformatics (22). A substantial proportion of the transcripts within the induced biological themes are involved in neutrophil-specific functions. Indeed, our data show that highly induced transcripts after pneumococcal infection serve as neutrophil recruiters, such as the chemoattractants Cxcl1 and Cxcl2 as well as Ptx3 (Pentraxin-3). Collectively, our comprehensive analysis of the pulmonary transcriptome at six hours post-pneumococcal infection suggests that while immune cell (innate, humoral and/or adaptive) related transcripts are maximal, epithelial cell transcripts as well as genes involved in mitochondrial function are negatively affected.
In our attempt to dissect differences between Nlrp3-/- and Asc-/- mice during pneumococcal pneumonia we focused on the early immune response considering that the immediate inflammatory reaction in the airways is decisive for an adequate defense (2) and since bacterial loads were still similar at the 6-hour time point allowing an unbiased comparison between mouse strains not hampered by differences in the bacterial stimulus. We first determined cytokine and chemokine levels in whole lungs of infected mice and found a markedly impaired response in both Nlrp3-/- and Asc-/- mice. Importantly, relative to WT mice, levels of IL-1β were only significantly reduced in lungs ofNlrp3 -/- mice, whereas TNFα was only lower in Asc-/- mice; the lung levels of CXCL1, CXCL2, CCL2 and IL-6 were significantly lower in both knockout strains. Of these differentially expressed mediators, especially TNFα plays an eminent role in host defense during pneumococcal pneumonia (23), but also IL-1β (24), IL-6 (25) and CCL2 (26) have been implicated in protective immunity. Thus, these differentially expressed mediators likely contributed to the impaired host defense of Asc-/- and Nlrp3 -/- mice. IL-17 was the only cytokine that was differentially expressed between Nlrp3-/- and Asc-/- mice, with lowest levels in Asc-/- mice, suggesting that reduced levels of IL-17 coincide with increased susceptibility of especially these mice in our model of pneumococcal pneumonia. Indeed, previous reports have documented that IL-17 is important for mucosal immunity and bacterial clearance, as well as colonization induced immunity against S. pneumonia (27, 28).
The comparison of the lung transcriptional response between WT, Asc-/- and Nlrp3-/- mice during early pulmonary infection with S. pneumoniae yielded 56 gene transcripts that differed in abundance between the three genotypes (table 4). Among the genes that were differentially expressed between genotypes were Csf2 (encoding GM-CSF) and Csf3 (encoding G-CSF). Considering that both GM- CSF and G-CSF have been implicated in protective immunity during pneumococcal pneumonia (20, 21), we expanded our analyses by determining protein levels of these growth factors in whole lung homogenates. We found significantly lower GM- CSF concentrations in lungs of Asc-/ - mice relative to both WT and Nlrp3-/- mice, while mRNA levels (on microarrays and confirmed by RT-PCR) were only slightly
147 Chapter 7 lower in Asc-/- but nearly absent in Nlrp3-/- mice. This might point to an inability of Asc-/- mice to secrete the protein GM-CSF. Alternatively, the discrepancy between GM-CSF mRNA and protein data in Asc-/- and Nlrp3-/- mice may have been caused by altered mRNA expression before the 6-hour time point. Nonetheless, reduced GM-CSF levels in lungs of Asc-/- mice might explain their increased susceptibility at least in part, since prophylactic as well as therapeutic treatment with GM-CSF directly into the airways was demonstrated to improve survival and bacterial clearance in murine pneumococcal pneumonia (21). The protein levels of G-CSF were in line with mRNA expression data and lower in both Asc-/- and Nlrp3-/- mice. It would be interesting to evaluate if reconstitution of Asc-/- mice with GM-CSF or Asc-/- and Nlrp3-/- mice with G-CSF improves bacterial clearance and mortality rates and how this relates to their phenotype. Another gene of functional interest is integrin alpha M (CD11b). In the current study, integrin alpha M mRNA was lower in both knockout strains compared to WT mice, but significantly lower inAsc -/- than in Nlrp3-/- mice. Considering that CD11b deficient mice have impaired antibacterial defense against pneumococci (29), these data suggest a role for reduced integrin alpha M expression in the enhanced susceptibility of Asc-/- mice relative to Nlrp3-/- mice during respiratory tract infection by S. pneumoniae.
Another difference in gene expression in infected Nlrp3-/- and Asc-/- mice related to the adaptive immune response (in particular Il17F, Foxp3 and Itgae) and all of these genes were higher expressed in Nlrp3-/- mice. The adaptive immune response is intimately tied to inflammasome activation and several reports point to a role for the adaptive immune response in pneumococcal pneumonia (27, 30). For example, regulatory T cells, for which Foxp3 is a marker, are probably important to limit excessive inflammation during pneumococcal pneumonia (30). The product of Itgae, Integrin alpha E (CD103), for which epithelial E-cadherin is the ligand, is expressed on certain populations of intraepithelial T cells and some regulatory T cells as well as on dendritic cells (31, 32). A recent study demonstrated that the activation of Integrin alpha E on dendritic cells can protect from lethal pneumonia with S. pneumoniae (33). Interestingly, the expression of Integrin alpha E on dendritic cells was reported to be induced by GM-CSF in an infection model (34), which is in line with the impaired levels of this growth factor detected here in Asc-/- mice. In addition, it was very recently reported that Asc-/- dendritic cells have impaired antigen presenting capacity and that Asc-/- mice have impaired lymphocyte migration independent of caspase-1 activation, pointing to an inflammasome independent role for ASC in the induction of the adaptive host response (35).
As a preliminary analysis of differences in inflammatory cell populations we evaluated co-clustering of genes that were significantly different between genotypes by use of the Immgen.org database. Dendritic cells were predicted to be significantly different between genotypes Nlrp3-/- and WT mice (p= 7,80E-03). This might suggest that dendritic cells compensate the lack of NLRP3 inflammasome dependent functions to some extent in Nlrp3-/- mice but not in Asc-/- mice. It remains to be determined if migration of dendritic cells to the lungs of Asc-/- mice is indeed impaired and if this contributes to their susceptible phenotype, for instance in adoptive transfer
148 NLRP3 and ASC differentially affect the lung transcriptome during pneumococcal pneumonia experiments.
In conclusion, we here demonstrate different susceptibilities of Nlrp3-/- and Asc-/ - mice after infection with S. pneumoniae via the airways reflected by enhanced bacterial dissemination and lethality in the latter mouse strain. While the vast majority of studies focused on the role of inflammasomes in caspase-1 activation, the release of IL-1β and IL-18 and pyroptosis, we here performed a detailed analysis of the early inflammatory response in the lungs by whole genome expression arrays. We identified several genes influenced by NLRP3 and ASC not classically linked to inflammasome activation and in addition found mediators that were differentially expressed in Nlrp3-/- and Asc-/ - mice. Of these, IL-17, GM-CSF and integrin alpha M were of particular interest considering that they were significantly attenuated inAsc - /- relative to Nlrp3-/- mice, which in light of their protective role during pneumococcal pneumonia may at least in part explain the relative hypersusceptibility of Asc-/ - mice. In addition, Asc-/ - mice displayed a reduced expression of a number of genes involved in the adaptive immune response. Taken together with previous studies from our laboratory that found only limited roles for inflammasome dependent cytokines IL-1β and IL-18 in host defense against pneumococcal pneumonia (24, 36), the current data suggest that especially ASC impacts on the immune response to pneumococci by mechanisms not directly linked to the release of IL-1β or IL-18. It remains to be determined to which extent inflammasome independent functions by ASC, such as recently described (35), contribute to its role in host defense against pneumonia caused by S. pneumoniae.
Acknowledgments
Fayaz S. Sutterwala and Richard A. Flavell kindly provided us with the Nlrp3- /- and Asc-/ - mice. We thank Joost Daalhuisen and Marieke ten Brink for expert technical assistance and James C. Paton for providing the pneumolysin deficient S. pneumoniae D39.
149 Chapter 7
References
1. Mandell LA, Wunderink RG, Anzueto A, Bartlett JG, Campbell GD, Dean NC, Dowell SF, File TM, Jr., Musher DM, Niederman MS, et al. Infectious Diseases Society of America/American Thoracic Society Consensus Guidelines on the Management of Community-Acquired Pneumonia in Adults. Clin Infect Dis 2007;44 Suppl 2:S27-S72.
2. van der Poll T, Opal SM. Pathogenesis, Treatment, and Prevention of Pneumococcal Pneumonia. Lancet 2009;374:1543-1556.
3. Zahar JR, Timsit JF, Garrouste-Org, Francais A, Vesin A, Descorps-Declere A, Dubois Y, Souweine B, Haouache H, Goldgran-Toledano D, et al. Outcomes in Severe Sepsis and Patients With Septic Shock: Pathogen Species and Infection Sites Are Not Associated With Mortality. Crit Care Med 2011;39:1886-1895.
4. Ramirez JA, Anzueto AR. Changing Needs of Community-Acquired Pneumonia. J Antimicrob Chemother 2011;66 Suppl 3:iii3-iii9.
5. Schroder K, Tschopp J. The Inflammasomes. Cell 2010;140:821-832.
6. Strowig T, Henao-Mejia J, Elinav E, Flavell R. Inflammasomes in Health and Disease.Nature 2012;481:278-286.
7. McNeela EA, Burke A, Neill DR, Baxter C, Fernandes VE, Ferreira D, Smeaton S, El-Rachkidy R, McLoughlin RM, Mori A, et al. Pneumolysin Activates the NLRP3 Inflammasome and Promotes Proinflammatory Cytokines Independently of TLR4.PLoS Pathog 2010;6:e1001191.
8. Fang R, Tsuchiya K, Kawamura I, Shen Y, Hara H, Sakai S, Yamamoto T, Fernandes-Alnemri T, Yang R, Hernandez-Cuellar E, et al. Critical Roles of ASC Inflammasomes in Caspase-1 Activation and Host Innate Resistance to Streptococcus Pneumoniae Infection. J Immunol 2011;187:4890-4899.
9. Witzenrath M, Pache F, Lorenz D, Koppe U, Gutbier B, Tabeling C, Reppe K, Meixenberger K, Dorhoi A, Ma J, et al. The NLRP3 Inflammasome Is Differentially Activated by Pneumolysin Variants and Contributes to Host Defense in Pneumococcal Pneumonia. J Immunol 2011;187:434-440.
10. Sutterwala FS, Ogura Y, Szczepanik M, Lara-Tejero M, Lichtenberger GS, Grant EP, Bertin J, Coyle AJ, Galan JE, Askenase PW, et al. Critical Role for NALP3/CIAS1/Cryopyrin in Innate and Adaptive Immunity Through Its Regulation of Caspase-1. Immunity 2006;24:317-327.
11. Dessing MC, Florquin S, Paton JC, van der Poll T. Toll-Like Receptor 2 Contributes to Antibacterial Defence Against Pneumolysin-Deficient Pneumococci. Cell Microbiol 2008;10:237-246.
12. Hoogendijk AJ, Roelofs JJ, Duitman J, van Lieshout MH, Blok DC, van der Poll T, Wieland CW. R-Roscovitine Reduces Lung Inflammation Induced by Lipoteichoic Acid and Streptococcus Pneumoniae. Mol Med 2012;18:1086-1095.
13. Dunning MJ, Smith ML, Ritchie ME, Tavare S. Beadarray: R Classes and Methods for Illumina Bead-Based Data. Bioinformatics 2007;23:2183-2184.
14. Reimers M, Carey VJ. Bioconductor: an Open Source Framework for Bioinformatics and Computational Biology. Methods Enzymol 2006;411:119-134.
150 NLRP3 and ASC differentially affect the lung transcriptome during pneumococcal pneumonia
15. Ruijter JM, Pfaffl MW, Zhao S, Spiess AN, Boggy G, Blom J, Rutledge RG, Sisti D, Lievens A, De PK, et al. Evaluation of QPCR Curve Analysis Methods for Reliable Biomarker Discovery: Bias, Resolution, Precision, and Implications. Methods 2012.
16. Smyth GK. Linear Models and Empirical Bayes Methods for Assessing Differential Expression in Microarray Experiments. Stat Appl Genet Mol Biol 2004;3:Article3.
17. Huang dW, Sherman BT, Lempicki RA. Systematic and Integrative Analysis of Large Gene Lists Using DAVID Bioinformatics Resources. Nat Protoc 2009;4:44-57.
18. Koppe U, Suttorp N, Opitz B. Recognition of Streptococcus Pneumoniae by the Innate Immune System. Cell Microbiol 2012;14:460-466.
19. Giebelen IA, Leendertse M, Florquin S, van der Poll T. Stimulation of Acetylcholine Receptors Impairs Host Defence During Pneumococcal Pneumonia. Eur Respir J 2009;33:375-381.
20. Knapp S, Hareng L, Rijneveld AW, Bresser P, van der Zee JS, Florquin S, Hartung T, van der Poll T. Activation of Neutrophils and Inhibition of the Proinflammatory Cytokine Response by Endogenous Granulocyte Colony-Stimulating Factor in Murine Pneumococcal Pneumonia. J Infect Dis 2004;189:1506-1515.
21. Steinwede K, Tempelhof O, Bolte K, Maus R, Bohling J, Ueberberg B, Langer F, Christman JW, Paton JC, Ask K, et al. Local Delivery of GM-CSF Protects Mice From Lethal Pneumococcal Pneumonia. J Immunol 2011;187:5346-5356.
22. Evans SE, Tuvim MJ, Zhang J, Larson DT, Garcia CD, Martinez-Pro S, Coombes KR, Dickey BF. Host Lung Gene Expression Patterns Predict Infectious Etiology in a Mouse Model of Pneumonia. Respir Res 2010;11:101.
23. van der Poll T, Keogh CV, Buurman WA, Lowry SF. Passive Immunization Against Tumor Necrosis Factor-Alpha Impairs Host Defense During Pneumococcal Pneumonia in Mice. Am J Respir Crit Care Med 1997;155:603-608.
24. Rijneveld AW, Florquin S, Branger J, Speelman P, Van Deventer SJ, van der Poll T. TNF- Alpha Compensates for the Impaired Host Defense of IL-1 Type I Receptor-Deficient Mice During Pneumococcal Pneumonia. J Immunol 2001;167:5240-5246.
25. van der Poll T, Keogh CV, Guirao X, Buurman WA, Kopf M, Lowry SF. Interleukin-6 Gene- Deficient Mice Show Impaired Defense Against Pneumococcal Pneumonia. J Infect Dis 1997;176:439-444.
26. Winter C, Taut K, Srivastava M, Langer F, Mack M, Briles DE, Paton JC, Maus R, Welte T, Gunn MD, et al. Lung-Specific Overexpression of CC Chemokine Ligand (CCL) 2 Enhances the Host Defense to Streptococcus Pneumoniae Infection in Mice: Role of the CCL2-CCR2 Axis. J Immunol 2007;178:5828-5838.
27. Zhang Z, Clarke TB, Weiser JN. Cellular Effectors Mediating Th17-Dependent Clearance of Pneumococcal Colonization in Mice. J Clin Invest 2009;119:1899-1909.
28. Graeber KE, Olsen NJ. Th17 Cell Cytokine Secretion Profile in Host Defense and Autoimmunity. Inflamm Res 2012;61:87-96.
151 Chapter 7
29. Rijneveld AW, de Vos AF, Florquin S, Verbeek JS, van der Poll T. CD11b Limits Bacterial Outgrowth and Dissemination During Murine Pneumococcal Pneumonia. J Infect Dis 2005;191:1755-1760.
30. Neill DR, Fernandes VE, Wisby L, Haynes AR, Ferreira DM, Laher A, Strickland N, Gordon SB, Denny P, Kadioglu A, et al. T Regulatory Cells Control Susceptibility to Invasive Pneumococcal Pneumonia in Mice. PLoS Pathog 2012;8:e1002660.
31. Van den Bossche J, Malissen B, Mantovani A, De BP, Van Ginderachter JA. Regulation and Function of the E-Cadherin/Catenin Complex in Cells of the Monocyte-Macrophage Lineage and DCs. Blood 2012;119:1623-1633.
32. Leepiyasakulchai C, Ignatowicz L, Pawlowski A, Kallenius G, Skold M. Failure to Recruit Anti-Inflammatory CD103+ Dendritic Cells and a Diminished CD4+ Foxp3+ Regulatory T Cell Pool in Mice That Display Excessive Lung Inflammation and Increased Susceptibility to Mycobacterium Tuberculosis. Infect Immun 2012;80:1128-1139.
33. Ivanov S, Fontaine J, Paget C, Macho FE, Van ML, Renneson J, Maillet I, Wolf NM, Rial A, Leger H, et al. Key Role for Respiratory CD103(+) Dendritic Cells, IFN-Gamma, and IL-17 in Protection Against Streptococcus Pneumoniae Infection in Response to Alpha- Galactosylceramide. J Infect Dis 2012;206:723-734.
34. Zhan Y, Carrington EM, van NA, Bedoui S, Seah S, Xu Y, Wang N, Mintern JD, Villadangos JA, Wicks IP, et al. GM-CSF Increases Cross-Presentation and CD103 Expression by Mouse CD8(+) Spleen Dendritic Cells. Eur J Immunol 2011;41:2585-2595.
35. Ippagunta SK, Malireddi RK, Shaw PJ, Neale GA, Walle LV, Green DR, Fukui Y, Lamkanfi M, Kanneganti TD. The Inflammasome Adaptor ASC Regulates the Function of Adaptive Immune Cells by Controlling Dock2-Mediated Rac Activation and Actin Polymerization. Nat Immunol 2011;12:1010-1016.
36. Lauw FN, Branger J, Florquin S, Speelman P, Van Deventer SJ, Akira S, van der Poll T. IL-18 Improves the Early Antimicrobial Host Response to Pneumococcal Pneumonia. J Immunol 2002;168:372-378.
152 NLRP3 and ASC differentially affect the lung transcriptome during pneumococcal pneumonia Supplemental methods
Assays for clinical chemistry Plasma levels of urea, lactate dehydrogenase (LDH), aspartate aminotransferase (AST) and alanine transaminase (ALT) were measured with kits from Sigma (St. Louis, MO), using a Hittachi analyzer (Boehringer Mannheim, Mannheim, Germany).
Processing of RNA & Bioinformatics Total RNA was isolated from lung homogenates using the Nucleospin RNA II kit (Machery-Nagel, Duren, Germany). Yield and purity (260nm:280nm) were determined by Nanodrop ND-1000. The integrity (RIN>7.0) of the re-suspended total RNA was determined by using the RNA Nano Chip Kit on the Bioanalyzer 2100 and the 2100 Expert software (Agilent). The Illumina TotalPrep-96 RNA Amplification Kit was used to generate biotin labeled (biotin-16-UTP) amplified cRNA starting from 200ng total RNA. A total of 750ng biotinylated cRNA was hybridized onto the Illumina MouseRef-8v2 Expression BeadChip. The samples were scanned using the Illumina iScan array scanner. Preparation of cRNA, chip hybridization, washing, staining and scanning were carried out at ServiceXS (Leiden, the Netherlands). The raw scan data were read using the beadarray package (version 1.12.1) (1), available through Bioconductor (2) , using the R statistical package (version 2.13.2; R Foundation for Statistical Computing, Vienna, Austria). Estimated background was subtracted from the foreground for each bead. For replicate beads, outliers greater than 3 median absolute deviations from the median were removed and the average signal was calculated for the remaining intensities. For each probe a detection score was calculated by comparing its average signal with the summarized values for the negative control probes. Resulting data were neqc normalized (3). Quality control was performed both on bead level and on bead summary data. The arrayQualityMetrics package v2.6.0 (4) was used for further quality assessment of the normalized bead summary data. Probes were re-annotated using the package illuminaMousev2.db from Bioconductor (5). Annotation quality was assessed by means of the illuminaMousev2PROBEQUALITY call of the illuminaMousev2. db package as described in (5). Probes that showed “no match” to transcript or genomic regions were filtered out of subsequent differential gene expression analysis. Differential gene expression analysis was performed by means of the limma package (version 3.8.3), which implements linear models for microarray data (Smyth GK, 2004). A factorial design matrix was constructed to indicate the RNA sample identity of each array, that is, uninfected wildtype (WT), Nlrp3-/-, Asc-/- and D39 infected wildtype, Nlrp3-/-, Asc-/- mouse lung RNA samples. Next, a contrast matrix was defined to specify the comparisons to be made between theRNA samples: a. genotype effect (uninfected samples only) Nlrp3_geno=(Nlrp3KO-WT), Asc_geno=(AscKO-WT) b. infection (infected samples only) Asc_infection=(AscKO-WT), Nlrp3_infection=(Nlrp3KO-WT), Asc_Nlrp3_ difference=((Nlrp3KO-WT)-(AscKO-WT)) The lmFit and eBayes functions coupled with array weights (implemented in
153 Chapter 7 limma) were used to statistically assess differential expression. Empirical Bayesian methods moderate the standard errors of the estimated log-fold changes resulting in more stable inferences and improved power (Smyth GK, 2004). Thus, p-values were obtained from moderated t statistics or f statistics, which are then adjusted for multiple comparisons with Benjamini and Hochberg’s (BH) method to control the false discovery rate. The toptable function was used to generate annotated outputs for which the most significant probe ID was presented. All non-normalized and normalized data are available at the gene expression omnibus of NCBI (GEO) with accession number GSE42464. Differentially expressed genes as defined by multiple-test corrected p < 0.05 were analyzed for enrichment of functional annotations using the Database for Annotation, Visualization and Integrated Discovery (DAVID) v6.7 (reference 17 in main manuscript). We analyzed up- and down-regulated gene expression profiles defined by positive and negative log2 foldchanges, respectively. All analyses were performed using default parameters. In order to assess enrichment for cell- specific gene co-expression signatures we used the coexpression atlas ofthe Immunological Genome database (Immgen.org) available through the Toppgene suite (http://toppgene.cchmc.org). Genes listed in table S6 were analyzed using default parameters. Significance for both DAVID and Toppgene outputs were defined by bonferroni p < 0.05.
References
1. Dunning MJ, Smith ML, Ritchie ME, Tavare S. Beadarray: R Classes and Methods for Illumina Bead-Based Data. Bioinformatics 2007;23:2183-2184.
2. Reimers M, Carey VJ. Bioconductor: an Open Source Framework for Bioinformatics and Computational Biology. Methods Enzymol 2006;411:119-134.
3. Shi W, Oshlack A, Smyth GK. Optimizing the Noise Versus Bias Trade-Off for Illumina Whole Genome Expression BeadChips. Nucleic Acids Res 2010;38:e204.
4. Kauffmann A, Rayner TF, Parkinson H, Kapushesky M, Lukk M, Brazma A, Huber W. Importing ArrayExpress Datasets into R/Bioconductor. Bioinformatics 2009;25:2092-2094.
5. Barbosa-Morais NL, Dunning MJ, Samarajiwa SA, Darot JF, Ritchie ME, Lynch AG, Tavare S. A Re-Annotation Pipeline for Illumina BeadArrays: Improving the Interpretation of Gene Expression Data. Nucleic Acids Res 2010;38:e17.
154 NLRP3 and ASC differentially affect the lung transcriptome during pneumococcal pneumonia Supplemental tables
Table S1: Plasma levels of chemokines and cytokines 6 hours after induction of pneumonia by S. pneumoniae.
Plasma WT Nlrp3-/- Asc-/-
TNF-α 27 (4) 16 (3) 19 (4)
IL-6 1038 (140) 416 (149)* 138 (35)**
IL-10 7 (1) 6 (1) 13 (5)
IL-12 12 (4) 9 (2) 22 (12)
CCL2 682 (118) 198 (48)** 131 (35)**
WT, Nlrp3 -/- and Asc-/- mice were inoculated with 1-2x107 CFU S. pneumoniae and sacrificed at 48 hours after infection in WT, Nlrp3-/- and Asc-/- mice. Plasma cytokine and chemokine levels are presented in pg/ml. Data are expressed as mean (SE). * p < 0.05, **p <0.01 compared to WT mice determined with Mann-Whitney U test.
Table S2: Plasma levels of chemokines and cytokines 48 hours after induction of pneumonia by S. pneumoniae.
Plasma WT Nlrp3-/- WT Asc-/-
TNF-α 4 (1) 70 (47)* 168 (95) 1020 (589)
IL-6 22 (12) 955 (632)** 1947 (1265) 3241 (1556)
IL-10 38 (28) 12 (2) 14 (19) 322 (227)
IL-12 104 (94) 14 (4) 27 (17) 15 (4)
CCL2 42 (10) 255 (138) 2093 (1214) 3805 (1733)
WT, Nlrp3-/- and Asc-/- mice were inoculated with 1-2x107 CFU S. pneumoniae and sacrificed 48 hours later. Plasma cytokine and chemokine levels are presented in pg/ml. Data are mean (SE) of 6-9 mice per group.* p < 0.05, ** p < 0.01 vs WT mice.
155 Chapter 7
Table S3: Primer sequences used for qRT-PCR validation of transcripts
Primer ID Sequence 5’→3’ Gdpd3_Forward ATGGCGATCGTTCTGGATAC Gdpd3_Reverse AATGGTAGCCGACAGTTGGT Csf2_Forward CTTGAACATGACAGCCAGCTA Csf2_Reverse TCATTTTTGGCCTGGTTTTT Csf3_Forward GTCTCCTGCAGGCTCTATCG Csf3_Reverse CTGGAAGGCAGAAGTGAAGG Nlrp3_Forward AGGACTCAGGCTCCTCTGTG Nlrp3_Reverse GATCATTGTTGCCCAGGTTC Pycard_Forward CCAGTGTCCCTGCTCAGAGT Pycard_Reverse TGTCTTGGCTGGTGGTCTCT Unc45b_Forward AGAACCATGACCAGCTACGG Unc45b_Reverse GCGTTCTGCAGTTTGTGGT Mid1_Forward CCGTCACTACTGGGAAGTGG Mid1_Reverse ATGGAGCCGTTGTCGTAGTC
156 NLRP3 and ASC differentially affect the lung transcriptome during pneumococcal pneumonia 3.880 4.437 4.754 4.836 5.132 5.446 5.539 5.629 7.861 8.556 9.064 10.247 10.576 12.358 14.073 B 0.00670 0.00368 0.00270 0.00262 0.00215 0.00161 0.00158 0.00158 0.00012 5.53E-05 3.39E-05 1.11E-05 9.58E-06 1.30E-06 2.28E-07 adj.P.Val 4.91E-06 2.54E-06 1.75E-06 1.58E-06 1.11E-06 7.63E-07 6.82E-07 6.13E-07 3.99E-08 1.67E-08 8.78E-09 1.91E-09 1.24E-09 1.12E-10 9.84E-12 P.Value -5.699 5.949 6.093 -6.131 6.267 -6.412 -6.456 6.498 7.587 7.948 -8.219 -8.879 -9.070 -10.176 -11.376 t mice after pulmonary infection. -/- v WT Nlrp3 -/- FC 2 -1.490 1.421 1.337 -1.399 1.454 -1.133 -1.159 1.591 1.593 1.787 -2.031 -1.513 -2.160 -2.181 -2.636 Nlrp3 log Kdm6b Itgae Slamf9 Pttg1 Itgae Zfp39 Unc45b Thg1l 2210407C18Rik Plac9 Csf3 Trim16 Csf2 Nlrp3 4933427D14Rik Symbol 216850 16407 98365 30939 16407 22698 217012 66628 78354 211623 12985 94092 12981 216799 74477 EntrezID ILMN_3095624 ILMN_1217629 ILMN_2663249 ILMN_2809167 ILMN_2699898 ILMN_1241611 ILMN_2732747 ILMN_2979430 ILMN_1226767 ILMN_2710159 ILMN_1217948 ILMN_2482494 ILMN_2749412 ILMN_1237471 ILMN_1245850 Probe ID Table S4: Differential transcriptional response between WT and Table
157 Chapter 7 1.662 1.878 1.932 1.932 2.071 2.106 2.159 2.205 2.318 2.413 2.448 2.552 2.615 2.935 3.128 3.668 B 0.04607 0.03698 0.03587 0.03587 0.03261 0.03243 0.03161 0.03112 0.02840 0.02647 0.02647 0.02457 0.02392 0.01727 0.01451 0.00812 adj.P.Val 6.56E-05 5.11E-05 4.80E-05 4.80E-05 4.08E-05 3.92E-05 3.68E-05 3.49E-05 3.06E-05 2.74E-05 2.63E-05 2.33E-05 2.17E-05 1.49E-05 1.19E-05 6.31E-06 P.Value -4.725 -4.819 4.842 4.842 -4.903 4.918 4.941 4.961 -5.010 5.052 5.067 -5.112 5.140 5.280 5.365 5.604 t v WT -/- FC 2 -0.761 -1.294 0.809 0.754 -0.998 1.433 1.097 1.055 -1.161 1.507 0.917 -0.759 1.041 0.884 0.866 0.786 Nlrp3 log Irak3 Pira6 Pafah1b3 Cep57l1 Clec5a D14Ertd449e Lta Irgq 6330403K07Rik Sept3 Fgd2 Gpx3 Rhox2d Cd27 Incenp B9d1 Symbol 73914 18729 18476 103268 23845 66039 16992 210146 103712 24050 26382 14778 434760 21940 16319 27078 EntrezID ILMN_1253972 ILMN_2691049 ILMN_2640971 ILMN_2807750 ILMN_3121522 ILMN_2693858 ILMN_1229804 ILMN_2715466 ILMN_2594139 ILMN_1218471 ILMN_2737903 ILMN_2715546 ILMN_2917647 ILMN_1233589 ILMN_1216213 ILMN_2713969 Probe ID
158 NLRP3 and ASC differentially affect the lung transcriptome during pneumococcal pneumonia p , nominal 1.511 1.540 1.554 1.630 B statistic. t t , 0.04897 0.04870 0.04870 0.04642 adj.P.Val Log 2 transformed fold-change. 7.82E-05 7.57E-05 7.44E-05 6.81E-05 P.Value FC, 2 log and genome-wide lung transcriptional responses were assessed mouse samples yielded 35 gene expression profiles (Benjamini- -/- Nlrp3 -4.660 4.672 4.678 -4.711 t S. pneumoniae CFU v WT 7 -/- -value. B, Beta probability. p -value. B, Beta probability. FC 2 -1.013 1.243 0.896 -0.879 Nlrp3 log statistics) of the WT and t transcriptional response in from pneumonia. WT -/-
Dll1 Hist1h2ab H2-DMb1 BC068281 Symbol Nlrp3 Pycard KO) mice were inoculated with 2x10 ( -/- 13388 319172 14999 238037 EntrezID Asc and -/- p < 0.05) that discriminate
Nlrp3 ILMN_2721188 ILMN_2836654 ILMN_1244977 ILMN_2760057 Probe ID p -value. BH , Benjamini-Hochberg multiple comparison corrected Hochberg WT, WT, 6 hours after infection. Univariate analysis (moderated
159 Chapter 7 B 2.858 3.327 3.006 4.810 4.026 3.438 5.057 6.924 8.070 7.072 9.417 8.340 8.100 9.601 11.126 10.426 0.0232 0.0153 0.0208 0.0034 0.0078 0.0144 0.0028 0.0004 0.0001 0.0003 0.0001 0.0001 adj.P.Val 3.82E-05 3.82E-05 2.12E-05 1.72E-05 P.Value 1.70E-05 9.89E-06 1.43E-05 1.75E-06 4.39E-06 8.70E-06 1.31E-06 1.42E-07 3.51E-08 1.19E-07 2.52E-08 3.39E-08 6.60E-09 5.23E-09 1.83E-09 7.40E-10 t 5.231 5.435 7.075 7.147 8.440 9.301 -5.295 -6.092 -5.742 -5.483 -6.203 -7.640 -7.777 -7.655 -8.341 -8.897 mice after pulmonary infection. -/- 1.064 0.879 1.764 0.831 4.625 1.790 -2.267 -1.821 -0.871 -0.833 -1.309 -2.680 -1.822 -1.560 -1.764 -2.370 logFC Asc Lif Asc Ngp Apip Csf3 Tpbg Itgb2l Itgam Plac9 Prok2 Camp Inpp5f Gdpd3 Map3k8 Symbol Sh2d1b1 D14Ertd449e 12796 26904 26410 21983 56369 16415 16878 66039 16409 66824 18054 12985 68616 50501 211623 101490 EntrezID Probe ID ILMN_2766604 ILMN_2978617 ILMN_1245924 ILMN_1250696 ILMN_1234781 ILMN_1258735 ILMN_3137291 ILMN_2785512 ILMN_2693858 ILMN_2696017 ILMN_2936476 ILMN_1228832 ILMN_1217948 ILMN_2893879 ILMN_3147259 ILMN_2710159 Table S5: Differential transcriptional response between WT and Table
160 NLRP3 and ASC differentially affect the lung transcriptome during pneumococcal pneumonia p , p < 2.711 1.983 2.000 2.730 2.451 2.190 2.025 2.716 1.982 1.842 p -value. BH p , nominal 0.0416 0.0416 0.0234 0.0300 0.0387 0.0416 0.0234 0.0234 0.0416 0.0471 t statistic. t , 4.67E-05 4.57E-05 1.97E-05 3.68E-05 4.44E-05 2.72E-05 2.01E-05 2.02E-05 4.67E-05 5.48E-05 4.853 4.792 -4.860 -5.175 -4.942 -4.871 -5.055 -5.169 -5.167 -4.852 Log 2 transformed fold-change. FC, 2 log and genome-wide lung transcriptional responses were assessed 6 hours after mouse samples yielded 26 gene expression profiles (Benjamini-Hochberg
-/- 0.515 0.906 -1.213 -1.026 -1.087 -0.697 -0.517 -1.215 -1.162 Asc -0.495 S. pneumoniae CFU 7 -value. B, Beta probability. p -value. B, Beta probability. Ptx3 Olfm4 Nfkb1 Rpp21 Stard7 Ralgds Akap12 Slc27a4 Adamts1 Gm4951 statistics) of the WT and t 11504 67676 26569 19288 83397 19730 99138 18033 380924 transcriptional response from WT in pneumonia. 240327
-/- Asc mice were inoculated with 2x10 -/- Asc and -/- Nlrp3 ILMN_2689119 ILMN_2726308 ILMN_2662802 ILMN_2624622 ILMN_2761082 ILMN_2709355 ILMN_3161834 ILMN_2676066 ILMN_2592476 ILMN_2904001 infection. Univariate analysis (moderated WT, WT, Benjamini-Hochberg multiple comparison corrected 0.05) that discriminate
161 Chapter 7
Table S6 Nlrp3 -/- vs WT mice, enrichment for cell-specific gene co-expression.
Coexpression Name bonferroni p Genes atlas ID
Myeloid Cells, DC.103+11b-.Lu, CD11chi Fgd2, Slamf9, GSM538231_500 CD11b low CD103+ 7,80E-03 Sept3, Clec5a, Itgae, MHCII+ SiglecF-, Lung, Gpx3, Nlrp3 avg-3
Toppgene suite (http://toppgene.cchmc.org) derived enrichment for cell-specific gene co-expression characteristics available through the Immunological Genome database (Immgen.org). Differentially expressed genes between WT and Nlrp3-/- mouse samples suggest lung dendritic cells (DC) sorted by CD11c hi CD11b low CD103+ MHCII+ SiglecF- markers as putatively prominent cell-type. Coexpressed genes are Fgd2, Slamf9, Sept3, Clec5a, Itgae, Gpx3, Nlrp3.
Supplemental figures
Figure S1: Pulmonary clearance of pneumolysin deficient S. pneumoniae D39 is not impaired in Nlrp3-/- and Asc-/- mice. T, Nlrp3 -/- and Asc-/- mice were inoculated with 2x107 CFU isogenic pneumolysin deficient S. pneumoniae D39 (Ply-) and sacrificed 48 hours after infection. Bacterial loads in lungs of WT (white), Nlrp3-/- (light grey) and Asc-/- mice (dark grey) (n=6-9 per group). Data are expressed as box-and-whisker diagrams depicting the smallest observation, lower quartile, median, upper quartile, and largest observation.
Figure S2: Position of differentially expressed genes in uninfected Nlrp3-/- mice on chromosome 11 in relation to the Nlrp3 gene.
162 NLRP3 and ASC differentially affect the lung transcriptome during pneumococcal pneumonia
Figure S3: Validation of transcripts differentially expressed on arrays by quantitative reverse- transcriptase PCR (qRT-PCR). WT, Nlrp3-/- and Asc-/- mice were inoculated with 2x107 CFU S. pneumoniae and genome-wide lung transcriptional responses were assessed 6 hours after infection. qRT-PCR results for normalized expression of Nlrp3, Asc, Gdpd3 and Unc45b. Data are expressed as mean ± standard error of the mean, * p < 0.05 vs WT mice determined with Mann-Whitney U test.
163