DOCSLIB.ORG

Migration Suggesting a Role in Cell Adhesion and Macrophages Is

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Migration Suggesting a Role in Cell Adhesion and Macrophages Is The Novel Endocytic and Phagocytic C-Type Lectin Receptor DCL-1/CD302 on Macrophages Is Colocalized with F-Actin, Suggesting a Role in Cell Adhesion and This information is current as Migration of September 23, 2021. Masato Kato, Seema Khan, Elisabetta d'Aniello, Kylie J. McDonald and Derek N. J. Hart J Immunol 2007; 179:6052-6063; ; doi: 10.4049/jimmunol.179.9.6052 Downloaded from http://www.jimmunol.org/content/179/9/6052 References This article cites 51 articles, 21 of which you can access for free at: http://www.jimmunol.org/ http://www.jimmunol.org/content/179/9/6052.full#ref-list-1 Why The JI? Submit online. • Rapid Reviews! 30 days* from submission to initial decision • No Triage! Every submission reviewed by practicing scientists by guest on September 23, 2021 • Fast Publication! 4 weeks from acceptance to publication *average Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2007 by The American Association of Immunologists All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology The Novel Endocytic and Phagocytic C-Type Lectin Receptor DCL-1/CD302 on Macrophages Is Colocalized with F-Actin, Suggesting a Role in Cell Adhesion and Migration1 Masato Kato,2* Seema Khan,* Elisabetta d’Aniello,* Kylie J. McDonald,* and Derek N. J. Hart*† C-type lectin receptors play important roles in mononuclear phagocytes, which link innate and adaptive immunity. In this study we describe characterization of the novel type I transmembrane C-type lectin DCL-1/CD302 at the molecular and cellular levels. DCL-1 protein was highly conserved among the human, mouse, and rat orthologs. The human DCL-1 (hDCl-1) gene, composed of six exons, was located in a cluster of type I transmembrane C-type lectin genes on chromosomal band 2q24. Multiple tissue expression array, RT-PCR, and FACS analysis using new anti-hDCL-1 mAbs established that DCL-1 expression in leukocytes was Downloaded from restricted to monocytes, macrophages, granulocytes, and dendritic cells, although DCL-1 mRNA was present in many tissues. ؍ Stable hDCL-1 Chinese hamster ovary cell transfectants endocytosed FITC-conjugated anti-hDCL-1 mAb rapidly (t1/2 20 min) and phagocytosed anti-hDCL-1 mAb-coated microbeads, indicating that DCL-1 may act as an Ag uptake receptor. However, anti-DCL-1 mAb-coated microbead binding and subsequent phagocytic uptake by macrophages was ϳ8-fold less efficient than that of anti-macrophage mannose receptor (MMR/CD206) or anti-DEC-205/CD205 mAb-coated microbeads. Confocal studies showed that DCL-1 colocalized with F-actin in filopodia, lamellipodia, and podosomes in macrophages and that this was unaffected http://www.jimmunol.org/ by cytochalasin D, whereas the MMR/CD206 and DEC-205/CD205 did not colocalize with F-actin. Furthermore, when transiently expressed in COS-1 cells, DCL-1-EGFP colocalized with F-actin at the cellular cortex and microvilli. These data suggest that hDCL-1 is an unconventional lectin receptor that plays roles not only in endocytosis/phagocytosis but also in cell adhesion and migration and thus may become a target for therapeutic manipulation. The Journal of Immunology, 2007, 179: 6052–6063. ononuclear phagocytes, such as monocytes (Mo)3/ functions of these APC are mediated, at least in part, by C-type macrophages (Mph) and dendritic cells (DC) act as lectin receptors. APC and link the innate and adaptive immune re- C-type lectin receptors are a superfamily of cell surface proteins M by guest on September 23, 2021 sponses. Mo/Mph are recruited to sites of inflammation where they whose biology is complex but highly relevant to several human phagocytose pathogenic microbes and damaged tissue components diseases (3–7). Both Mph and DC are equipped with an array of and mediate local effector functions. Resident and recruited DC C-type lectin receptors that act as pattern recognition receptors. also phagocytose pathogens but, after migrating into draining These include the classical (Ca2ϩ-dependent sugar binding pro- lymph nodes, present processed Ags to T and B lymphocytes to teins, e.g., macrophage mannose receptor (MMR/CD206, MMR elicit Ag-specific adaptive immune responses (1, 2). The different hereafter), DC-specific ICAM-3 grabbing nonintegrin (DC-SIGN)/ CD209, and macrophage C-type galactose/N-acetyl galac- tosamine-specific lectin (MGL)/CD301; Refs. 8–12) but also the *Dendritic Cell Program, Mater Medical Research Institute, South Brisbane, Queens- land, Australia; and †School of Medicine, University of Queensland, Herston, nonclassical C-type lectin receptors (e.g., dectin-1; Refs. 13 and Queensland, Australia 14) that retain structural homology with the classical C-type lectins Received for publication February 28, 2007. Accepted for publication August but have evolved to bind sugar and nonsugar ligands without clas- 21, 2007. sic Ca2ϩ and sugar binding motifs. The costs of publication of this article were defrayed in part by the payment of page Many C-type lectin family members have more than one func- charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. tional capacity, but these in general relate to innate and adaptive 1 This work was supported by grants from National Health and Medical Research immune cell activity. These include: 1) specific binding to carbo- Council of Australia, and Mater Medical Research Institute. hydrate pathogen-associated molecular patterns expressed on 2 Address correspondence and reprint request to Dr. Masato Kato, Mater Medical pathogenic microbes (e.g., MMR, MGL/CD301, DC-SIGN/ Research Institute, Aubigny Place, Raymond Terrace, South Brisbane, Queensland, CD209, and dectin-1); 2) triggering phagocytosis of pathogens 4101 Australia. E-mail address: [email protected] (e.g., MMR, MGL/CD301, DC-SIGN/CD209, and dectin-1; Refs. 3 Abbreviations used in this paper: Mo, monocyte; BDC, blood dendritic cell; BDCA, BDC Ag; BLAST, basic local alignment search tool; CHO, Chinese hamster ovary; 10 and 14–17); 3) directing transport of phagocytosed pathogens CP, cytoplasmic domain; CTLD, C-type lectin-like domain; DAPI, 4Ј,6-diamidino- to appropriate intracellular compartments (e.g., human DEC-205/ 2-phenylindole; DC, dendritic cell; DCL-1, DEC-205-associated C-type lectin 1; DC- SIGN, DC-specific ICAM-3 grabbing nonintegrin; EGFP, enhanced GFP; GAM, goat CD205, denoted hDEC-205 hereafter; Ref. 18); 4) signaling to Ј anti-mouse; IgG, F(ab )2; hDCL-1, human DCL-1; hDEC-205, human DEC-205; IP, initiate and regulate innate/adaptive immune responses (e.g., DC immunoprecipitation; Lin, lineage; LSM, laser scanning microscope/microscopy; immuno activating receptor (DCAR), DC immunoreceptor MGL, macrophage C-type galactose/N-acetyl galactosamine-specific lectin; MMR, macrophage mannose receptor; MoDC, monocyte-derived dendritic cell; Mph, mac- (DCIR), dectin-1, and blood DC Ag-2 (BDCA-2/CD303; Refs. rophage; PFA, paraformaldehyde; pI, isoelectric point; PLA2R, phospholipase A2 19–25); and 5) specific interactions with self ligands to mediate receptor; SP, signal peptide; WB, Western blot. cellular functions such as adhesion (e.g., DC-SIGN/CD209; Refs. Copyright © 2007 by The American Association of Immunologists, Inc. 0022-1767/07/$2.00 11 and 26). www.jimmunol.org The Journal of Immunology 6053 While cloning human DEC-205, we identified a cDNA encoding dysfunction of the vector-derived signal peptide (SP). We therefore ream- a novel type I transmembrane C-type lectin receptor, termed DCL- plified the 700-bp DNA encoding 3XFLAG-hDCL-1 using MK333 (cgg 1/CD302 (derived from the underlined letters of DEC-205-associ- gatccGACTACGAAGACCATGACGGT; the BamHI site is underlined) and MK203 with p3XFLAG-hDCL-1 as a template and cloned it into the ated C-type lectin-1 and denoted hereafter as DCL-1 or human pSecTag B vector (Invitrogen Life Technologies) to construct DCL-1 (hDCL-1)), as a genetic fusion partner of hDEC-205 in the pSec3XFLAG-hDCL-1. Hodgkin’s lymphoma cell lines (i.e., L428, HDLM2, and KM-H2; The pSec3XFLAG-hDCL-1-Ig expression vector was constructed by Refs. 27 and 28). The hDCL-1 gene was localized directly ϳ5 kbp PCR amplifying the 650-bp fragment encoding the 3XFLAG-hDCL-1 ex- tracellular domain using a T7 primer and MK211 (cgaattcacttacctgt downstream of the hDEC-205 gene, and these cell lines produced ATATTTCCTTTTGTATGGGATAGCT; the EcoRI site underlined and a a 9.5-kb hDEC-205/hDCL-1 fusion mRNA by cotranscription and splice donor site is italicized) and pSec3XFLAG-hDCL-1 as a template and intergenic splicing and translated it into a hDEC-205/hDCL-1 fu- cloned the fragment at the blunted HindIII and EcoRI site of the sion protein in situ (28). We also identified a hDCL-1 4.2-kb pcDNA3-Fc vector, which was constructed by cloning a 1.4-kb HindIII- mRNA in human myeloid-like cell lines (e.g., HEL, HL60, U937, NotI fragment (containing human IgG1 Fc) from the pIG-1 vector (30) into the pcDNA3 vector (Invitrogen Life Technologies). and Mono Mac 6) but not in T and B lymphocyte cell lines (28), To construct the pEGFP-hDCL-1 expression vector (EGFP is enhanced suggesting that the hDCl-1 protein was expressed independently. GFP), we first constructed a pSecMyc-hDCL-1 expression vector by sub- The predicted cytoplasmic sequence of DCL-1 implied that it cloning the 700-bp BamHI-EcoRI fragment from the pSec3XFLAG- might have endocytic activity.
Load more

Recommended publications
  • Human and Mouse CD Marker Handbook Human and Mouse CD Marker Key Markers - Human Key Markers - Mouse
    Welcome to More Choice CD Marker Handbook For more information, please visit: Human bdbiosciences.com/eu/go/humancdmarkers Mouse bdbiosciences.com/eu/go/mousecdmarkers Human and Mouse CD Marker Handbook Human and Mouse CD Marker Key Markers - Human Key Markers - Mouse CD3 CD3 CD (cluster of differentiation) molecules are cell surface markers T Cell CD4 CD4 useful for the identification and characterization of leukocytes. The CD CD8 CD8 nomenclature was developed and is maintained through the HLDA (Human Leukocyte Differentiation Antigens) workshop started in 1982. CD45R/B220 CD19 CD19 The goal is to provide standardization of monoclonal antibodies to B Cell CD20 CD22 (B cell activation marker) human antigens across laboratories. To characterize or “workshop” the antibodies, multiple laboratories carry out blind analyses of antibodies. These results independently validate antibody specificity. CD11c CD11c Dendritic Cell CD123 CD123 While the CD nomenclature has been developed for use with human antigens, it is applied to corresponding mouse antigens as well as antigens from other species. However, the mouse and other species NK Cell CD56 CD335 (NKp46) antibodies are not tested by HLDA. Human CD markers were reviewed by the HLDA. New CD markers Stem Cell/ CD34 CD34 were established at the HLDA9 meeting held in Barcelona in 2010. For Precursor hematopoetic stem cell only hematopoetic stem cell only additional information and CD markers please visit www.hcdm.org. Macrophage/ CD14 CD11b/ Mac-1 Monocyte CD33 Ly-71 (F4/80) CD66b Granulocyte CD66b Gr-1/Ly6G Ly6C CD41 CD41 CD61 (Integrin b3) CD61 Platelet CD9 CD62 CD62P (activated platelets) CD235a CD235a Erythrocyte Ter-119 CD146 MECA-32 CD106 CD146 Endothelial Cell CD31 CD62E (activated endothelial cells) Epithelial Cell CD236 CD326 (EPCAM1) For Research Use Only.
    [Show full text]
  • Flow Reagents Single Color Antibodies CD Chart
    CD CHART CD N° Alternative Name CD N° Alternative Name CD N° Alternative Name Beckman Coulter Clone Beckman Coulter Clone Beckman Coulter Clone T Cells B Cells Granulocytes NK Cells Macrophages/Monocytes Platelets Erythrocytes Stem Cells Dendritic Cells Endothelial Cells Epithelial Cells T Cells B Cells Granulocytes NK Cells Macrophages/Monocytes Platelets Erythrocytes Stem Cells Dendritic Cells Endothelial Cells Epithelial Cells T Cells B Cells Granulocytes NK Cells Macrophages/Monocytes Platelets Erythrocytes Stem Cells Dendritic Cells Endothelial Cells Epithelial Cells CD1a T6, R4, HTA1 Act p n n p n n S l CD99 MIC2 gene product, E2 p p p CD223 LAG-3 (Lymphocyte activation gene 3) Act n Act p n CD1b R1 Act p n n p n n S CD99R restricted CD99 p p CD224 GGT (γ-glutamyl transferase) p p p p p p CD1c R7, M241 Act S n n p n n S l CD100 SEMA4D (semaphorin 4D) p Low p p p n n CD225 Leu13, interferon induced transmembrane protein 1 (IFITM1). p p p p p CD1d R3 Act S n n Low n n S Intest CD101 V7, P126 Act n p n p n n p CD226 DNAM-1, PTA-1 Act n Act Act Act n p n CD1e R2 n n n n S CD102 ICAM-2 (intercellular adhesion molecule-2) p p n p Folli p CD227 MUC1, mucin 1, episialin, PUM, PEM, EMA, DF3, H23 Act p CD2 T11; Tp50; sheep red blood cell (SRBC) receptor; LFA-2 p S n p n n l CD103 HML-1 (human mucosal lymphocytes antigen 1), integrin aE chain S n n n n n n n l CD228 Melanotransferrin (MT), p97 p p CD3 T3, CD3 complex p n n n n n n n n n l CD104 integrin b4 chain; TSP-1180 n n n n n n n p p CD229 Ly9, T-lymphocyte surface antigen p p n p n
    [Show full text]
  • Mouse CD302/CLEC13A Antibody Antigen Affinity-Purified Polyclonal Sheep Igg Catalog Number: AF6424
    Mouse CD302/CLEC13A Antibody Antigen Affinity-purified Polyclonal Sheep IgG Catalog Number: AF6424 DESCRIPTION Species Reactivity Mouse Specificity Detects mouse CD302/CLEC13A in direct ELISAs and Western blots. In direct ELISAs, approximately 30% cross­reactivity with recombinant human CD302 is observed. Source Polyclonal Sheep IgG Purification Antigen Affinity­purified Immunogen Mouse myeloma cell line NS0­derived recombinant mouse CD302/CLEC13A Asp21­His165 Accession # Q9DCG2 Formulation Lyophilized from a 0.2 μm filtered solution in PBS with Trehalose. See Certificate of Analysis for details. *Small pack size (­SP) is supplied either lyophilized or as a 0.2 μm filtered solution in PBS. APPLICATIONS Please Note: Optimal dilutions should be determined by each laboratory for each application. General Protocols are available in the Technical Information section on our website. Recommended Sample Concentration Western Blot 1 µg/mL See Below DATA Western Blot Detection of Mouse CD302/CLEC13A by Western Blot. Western blot shows lysates of mouse spleen tissue. PVDF Membrane was probed with 1 µg/mL of Mouse CD302/CLEC13A Antigen Affinity­purified Polyclonal Antibody (Catalog # AF6424) followed by HRP­conjugated Anti­Sheep IgG Secondary Antibody (Catalog # HAF016). A specific band was detected for CD302/CLEC13A at approximately 32 kDa (as indicated). This experiment was conducted under reducing conditions and using Immunoblot Buffer Group 8. PREPARATION AND STORAGE Reconstitution Sterile PBS to a final concentration of 0.2 mg/mL. Shipping The product is shipped at ambient temperature. Upon receipt, store it immediately at the temperature recommended below. *Small pack size (­SP) is shipped with polar packs. Upon receipt, store it immediately at ­20 to ­70 °C Stability & Storage Use a manual defrost freezer and avoid repeated freeze­thaw cycles.
    [Show full text]
  • Human Lectins, Their Carbohydrate Affinities and Where to Find Them
    biomolecules Review Human Lectins, Their Carbohydrate Affinities and Where to Review HumanFind Them Lectins, Their Carbohydrate Affinities and Where to FindCláudia ThemD. Raposo 1,*, André B. Canelas 2 and M. Teresa Barros 1 1, 2 1 Cláudia D. Raposo * , Andr1 é LAQVB. Canelas‐Requimte,and Department M. Teresa of Chemistry, Barros NOVA School of Science and Technology, Universidade NOVA de Lisboa, 2829‐516 Caparica, Portugal; [email protected] 12 GlanbiaLAQV-Requimte,‐AgriChemWhey, Department Lisheen of Chemistry, Mine, Killoran, NOVA Moyne, School E41 of ScienceR622 Co. and Tipperary, Technology, Ireland; canelas‐ [email protected] NOVA de Lisboa, 2829-516 Caparica, Portugal; [email protected] 2* Correspondence:Glanbia-AgriChemWhey, [email protected]; Lisheen Mine, Tel.: Killoran, +351‐212948550 Moyne, E41 R622 Tipperary, Ireland; [email protected] * Correspondence: [email protected]; Tel.: +351-212948550 Abstract: Lectins are a class of proteins responsible for several biological roles such as cell‐cell in‐ Abstract:teractions,Lectins signaling are pathways, a class of and proteins several responsible innate immune for several responses biological against roles pathogens. such as Since cell-cell lec‐ interactions,tins are able signalingto bind to pathways, carbohydrates, and several they can innate be a immuneviable target responses for targeted against drug pathogens. delivery Since sys‐ lectinstems. In are fact, able several to bind lectins to carbohydrates, were approved they by canFood be and a viable Drug targetAdministration for targeted for drugthat purpose. delivery systems.Information In fact, about several specific lectins carbohydrate were approved recognition by Food by andlectin Drug receptors Administration was gathered for that herein, purpose. plus Informationthe specific organs about specific where those carbohydrate lectins can recognition be found by within lectin the receptors human was body.
    [Show full text]
  • Multiomics of Azacitidine-Treated AML Cells Reveals Variable And
    Multiomics of azacitidine-treated AML cells reveals variable and convergent targets that remodel the cell-surface proteome Kevin K. Leunga, Aaron Nguyenb, Tao Shic, Lin Tangc, Xiaochun Nid, Laure Escoubetc, Kyle J. MacBethb, Jorge DiMartinob, and James A. Wellsa,1 aDepartment of Pharmaceutical Chemistry, University of California, San Francisco, CA 94143; bEpigenetics Thematic Center of Excellence, Celgene Corporation, San Francisco, CA 94158; cDepartment of Informatics and Predictive Sciences, Celgene Corporation, San Diego, CA 92121; and dDepartment of Informatics and Predictive Sciences, Celgene Corporation, Cambridge, MA 02140 Contributed by James A. Wells, November 19, 2018 (sent for review August 23, 2018; reviewed by Rebekah Gundry, Neil L. Kelleher, and Bernd Wollscheid) Myelodysplastic syndromes (MDS) and acute myeloid leukemia of DNA methyltransferases, leading to loss of methylation in (AML) are diseases of abnormal hematopoietic differentiation newly synthesized DNA (10, 11). It was recently shown that AZA with aberrant epigenetic alterations. Azacitidine (AZA) is a DNA treatment of cervical (12, 13) and colorectal (14) cancer cells methyltransferase inhibitor widely used to treat MDS and AML, can induce interferon responses through reactivation of endoge- yet the impact of AZA on the cell-surface proteome has not been nous retroviruses. This phenomenon, termed viral mimicry, is defined. To identify potential therapeutic targets for use in com- thought to induce antitumor effects by activating and engaging bination with AZA in AML patients, we investigated the effects the immune system. of AZA treatment on four AML cell lines representing different Although AZA treatment has demonstrated clinical benefit in stages of differentiation. The effect of AZA treatment on these AML patients, additional therapeutic options are needed (8, 9).
    [Show full text]
  • CD24, CD27, CD36 and CD302 Gene Expression for Outcome Prediction in Patients with Multiple Myeloma
    www.impactjournals.com/oncotarget/ Oncotarget, 2017, Vol. 8, (No. 58), pp: 98931-98944 Research Paper CD24, CD27, CD36 and CD302 gene expression for outcome prediction in patients with multiple myeloma Elina Alaterre6,2, Sebastien Raimbault6, Hartmut Goldschmidt4,5, Salahedine Bouhya7, Guilhem Requirand1,2, Nicolas Robert1,2, Stéphanie Boireau1,2, Anja Seckinger4,5, Dirk Hose4,5, Bernard Klein1,2,3 and Jérôme Moreaux1,2,3 1Department of Biological Haematology, CHU Montpellier, Montpellier, France 2Institute of Human Genetics, CNRS-UM UMR9002, Montpellier, France 3University of Montpellier, UFR Medecine, Montpellier, France 4Medizinische Klinik und Poliklinik V, Universitätsklinikum Heidelberg, Heidelberg, Germany 5Nationales Centrum für Tumorerkrankungen, Heidelberg, Germany 6HORIBA Medical, Parc Euromédecine, Montpellier, France 7CHU Montpellier, Department of Clinical Hematology, Montpellier, France Correspondence to: Jérôme Moreaux, email: [email protected] Keywords: multiple myeloma; prognostic factor; gene expression profiling; cluster differentiation Received: February 10, 2017 Accepted: August 27, 2017 Published: October 30, 2017 Copyright: Alaterre et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License 3.0 (CC BY 3.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. ABSTRACT Multiple myeloma (MM) is a B cell neoplasia characterized by clonal plasma cell (PC) proliferation. Minimal residual disease monitoring by multi-parameter flow cytometry is a powerful tool for predicting treatment efficacy and MM outcome. In this study, we compared CD antigens expression between normal and malignant plasma cells to identify new potential markers to discriminate normal from malignant plasma cells, new potential therapeutic targets for monoclonal-based treatments and new prognostic factors.
    [Show full text]
  • Human CD Marker Chart Reviewed by HLDA1 Bdbiosciences.Com/Cdmarkers
    BD Biosciences Human CD Marker Chart Reviewed by HLDA1 bdbiosciences.com/cdmarkers 23-12399-01 CD Alternative Name Ligands & Associated Molecules T Cell B Cell Dendritic Cell NK Cell Stem Cell/Precursor Macrophage/Monocyte Granulocyte Platelet Erythrocyte Endothelial Cell Epithelial Cell CD Alternative Name Ligands & Associated Molecules T Cell B Cell Dendritic Cell NK Cell Stem Cell/Precursor Macrophage/Monocyte Granulocyte Platelet Erythrocyte Endothelial Cell Epithelial Cell CD Alternative Name Ligands & Associated Molecules T Cell B Cell Dendritic Cell NK Cell Stem Cell/Precursor Macrophage/Monocyte Granulocyte Platelet Erythrocyte Endothelial Cell Epithelial Cell CD1a R4, T6, Leu6, HTA1 b-2-Microglobulin, CD74 + + + – + – – – CD93 C1QR1,C1qRP, MXRA4, C1qR(P), Dj737e23.1, GR11 – – – – – + + – – + – CD220 Insulin receptor (INSR), IR Insulin, IGF-2 + + + + + + + + + Insulin-like growth factor 1 receptor (IGF1R), IGF-1R, type I IGF receptor (IGF-IR), CD1b R1, T6m Leu6 b-2-Microglobulin + + + – + – – – CD94 KLRD1, Kp43 HLA class I, NKG2-A, p39 + – + – – – – – – CD221 Insulin-like growth factor 1 (IGF-I), IGF-II, Insulin JTK13 + + + + + + + + + CD1c M241, R7, T6, Leu6, BDCA1 b-2-Microglobulin + + + – + – – – CD178, FASLG, APO-1, FAS, TNFRSF6, CD95L, APT1LG1, APT1, FAS1, FASTM, CD95 CD178 (Fas ligand) + + + + + – – IGF-II, TGF-b latency-associated peptide (LAP), Proliferin, Prorenin, Plasminogen, ALPS1A, TNFSF6, FASL Cation-independent mannose-6-phosphate receptor (M6P-R, CIM6PR, CIMPR, CI- CD1d R3G1, R3 b-2-Microglobulin, MHC II CD222 Leukemia
    [Show full text]
  • Engineered Type 1 Regulatory T Cells Designed for Clinical Use Kill Primary
    ARTICLE Acute Myeloid Leukemia Engineered type 1 regulatory T cells designed Ferrata Storti Foundation for clinical use kill primary pediatric acute myeloid leukemia cells Brandon Cieniewicz,1* Molly Javier Uyeda,1,2* Ping (Pauline) Chen,1 Ece Canan Sayitoglu,1 Jeffrey Mao-Hwa Liu,1 Grazia Andolfi,3 Katharine Greenthal,1 Alice Bertaina,1,4 Silvia Gregori,3 Rosa Bacchetta,1,4 Norman James Lacayo,1 Alma-Martina Cepika1,4# and Maria Grazia Roncarolo1,2,4# Haematologica 2021 Volume 106(10):2588-2597 1Department of Pediatrics, Division of Stem Cell Transplantation and Regenerative Medicine, Stanford School of Medicine, Stanford, CA, USA; 2Stanford Institute for Stem Cell Biology and Regenerative Medicine, Stanford School of Medicine, Stanford, CA, USA; 3San Raffaele Telethon Institute for Gene Therapy, Milan, Italy and 4Center for Definitive and Curative Medicine, Stanford School of Medicine, Stanford, CA, USA *BC and MJU contributed equally as co-first authors #AMC and MGR contributed equally as co-senior authors ABSTRACT ype 1 regulatory (Tr1) T cells induced by enforced expression of interleukin-10 (LV-10) are being developed as a novel treatment for Tchemotherapy-resistant myeloid leukemias. In vivo, LV-10 cells do not cause graft-versus-host disease while mediating graft-versus-leukemia effect against adult acute myeloid leukemia (AML). Since pediatric AML (pAML) and adult AML are different on a genetic and epigenetic level, we investigate herein whether LV-10 cells also efficiently kill pAML cells. We show that the majority of primary pAML are killed by LV-10 cells, with different levels of sensitivity to killing. Transcriptionally, pAML sensitive to LV-10 killing expressed a myeloid maturation signature.
    [Show full text]
  • Engagement of the Mannose Receptor by Tumoral Mucins Activates an Immune Suppressive Phenotype in Human Tumor-Associated Macrophages
    Hindawi Publishing Corporation Clinical and Developmental Immunology Volume 2010, Article ID 547179, 10 pages doi:10.1155/2010/547179 Research Article Engagement of the Mannose Receptor by Tumoral Mucins Activates an Immune Suppressive Phenotype in Human Tumor-Associated Macrophages P.Allavena,1 M. Chieppa,2, 3 G. Bianchi,4 G. Solinas,1, 5 M. Fabbri,6 G. Laskarin,7 and A. Mantovani1, 8 1 Deptartment Immunology & Inflammation, IRCCS Clinical Institute Humanitas, Rozzano, 20089 Milan, Italy 2 Department of Translational Medicine, National Institute of Gastroenterology IRCCS “Saverio de Bellis”, Castellana Grotte, 70013 Bari, Italy 3 Advanced Research Centre for Health (ARCHES), Enviroment and Space, Castellana Grotte, 70013 Bari, Italy 4 Environmental Health Sciences Department, Mario Negri Institute, 20157 Milano, Italy 5 Cardiovascular Research Institute, University of California, San Francisco, CA 94158, USA 6 European Commission, Joint Research Centre Institute for Health and Consumer Protection Molecular Biology and Genomics, 21020 (VA) Ispra, Italy 7 Department of Physiology and Immunology, University of Rijeka, 51000 Rijeka, Croatia 8 Department of Translational Medicine, University of Milan, 20121 Milan, Italy Correspondence should be addressed to P. Allavena, [email protected] Received 2 August 2010; Revised 18 October 2010; Accepted 21 December 2010 Academic Editor: Nima Rezaei Copyright © 2010 P. Allavena et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Tumor-Associated Macrophages (TAMs) are abundantly present in the stroma of solid tumors and modulate several important biological processes, such as neoangiogenesis, cancer cell proliferation and invasion, and suppression of adaptive immune responses.
    [Show full text]
  • Effects of Dietary NEXT ENHANCE150.Pdf
    Accepted Manuscript Effects of dietary NEXT ENHANCE ®150 on growth performance and expression of immune and intestinal integrity related genes in gilthead sea bream (Sparus aurata L.) Jaume Pérez-Sánchez, Laura Benedito-Palos, Itziar Estensoro, Yiannis Petropoulos, Josep Alvar Calduch-Giner, Craig L. Browdy, Dr. Ariadna Sitjà-Bobadilla PII: S1050-4648(15)00057-1 DOI: 10.1016/j.fsi.2015.01.039 Reference: YFSIM 3318 To appear in: Fish and Shellfish Immunology Received Date: 31 October 2014 Revised Date: 30 January 2015 Accepted Date: 30 January 2015 Please cite this article as: Pérez-Sánchez J, Benedito-Palos L, Estensoro I, Petropoulos Y, Calduch- Giner JA, Browdy CL, Sitjà-Bobadilla A, Effects of dietary NEXT ENHANCE ®150 on growth performance and expression of immune and intestinal integrity related genes in gilthead sea bream (Sparus aurata L.), Fish and Shellfish Immunology (2015), doi: 10.1016/j.fsi.2015.01.039. This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain. ACCEPTED MANUSCRIPT 1 Effects of dietary NEXT ENHANCE ®150 on growth performance and expression of 2 immune and intestinal integrity related genes in gilthead sea bream ( Sparus aurata 3 L.). 4 5 Jaume Pérez-Sánchez 1, Laura Benedito-Palos 1, Itziar Estensoro 2, Yiannis Petropoulos 3, 6 Josep Alvar Calduch-Giner 1, Craig L.
    [Show full text]
  • Mouse CD Marker Chart Bdbiosciences.Com/Cdmarkers
    BD Mouse CD Marker Chart bdbiosciences.com/cdmarkers 23-12400-01 CD Alternative Name Ligands & Associated Molecules T Cell B Cell Dendritic Cell NK Cell Stem Cell/Precursor Macrophage/Monocyte Granulocyte Platelet Erythrocyte Endothelial Cell Epithelial Cell CD Alternative Name Ligands & Associated Molecules T Cell B Cell Dendritic Cell NK Cell Stem Cell/Precursor Macrophage/Monocyte Granulocyte Platelet Erythrocyte Endothelial Cell Epithelial Cell CD Alternative Name Ligands & Associated Molecules T Cell B Cell Dendritic Cell NK Cell Stem Cell/Precursor Macrophage/Monocyte Granulocyte Platelet Erythrocyte Endothelial Cell Epithelial Cell CD1d CD1.1, CD1.2, Ly-38 Lipid, Glycolipid Ag + + + + + + + + CD104 Integrin b4 Laminin, Plectin + DNAX accessory molecule 1 (DNAM-1), Platelet and T cell CD226 activation antigen 1 (PTA-1), T lineage-specific activation antigen 1 CD112, CD155, LFA-1 + + + + + – + – – CD2 LFA-2, Ly-37, Ly37 CD48, CD58, CD59, CD15 + + + + + CD105 Endoglin TGF-b + + antigen (TLiSA1) Mucin 1 (MUC1, MUC-1), DF3 antigen, H23 antigen, PUM, PEM, CD227 CD54, CD169, Selectins; Grb2, β-Catenin, GSK-3β CD3g CD3g, CD3 g chain, T3g TCR complex + CD106 VCAM-1 VLA-4 + + EMA, Tumor-associated mucin, Episialin + + + + + + Melanotransferrin (MT, MTF1), p97 Melanoma antigen CD3d CD3d, CD3 d chain, T3d TCR complex + CD107a LAMP-1 Collagen, Laminin, Fibronectin + + + CD228 Iron, Plasminogen, pro-UPA (p97, MAP97), Mfi2, gp95 + + CD3e CD3e, CD3 e chain, CD3, T3e TCR complex + + CD107b LAMP-2, LGP-96, LAMP-B + + Lymphocyte antigen 9 (Ly9),
    [Show full text]
  • An Online Prognostic Biomarker Analysis Tool for Low-Grade Glioma
    ORIGINAL RESEARCH published: 07 July 2020 doi: 10.3389/fonc.2020.01097 OSlgg: An Online Prognostic Biomarker Analysis Tool for Low-Grade Glioma Yang An 1†, Qiang Wang 1†, Lu Zhang 1, Fengjie Sun 1, Guosen Zhang 1, Huan Dong 1, Yingkun Li 1, Yanyu Peng 1, Haojie Li 1, Wan Zhu 2, Shaoping Ji 1, Yunlong Wang 3* and Xiangqian Guo 1* 1 Department of Predictive Medicine, Institute of Biomedical Informatics, Cell Signal Transduction Laboratory, Bioinformatics Center, Henan Provincial Engineering Center for Tumor Molecular Medicine, Kaifeng Key Laboratory of Cell Signal Transduction, School of Basic Medical Sciences, School of Software, Henan University, Kaifeng, China, 2 Department of Edited by: Anesthesia, Stanford University, Stanford, CA, United States, 3 Henan Bioengineering Research Center, Zhengzhou, China Maciej Harat, Franciszek Lukaszczyk Oncology Centre, Poland Glioma is the most frequent primary brain tumor that causes high mortality and morbidity Reviewed by: with poor prognosis. There are four grades of gliomas, I to IV, among which grade II Vidyasiri Vemulapalli, Dana–Farber Cancer Institute, and III are low-grade glioma (LGG). Although less aggressive, LGG almost universally United States progresses to high-grade glioma and eventual causes death if lacking of intervention. Maria Caffo, Current LGG treatment mainly depends on surgical resection followed by radiotherapy University of Messina, Italy and chemotherapy, but the survival rates of LGG patients are low. Therefore, it is *Correspondence: Yunlong Wang necessary to use prognostic biomarkers to classify patients into subgroups with different [email protected] risks and guide clinical managements. Using gene expression profiling and long-term Xiangqian Guo [email protected] follow-up data, we established an Online consensus Survival analysis tool for LGG named OSlgg.
    [Show full text]