DOCSLIB.ORG

PHYLOGENY of Glyphodes Guenee (Lepidoptera: Crambidae

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
PHYLOGENY of Glyphodes Guenee (Lepidoptera: Crambidae Treubia 2003 33 (1) 35-42 PHYLOGENY OF Glyphodes Guenee (Lepidoptera: Crambidae: Spilomelinae) BASEDON NUCLEOTIDE SEQUENCE VARIATION IN A MITOCHONDRIAL CO I GENE: CONGRUENCE WITH MORPHOLOGICAL DATA Hari Sutrisno Division of Zoology, Research Center for Biology, Indonesian Institute of Sciences, JI. Raya Bogor Km. 46, Cibinong, 16911 Indonesia E-mail: [email protected] Abstract The phylogeny of Glyphodes Cuenee (14 species) and [our outgroup species (Feltia jaculifera, Metallarcha aureodiscalis, Talanga sexpunctalis and Agrioghrypta eurytusalis) was inferred from nucleotide sequence variation across a 686-bp region in the CO I gene. Over the entire 686-bp region, 19.9% sites were informative (3.35% in the 1"-, 0.29% in the 2''''- alld 16.32% in 3"'-codon position). The results also showed that the base composition of this region was high A+T biased (C= 0.258) and the averages of estimated sequence divergence in the comparisons between species within and between groups were 7.1% and 9.0%, respectively. In general, the phylogeny based 011 CO Igene by including all substitutions or any partial data set used in this study was not only able to recover almost the three monophyletic groups within Glyphodes as previously recovered by morphological phylogeny but also showed more clearly the relationships among them: Glyphodes group 2 was branched off first then followed by group 3 and 1. Key words: CO I, Gbjphodes, morphology, phylogeny. Introduction The Glyphodes Cuenee, 1854, is medium-sized moth (15-51 mm) belongs to the subfamily Spilomelinae (Common, 1990; Shaffer et al., 1996). This genus is diverse and widespread in tropical regions with some species penetrating into subtropical and warm temperate areas (Common, 1990;Robinson et al., 1994).The genus consists of 120 species throughout the world, and about 25 and 17 species have been recorded in the Southeast Asia and Australia, respectively (Robinson et al., 1994; Shaffer et al., 1996). As other pyraloids in the Indo-Australian regions, this genus is also poorly defined and has been suggested that it is seriously in need of revision since the current generic classification of this genus was based on superficial similarities only (Robinson et al., 1994;Sutrisno & Horak, 2003). However, the comprehensive study on the taxonomy or phylogeny to assess the monophyly and the relationships among them has never been conducted except for a cladistic analysis based on the Australian Glyphodes and its allied genera using morphological data (Sutrisno, 2002). The cladistic analysis showed that the genus Glyphodes falls into three monophyletic groups (Glyphodes group I, 2 and 3); each of them can be diagnosed by the adult morphology. In general, the result showed that morphological characters used 36 Sutrisno: Phylogeny of Glyphodes Guenee (Lepidoptera: Crambidae: Spilomelinae) in the previous study were able to infer the phylogenetic relationships of this genus. However, the evolutionary change of morphological characters in this genus is extremely complicated that this approach did not produce a clear-cut picture of evolutionary history; i.e., for the relationships among groups within Glyphodes. In addition, the relationships among closely-related species within Glyphodes group 3 seem very difficult to be resolved. Therefore, another possible approach such as molecular phylogeny that has been proved to give more powerful resolution is really needed. Mitochondrial genes have been used intensively to infer the phylogenetic relationships among groups of insects as have been repeatedly reported by numerous authors (reviewed in Simon et al., 1994). CO I gene is one of the most common to be considered infering the relationships among closely-related species in several groups of Lepidoptera, as individual gene or to be combined with other genes (Andrew, 1994; Sperling & Hickey, 1994; Caterino & Sperling, 1999; Landry et al., 1999; and Blum et al., 2003). Therefore, in this issue I used mitochondrial CO I gene to reassess the monophyly of Glyphodes and to estimate the relationships among species within this genus. Material and Methods DNA extraction and Sequencing A total of 17 species representing the four genera (Glyphodes, Talanga, Agrioglypta and Metal/archa) from various localities in Indonesia and Australia were collected using a light trap and preserved in absolute alcohol (Table 1). The DNA extraction method and the PCR amplification conditions used in this study were similar with the procedures described in my previous study (Sutrisno, 2003). I used Mt 0-4 and Mt 0-9 primers to amplify CO I gene for a total of 686-bp and the complete sequences were Mt 0-4: 5'- TACAATTTATCGCCTAAACT TCAG CC-3', and Mt 0-9: 5'-CCCGGTAAAATT AAAATATAAACTTC-3' (http://www.biotech.ubc.ca/services/naps/primers.html). Sequencing was performed using an AB!PRISMDye Terminator Cycle Sequencing Ready Reaction Kit (Perkin-Elmer) on AB! PRISM model 310 Genetic Analyzer (PE Applied Biosystems). Phylogenetic Analysis For the phylogenetic analysis, I used Maximum-Parsimony method using an exhaustive search with different data sets: all substitutions; transversions only; weighting scheme 2:1; ntl + nt3; and nt3 only and Neighbor Joining method using K80 model (Kimura, 1980) in PAUP 4.0b4a (Swofford, 2001); and Bootstrap test (Felsenstein, 1985) to evaluate the statistical confidence of the MP and NJ trees. Four species, Agrioglypta eurytusalis (Walker), Talanga sexpunctalis Moore, Metallarcha aureodiscalis Meyrick and Feltia jaculifera Meyrick (Noctuidae) were included as outgroup taxa in the present analysis. The sequence of CO I-CO II of the last species is available from the gene bank with the accession number U60990. Treubia 2003 33 (1) 37 Table 1. Species examined for the molecular study Species Collection locality Date of Collection Agrioglypta eurytusalis (Walker) G. Pangrango, Java September 2000 Glyphodes G. actorionalis (Walker) Sorong, Papua February, 2002 G. apiospila (Turner) Sorong, Papua February, 2002 G. bicolor (Swainson) Sorong, Papua February, 2002 G. bivitralis Cuenee Patunuang, Sulawesi April, 2001 G. caesalis (Walker) Menado, Sulawesi March,2001 G. conjuncialis Walker Sorong, Papua February, 2002 G. cosrnarcha Meyrick Patunuang, Sulawesi April,2001 G. doleschalii Lederer Sorong,Papua January, 2002 G. jlauizonalis Hampson Sorong, Papua January, 2002 G. margaritaria (CIerck) Patunuang, Sulawesi April, 2001 G. multilinealis Kenrick Bantimurung, Sulawesi April, 2001 G. onychinalis Cuenee Bucasia, Queensland April, 2001 G. puioerulentalis Hampson Sukabumi, Java February, 2002 G. stolalis Cuenee G. Halimun NP, Java March,2002 Metallarcha aureodiscalis Meyrick Bucasia, Queensland April,2001 Talanga sexpuncialis Moore Patunuang, Sulawesi April, 2001 Table 2. Percent variable sites across 14species of Glyphodes and four outgroup species Total lst-codon 2nd-codon 3rtl-codon Constant (%) 67.9 27.25 31.77 8.89 Uninformative (%) 12.1 2.76 1.31 8.01 Informative (%) 19.9 3.35 0.29 16.32 Number of sites 686 229 229 228 Results Base compositions Sequences of 14 species of the Glyphodes, and four species outgroup were aligned with no evidence of insertion and deletion (aligned sequences are available from the author on request). Over the entire 686-bp region, 67.9 % of the nucleotide positions were constant, 12.1 % were uninformative (i.e., any variants were found in single sequence), and 19.9% were informative (Table2). In addition, the most informative 38 Sutrisno: Phylogeny of G/yphodes Guenee (Lepidoptera: Crambidae: Spilomelinae) sites for maximum parsimony analysis lied in the third-codon positions and the least informative site was in the second-codon positions. Table 3 shows the proportion of nucleic acids and bias in CO I. The results showed that the base compositions were strongly biased (C= 0.258) with the A+T proportions ranged from 69.82% to 72.01%. Interspecific variations in base compositions CO I were very low for a total of nucleotides (the Chi-square test, X2= 10.684, df= 51, P=1.00). In addition, the averages of estimated sequence divergence in the comparisons between species within and between groups were 7.1%and 9.0%, respectively. Table 3. Proportion of each nucleotide and bias in CO I Codon position l'l-codon 2nd-codon 3rd-codon Mean A 0.316 0.170 0.485 0.324 C 0.139 0.249 0.042 0.142 G 0.264 0.169 0.097 0.175 T 0.279 0.410 0.462 0.384 Bias 0.258 Bias in base composition is calculated as 4 C = (X)2J, - 0251 /::1 Where C is the composition bias and ci is the frequency of its base. Phylogenetic analyses An exhaustive search in maximum-parsimony analysis using all nucleotides substitutions resulted in two equally MP trees (Fig.l). The MP trees showed that the three groups within the Glyphodes as previously recognized in the morphological study (Sutrisno, 2002) were recovered. However, the relationships among species within Glyphodes group 2 were less-resolved: G. onychinalis was evolved independently. When the weighting scheme 2:1,or transversional substitutions only or the combination between 1"_and 3rd-codon (nt1+nt3) or 3rd-codon (nt3) only were included in the analysis, the relationships among five species of Glyphodes group 2 was also poorly-resolved, except for the relationships between G.flavizonalis and G. apiospila (Figs. 2-5). The descriptive tree statistics for parsimony analyses are presented in Table 4. The NJ tree based on all substitutions revealed that each group was found to be monophyletic (Fig. 6) and the relationships among them were well-resolved: Glyphodes group 2 was branched off first then followed by group 3 and 1. In addition, the relationships among the three species of Glyphodes group 3 were also well-resolved in both MP and NJ analyses: G. doleschalii lied in the basal group, G. actorionalis was the sister group of G. bivitralis. Treubia 2003 33 (1) 39 F.jaculifera Fjaculifera M. aureodiscalis M. aureodiscalis 5 A eurytusalis 58 A eurutusalis T sexpunctalis T sexpunclalis 100 50 Gflavizonalis ] 55 Gflavizonalis ] G apiospila ~ 3 G apiospila ~ I--------G onychinalis .g ,-------+--G conjunctalis -ii 1-----------1iG conjunctalis 2 G bicolor 20 G bicolor 19f--------G onychinalis 51 G caesalis ] G.
Load more

Recommended publications
  • 1 1 DNA Barcodes Reveal Deeply Neglected Diversity and Numerous
    Page 1 of 57 1 DNA barcodes reveal deeply neglected diversity and numerous invasions of micromoths in 2 Madagascar 3 4 5 Carlos Lopez-Vaamonde1,2, Lucas Sire2, Bruno Rasmussen2, Rodolphe Rougerie3, 6 Christian Wieser4, Allaoui Ahamadi Allaoui 5, Joël Minet3, Jeremy R. deWaard6, Thibaud 7 Decaëns7, David C. Lees8 8 9 1 INRA, UR633, Zoologie Forestière, F- 45075 Orléans, France. 10 2 Institut de Recherche sur la Biologie de l’Insecte, UMR 7261 CNRS Université de Tours, UFR 11 Sciences et Techniques, Tours, France. 12 3Institut de Systématique Evolution Biodiversité (ISYEB), Muséum national d'Histoire naturelle, 13 CNRS, Sorbonne Université, EPHE, 57 rue Cuvier, CP 50, 75005 Paris, France. 14 4 Landesmuseum für Kärnten, Abteilung Zoologie, Museumgasse 2, 9020 Klagenfurt, Austria 15 5 Department of Entomology, University of Antananarivo, Antananarivo 101, Madagascar 16 6 Centre for Biodiversity Genomics, University of Guelph, 50 Stone Road E., Guelph, ON 17 N1G2W1, Canada 18 7Centre d'Ecologie Fonctionnelle et Evolutive (CEFE UMR 5175, CNRS–Université de Genome Downloaded from www.nrcresearchpress.com by UNIV GUELPH on 10/03/18 19 Montpellier–Université Paul-Valéry Montpellier–EPHE), 1919 Route de Mende, F-34293 20 Montpellier, France. 21 8Department of Life Sciences, Natural History Museum, Cromwell Road, SW7 5BD, UK. 22 23 24 Email for correspondence: [email protected] For personal use only. This Just-IN manuscript is the accepted prior to copy editing and page composition. It may differ from final official version of record. 1 Page 2 of 57 25 26 Abstract 27 Madagascar is a prime evolutionary hotspot globally, but its unique biodiversity is under threat, 28 essentially from anthropogenic disturbance.
    [Show full text]
  • DNA Barcodes Reveal Deeply Neglected Diversity and Numerous Invasions of Micromoths in Madagascar
    Genome DNA barcodes reveal deeply neglected diversity and numerous invasions of micromoths in Madagascar Journal: Genome Manuscript ID gen-2018-0065.R2 Manuscript Type: Article Date Submitted by the 17-Jul-2018 Author: Complete List of Authors: Lopez-Vaamonde, Carlos; Institut National de la Recherche Agronomique (INRA), ; Institut de Recherche sur la Biologie de l’Insecte (IRBI), Sire, Lucas; Institut de Recherche sur la Biologie de l’Insecte Rasmussen,Draft Bruno; Institut de Recherche sur la Biologie de l’Insecte Rougerie, Rodolphe; Institut Systématique, Evolution, Biodiversité (ISYEB), Wieser, Christian; Landesmuseum für Kärnten Ahamadi, Allaoui; University of Antananarivo, Department Entomology Minet, Joël; Institut de Systematique Evolution Biodiversite deWaard, Jeremy; Biodiversity Institute of Ontario, University of Guelph, Decaëns, Thibaud; Centre d'Ecologie Fonctionnelle et Evolutive (CEFE UMR 5175, CNRS–Université de Montpellier–Université Paul-Valéry Montpellier–EPHE), , CEFE UMR 5175 CNRS Lees, David; Natural History Museum London Keyword: Africa, invasive alien species, Lepidoptera, Malaise trap, plant pests Is the invited manuscript for consideration in a Special 7th International Barcode of Life Issue? : https://mc06.manuscriptcentral.com/genome-pubs Page 1 of 57 Genome 1 DNA barcodes reveal deeply neglected diversity and numerous invasions of micromoths in 2 Madagascar 3 4 5 Carlos Lopez-Vaamonde1,2, Lucas Sire2, Bruno Rasmussen2, Rodolphe Rougerie3, 6 Christian Wieser4, Allaoui Ahamadi Allaoui 5, Joël Minet3, Jeremy R. deWaard6, Thibaud 7 Decaëns7, David C. Lees8 8 9 1 INRA, UR633, Zoologie Forestière, F- 45075 Orléans, France. 10 2 Institut de Recherche sur la Biologie de l’Insecte, UMR 7261 CNRS Université de Tours, UFR 11 Sciences et Techniques, Tours, France.
    [Show full text]
  • Fung Yuen SSSI & Butterfly Reserve Moth Survey 2009
    Fung Yuen SSSI & Butterfly Reserve Moth Survey 2009 Fauna Conservation Department Kadoorie Farm & Botanic Garden 29 June 2010 Kadoorie Farm and Botanic Garden Publication Series: No 6 Fung Yuen SSSI & Butterfly Reserve moth survey 2009 Fung Yuen SSSI & Butterfly Reserve Moth Survey 2009 Executive Summary The objective of this survey was to generate a moth species list for the Butterfly Reserve and Site of Special Scientific Interest [SSSI] at Fung Yuen, Tai Po, Hong Kong. The survey came about following a request from Tai Po Environmental Association. Recording, using ultraviolet light sources and live traps in four sub-sites, took place on the evenings of 24 April and 16 October 2009. In total, 825 moths representing 352 species were recorded. Of the species recorded, 3 meet IUCN Red List criteria for threatened species in one of the three main categories “Critically Endangered” (one species), “Endangered” (one species) and “Vulnerable” (one species” and a further 13 species meet “Near Threatened” criteria. Twelve of the species recorded are currently only known from Hong Kong, all are within one of the four IUCN threatened or near threatened categories listed. Seven species are recorded from Hong Kong for the first time. The moth assemblages recorded are typical of human disturbed forest, feng shui woods and orchards, with a relatively low Geometridae component, and includes a small number of species normally associated with agriculture and open habitats that were found in the SSSI site. Comparisons showed that each sub-site had a substantially different assemblage of species, thus the site as a whole should retain the mosaic of micro-habitats in order to maintain the high moth species richness observed.
    [Show full text]
  • Download Download
    Agr. Nat. Resour. 54 (2020) 499–506 AGRICULTURE AND NATURAL RESOURCES Journal homepage: http://anres.kasetsart.org Research article Checklist of the Tribe Spilomelini (Lepidoptera: Crambidae: Pyraustinae) in Thailand Sunadda Chaovalita,†, Nantasak Pinkaewb,†,* a Department of Entomology, Faculty of Agriculture, Kasetsart University, Bangkok 10900, Thailand b Department of Entomology, Faculty of Agriculture at Kamphaengsaen, Kasetsart University, Kamphaengsaen Campus, Nakhon Pathom 73140, Thailand Article Info Abstract Article history: In total, 100 species in 40 genera of the tribe Spilomelini were confirmed to occur in Thailand Received 5 July 2019 based on the specimens preserved in Thailand and Japan. Of these, 47 species were new records Revised 25 July 2019 Accepted 15 August 2019 for Thailand. Conogethes tenuialata Chaovalit and Yoshiyasu, 2019 was the latest new recorded Available online 30 October 2020 species from Thailand. This information will contribute to an ongoing program to develop a pest database and subsequently to a facilitate pest management scheme in Thailand. Keywords: Crambidae, Pyraustinae, Spilomelini, Thailand, pest Introduction The tribe Spilomelini is one of the major pests in tropical and subtropical regions. Moths in this tribe have been considered as The tribe Spilomelini Guenée (1854) is one of the largest tribes and the major pests of economic crops such as rice, sugarcane, bean belongs to the subfamily Pyraustinae, family Crambidae; it consists of pods and corn (Khan et al., 1988; Hill, 2007), durian (Kuroko 55 genera and 5,929 species worldwide with approximately 86 genera and Lewvanich, 1993), citrus, peach and macadamia, (Common, and 220 species of Spilomelini being reported in North America 1990), mulberry (Sharifi et.
    [Show full text]
  • Bitki Koruma Bülteni / Plant Protection Bulletin, 2020, 60 (3) : 39-45
    Bitki Koruma Bülteni / Plant Protection Bulletin, 2020, 60 (3) : 39-45 Bitki Koruma Bülteni / Plant Protection Bulletin http://dergipark.gov.tr/bitkorb Original article A pest that could be posing a threat to mulberry production of Turkey: Glyphodes pyloalis (Walker, 1859) (Lepidoptera: Crambidae) Türkiye dut üretimini tehdit edebilecek bir zararlı: Glyphodes pyloalis (Walker, 1859) (Lepidoptera: Crambidae) Gürsel ÇETİNa* Pınar HEPHIZLI GÖKSELa Mustafa ÖZDEMİRb Yılmaz BOZa a*Directorate of Ataturk Central Horticultural Research Institute, Süleyman Bey Mah., Yalı Cad., 77100 Yalova, Turkey bPlant Protection Central Research Institute, Gayret Mah. Fatih Sultan Mehmet Bulv. 06172 Yenimahalle, Ankara, Turkey ARTICLE INFO ABSTRACT Article history: Mulberry, Morus spp. (Moraceae) is naturally cultivated in Turkey, and no DOI: 10.16955/bitkorb.669491 chemical input used during the production process. Hitherto, major and common Received : 02.01.2020 species of insect and acari caused the economic yield and quality losses in the Accepted : 28.05.2020 mulberry production have not been recorded. On the other hand, lesser mulberry snout moth, Glyphodes pyloalis (Walker, 1859) (Lepidoptera: Crambidae), Keywords: considered being one of the most important pests of mulberry around the world Lesser mulberry snout moth, Glyphodes pyloalis, Morus spp., was detected in the province of Yalova in the last week of August in 2018 for the Crambidae, Lepidoptera first time. Larvae of this pest caused serious damage to leaves of white mulberry (Morus alba L., 1753), black mulberry (Morus nigra L., 1753), and weeping white * Corresponding author: Gürsel ÇETİN mulberry (Morus alba cv. ‘Pendula’) (Urticales: Moraceae) whereas it has newly [email protected] just occurred.
    [Show full text]
  • The Lepidoptera Rapa Island
    J. F. GATES CLA, The Lepidoptera Rapa Island SMITHSONIAN CONTRIBUTIONS TO ZOOLOGY • 1971 NUMBER 56 .-24 f O si % r 17401 •% -390O i 112100) 0 is -•^ i BLAKE*w 1PLATEALP I5 i I >k =(M&2l2Jo SMITHSONIAN CONTRIBUTIONS TO ZOOLOGY NUMBER 56 j. F. Gates Clarke The Lepidoptera of Rapa Island SMITHSONIAN INSTITUTION PRESS CITY OF WASHINGTON 1971 SERIAL PUBLICATIONS OF THE SMITHSONIAN INSTITUTION The emphasis upon publications as a means of diffusing knowledge was expressed by the first Secretary of the Smithsonian Institution. In his formal plan for the Insti- tution, Joseph Henry articulated a program that included the following statement: "It is proposed to publish a series of reports, giving an account of the new discoveries in science, and of the changes made from year to year in all branches of knowledge not strictly professional." This keynote of basic research has been adhered to over the years in the issuance of thousands of titles in serial publications under the Smithsonian imprint, commencing with Smithsonian Contributions to Knowledge in 1848 and continuing with the following active series: Smithsonian Annals of Flight Smithsonian Contributions to Anthropology Smithsonian Contributions to Astrophysics Smithsonian Contributions to Botany Smithsonian Contributions to the Earth Sciences Smithsonian Contributions to Paleobiology Smithsonian Contributions to Zoology Smithsonian Studies in History and Technology In these series, the Institution publishes original articles and monographs dealing with the research and collections of its several museums and offices and of professional colleagues at other institutions of learning. These papers report newly acquired facts, synoptic interpretations of data, or original theory in specialized fields.
    [Show full text]
  • PACIFIC INSECTS MONOGRAPH Ll
    PACIFIC INSECTS MONOGRAPH ll Lepidoptera of American Samoa with particular reference to biology and ecology By John Adams Comstock Published by Entomology Department, Bernice P. Bishop Museum Honolulu, Hawaii, U. S. A. 1966 PACIFIC INSECTS MONOGRAPHS Published by Entomology Department, Bernice P. Bishop Museum, Honolulu, Hawaii, 96819, U. S. A. Editorial Committee: J. L. Gressitt, Editor (Honolulu), S. Asahina (Tokyo), R. G. Fennah (London), R. A. Harrison (Christchurch), T. C. Maa (Honolulu & Taipei), C. W. Sabrosky (Washington, D. C), R. L. Usinger (Berkeley), J. van der Vecht (Leiden), K. Yasumatsu (Fukuoka), E. C. Zimmerman (New Hampshire). Assistant Editors: P. D. Ashlock (Honolulu), Carol Higa (Honolulu), Naoko Kunimori (Fukuoka), Setsuko Nakata (Honolulu), Toshi Takata (Fukuoka). Business Manager: C. M. Yoshimoto (Honolulu). Business Assistant: Doris Anbe (Honolulu). Business Agent in Japan: K. Yasumatsu (Fukuoka). Entomological staff, Bishop Museum, 1966: Doris Anbe, Hatsuko Arakaki, P. D. Ashlock, S. Azuma, Madaline Boyes, Candida Cardenas, Ann Cutting, M. L. Goff, J. L. Gressitt (Chairman), J. Harrell, Carol Higa, Y. Hirashima, Shirley Hokama, E. Holzapfel, Dorothy Hoxie, Helen Hurd, June Ibara, Naoko Kuni­ mori, T. C. Maa, Grace Nakahashi, Setsuko Nakata (Adm. Asst.), Tulene Nonomura, Carol Okuma, Ka­ tharine Pigue, Linda Reineccius, T. Saigusa, I. Sakakibara, Judy Sakamoto, G. A. Samuelson, Sybil Seto, W. A. Steffan, Amy Suehiro, Grace Thompson, Clara Uchida, J. R. Vockeroth, Nixon Wilson, Mabel Ya- tsuoka, C. M. Yoshimoto, E. C. Zimmermann. Field associates: M. J. Fitzsimons, E. E. Gless, G. E. Lip- pert, V. Peckham, D. S. Rabor, J. Sedlacek, M. Sedlacek, P. Shanahan, R. Straatman, J. Strong, H. M. Tor- revillas, A.
    [Show full text]
  • CV Dr Jalali Sendi
    Curriculum Vitae Dr. Jalal Jalali Sendi Professor Department of Plant Protection, Faculty of Agricultural Sciences, University of Guilan, Rasht, Iran. E mail: [email protected] Tel. Office: +981333690817 Cell phone: +989113309574 Personal Link: https://staff.guilan.ac.ir/jalali/index.php?a=0&lg=1 Researcher ID : C-5364-2017 Author ID : 38561500900 Orc ID: 0000-0002-4917-1068 Educational Qualifications: B.S.(1982) M.S.(1985) Ph.D.(1991)- specialized in Insect Physiology Banaras Hindu University, Uttar Pradesh, India Research Grants: 1) Botanical pesticides from indigenous plants of Guilan Province against insect pests of economic importance University of Guilan, Reseach Office Grant 1385 2) Establishment of a new cell line from hemocyte of rose sawfly Arge rosae (Hym Argidae) and investigation on the responses to pathogenic factors by these cells Iranian National Science Foundation (INSF) Grant No. 911003789 3) Effect of essential Oil and extract formulation of Sweetworm wood Artemisia annua L. on larvae and a cell line of lesser mulberry snout moth, Glyphodes pyloalis Walker Iranian National Science Foundation (INSF) Grant No. 98004512 Publications Book Chapter 1. Artemisia annua - Pharmacology and Biotechnology Chapter 13. Recent Developments in Controlling Insect, Acari, Nematode, and Plant Pathogens of Agricultural and Medical Importance by Artemisia annua L. (Asteraceae) Spriger pp 229-247 2. Recent Progress in Medicinal Plants Chapter 5. Biological Activities of Essential oils on Insects Research Articles: (From 1990 – 2020) ٢. 3. Srivastava,K.P.,Katyar,R.L.,Tiwari,R.K.,Tiwari,J.N. and J.Jalali.1990.Effects of a juvenoid on the morphogenesis of the female reproductive organs in Dysdercus koenigii Fabr.(Hemiptera).Proceedings of the Indian National Science Academy Part- B (Biological Sciences) .
    [Show full text]
  • Phylogeny and Nomenclature of the Box Tree Moth, Cydalima Perspectalis (Walker, 1859) Comb
    Eur. J. Entomol. 107: 393–400, 2010 http://www.eje.cz/scripts/viewabstract.php?abstract=1550 ISSN 1210-5759 (print), 1802-8829 (online) Phylogeny and nomenclature of the box tree moth, Cydalima perspectalis (Walker, 1859) comb. n., which was recently introduced into Europe (Lepidoptera: Pyraloidea: Crambidae: Spilomelinae) RICHARD MALLY and MATTHIAS NUSS Museum of Zoology, Koenigsbruecker Landstrasse 159, 01109 Dresden, Germany; e-mails: [email protected]; [email protected] Key words. Crambidae, Spilomelinae, box tree moth, generic placement, Diaphania, Glyphodes, Neoglyphodes, Palpita, Cydalima perspectalis, new combination, taxonomy, phylogeny, morphology, nomenclature Abstract. The box tree moth, Cydalima perspectalis (Walker, 1859) comb. n., is native to India, China, Korea, Japan and the Rus- sian Far East. Its larvae are a serious pest of different species of Buxus. Recently, C. perspectalis was introduced into Europe and first recorded from Germany in 2006. This species has been placed in various spilomeline genera including Palpita Hübner, 1808, Diaphania Hübner, 1818, Glyphodes Guenée, 1854 and the monotypic Neoglyphodes Streltzov, 2008. In order to solve this nomen- clatural confusion and to find a reasonable and verifiable generic placement for the box tree moth, the morphology of the above mentioned and some additional spilomeline taxa was investigated and their phylogeny analysed. The results show that C. perspec- talis belongs to a monophylum that includes three of the genera in which it was previously placed: Glyphodes, Diaphania and Pal- pita. Within this monophylum, it is closely related to the Asian Cydalima Lederer, 1863. As a result of this analysis, Sisyrophora Lederer, 1863 syn. rev. and Neoglyphodes Streltzov, 2008 syn.
    [Show full text]
  • DNA Barcodes Reveal Deeply Neglected
    DNA barcodes reveal deeply neglected diversity and numerous invasions of micromoths in Madagascar Carlos Lopez-Vaamonde, Lucas Sire, Bruno Rasmussen, Rodolphe Rougerie, Christian Wieser, Allaoui Ahamadi Allaoui, Joël Minet, Jeremy Dewaard, Thibaud Decaëns, David Lees To cite this version: Carlos Lopez-Vaamonde, Lucas Sire, Bruno Rasmussen, Rodolphe Rougerie, Christian Wieser, et al.. DNA barcodes reveal deeply neglected diversity and numerous invasions of micromoths in Madagascar. Genome, NRC Research Press, 2019, 62 (3), pp.108-121. 10.1139/gen-2018-0065. hal-02613924 HAL Id: hal-02613924 https://hal.archives-ouvertes.fr/hal-02613924 Submitted on 20 May 2020 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. Pagination not final (cite DOI) / Pagination provisoire (citer le DOI) 1 ARTICLE DNA barcodes reveal deeply neglected diversity and numerous invasions of micromoths in Madagascar1 Carlos Lopez-Vaamonde, Lucas Sire, Bruno Rasmussen, Rodolphe Rougerie, Christian Wieser, Allaoui Ahamadi Allaoui, Joël Minet, Jeremy R. deWaard, Thibaud Decaëns, and David C. Lees Abstract: Madagascar is a prime evolutionary hotspot globally, but its unique biodiversity is under threat, essentially from anthropogenic disturbance. There is a race against time to describe and protect the Madagascan endangered biota.
    [Show full text]
  • Lepidoptera: Pyraloidea: Crambidae) Inferred from DNA and Morphology 141-204 77 (1): 141 – 204 2019
    ZOBODAT - www.zobodat.at Zoologisch-Botanische Datenbank/Zoological-Botanical Database Digitale Literatur/Digital Literature Zeitschrift/Journal: Arthropod Systematics and Phylogeny Jahr/Year: 2019 Band/Volume: 77 Autor(en)/Author(s): Mally Richard, Hayden James E., Neinhuis Christoph, Jordal Bjarte H., Nuss Matthias Artikel/Article: The phylogenetic systematics of Spilomelinae and Pyraustinae (Lepidoptera: Pyraloidea: Crambidae) inferred from DNA and morphology 141-204 77 (1): 141 – 204 2019 © Senckenberg Gesellschaft für Naturforschung, 2019. The phylogenetic systematics of Spilomelinae and Pyraustinae (Lepidoptera: Pyraloidea: Crambidae) inferred from DNA and morphology Richard Mally *, 1, James E. Hayden 2, Christoph Neinhuis 3, Bjarte H. Jordal 1 & Matthias Nuss 4 1 University Museum of Bergen, Natural History Collections, Realfagbygget, Allégaten 41, 5007 Bergen, Norway; Richard Mally [richard. [email protected], [email protected]], Bjarte H. Jordal [[email protected]] — 2 Florida Department of Agriculture and Consumer Ser- vices, Division of Plant Industry, 1911 SW 34th Street, Gainesville, FL 32608 USA; James E. Hayden [[email protected]] — 3 Technische Universität Dresden, Institut für Botanik, 01062 Dresden, Germany; Christoph Neinhuis [[email protected]] — 4 Senckenberg Naturhistorische Sammlungen Dresden, Museum für Tierkunde, Königsbrücker Landstraße 159, 01109 Dresden, Germany; Matthias Nuss [[email protected]] — * Corresponding author Accepted on March 14, 2019. Published online at www.senckenberg.de/arthropod-systematics on May 17, 2019. Published in print on June 03, 2019. Editors in charge: Brian Wiegmann & Klaus-Dieter Klass. Abstract. Spilomelinae and Pyraustinae form a species-rich monophylum of Crambidae (snout moths). Morphological distinction of the two groups has been diffcult in the past, and the morphologically heterogenous Spilomelinae has not been broadly accepted as a natural group due to the lack of convincing apomorphies.
    [Show full text]
  • Moths at Kadoorie Farm 1994-2004
    Fauna Department Kadoorie Farm and Botanic Garden Lam Kam Road Tai Po, N.T. Phone 24886192 Hong Kong Fax 24831877 Fauna Conservation Department Project Report Monday, 30th May 2004 Project Area: Conservation (Species & Habitats); Wildlife Monitoring Project title: Moth Survey Code: FAU206 Coordinator: R.C. Kendrick Ph.D. Report period: 1994 to March 2004 Fauna Department Kadoorie Farm and Botanic Garden Lam Kam Road Tai Po, N.T. Phone 24886192 Hong Kong Fax 24831877 Summary Moth Survey Report 1994 to March 2004 at Kadoorie Farm & Botanic Garden Tai Po, Hong Kong. by R.C. Kendrick Ph.D. Report No. KFBG-FAU206/1 May 2004 Project Area: Conservation (Species & Habitats); Wildlife Monitoring Project title: Moth Survey Coordinator: Roger Kendrick Ph.D 1 CODE: FAU 206 Date commenced: February 2001 1 P/T Senior Conservation Officer, Fauna Conservation Department, Kadoorie Farm & Botanic Garden Corporation KFBG Moth Report 1994-2004 R.C.Kendrick, Fauna Conservation Contents 1 ABSTRACT 3 2 INTRODUCTION 4 3 OBJECTIVES 4 4 METHODS 5 4.1 SPECIES RICHNESS & DIVERSITY AT KFBG 5 4.2 SPECIES OF CONSERVATION IMPORTANCE 5 5 RESULTS 6 5.1 SPECIES RICHNESS & DIVERSITY AT KFBG 8 5.2 SPECIES OF CONSERVATION IMPORTANCE 12 6 DISCUSSION 18 7 CONCLUSIONS 19 8 REFERENCES 19 9 APPENDIX 21 9.1 SPECIES LIST 21 9.2 RAW DATA 28 1 ABSTRACT A brief history of moth recording at Kadoorie Farm & Botanic Garden is presented. Data from light trapping between 1994 and March 2004 is given. KFBG was found to have a high diversity and high species richness of moths.
    [Show full text]