DOCSLIB.ORG

The Eukaryotic Host Factor That Activates Exoenzyme S of Pseudomonas Aeruginosa Is a Member of the 14-3-3 Protein Family

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
The Eukaryotic Host Factor That Activates Exoenzyme S of Pseudomonas Aeruginosa Is a Member of the 14-3-3 Protein Family Proc. Natl. Acad. Sci. USA Vol. 90, pp. 2320-2324, March 1993 Biochemistry The eukaryotic host factor that activates exoenzyme S of Pseudomonas aeruginosa is a member of the 14-3-3 protein family HAIAN Fu*, JENIFER COBURNt, AND R. JOHN COLLIER*t *Department of Microbiology and Molecular Genetics, and Shipley Institute of Medicine, Harvard Medical School, 200 Longwood Avenue, Boston, MA 02115; and tDivision of Rheumatology, New England Medical Center, 750 Washington Street, Boston, MA 02111 Contributed by R. John Collier, December 21, 1992 ABSTRACT Exoenzyme S (ExoS), which has been impli- heat-labile toxin are stimulated by several orders of magni- cated as a virulence factor of Pseudomonas aeruginosa, cata- tude by a 21-kDa eukaryotic GTP-binding protein, termed lyzes transfer of the ADP-ribose moiety of NADI to many ADP-ribosylation factor (ARF; refs. 7 and 8). ARFs appear eukaryotic cellular proteins. Its preferred substrates include to be abundant and ubiquitous and represent a subfamily of Ras and several other 21- to 25-kDa GTP-binding proteins. the highly conserved GTP-binding proteins of the Ras super- ExoS absolutely requires a ubiquitous eukaryotic protein family. Evidence is accumulating that ARF is associated with factor, termed FAS (factor activating ExoS), for enzymatic Golgi membranes and may be directly involved in the regu- activity. Here we describe the cloning and expression of a gene lation of vesicle trafficking (9). It has also been reported that encoding FAS from a bovine brain cDNA library and demon- the ADP-ribosyltransferase activity of exoenzyme C3, se- strate that purified recombinant FAS produced in Escherichia creted from Clostridium botulinum, is enhanced by a bovine coli activates ExoS in a defined cell-free system. The deduced brain cytosolic protein (10), but this activator protein has not amino acid sequence of FAS shows that the protein (245 been well characterized. residues, calculated molecular mass 27,743 Da) belongs to a Like ARF, FAS is abundant and widely distributed highly conserved, widely distributed eukaryotic protein family, throughout the eukaryotes. To determine the molecular iden- collectively designated as 14-3-3 proteins. Various functions tity and structural characteristics of FAS, we undertook the have been reported for members ofthe 14-3-3 family, including molecular cloning, expression, and characterization of its phospholipase A2 activitY and regulation of tyrosine hydroxy- gene from a bovine brain cDNA library.§ Our purified lase, tryptophan hydroxylase, and, possibly, protein kinase C recombinant FAS protein was as active as that purified from activities. Identification of FAS as a 14-3-3 protein establishes bovine testes in a defined assay system for ADP-ribosylation an additional function for this family of proteins-the activa- by ExoS. Sequence homology comparisons have revealed tion of an exogenous ADP-ribosyltransferase. Elucidation of that FAS is a member of the multifunctional 14-3-3 protein the precise role of FAS in activating ExoS will contribute to family. understanding the molecular mechanisms by which P. aeru- ginosa causes disease. MATERIALS AND METHODS Exoenzyme S (ExoS) is a mono-ADP-ribosyltransferase se- Strains, Plasmids, and General Methods. E. coli strain creted by the opportunistic pathogen Pseudomonas aerugin- XL1-Blue (Stratagene) was used for the propagation of osa (1, 2). This enzyme has been associated with the estab- plasmids, and E. coli BL21(DE3) was used for expression of lishment of infection and with tissue damage, although its proteins using bacteriophage T7 promoter-based overexpres- precise role in pathogenesis has not been elucidated. In vitro, sion vectors (11). Plasmid pET-15b was used as a parent ExoS catalyzes the transfer of the ADP-ribose moiety of expression vector (Novagen, Madison, WI). Restriction- NADI to many eukaryotic cellular proteins, but its preferred enzyme mapping, subcloning, Southern hybridization, and substrates are a subset of the small GTP-binding proteins of gel electrophoresis procedures were done essentially as de- 21-25 kDa, including the products of the c-Ha-ras, ral, scribed (12) or as indicated. raplA, rab3, and rab4 genes (3, 4). These small GTP-binding Preparation of FAS-Specific Probe. To obtain amino acid proteins are thought to function as central components of the sequence information, proteins in the partially purified FAS signaling pathways regulating intracellular vesicle transport, preparation were separated by SDS/11.25% PAGE and cell proliferation, and differentiation (5). ADP-ribosylation of transferred to a nitrocellulose membrane (13). After brief the small GTP-binding proteins by ExoS is not known to alter staining with Ponceau S and washing with 1% acetic acid, the their nucleotide interactions but may affect their interactions putative FAS protein band was excised for peptide sequenc- with other cellular proteins (3). ing. Because the N terminus of FAS is blocked (data not A eukaryotic cellular factor was found to be absolutely shown), three internal peptide sequences were obtained after required for ADP-ribosylation ofRas and all other substrates in situ trypsin digestion and separation by reverse-phase The FAS HPLC (Harvard MicroChem Facility). These peptide se- by ExoS in vitro (6). factor, designated (factor quences are underlined in Fig. 1. For PCR amplification of activating ExoS), appeared to have a monomeric molecular based on mass of -29 kDa and an isoelectric point of4.3-4.5. Activity FAS DNA, two degenerate primers were designed was detected in all eukaryotic cells and tissues tested, but the peptide sequences (5' primer: 5'-CAAGAATTCGAGC- activity was absent from bacterial species. ITTYCTNATHCCNAAYGCNTC-3'; 3' primer: 5'-TC- The requirement of a eukaryotic protein cofactor for ADP- AAGC TTCTGCAGCYTCRTCRAANGCNGT-3'). The un- ribosyltransferase activity has also been found for certain derlined sequences indicate the restriction sites introduced, other bacterial toxins. The intrinsically low ADP-ribosyl- transferase activities of cholera toxin and Escherichia coli Abbreviations: ExoS, exoenzyme S; FAS, factor activating ExoS; PLA2, phospholipase A2; SBTI, soybean trypsin inhibitor; ARF, ADP-ribosylation factor. The publication costs of this article were defrayed in part by page charge 1To whom reprint requests should be addressed. payment. This article must therefore be hereby marked "advertisement" §The sequence reported in this paper has been deposited in the in accordance with 18 U.S.C. §1734 solely to indicate this fact. GenBank data base (accession no. L07955). 2320 Downloaded by guest on September 28, 2021 Biochemistry: Fu et al. Proc. Natl. Acad. Sci. USA 90 (1993) 2321 5 '... TGCTGAGCCCCGTCCGTCCGCCG CCACCTACTCCGGACACAGAACATCCAGTC ATGGATAAAAACGAGCTGGTACAGAAGGCC AAACTGGCCGAGCAGGCTGAGCGATATGAT GACATGGCAGCCTGCATGAAGTCTGTAACT GAGCAAGGAGCTGAATTATCCAATGAGGAG MetAspLysAsnGluLeuValGlnLysAla LysIluAlaGluOlnAlaGluArg?yrAsp AspMstAlaAlaCysXetLysSerValThr GluGlnGlyAlaGluL.uSerAsnOluGlu 10 20 30 40 AGGAATCTTCTCTCAGTTGCTTATAAAAAT GTTGTAGGAGCCCGTAGGTCATCTTGGAGG GTCGTCTCCAGTATTGAGCAAAAGACGGAA GGTGCTGAGAAAAAACAGCAGATGGCTCGA ArgAnL.uLau8rValklaTyrLyuAan ValValGlyAlaArg&rgSerSer?rpArg ValValSerBerIlQluGlnyaThrGlu GlyAlaGluLysLysGlnGlnMetAlaArg 50 60 70 80 PCR-5'primer - GAATACAGAGAGAAAATAGAGACCGAGCTA AGAGATATCTGCAATGATGTACTGTCTCTT TTGGAAAAGTTCTTGATCCCCAACGCTTCA CAAGCAGAGAGCAAAGTCTTCTATTTGAAA GluTyrArgGluLysIleOluThrGluLou ArgAspIleCysAsnAspValLouSerLeu LeuGluLysV __ leProAs Pr GnAValPheTyrLeuLys 90 100 vpep 110 120 ATGAAAGGAGACTACTACCGCTACTTGGCT GAGGTTGCAGCTGGTGATGACAAGAAAGGG ATTGTGGACCAGTCACAGCAAGCATACCAA GAAGCTTTTGAAATCAGCAAAAAGGAAATG KgtLysGlyAspTyrTyrArglyrL.uAla GluValAlaAlaGlyAspAspLysLysGlv TleV snGInse n k vrGIn lhSerLvsLysGluMet 130 140 peV2 150 160 qlng primr_Ri PCR-3'primera CAACCAACACATCCTATCAGACTGGGTCTG GCCCTTAACTTCTCTGTGTTCTATTATGAG ATTCTGAACTCCCCTGAGAAAGCCTGCTCT CTTGCAAAGACAGCATTTGATGAAGCCATT GlnProThrHisProXllArgLeulyLeu AlaLeuAsnPheerValPh.Tyr?yrolu IleLeuhanSerProGluLysklaCysSer LouAlaLys aL 170 180 190 Vp.3 200 GCTGAACTGATACATTMGTGAAGAGTCA TACAAAGACAGCACGCTAATAATGCAGTTA CTGAGAGATAACTTGACATTGTGGACATCG GATACCCAAGGAGACGAAGCTGAAGCAGGA __ c_u*ZIaLzLxPA.p8erThrheuuleUstG1nL.u_ L.uArgAupAunL.uThrLouTrpThrSer AspThrGlnGlyAspGluAlaGluAlaGly 210 220 230 240 GAAGGAGGGGAAAATTAACCTGCCTTCCAA CTTI'TGTCTGCCTCATTCTAAAATTrACACAGTAGACCCCGGAA¶ITC... 3' GluGlyGlyGluAsnEND FIG. 1. Nucleotide sequence of the cDNA encoding bovine brain FAS and predicted primary structure of FAS. Amino acid residues are numbered. Three peptide sequences obtained from the tryptic digestion of native FAS (pepl, pep2, and pep3) are indicated by a single underline. Location of the PCR primers and a sequencing primer, Rl, are indicated by arrows. Amino acid residues identical among all known members of 14-3-3 family are in boldface type (see Fig. 5). The two residues of FAS that differ from that of the rat or sheep homologues are double underlined. EcoRI and Sac I for the 5' primer and HindIll and Pst I for partially purified from bovine testes, as described (6). The the 3' primer. recombinant FAS was purified by affinity chromatography cDNA was synthesized from bovine brain total RNA on a Ni2+-charged histidine-binding column (Novagen). (Clontech) using Moloney murine leukemia virus reverse Briefly, the cell lysate, prepared from E. coli BL21(DE3)/ transcriptase (GIBCO/BRL) and used as a template to am- pHAF612 by sonication, was cleared by centrifugation plify the FAS-specific fragment by PCR (Perkin-Elmer/
Load more

Recommended publications
  • An Unknown Oxidative Metabolism Substantially Contributes to Soil CO2
    EGU Journal Logos (RGB) Open Access Open Access Open Access Advances in Annales Nonlinear Processes Geosciences Geophysicae in Geophysics Open Access Open Access Natural Hazards Natural Hazards and Earth System and Earth System Sciences Sciences Discussions Open Access Open Access Atmospheric Atmospheric Chemistry Chemistry and Physics and Physics Discussions Open Access Open Access Atmospheric Atmospheric Measurement Measurement Techniques Techniques Discussions Open Access Biogeosciences, 10, 1155–1167, 2013 Open Access www.biogeosciences.net/10/1155/2013/ Biogeosciences doi:10.5194/bg-10-1155-2013 Biogeosciences Discussions © Author(s) 2013. CC Attribution 3.0 License. Open Access Open Access Climate Climate of the Past of the Past Discussions An unknown oxidative metabolism substantially contributes to soil Open Access Open Access Earth System CO2 emissions Earth System Dynamics 1,* 1,2 3 1 4 5 Dynamics1 3 V. Maire , G. Alvarez , J. Colombet , A. Comby , R. Despinasse , E. Dubreucq , M. Joly , A.-C. Lehours , Discussions V. Perrier5, T. Shahzad1,**, and S. Fontaine1 1INRA, UR 874 UREP, 63100 Clermont-Ferrand, France Open Access Open Access 2Clermont Universite,´ VetAgro Sup, 63000, Clermont-Ferrand, France Geoscientific Geoscientific 3University of Clermont Ferrand, UMR 6023 LMGE, 63177 Aubiere,` France Instrumentation Instrumentation 4INRA, UMR 1095 UBP, 63100 Clermont-Ferrand, France Methods and Methods and 5Montpellier SupAgro, UMR 1208 IATE, 34060 Montpellier, France *present address: Department of Biological Sciences, Macquarie
    [Show full text]
  • The Implications of Exoenzyme Activity on Microbial Carbon and Nitrogen Limitation in Soil: a Theoretical Model
    Soil Biology & Biochemistry 35 (2003) 549–563 www.elsevier.com/locate/soilbio The implications of exoenzyme activity on microbial carbon and nitrogen limitation in soil: a theoretical model Joshua P. Schimel*, Michael N. Weintraub Department of Ecology, Evolution, and Marine Biology, University of California, Santa Barbara, CA 93106, USA Received 17 May 2002; received in revised form 22 October 2002; accepted 8 November 2002 Abstract Traditional models of soil organic matter (SOM) decomposition are all based on first order kinetics in which the decomposition rate of a particular C pool is proportional to the size of the pool and a simple decomposition constant ðdC=dt ¼ kCÞ: In fact, SOM decomposition is catalyzed by extracellular enzymes that are produced by microorganisms. We built a simple theoretical model to explore the behavior of the decomposition–microbial growth system when the fundamental kinetic assumption is changed from first order kinetics to exoenzymes catalyzed decomposition ðdC=dt ¼ KC £ EnzymesÞ: An analysis of the enzyme kinetics showed that there must be some mechanism to produce a non-linear response of decomposition rates to enzyme concentration—the most likely is competition for enzyme binding on solid substrates as predicted by Langmuir adsorption isotherm theory. This non-linearity also induces C limitation, regardless of the potential supply of C. The linked C and N version of the model showed that actual polymer breakdown and microbial use of the released monomers can be disconnected, and that it requires relatively little N to maintain the maximal rate of decomposition, regardless of the microbial biomass’ ability to use the breakdown products.
    [Show full text]
  • Exoenzyme Activities As Indicators of Dissolved Organic Matter Composition in the Hyporheic Zone of a Floodplain River
    Exoenzyme activities as indicators of dissolved organic matter composition in the hyporheic zone of a floodplain river SUMMARY 1. We measured the hyporheic microbial exoenzyme activities in a floodplain river to determine whether dissolved organic matter (DOM) bioavailability varied with overlying riparian vegetation patch structure or position along flowpaths. 2. Particulate organic matter (POM), dissolved organic carbon (DOC), dissolved oxygen (DO), electrical conductivity and temperature were sampled from wells in a riparian terrace on the Queets River, Washington, U.S.A. on 25 March, 15 May, 20 July and 09 October 1999. Dissolved nitrate, ammonium and soluble reactive phosphorus were also collected on 20 July and 09 October 1999. Wells were characterised by their associated overlying vegetation: bare cobble/young alder, mid-aged alder (8-20 years) and old alder/old-growth conifer (25 to >100 years). POM was analysed for the ash-free dry mass and the activities of eight exoenzymes (x-glucosidase, B-glucosidase, B-N-acetylglucosa- minidase, xylosidase, phosphatase, leucine aminopeptidase, esterase and endopeptidase) using fluorogenic substrates. 3. Exoenzyme activities in the Queets River hyporheic zone indicated the presence of an active microbial community metabolising a diverse array of organic molecules. Individual exoenzyme activity (mean ± standard error) ranged from 0.507 ± 0.1547 to 22.8 ± 5.69 umol MUF (g AFDM)-l h-1, was highly variable among wells and varied seasonally, with the lowest rates occurring in March. Exoenzyme activities were weakly correlated with DO, DOC and inorganic nutrient concentrations. 4. Ratios of leucine aminopeptidase: B-glucosidase were low in March, May and October and high in July, potentially indicating a switch from polysaccharides to proteins as the dominant component of microbial metabolism.
    [Show full text]
  • The Implications of Exoenzyme Activity on C Flow and Microbial Carbon and Nitrogen Limitation in Soil
    2001-2006 Mission Kearney Foundation of Soil Science: Soil Carbon and California's Terrestrial Ecosystems Final Report: 2003318, 1/1/2004-12/31/2006 The Implications of Exoenzyme Activity on C Flow and Microbial Carbon and Nitrogen Limitation in Soil Joshua P. Schimel1, Shinichi Asao2, Allen Doyle3, Keri Holland4, Eric Seabloom5, Elizabeth Borer5 Summary It has become increasingly clear that extracellular enzymes regulate decomposition and C flow in the environment. However, the specific kinetics and mechanisms regulating enzyme activity and function have been poorly understood. This project took a novel theoretical framework and tested key predictions of that theory that described how C and N availability regulate enzymes and overall C flow. Objectives Exoenzymes mediate breakdown of soil organic matter, and therefore must be included in models of SOM breakdown. Exoenzyme production must be mediated by microbial community composition, and should not ensue unless the returns on production exceed the metabolic costs. High rates of diffusion (Ekschmitt et al. 2005) or high concentrations of cheaters (microbes not producing enzymes but taking up product) can limit rates of production because of low returns on investment (Allison 2005). In contrast, saturation of substrate on enzymes also inhibits production by lowering the return on investment (Schimel and Weintraub 2003). High returns on investment should favor producer community and, therefore, the functionality of enzymes in soils may in part structure microbial communities in soils. A significant portion of enzymes become stabilized in soils, and maintain some activity although kinetic parameters can change as enzymatic conformation is altered by sorption and clay-binding; the large degree of stabilized enzymes in soils may drive enzyme evolution for functionality in the stabilized state (Leprince and Quiquampoix 1996).
    [Show full text]
  • Cooperation and Cheating in Exoenzyme Production By
    Biotechnol. J. 2010, 5 DOI 10.1002/biot.200900303 www.biotechnology-journal.com Research Article Cooperation and cheating in microbial exoenzyme production – Theoretical analysis for biotechnological applications Stefan Schuster1, Jan-Ulrich Kreft2, Naama Brenner3, Frank Wessely1, Günter Theißen4, Eytan Ruppin5 and Anja Schroeter1 1 Department of Bioinformatics, School of Biology and Pharmaceutics, Friedrich Schiller University of Jena, Jena, Germany 2 Centre for Systems Biology, School of Biosciences, University of Birmingham, Birmingham, UK 3 Department of Chemical Engineering, Technion – Israel Institute of Technology, Technion City, Haifa, Israel 4 Department of Genetics, Friedrich Schiller University of Jena, Jena, Germany 5 School of Computer Sciences and School of Medicine, Tel Aviv University, Tel Aviv, Israel The engineering of microorganisms to produce a variety of extracellular enzymes (exoenzymes), for example for producing renewable fuels and in biodegradation of xenobiotics, has recently attracted increasing interest. Productivity is often reduced by “cheater” mutants, which are deficient in exo- Received 19 January 2010 enzyme production and benefit from the product provided by the “cooperating” cells. We present Revised 25 April 2010 a game-theoretical model to analyze population structure and exoenzyme productivity in terms of Accepted 28 April 2010 biotechnologically relevant parameters. For any given population density, three distinct regimes are predicted: when the metabolic effort for exoenzyme production and secretion is low, all cells coop- erate; at intermediate metabolic costs, cooperators and cheaters coexist; while at high costs, all cells use the cheating strategy. These regimes correspond to the harmony game, snowdrift game, and Prisoner’s Dilemma, respectively. Thus, our results indicate that microbial strains engineered for exoenzyme production will not, under appropriate conditions, be outcompeted by cheater mutants.
    [Show full text]
  • Digestive Enzyme Activities and Gastrointestinal Fermentation in Wood-Eating Catfishes
    UC Irvine UC Irvine Previously Published Works Title Digestive enzyme activities and gastrointestinal fermentation in wood-eating catfishes Permalink https://escholarship.org/uc/item/1p88v3g4 Journal Journal of Comparative Physiology B: Biochemical, Systems, and Environmental Physiology, 179(8) ISSN 1432-136X Authors German, Donovan P. Bittong, Rosalie A. Publication Date 2009-11-01 DOI 10.1007/s00360-009-0383-z Peer reviewed eScholarship.org Powered by the California Digital Library University of California J Comp Physiol B (2009) 179:1025–1042 DOI 10.1007/s00360-009-0383-z ORIGINAL PAPER Digestive enzyme activities and gastrointestinal fermentation in wood-eating catWshes Donovan P. German · Rosalie A. Bittong Received: 27 March 2009 / Revised: 11 June 2009 / Accepted: 16 June 2009 / Published online: 1 July 2009 © The Author(s) 2009. This article is published with open access at Springerlink.com Abstract To determine what capabilities wood-eating and -glucosidase and N-acetyl--D-glucosaminidase enzymes W W detritivorous cat shes have for the digestion of refractory were signi cantly lower than the Km values of microbial polysaccharides with the aid of an endosymbiotic microbial enzymes ingested with their food, further suggesting that the community, the pH, redox potentials, concentrations of Wsh eYciently digest soluble components of their detrital diet short-chain fatty acids (SCFAs), and the activity levels of 14 rather than refractory polysaccharides. Coupled with rapid digestive enzymes were measured along the gastrointestinal gut transit and poor cellulose digestibility, the wood-eating (GI) tracts of three wood-eating taxa (Panaque cf. nigroline- catWshes appear to be detritivores reliant on endogenous atus “Marañon”, Panaque nocturnus, and Hypostomus pyrin- digestive mechanisms, as are other loricariid catWshes.
    [Show full text]
  • Exoenzyme T Plays a Pivotal Role in the IFN- Production After
    Exoenzyme T Plays a Pivotal Role in the IFN-γ Production after Pseudomonas Challenge in IL-12 Primed Natural Killer Cells Mickael Vourc’h, Antoine Roquilly, Alexis Broquet, Gaëlle David, Philippe Hulin, Cédric Jacqueline, Jocelyne Caillon, Christelle Retiere, Karim Asehnoune To cite this version: Mickael Vourc’h, Antoine Roquilly, Alexis Broquet, Gaëlle David, Philippe Hulin, et al.. Exoenzyme T Plays a Pivotal Role in the IFN-γ Production after Pseudomonas Challenge in IL-12 Primed Natural Killer Cells. Frontiers in Immunology, Frontiers, 2017, 8, pp.1283 - 1283. 10.3389/fimmu.2017.01283. inserm-01813287 HAL Id: inserm-01813287 https://www.hal.inserm.fr/inserm-01813287 Submitted on 12 Jun 2018 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. ORIGINAL RESEARCH published: 10 October 2017 doi: 10.3389/fimmu.2017.01283 Exoenzyme T Plays a Pivotal Role in the IFN-γ Production after Pseudomonas Challenge in IL-12 Primed Natural Killer Cells Mickael Vourc’h1,2†, Antoine Roquilly1,2†, Alexis Broquet1, Gaelle David3,4, Philippe Hulin5, Cedric Jacqueline1,
    [Show full text]
  • Food Enzymes
    C R C Critical Reviews in Food Technology ISSN: 0007-9006 (Print) (Online) Journal homepage: http://www.tandfonline.com/loi/bfsn18 Food enzymes George I. de Becze Ph.D. & L. A. Underkofler To cite this article: George I. de Becze Ph.D. & L. A. Underkofler (1970) Food enzymes, C R C Critical Reviews in Food Technology, 1:4, 479-518, DOI: 10.1080/10408397009558515 To link to this article: https://doi.org/10.1080/10408397009558515 Published online: 17 Feb 2010. Submit your article to this journal Article views: 38 View related articles Full Terms & Conditions of access and use can be found at http://www.tandfonline.com/action/journalInformation?journalCode=bfsn20 Download by: [Texas A&M University Libraries] Date: 09 January 2018, At: 11:03 FOOD ENZYMES Author: George I. de Becze, Ph.D. St. Thomas Institute Cincinnati, Ohio Referee: L. A. Underkofler, Director Molecular Biology Research Laboratory Miles Laboratories, Inc. Elkhart, Ind. INTRODUCTION manufactured by living cells through the activities of enzymes, themselves synthesized in the cell. In 1. Food—Enzymes—Man most instances substances in foods, constituting You are what you eat, according to an old nutrients for man and synthesized by enzymes, are saying. Disregarding the modifying facts, the say- large complex molecules built from much smaller ing brutally emphasizes the importance of food. molecules. The complex molecules may exceed Food makes man grow and enables him to exist over a million molecular weight while the units of and act. A sizable part of man's activity, in fact, which they are built are around 200 or less.
    [Show full text]
  • Genigraphics Research Poster Template 36X48
    Development of In-Situ Extraction for Point-of-Use Trace Metal Sensor in New Jersey Sediment Philip Sontag1, Katherine Dawson2, Mikayla Byron2, Matthew Esteves2, Azam Gholizadeh3, Malcolm X Shabazz Biogeochemistry Team4, Andrew D. Steen5, Ali Maher1, Mehdi Javanmard6, and Robert Miskewitz1 1Center for Advanced Infrastructure and Technology, Rutgers University 2Department of Environmental Sciences, Rutgers University 3Virginia Tech University 4Malcolm X Shabazz High School, NJ 5University of Tennessee, Earth and Planetary Sciences 6Department of Electrical Engineering, Rutgers University Abstract Square wave anodic stripping voltammogram (SWASV) of Discussion Collaborative research efforts between the Center for Advanced lead (Pb) ion in enzyme digested sediment sample • Iron (Fe)-bound and residual (sulfide)-bound lead (Pb) controls the majority of the Pb fractions in New Jersey sediment Infrastructure and Technology, Electrical Engineering, and Environmental 25 6 CC7B CC5A • Addition of β-glucosidase exoenzyme increased Pb signal in most samples Science Departments at Rutgers University have yielded a graphene oxide Pb measurment without enzyme digestion Pb measurment without enzyme digestion 5 sensor capable of measuring lead (Pb) in sediment at part per billion levels. 20 of digested sediment Pb measurment with enzyme digestion Pb measurment with enzyme digestion • Bacterial communities and metabolisms may impact enzyme-sediment 4 Parallel measurements of total Pb and Pb speciation in various sediment ICPICP-OES-OES Sediment Sediment [Pb] (mg/kg) [Pb] 15 Nitric Acid(mg/kg) alone (control): 4.4 ) digestion at varying salinities in estuarine watersheds fractions were used to produce modeled total Pb concentration from the ICPICP--OESOES Sediment Sediment [Pb] (mg/kg) [Pb] +Enzyme Extraction: 4.3 Nitric Acid(mg/kg) alone (control): 1.2 Nitric Acid alone (control): +Enzyme Extraction: 2.2 Nitric Acid alone (control): 3 4.4 • Good agreement between sensor signal and modeled total Pb sensor’s electrochemical response.
    [Show full text]
  • Complex N Acquisition by Soil Diazotrophs: How the Ability to Release Exoenzymes Affects N Fixation by Terrestrial Free-Living Diazotrophs
    The ISME Journal (2017) 11, 315–326 OPEN © 2017 International Society for Microbial Ecology All rights reserved 1751-7362/17 www.nature.com/ismej PERSPECTIVE Complex N acquisition by soil diazotrophs: how the ability to release exoenzymes affects N fixation by terrestrial free-living diazotrophs Jeffrey S Norman and Maren L Friesen Department of Plant Biology, Michigan State University, East Lansing, MI, USA Terrestrial systems support a variety of free-living soil diazotrophs, which can fix nitrogen (N) outside of plant associations. However, owing to the metabolic costs associated with N fixation, free-living soil diazotrophs likely rely on soil N to satisfy the majority of cellular N demand and only fix atmospheric N under certain conditions. Culture-based studies and genomic data show that many free-living soil diazotrophs can access high-molecular weight organic soil N by releasing N-acquiring enzymes such as proteases and chitinases into the extracellular environment. Here, we formally propose a N acquisition strategy used by free-living diazotrophs that accounts for high-molecular weight N acquisition through exoenzyme release by these organisms. We call this the ‘LAH N-acquisition strategy’ for the preferred order of N pools used once inorganic soil N is limiting: (1) low-molecular weight organic N, (2) atmospheric N and (3) high-molecular weight organic N. In this framework, free-living diazotrophs primarily use biological N fixation (BNF) as a short-term N acquisition strategy to offset the cellular N lost in exoenzyme excretion as low-molecular weight N becomes limiting. By accounting for exoenzyme release by free-living diazotrophs within a cost– benefit framework, investigation of the LAH N acquisition strategy will contribute to a process-level understanding of BNF in soil environments.
    [Show full text]
  • Extracytoplasmic Adenylate Cyclase of Bordetella Pertussis
    Proc. Natl. Acad. Sol. USA Vol. 73, No. 6, pp 1926-1930, June 1976 Biochemistry Extracytoplasmic adenylate cyclase of Bordetella pertussis (exoenzyme/malate dehydrogenase/alkaline phosphatase/bacterial enzyme compartments/adenosine 3':5'-cyclic monophosphate) E. L. HEWLETT, M. A. URBAN*, C. R. MANCLARK*, AND J. WOLFF National Institute of Arthritis, Metabolism and Digestive Diseases, National Institutes of Health, Bethesda, Maryland 20014; and *Division of Bacterial Products, Bureau of Biologics, Food and Drug Administration, Bethesda, Maryland 20014 Communicated by E. R. Stadtman, March 29,1976 ABSTRACT Soluble adenylate cyclase [EC 4.6.1.1] accu- be destroyed by brief trypsin treatment of the intact cells. Since mulates in the culture medium of exponentially growing Bor- it has been shown previously that exogenously supplied intact detella pertussis (300-900 pmol of cAMP formed/min per ml of 24 hr culture supernatant). In addition, there is an extracy- nucleoside triphosphates are excluded from bacterial cells (12), toplasmic adenylate cyclase which enables the intact organisms it is proposed that the adenylate cyclase activity expressed by to form [3P~cAMP (adenosine 3':5'-cyclic monophosphate) from these intact cells represents enzyme in a location external to the exogenous[a,2PJATP (200-1200 nmol of cAMP formed/min per cytoplasmic membrane. g wet weight of cells) and which comprises 20-45% of the total adenylate cyclase activity. In contrast, only 1.7 and 2.4% of the total cell malate dehydrogenase [EC 1.1.1.371 and alkaline MATERIALS AND METHODS phosphatase [EC 3.1.3.11, respectively, are detectable in the intact cell. Trypsin treatment of intact organisms destroys 96% Materials.
    [Show full text]
  • "Why Michigan Koi All-In-One Bacteria and Enzymes Work So Well"
    "Why Michigan Koi All-In-One Bacteria And Enzymes Work so well" Understanding The Role Of Bacteria And Enzymes And How We Use Them! What is Bacterial-Enzyme Digestion? Bacterial-enzyme digestion is the process of bacteria consuming organic matter. Enzymes act to break the organic matter into water soluble nutrients. The bacteria feeds on organic matter i.e., (fish waste / uneaten food / decaying organisms), obtaining nutrition for growth and reproduction. Using complex chemical reactions, the organic waste is metabolized down to water and carbon dioxide (the final metabolic waste products), providing the bacteria with energy for growth and reproduction. It may be shown by this simple equation: Bacteria + Enzyme + Organic Matter + Oxygen = Water + Carbon Dioxide Beneficial bacterial products must contain three necessary components: Bacteria Enzymes Nutrients These three components work in harmony, to consume the food of unwanted bacteria. They speedily and efficiently digest organic waste without odor or noxious gases and are a non-pathogen. Bacteria Types Thousands of different types of bacteria exist everywhere in our world, and most of them carry on bacterial digestion in some way. However, some of them are found only in a particular environment and require specialized types of food, and/or have very unique biological roles. A bacterium is a single cell life form – each individual cell is a separate, unique organism. Bacteria often grow into colonies or masses, but each cell remains an independent, individual life. Bacteria reproduce by a process called cell division. A mature bacterium reproduces by dividing into two daughter cells, each identical to each other and the parent bacteria.
    [Show full text]