Journal of Genetics and Molecular Biology Vol. 19, No. 3, 158-167, September 1, 2008 Deciphering the Molecular Phylogenetics of Family Hyblaeidae and Inferring the Phylogeographical Relationships Using DNA Barcoding Chandrasekhar N., Neetha N.V., Linda Koshy Vaidyan and Moinak Banerjee* Rajiv Gandhi Centre for Biotechnology, Human Molecular Genetics Lab, Poojapura, Thiruvananthapuram, Kerala, India 695 014 Hyblaea puera (teak defoliator) is a pest moth of teak woodlands in India and other tropics. H. puera is a type genus that represents the fam- ily Hyblaeidae and superfamily Hyblaeoidea. The relationships between the superfamily Hyblaeoidea other smaller superfamilies like Pyraloidea, Bombycoidea, Geometroidea, Noctuoidea, Torticoidea, Papilionoidea and others are not well understood. This study provides substantial molecular evidence in supporting the morphological classification of Hyblaeidae fam- ily and its relationship with other superfamilies. As a molecular tool DNA barcoding has gained importance in species identification and taxonomic verification. Present case study on Hyblaea demonstrates the efficiency of the barcoding gene (folmer region) in discriminating global phylogeograph- ical variants among the Hyblaea species complex. Key words: multigenic phylogeny, Hyblaea puera, Hyblaeidae, Molecular systematics, teak defoliator, DNA barcoding Introduction ing ability demarcates the superfamilies of macrolepidoptera, like Mimallonoidea, Lepidoptera is the second largest order Lasiocampoidea, Bombycoidea, Noctuoidea, in the class Insecta comprising of but- Geometroidea, Axioidea, Calliduloidea, terflies, skippers and moths. So far 127 Hedyloidea, Hesperioidea and Papilionoidea families and 46 superfamilies have been from other Lepidoptera [1]. Microlepidoptera described. Around 98% of the species is an informal grouping of other moths and in the order Lepidoptera fall in Ditrysia butterfly families which are not included group. In Lepidoptera the Macrolepidoptera in the macrolepidoptera. It constitutes suborder constitutes about 60% of the paraphyletic assemblage of moths and but- total lepidopteran species. The better fly- terflies falling under Tortricidae, Pyralidae, ∗ Corresponding authors: Dr. Moinak Banerjee; Human Molecular Genetics Laboratory, Rajiv Gandhi Centre for Biotechnology, Thiruvananthapuram Kerala, India, 695 014 Tel: +91-471-234-5899, 234-8753 (O), 234-3367 (R) Fax: +91-471-234-8096 <[email protected]> <[email protected]> <www.rgcb.res.in> JGMB<http://140.109.54.28/jgmb> – 158 – Molecular phylogenetics and phylogeographical relationships by DNA barcoding Hyblaeidae, Gracillariidae, Tineidae, than the rate of substitution at silent sites in Gelechiidae, Lecithoceridae, Limacodidae mammalian genes. The focus of the current and many others. The current study was study is to decipher the systematic position intended to resolve the systematics of of H. puera using mitochondrial and nuclear Hyblaea and understand the genetic relation- genes in the order Lepidoptera. ships between the family Hyblaeidae with micro and macro lepidopterans. The current Materials and Methods study also demonstrates the resolving power of DNA barcoding at species level. Hyblaea puera (Cramer, 1777) is a type DNA Isolation and Polymerase Chain genus representing the family Hyblaeidae Reaction and superfamily Hyblaeoidea in order DNA extraction was done from whole Lepidoptera. Hyblaeidae consists of two larvae as per the protocol described by major genera Hyblaea and Erythrochrus Andrew and Gary (1995) [10]. The quality while the family comprises of 20 species and quantity of the DNA was checked spec- found throughout the new and old world trophotometrically by taking the absorbance tropics and subtropics. The current study ratios of 260/280 nm. The primer sequences rationalizes the morphological classifica- used for the amplification of Mt genes and tion with the sequence data for the family nuclear genes are tabulated in table 1. The Hyblaeidae. H. puera was first described template of 200 ng of total genomic DNA in 1794, and was originally included in was subjected to PCR reactions in 30 µL the family Noctuidae (Macrolepidoptera) volume. Each reaction consisted of 1 X Taq and recognized as a serious forest pest by buffer with 1.5 mM MgCl2, 1.2 U of Taq Hampson in 1894 [2]. In the same year polymerase (Genei), 0.25 mM of dNTPs Fletcher and Nye (1894) [3], placed the fam- (Amersham) and 10 pmols of primers per ily Hyblaeidae along with the superfamily reaction (Sigma). PCR cycling conditions Pyraloidea based on the morphology, subse- were as follows: 16S, 12S, COI (folmer quently the family became independent and region) gene were amplified with initial got its own superfamily status Hyblaeoidea. denaturation at 94°C for 3 mins followed by Till date the systematics of Hyblaeoidea has 35 cycles of cycle denaturation at 94°C for not been supported by molecular data. 30 secs, annealing at 55°C for 30 secs, exten- Mt genomes are renowned for mutation sion at 72°C for 1 min, final extension at 72° hot spots or adaptive substitutions which C for 4 mins and held at 4°C. In case of COI makes the genome more noteworthy, and and COII genes, amplification was done results in the heterogeneous evolutionary using COa and COb primers with an initial rates across genes [4, 5]. The average rate denaturation at 94°C for 5 mins followed of evolution of the mitochondrial genome is by 35 cycles of cycle denaturation at 94°C known to be 5-10 times higher than that of for 30 secs, annealing at 56.8°C for 1 min, nuclear genome, in case of mammals [6, 7, 8]. extension at 72°C for 1 min, final extension In Drosophila it has been shown that nuclear at 72°C for 4 mins and held at 4°C. COc, genes evolve faster than mammalian nuclear COd and COe were used for sequencing the genes and mitochondrial genes evolve faster full length gene. The nuclear gene 28S was than that of nuclear genes with high codon amplified using 28Sf and 28Sr primers with bias and at approximately the same rate as initial denaturation at 95°C for 3 mins, fol- nuclear genes with low bias [9]. The rates lowed by 45 cycles of denaturation at 95°C of substitution at silent sites in Drosophila for 30 secs, annealing at 60°C for 30 secs, nuclear genes are at least three times higher extension at 72°C for 1.5 mins, final exten- – 159 – Chandrasekhar N., Neetha N.V., Linda Koshy Vaidyan and Moinak Banerjee Table 1. Primer sequences used for PCR amplification inH. puera. S.No. Primer name Sequence 1 COIf TACAATTTATCGCCTAAACTTCAGCC 2 COIr CCCGGTAAAATTAAAATATAAACTTC 3 COa CAACATTTATTTTGATTTTTTGG 4 COb GAGACCATTACTTGCTTTCAGTCATCT 5 COc TCCAATGCACTAATCTGCCATATTA 6 COd GGTCAAACAATTGAGTCTATTTGAAC 7 COe CCACAAATTTCTGAACATTGACCA 12 16Sf CGCCTGTTTATCAAAAACAT 13 16Sr CCGGTTGAACTCAGATCA 14 12Sf AAGAGCGACGGGCGATGTGT 15 12Sr AAACTAGGATTAGATACCCTATTAT 16 EF1 CACAT(CT)AACATTGTCGT(GC)AT(CT)GG 17 EF3 GCTGAGCG(CT)GA(AG)CGTGGTATCAC 18 EF4 CAT(AG)TTGTC(GT)CCGTGCCA(GT)CC 19 EF6 GC(CT)TCGTGGTGCAT(CT)TC(GC)AC 20 EF7 CA(AG)GACGTATACAAAATCGG 21 EF10 ACAGC(ACG)AC(GT)GT(CT)TG(CT)CTCAT(AG)TC 22 28Sf AGAGAGAGTTCAAGAGTACGTG 23 28Sr TTGGTCCGTGTTTCAAGACGGG sion at 72°C for 4 mins and held at 4°C. EFα (Promega) and plasmids were isolated from gene amplification was performed using EF1 the positive clones and sequenced using Big and EF10 primers with initial denaturation dye terminator sequencing kit ver 3.1 as per at 95°C for 3 mins, followed by 40 cycles of the manufacturer’s protocol. The sequencing denaturation at 95°C for 30 secs, annealing was repeated twice before being submitted to at 55°C for 30 secs, extension at 72°C for 2 NCBI GenBank. The accession numbers are mins, final extension at 72°C for 8 mins and as follows AY572232 - 16S ribosomal RNA held at 4°C. EF3, EF4, EF6 and EF7 primers gene, AY575214 - 12S ribosomal RNA gene, were used as internal sequencing primers. AY572235 - Cytochrome oxidase subunit I The PCR amplicons were separated using (COI) and Cytochrome oxidase subunit II 1.2% agarose gel in 0.5 X TBE buffer. The (COII) genes, AY847953 - Cytochrome oxi- gel was stained with ethidium bromide (0.5 dase subunit I (Folmer region), AY572233 – µg/mL) and visualized in Fluor-STM multi 28S ribosomal RNA gene and AY575215 - imager system (Bio-Rad) using Quantity elongation factor 1 alpha gene. One software module. The PCR products were subsequently Dataset cloned in pGEMT easy vector system The dataset consist of 11 families – 160 – Molecular phylogenetics and phylogeographical relationships by DNA barcoding Appendix 1 - List of accession numbers used in the dataset for family level study. Families GENES Code or 12S 16S 28S COI COII EF Orders α Dip Diptera NC_001709 NC_001709 AF191294 NC_001709 NC_001709 NM_206593 Pie Pieridae DQ150058 DQ150095 AY521784 AY954565 AF044024 DQ082828 Pap Papilionidae AY351418 AF095450 DQ406739 DQ270142 DQ270139 AY804454 Lyc Lycaenidae NC_007976 NC_007976 AY954532 NC_007976 NC_007976 AY954622 Tor Tortricidae NC_008141 DQ073916 AJ844025 NC_008141 NC_008141 DQ232886 Geo Geometridae AF232885 AJ505592 DQ178927 AJ870409 AF064521 DQ018899 Noc Noctuidae AF232884 AF173062 AF178905 AJ420370 AB158623 DQ192234 Bom Bombycidae NC_003395 NC_003395 M 3 1 3 2 0 NC_003395 NC_003395 NM_001046653 Sat Saturniidae NC_004622 NC_004622 AF423922 NC_004622 NC_004622 AY301297 Hyb Hyblaeidae AY575214 AY572232 AY572233 AY847953 AY572235 AY575215 Pyr Pyralidae AJ560801 DQ150095 AY062912 DQ630742 AY320504 A F 4 2 3 8 1 1 Cra Crambidae NC_003368 NC_003368 DQ406739 NC_003368 NC_003368 A F 1 7 3 3 9 2 spanning