Mir-193A-3P Is a Key Tumor Suppressor in Ulcerative Colitis

Published OnlineFirst June 9, 2017; DOI: 10.1158/1078-0432.CCR-17-0171

Biology of Human Tumors Clinical Cancer Research miR-193a-3p is a Key Tumor Suppressor in Ulcerative Colitis–Associated Colon Cancer and Promotes Carcinogenesis through Upregulation of IL17RD Joel Pekow1, Katherine Meckel1, Urszula Dougherty1, Yong Huang1, Xindi Chen1, Anas Almoghrabi1, Reba Mustaﬁ1, Fatma Ayaloglu-Butun1, Zifeng Deng1, Haider I. Haider1, John Hart2, David T. Rubin1, John H. Kwon3, and Marc Bissonnette1

Abstract

Purpose: Patients with ulcerative colitis are at increased risk adjacent tissue. Significant down-regulation of miR-193a-3p for colorectal cancer, although mechanisms underlying neo- was also seen in an independent cohort of ulcerative colitis plastic transformation are poorly understood. We sought to cancers. Changes in methylation of miR-193a or expression of evaluate the role of microRNAs in neoplasia development in pri-miR-193a were not observed in ulcerative colitis cancer. this high-risk population. Transfection of miR-193a-3p resulted in decreased prolifera- Experimental Design: Tissue from 12 controls, 9 ulcerative tion, and identified IL17RD as a direct target of miR-193a-3p. colitis patients without neoplasia, and 11 ulcerative colitis IL17RD expression was increased in ulcerative colitis cancers, patients with neoplasia was analyzed. miRNA array analysis was and miR-193a-3p treatment decreased growth and EGFR sig- performed and select miRNAs assayed by real-time PCR on the naling of HCT116 cells in xenografts expressing both IL17RD discovery cohort and a validation cohort. DNA methylation of with WT 30UTR compared with cells expressing IL17RD with miR-193a was assessed. Following transfection of miR-193a-3p, mutant 30UTR. proliferation, IL17RD expression, and luciferase activity of the Conclusions: miR-193a-3p is downregulated in ulcerative 30UTR of IL17RD were measured. Tumor growth in xenografts as colitisneoplasia,anditslosspromotescarcinogenesisthrough well as EGFR signaling were assessed in HCT116 cells expressing upregulation of IL17RD. These findings provide novel insight IL17RD with either a mutant 30 untranslated region (UTR) or into inflammation-driven colorectal cancer and could suggest wild-type (WT) 30UTR. new therapeutic targets in this high-risk population. Clin Cancer Results: miR-31, miR-34a, miR-106b, and miR-193a-3p were Res; 1–11. 2017 AACR. significantly dysregulated in ulcerative colitis-neoplasia and

Introduction Gene expression is regulated in part by a class of non-coding RNAs, termed microRNAs (miRNA). These small RNAs regulate Patients with long-standing ulcerative colitis are at increased 0 gene expression by binding to the 3 untranslated region (UTR) of risk for colorectal cancer (1, 2). Although many mechanisms of messenger RNA (mRNA) and either inhibit protein translation or carcinogenesis in IBD remain unknown, neoplastic lesions likely destabilize target mRNA (3). Changes in miRNA expression have result from a combination of genetic alterations, inflammatory been implicated in the pathogenesis of many cancer types, mediators, and activation of cell signaling pathways. Discovery of including colon cancer (4–7). miRNAs control the expression of novel genomic mediators of these pathways could greatly facil- signaling molecules and play important roles in cell growth (8). itate risk stratification as well as treatment and chemoprevention As such, growth promoting or cell death inhibiting miRNAs, if strategies. upregulated, could act as gain-of-function oncogenes, whereas growth suppressing or cell death enhancing mRNAs, if downregulated, could act as loss-of-function tumor suppressors (9). 1University of Chicago, Section of Gastroenterology, Hepatology, and Nutrition, Prior studies, including analyses from our group, indicate that Chicago, Illinois. 2University of Chicago, Department of Pathology, Chicago, fi – 3 the miRNA pro le changes in chronic ulcerative colitis associated Illinois. University of Texas Southwestern, Digestive and Liver Disease Division, inflammation (10–13). Several small studies have also demon- Dallas, Texas. strated dysregulation of multiple miRNAs, including miR-31, Note: Supplementary data for this article are available at Clinical Cancer miR-21, and miR-224, in IBD-associated neoplastic tissue Research Online (http://clincancerres.aacrjournals.org/). (14–17). However, alterations in miRNA expression have not Corresponding Author: Joel Pekow, University of Chicago, KCBD, 900 East 57th been examined globally in a large subset of patients with Street, MB #9, Chicago, IL 60637. Phone: 773-702-7895; Fax: 773-702-2180; advanced ulcerative colitis–associated neoplasia, nor have E-mail: [email protected] miRNA changes been described in non-dysplastic tissue adjacent doi: 10.1158/1078-0432.CCR-17-0171 to a neoplastic lesion. In addition, there has been limited eval- 2017 American Association for Cancer Research. uation of the functional role of miRNAs dysregulated in

www.aacrjournals.org OF1

Pekow et al.

RNA and DNA extraction Translational Relevance RNA and DNA were extracted from FFPET and fresh-frozen Approximately 1.6 million Americans have inflammatory samples as described in the Supplementary Materials and bowel disease (IBD), which is comprised of Crohn's disease Methods. and ulcerative colitis. Patients with long-standing colonic fl in ammation related to IBD have a high-risk of developing Nanostring analysis colonic neoplasia. Although cancer in IBD differs from spo- miRNA analysis was performed using the Nanostring nCounter radic colon cancer in clinical presentation, progression from expression assay v1 per the manufacturer's specifications. Details dysplasia, and outcome, few studies have mechanistically regarding the analysis of array data are presented in the Supple- examined the pathogenesis of neoplasia in IBD using human mentary Materials and Methods. samples. In this study, we investigated miRNA expression in ulcerative colitis–associated cancer and report that loss of the tumor suppressor, miR-193a-3p, promotes colon carcinogen- Real-time PCR esis in patients with ulcerative colitis. These findings uncover a Quantitative real-time PCR was performed to assess expression novel mechanism of inflammation-associated colon cancer of miR-31, miR-34a, miR-106b, miR-193a-3p, miR-376, miR- IL17RD that has the potential to be used as a target for chemopreven- 497, pri-miR-193a, and as detailed in the Supplementary Materials and Methods. Results were normalized to beta-actin, tion and treatment in this high-risk population. DD comparisons made between groups using the 2 CT method (18), and significance calculated using the Student t test.

inflammatory bowel disease (IBD)-carcinogenesis. In this study, Genomic bisulfite sequencing we describe miRNA changes occurring in both IBD-neoplasia as DNA bisulfite treatment was carried out using the Qiagen well as adjacent non-dysplastic tissue and investigate the func- Epitect Bisulfite Kit per the manufacturer's directions. Primers tional role of the tumor suppressor, miR-193a-3p, and a putative for miR-193a designed with methprimer software (L: TTTGAGG- target which potentiates EGFR signaling, interleukin 17 receptor D GATATTTAGAGTTT, R: AACCTAAAAAACAACCTAACC). PCR, (IL17RD), in ulcerative colitis–associated cancer. subcloning of products, and sequencing were carried out as described in the Supplementary Materials and Methods. Analysis Materials and Methods and visualization of CpG dinucleotide methylation were performed using BISMA software (http://services.ibc.uni-stuttgart. Tissue de/BDPC/BISMA; ref. 19). Discovery cohort. The study was approved by the institutional review board at the University of Chicago (IRB# 11-0411 and 10- Immunohistochemistry fi fi 209A). Archived formalin- xed paraf n-embedded tissues Immunohistochemistry was carried out as previously described (FFPET) were obtained from normal controls and patients with using antigen retrieval with a citrate buffer and primary antibody ulcerative colitis who underwent a colectomy. Three groups of for IL17RD at a concentration of 1:15 (R & D Systems; ref. 20). patients were examined: Normal controls (N, n ¼ 12), ulcerative colitis patients without neoplasia (ulcerative colitis, n ¼ 9), and ulcerative colitis patients with neoplasia (n ¼ 11). From the Colonocyte Isolation n ¼ ulcerative colitis patients with neoplasia, two separate tissues Colon biopsies ( 6-12/subject) were collected from the þ were analyzed, ulcerative colitis–associated neoplastic tissue sigmoid colon and stored for up to 6 hours at 4 C in transport 2þ 2þ (UCN, n ¼ 10; high-grade dysplasia [HGD]-4, colorectal cancer media which consists of Mg and Ca -free PBS containing 50 m [CRC]-6), and nondysplastic ulcerative colitis tissue adjacent to a IU/mL penicillin, 50 g/mL streptomycin and 0.5 mg/mL genta- neoplastic lesion (nUCaN, n ¼ 10). The tissue adjacent to the mycin. Isolation of colonocyte and stromal fractions was per- neoplastic lesion was obtained from the archived FFPET in closest formed as detailed in the Supplementary Materials and Methods. proximity to the neoplastic lesion. Baseline demographics, site of sample collection, and medication usage for each group is pre- Cell Culture sented in Supplementary Table S1. Additional information on the HCT116, DLD-1, LoVo, and HT29 colon cancer cells, as well as patient groups, inclusion, and exclusion criteria are included in human umbilical vein endothelial cells (HUVEC) and human the Supplementary Materials and Methods. colonic fibroblasts (CCD-18co) were obtained from the ATCC. HCT116 luciferase–expressing cells were obtained from Dr. Tong Validation cohort. Flash-frozen tissue was obtained by the Chuan He (University of Chicago) for xenograft experiments. We University of Chicago Human Tissue Resource Center using routinely authenticate cell lines by short tandem repeat analysis mucosal stripping after surgical resection from 11 patients (21). The most recent date of authentication was 2/2017 by the with sporadic colon cancer and 11 patients with ulcerative University of Arizona Genetics Core. miRNA transfection experi- colitis–associated colon cancer. Comparison in this group was ments were conducted on preconfluent HUVEC and HCT116 performed between normal-appearing tissue adjacent to spo- cells. Cells were seeded on 6-well plates and transfected the radic colon cancers (normal controls, n ¼ 11), ulcerative following day with 6.25 and 12.5 nmol/L mimics of mature colitis–associated cancer (n ¼ 11), and non-dysplastic mucosa miR-193a-3p (Life Technologies; assay ID: MC11123, catalog # adjacent to the ulcerative colitis cancers (n ¼ 11). Individuals 4464066) or control oligonucleotides (Life Technologies assay and samples were matched by age and colon location, ID: AM17110, AM17111) and cells harvested 72 hours later to respectively. examine protein and RNA expression.

OF2 Clin Cancer Res; 2017 Clinical Cancer Research

Role of miR-193a-3p in UC-Associated Neoplasia

Preconfluent HCT116, LoVo, HT29, and DLD1 cells were miR-193a-3p (n ¼ 10) or vehicle alone (n ¼ 5, jetPEI alone) on treated with 0, 5, or 10 mmol/L 5-aza-20-deoxycytidine daily for days 5 and 8 after implantation of HCT116 cells. Tumor growth 5 days. The cells were harvested 24 hours after the last treatment was measured three times weekly for 3 weeks and the mice were and pri–miR-193a as well as mature miR-193a-3p were measured sacrificed 25 days after implantation of tumors. Tumor volumes by qPCR. were compared at each time point using a Wilcoxon signed rank Three seed matches for miR-193a-3p are contained in the test. In separate experiments, 10 mg of anti–miR-193a-3p was 30UTR of IL17RD at positions 128-134, 964-970, and 5378- injected into 9-week-old male and female NSG / mice (n ¼ 9) or 5384. A 910 bp oligonucleotide flanking the first 2 seed sequences vehicle (n ¼ 6) with HCT 116 cells containing IL17RD and the WT and a mutant construct, in which both seed sequences were 30UTR in one flank. Injections of anti–miR-193a-3p were initiated deleted, were constructed by Origene and inserted downstream 12 days after tumor implantation and continued twice weekly for from a luciferase encoding cDNA in the pMirTarget Destination 3 weeks. Tumor growth was measured after the final injection Vectors (Origene; Supplementary Materials and Methods). (35 days after initial cell injection) and the animals were sacrificed HCT116 cells were co-transfected with the vector coding for firefly 3 days later. Tumor volumes were compared between groups luciferase regulated by wild-type or mutant IL17RD 30UTR togeth- every 3 days using a Student t test. Immunohistochemistry was er with a Renilla luciferase regulated by a CMV to control for performed for ki67 with a concentration of 1:500 (Thermo transfection efficiency. Cells were then transfected with a mature Scientific) on formalin-fixed paraffin-embedded tissues. Nuclear mimic of miR-193a-3p or scrambled probe (Life Sciences) and staining was assessed on these samples using ImmunoRatio harvested 48 hours later. Firefly luciferase activity regulated by software to evaluate cellular proliferation (23). Percent of positive IL17RD-30UTR was normalized to renilla expression for each well. staining was compared between tumors expressing the MT or WT Eight wells for each condition were evaluated and mean expres- 30UTR in both vehicle and miR-193a-3p–treated animals using a sion between each group compared using a Student t test. paired Student t test. To assess cellular proliferation, preconfluent (5,000–7,500 cells/96-well plate) HCT116, HT29, or CCD18co cells were Western Blotting transfected with 25 nmol/L miR-193a-3p or control miRNA and Protein extraction and Western blotting were performed as proliferation assessed 48 hours later using a WST-1 proliferation previously described (24). Primary antibodies against IL17RD, assay. Raw optical density was obtained in 12 replicates, normal- FLAG, pAKT, pERK, pERBB2 EGFR, pEGFR, and beta-actin were ized, percent proliferation calculated as compared with a scram- used with a dilution of 1:500 for IL17RD (R and D systems), bled control miRNA, and significance assessed using a two-sample 1:1,000 for FLAG (Clontech),1:500 pAKT (Cell Signaling Tech- t test. nology), 1:500 for EGFR (Cell Signaling Technology), 1:100 for hSEF (IL17RD) plasmid was obtained from Dr. Chang (Tsin- pEGFR (Santa Cruz Biotechnology), 1:2,500 for pERK (Santa Cruz ghua University; ref. 22). The plasmid was transiently transfected Biotechnology), 1:200 for pERBB2 (Santa Cruz Biotechnology), into HCT-116 or HT-29 cells and proliferation assessed by WST-1 and 1:5,000 for beta-actin (Sigma-Aldrich). Mean expression proliferation assay 96 hours later. In separate experiments, HT29 between treatment group was compared using a Student t test. cells were transiently transfected with the IL17RD encoding plasmid, and 24 hours later cells were either treated with 10 ng/mL of EGF or untreated. Cells were harvested for protein 15 and 30 Results minutes after EGF treatment. WST-1 proliferation assay was Microarray analysis identifies 13 miRNAs that are significantly performed 72 hours after EGF treatment of cells seeded on 12-well dysregulated in both ulcerative colitis neoplasia and adjacent plates containing 2,000–2,500 cells per well. tissue compared with ulcerative colitis without neoplasia IL17RD with either the 910 bp wild-type 30UTR or mutant Using RNA extracted from FFPET, we compared miRNA expres- 30UTR on the 30 end of IL17RD were stably transfected into sion levels quantified with Nanostring technology among normal HCT116 cells. A polyclonal population of IL17RD-30UTR–stable controls, ulcerative colitis without neoplasia, ulcerative colitis– transfectants were untreated or treated with a 20 nmol/L of a associated neoplasia and mucosa adjacent to the neoplastic scrambled probe or 5, 10, or 20 nmol/L of miR-193a-3p for 24 lesion. Following normalization, 11 samples were removed from hours and harvested for protein extraction. In separate experi- the analysis as they demonstrated a "batch effect," clustering ments, HCT116 cells expressing IL17RD with WT 30UTR or mutant together in two-way unsupervised hierarchical clustering analysis. 30UTR were transfected with similar doses of a miR-193a-3p miRNA expression was analyzed from arrays in the remaining 30 antagomir (Life Technologies; assay ID: MH11123, catalog patients, including 9 normal controls, 7 ulcerative colitis patients #4464088). without neoplasia (ulcerative colitis), 7 ulcerative colitis–associated neoplastic tissues (UCN), and 7 nondysplastic ulcerative Animal Studies colitis mucosa adjacent to a neoplastic lesion (nUCaN). As shown Animal studies were approved by the University of Chicago in the multidimensional scaling analysis in Fig. 1A, there was Institutional Animal Care and Use Facility (#59771). Nod Scid clustering by miRNA expression between UCN and ulcerative Gamma (NSG / ) mice were obtained from The Jackson Labo- colitis (P ¼ 0.003) as well as between nUCaN and ulcerative colitis ratory. A mixed population of 2.5 million HCT116 cells that were (P ¼ 0.056). Compared with normal controls, there were 39 stably transfected with IL17RD with WT 30UTR were injected in significantly dysregulated miRNAs in ulcerative colitis patients one flank, and a comparable number of cells expressing IL17RD without neoplasia, 10 significantly dysregulated miRNAs in ulcer- with mutant 30UTR were injected into the opposite flank in 15 ative colitis neoplastic tissues, and 11 dysregluated miRNAs in nine-week-old male mice. Ten mg of mature miR-193a-3p was nondysplastic ulcerative colitis tissue adjacent to a neoplastic mixed with in vivo jetPEI (Polyplus) for intraperitoneal injection lesion (LogFC>1 and P < 0.01; Fig. 1C). Compared with ulcerative per the manufacturer's specifications. The mice were treated with colitis without neoplasia, there were 59 miRNAs with a significant

www.aacrjournals.org Clin Cancer Res; 2017 OF3

Pekow et al.

Figure 1. miRNA microarray analysis demonstrates differential expression of miRNAs in normal, ulcerative colitis, ulcerative colitis (UC) neoplasia, and adjacent tissue. Clustering of miRNA expression using non-metric multidimensional scaling in ulcerative colitis versus ulcerative colitis neoplasia (A); nUCaN versus ulcerative colitis (B). Each circle represents a single subject in the indicated group. C, Venn diagram displaying the number of signiﬁcantly upregulated (red) and downregulated (green) miRNAs between ulcerative colitis and normal controls, UCN and normal controls, as well as nUCaN and normal controls (LogFC>1, P < 0.01). D, Venn diagram displaying the number of signiﬁcantly dysregulated miRNAs between UCN and ulcerative colitis as well as nUCaN and ulcerative colitis (LogFC>1, P < 0.01).

change in expression in UCN, and 18 miRNAs with a signiﬁcant lated in UCN by qPCR (Fig. 2A). miR-193a-3p expression was change in expression in nUCaN (Fig. 1D; Supplementary Data downregulated 2.9-fold in ulcerative colitis (P ¼ 0.04), 3.3-fold in Tables S2–S6). Thirteen miRNAs were signiﬁcantly dysregulated nUCaN (P ¼ 0.03), and 5.3-fold in UCN (P ¼ 0.003) compared in both UCN and nUCaN compared with ulcerative colitis with normal controls. Compared with ulcerative colitis without without neoplasia. Microarray Data: Available at Geo DataSets. dysplasia, miR-193a-3p was downregulated 1.2-fold in nUCaN Accession GSE68306. (P ¼ 0.7) and 1.9-fold in UCN (P ¼ 0.05; Fig. 2B).

Real-time PCR validates array findings that miR-31, miR-34a, DNA methylation of miR-193a is not increased in ulcerative miR-106b are upregulated and miR-193a-3p is downregulated colitis–associated colon cancer in ulcerative colitis–associated neoplasia and adjacent tissue Because miR-193a-3p was downregulated in IBD-associated Six miRNAs (miR-31, miR-34a, miR-106b, miR-193a-3p, miR- cancer and is located in a CpG island (Fig. 3A), DNA methylation 376c, and miR-476) that were significantly dysregulated in both of the gene was analyzed. Bisulfite genomic sequencing was UCN and nUCaN compared with ulcerative colitis without neo- performed in 3 normal controls, 2 quiescent ulcerative colitis plasia, and previously described to be dysregulated in other tissues, and 3 ulcerative colitis–associated cancers. As shown cancers were analyzed by qPCR in all samples (n ¼ 41). miR- in Fig. 3B, there was a heterogeneous pattern of methylation 31 demonstrated significant upregulation in UCN and nUCaN across all samples without significant differences in total meth- compared with both normal controls and ulcerative colitis with- ylation between phenotypic groups (Normal: 62%, ulcerative out neoplasia (UCN vs. N: 9.7-fold, P < 0.001; nUCaN vs. N: 8.2- colitis: 42%, ulcerative colitis cancer: 46%) (Fig. 3B). Likewise, fold, P < 0.001; UCN vs. ulcerative colitis: 4.7-fold, P ¼ 0.01; there was no association between miRNA expression and per- nUCaN vs. ulcerative colitis: 4.0-fold, P ¼ 0.05). Similarly, miR- centage of methylation across these samples. 106b was significantly upregulated in both UCN and nUCaN In vitro,pri–miR-193a expression was significantly increas- compared with both normal controls and ulcerative colitis with- ed following treatment with 5-AZA in LoVo cells, although there out neoplasia (UCN vs. N: 1.8-fold, P ¼ 0.04; nUCaN vs. N: 3.4- were no differences in mature miR-193a-3p expression. In contrast, fold, P ¼ 0.005; UCN vs. ulcerative colitis: 2.2-fold, P ¼ 0.04; 5-AZA did not induce changes in expression of pri–miR-193a or nUCaN vs. ulcerative colitis: 4.1-fold, P ¼ 0.009). miR-34a was mature miR-193a-3p in HCT116, DLD-1, or HT29 cells (Fig. 3C). significantly upregulated in UCN and nUCaN compared with ulcerative colitis without neoplasia (UCN vs. ulcerative colitis: Expression of the primary transcript of miR-193a is unchanged, 3.3-fold, P ¼ 0.03; nUCaN vs. ulcerative colitis: 5.3-fold, P ¼ although miR-193a-3p is significantly downregulated in a 0.006) although did not demonstrate a significant change in validation set of ulcerative colitis cancers expression compared with normal controls (UCN vs. N: 1.2-fold, pri–miR-193a and miR-193a-3p were assessed by qPCR in an P ¼ 0.7; nUCaN vs. N: 1.9-fold, P ¼ 0.2). In contrast to microarray independent cohort of normal controls, ulcerative colitis–asso- findings, expression of miR-376c and miR-497 were not upregu- ciated colon cancers, and non-dysplastic mucosa adjacent to

OF4 Clin Cancer Res; 2017 Clinical Cancer Research

Role of miR-193a-3p in UC-Associated Neoplasia

Figure 2. Real-time PCR results validate microarray finding that miR-31, miR- 34a, miR-106b, and miR-193a-3p are differentially expressed in both ulcerative colitis (UC)-neoplasia and adjacent tissue compared with ulcerative colitis without neoplasia. miRNAs that were significantly dysregulated in both ulcerative colitis neoplasia and adjacent mucosa compared with ulcerative colitis without neoplasia in the array analysis, and had a previously described putative functional role in carcinogenesis were quantified by real-time PCR. Upregulated miRNAs (A); miR-193a-3p (B). ulcerative colitis–associated cancers (n ¼ 11/group). As shown isolated colonocytes and stromal cells. Compared with whole in Fig. 4A, there were no differences in primary transcript expres- biopsy specimens, however, miR193a-3p was enriched in isolated sion levels of pri–miR-193a in ulcerative colitis cancer (P ¼ 0.49) stromal cells and decreased in isolated colonocytes (P < or adjacent tissue (P ¼ 0.75) compared with normal controls. 0.001; Fig. 4B). There was a significant decrease, however, in expression of mature miR-193a-3p in ulcerative colitis cancers (5.6-fold, P ¼ 0.03) IL17RD transcript and protein expression are increased in and adjacent non-dysplastic tissue (4.8-fold, P ¼ 0.05) com- ulcerative colitis–associated neoplasia and discordant to pared with normal controls. These findings paired with the expression of miR-193a-3p methylation analysis support the conclusion that downregula- As IL17RD has the second highest weighted contextþþ score as tion of miR-193a-3p in IBD-cancer involves posttranscriptional a target of miR-193a-3p in TargetScan (www.targetscan.org) and dysregulation. we theorized that it has an oncogenic role in colitis-associated cancer, we evaluated transcript and protein expression of IL17RD Relative expression of miR-193a-3p is higher in stromal cells in ulcerative colitis and ulcerative colitis–associated neoplasia than colonocytes in normal controls (25). Real-time PCR was carried out in normal controls, ulcerative To explore the cell specificity of miR-193a-3p, we isolated colitis–associated cancers, and non-dysplastic mucosa adjacent to colonocytes from stromal cells in biopsies obtained from colo- the cancer from samples in the validation cohort (n ¼ 7 samples/ noscopy in 13 normal controls. To confirm separation of stromal group). Six of the seven ulcerative colitis–associated cancers had cells from colonocytes, we measured expression of vimentin, active inflammation in the surrounding mucosa. Compared with which is specific for stromal cells, and CK20, which is specific normal controls, IL17RD was increased in ulcerative colitis–asso- for colonocytes (Fig. 4B). miR193a-3p was detected in both ciated cancer 3.2-fold (P ¼ 0.04), and in nondysplastic mucosa

Figure 3. miR-193a does not have increased DNA methylation in ulcerative colitis-associated neoplasia. A, Genomic structure of miR-193a-3p. Location of miR-193a (gray rectangle) with respect to CpG sites (vertical lines) and region examined by bisulﬁte genomic sequencing. The analyzed genomic region had 27 CpG dinucleotides as shown in red. The genomic sequence of pre–miR-193a is underlined. B, Bisulﬁte genomic sequencing in eight subjects, including three normal controls, two ulcerative colitis without dysplasia, and three ulcerative colitis–associated cancers. Red boxes represent methylated CpG sites and blue boxes unmethylated sites. C, Real-time PCR of pri–miR-193a and miR-193a-3p following treatment with 0, 5 mmol/L, or 10 mmol/L of 5-aza-20-deoxycytidine daily for 5 days in the indicated colon cancer cell lines (, P < 0.05).

www.aacrjournals.org Clin Cancer Res; 2017 OF5

Pekow et al.

Normal ABEP UC Cancer < 0.001 abc 2.5 Adjacent mucosa 4 Whole biopsy P = 0.05 Colonocytes 2 P = 0.03 Stromal cells 3

1.5 P < 0.001 2 d e f 1 P = 0.001

0.5 Fold change in expression Fold change in expression

0 0 pri-miR-193a-3p miR-193a-3p miR-193a-3p CK20 Vimentin Normal 6 C UC Cancer D gh i Adjacent mucosa P = 0.03 5 P = 0.04 5

4 4

3 3 r = −0.29 j k l 2 2

1 miR-193a-3p (Fold-adjacent) Fold change in expression 0 0 012345 IL17RD IL17RD (Fold-adjacent)

Figure 4. miR-193a-3p is downregulated and IL17RD upregulated in ulcerative colitis-associated cancer. A, Expression of the primary transcript of miR-193a and mature miR-193a-3p in an independent validation cohort of ulcerative colitis–associated cancers and adjacent tissue as compared with normal controls (n ¼ 11/group). B, Expression of miR-193a-3p, in whole colon biopsies, the fractionated colonocytes, and stroma from the same normal control patients (n ¼ 13). Vimentin, which is highly expressed in colonic ﬁbroblasts, and CK20 that is expressed in colonocytes but not stromal cells, were measured as cell purity controls. C, Expression of IL17RD in ulcerative colitis–associated cancers and adjacent tissue as compared with normal controls (n ¼ 7/group). D, Correlation between miR-193a-3p and IL17RD transcripts. Individual sample expression of miR-193a-3p as compared with expression IL17RD with logarithmic trend line in IBD cancers and adjacent tissue (fold change of expression as compared with normal controls). Samples included had expression data available for both miR-193a-3p and IL17RD (n ¼ 12, ulcerative colitis cancer¼6, adjacent tissue¼6). E, Immunohistochemistry of IL17RD at 10x magniﬁcation [a, normal control; b, quiescent ulcerative colitis; c, active ulcerative colitis; d and e, nondysplastic mucosa adjacent to a cancer; f and g, ulcerative colitis cancer; h and i, sporadic colon cancer; j, k, and l, representative images from ulcerative colitis cancers in tissue array demonstrating positive staining in epithelial cancer cells.

adjacent to the cancers 2.7-fold (P ¼ 0.03; Fig. 4C). In subjects seed complement sequences deleted were cloned into a lucif- who had expression of miR-193a-3p and IL17RD analyzed in the erase vector regulated by IL17RD 30UTR. Compared with a same sample, there was an inverse correlation between miR-193a- scrambled oligonucleotide control, miR-193a-3p decreased 3p and IL17RD (R2¼-0.23; Fig. 4D). By immunohistochemistry, expression of luciferase regulated by wild-type 30UTR construct IL17RD expression was present in malignant colonocytes in IBD- by 42% (P < 0.001). Luciferase activity was also decreased 37% associated cancers, whereas expression was seen predominately in with transfection of miR-193a-3p in cells containing the wild- endothelial and other stromal cells in normal controls, active type 30UTR compared with the mutated 30UTR (P ¼ 0.001). In ulcerative colitis, and quiescent ulcerative colitis. In a tissue array untreated cells, luciferase activity was decreased 13% in cells of 24 ulcerative colitis–associated cancers, 19 of 24 had strong containing luciferase regulated by IL17RD wild-type 30 UTR positive staining and 5 of 24 had weak positive staining (Fig. 4E). compared with the mutated 30UTR, likely related to endoge- nous miR-193a-3p activity in these colon cancer cells (P ¼ miR-193a-3p decreases colon cancer cell proliferation and 0.02; Fig. 5B). directly targets IL17RD HCT116 and HUVEC cells were also transfected with 6.25 or To examine the growth phenotype of miR-193a-3p, HT-29, 12.5 nmol/L mature mimic of miR-193a-3p or a scrambled HCT-116 colon cancer cells, and CCD-18co colonic fibroblasts (a RNA oligonucleotide and cells were harvested 72 hours later to stromal cellular component) were transfected with mature mimic measure IL17RD protein and gene expression. HUVEC cells of miR-193a-3p and proliferation was assessed. As shown in Fig. were selected because of high baseline expression of IL17RD 5A, upregulation of miR-193a-3p significantly decreased prolif- (26). Following transfection with 6.25 nmol/L in HUVEC, eration in both colon cancer cell lines as well as cultured fibro- there was a decrease in IL17RD RNA expression (2.1-fold; blasts. At 48 hours, miR-193a-3p upregulation resulted in a 34% P ¼ 0.03), but no differences in IL17RD protein expression decrease in proliferation of HCT116 (P < 0.001), 19.5% decrease compared with the scrambled control. With transfection of in proliferation of HT-29 cells (P ¼ 0.002), and 14.1% decrease in 12.5 nmol/L of mature miR-193a-3p, there was downregula- proliferation of CCD-18co cells (P ¼ 0.03). tion of both IL17RD protein (2.5-fold) and transcript expres- We next carried out cell culture studies to investigate regulation sion (3.1-fold; P < 0.001; Fig. 5C). In HCT116 cells, baseline of IL17RD by miR-193a-3p. To assess a direct interaction between IL17RD protein expression was too low to detect a band on miR-193a-3p and IL17RD, a 910bp oligonucleotide containing Western blot. Similar to the HUVEC cells, however, IL17RD 2 predicted binding sites for the miR-193a-3p seed sequences RNA expression in HCT116 was minimally decreased (1.2- in the 30UTR of IL17RD and a mutant IL17RD 30UTR with the fold, P ¼ 0.2) following transfection with 6.25 nmol/L of the

OF6 Clin Cancer Res; 2017 Clinical Cancer Research

Role of miR-193a-3p in UC-Associated Neoplasia

Figure 5. miR-193a-3p decreases cellular proliferation and targets IL-17RD. A, Cellular proliferation at 48 hours in the indicated cell lines following transfection with 25 nmol/L of miR- 193a-3p or scrambled control. B, Activity of luciferase regulated by mutated or wild type IL17RD 30-UTR following transfection with mature miR-193a-3p or a scrambled control oligonucleotide. Results are expressed as the ratio of ﬁreﬂy to Renilla luciferase activity and normalized to empty vector. C, Expression of IL17RD by Western blot following transfection with 6.25 or 12.5 nmol/L of miR-193a- 3p in HUVEC cells. D, RNA transcript expression of IL17RD following transfection of 6.25 or 12.5 nmol/L of IL17RD in HUVEC or HCT116 cells.

miRNA although there was a greater decrease in expression miR-193a-3p regulates IL17RD controlled EGFR signaling following transfection with 12.5 nmol/L miR193a-3p (1.7- To explore the interaction between miR-193a-3p, IL17RD, and fold, P ¼ 0.06; Fig. 5D). EGFR signaling, HCT116 cells stably transfected with the WT 30UTR and IL17RD or the mutant 30UTR and IL17RD were treated IL17RD increases EGF-induced colon cancer cell proliferation with miR-193a-3p. As shown in Fig. 6A and B, miR-193a-3p and EGFR signaling resulted in significant downregulation of pAKT and pERK in cells In previous studies, IL17RD prevented degradation of EGFR expressing the WT 30UTR at 5, 10, and 20 nmol/L. In addition, and potentiated EGF signaling in HEK293T human embryonic there was downregulation of pERBB2 with treatment of 20 nmol/ kidney cells (27). As such, we explored the effect of IL17RD over- L of miR-193a-3p in cells expressing the WT 30UTR. In contrast, expression on proliferation of colon cancer cells with or without expression of pAKT and pERK were increased in cells expressing EGF treatment. Without EGF treatment, IL17RD overexpression the WT 30UTR and IL17RD compared with those expressing the resulted in a decrease in cell proliferation at 96 hours in HT-29 mutant 30UTR and IL17RD following treatment with a miR-193a- cells (12.1%, P < 0.001), which have a p53 mutation, and no 3p antagomir (Fig. 6C and D). We did not observe differences in change in proliferation of HCT116 cells, which do not carry a p53 EGFR expression between WT 30UTR and mutant 30UTR-expres- mutation (Supplementary Fig. S1A). In contrast, in colon cancer sing cells following treatment with miR-193a-3p or its inhibitor. cells that were treated with EGF, IL17RD significantly increased proliferation of both HT-29 cells (16%, P < 0.001) and HCT116 miR-193a-3p suppression of colon cancer growth is mediated cells (53%, P < 0.001) 96 hours following transfection (Supple- through IL17RD mentary Fig. S1B). We also examined pAKT, pERK pEGFR, and To explore the interaction between miR-193a-3p, IL17RD, and pan-EGFR in EGF-treated cells transfected with a plasmid coding tumor growth, HCT116 cells were stably transfected with the for IL17RD or an empty vector (EV) plasmid. In HT-29 cells plasmid coding for IL17RD controlled by either wild-type or transfected with IL17RD, EGFR and ERK were activated 15 min- mutant 30 UTR for the IL17RD gene. NSG / mice were injected utes after treatment of EGF, and AKT was activated by 30 minutes on contralateral flanks with cells expressing IL17RD regulated by (Supplementary Fig. S1C and 1D). As expected, short-term EGF either wild-type or mutant 30UTR. Intraperitoneal treatment of treatment led to a decrease of pan-EGFR in both IL17RD trans- mice with miR-193a-3p significantly decreased growth of tumors fected and control cells, although EGF-treated IL17RD and con- expressing IL17RD with wild type 30UTR compared with tumors trols were not different with respect to pan-EGFR (Supplementary in vehicle treated mice expressing IL17RD with WT 30UTR or Fig. S1C). However, IL17RD transfection into HT29 cells not tumors in mice expressing IL17RD with mutant 30UTR (Fig. 6E). treated with EGF exhibited a trend toward an increase in total Similarly, in miRNA treated mice cellular proliferation was sig- EGFR expression compared with cells treated with an empty nificantly decreased in tumors expressing IL17RD with wild-type vector 96-hours after transfection of IL17RD (P ¼ 0.1; Supple- 30UTR compared with tumors with cells expressing IL17RD with mentary Fig. S1E). mutant 30UTR (Fig. 6F and G). In separate experiments,

www.aacrjournals.org Clin Cancer Res; 2017 OF7

Pekow et al.

Figure 6. IL17RD mediates the impact of miR-193a-3p on tumor growth and EGFR signaling. A, Western blots demonstrating protein expression following transfection with the indicated doses of miR-193a-3p or a scrambled probe in HCT116 cells stably transfected with a vector containing IL17RD with wild-type 30UTR or IL17RD with mutant 30UTR. Images represent one of two blots using the same conditions. B, Quantitation of protein expression following transfection with the indicated doses of miR-193a-3p or a scrambled probe in HCT116 cells stably transfected with a vector containing IL17RD with wild-type 30UTR or IL17RD with mutant 30UTR. , P < 0.05. C, Western blots demonstrating protein expression in parental HCT116 cells (par) or following treatment with a scrambled probe or miR-193a-3p inhibitor (Inh) at the indicated doses in HCT116 cells stably transfected with a vector containing IL17RD with wild-type 30UTR or IL17RD with mutant 30UTR. Images represent one of two blots using the same conditions. D, Quantitation of protein expression following transfection with the indicated doses of a miR-193a-3p antagomir or a scrambled probe in HCT116 cells stably transfected with a vector containing IL17RD with wild-type 30UTR or IL17RD with mutant 30UTR; , P < 0.05. E, Time course of tumor growth of HCT116 cells stably transfected with a vector coding for IL17RD with wild-type 30UTRormutant30UTR with mutations in the seed-binding sites for IL17RD and treated with intraperitoneal injection of miR-193a-3p (n ¼ 10 mice containing one cell line in each ﬂank) or vehicle (n ¼ 5). F, Representative images of Ki67 staining of tumor xenografts of cells expressing IL17RD withwild-typeormutant30UTR in mice treated with miR-193a-3p. G, Quantiﬁcation of KI67 staining from tumors consisting of HCT116 cells expressing IL17RD with wild-type 30UTR. Mice were treated with miR-193a-3p or vehicle as indicated (n ¼ 5/group). H, Tumor volume by day in tumor xenografts containing HCT116 cells stably transfected with a vector containing IL17RD, and a wild-type 30UTR treated with intraperitoneal injection of anti–miR-193a-3p (n ¼ 9) or vehicle (n ¼ 6).

intraperitoneal injection of anti–miR-193a-3p resulted in signif- ulcerative colitis–associated neoplasia. The fact that we did not icantly increased growth of tumors expressing wild-type 30 UTR of identify changes in several other miRNAs found to be dysregu- IL17RD (Fig. 6H). lated in prior studies may be related to differences in patient populations and methodological differences including miRNA Discussion platforms. Our investigations had the advantage of controlling for inflammation and location of tissue biopsies among sample This report highlights the importance of miRNAs in the groups as well as having a more homogeneous patient population pathogenesis of IBD-associated colon cancer. We identified that included only ulcerative colitis patients. In addition to several miRNAs that were dysregulated in IBD-associated neo- demonstrating changes in miR-31, we also identified significant plasia, which may contribute causally to cancer development in upregulation miR-34a and miR-106b, as well as downregulation this high-risk population. In addition, this study established of miR-193a-3p in IBD-associated neoplasia and adjacent tissue. that changes in miRNAs occur in non-dysplastic mucosa adja- miR-106b, like miR-31, has been ascribed an oncogenic role in cent to a neoplastic lesion as a "field effect." We also demon- colon cancer previously (29, 30). In contrast to our findings in strated downregulation of miR-193a-3p in IBD-associated neo- IBD-cancer, however, previous studies indicate that miR-34a is plasia, validated changes in an independent cohort, and iden- decreased in a subset of sporadic colon cancers (31). As the impact tified a possible key mechanism of carcinogenesis in IBD of miR-34a on cancer cell proliferation is dependent on p53 and involving IL17RD. Although miR-193a-3p has been reported its expression is associated with that of p53 (32), the upregulation as downregulated in several cancers, this is the first study observed in neoplasia in our analysis may be linked to the tumor- to report downregulation of miR-193a-3p in IBD-associated suppressor gene status. However, we did not directly measure p53 neoplasia. expression in our cohort. In this study, we chose to focus mech- Previous miRNA analyses in IBD-associated cancers have anistic investigations on miR-193a-3p given the fact that it may be focused on the upregulation of miR-31, miR-21, miR-155, integral to bowel inflammation and is known to function as a miR-224, let-7e, miR-17, and miR-122 (14–17, 28). In concor- tumor suppressor in other cancers, but had not been investigated dance with these studies, we confirmed upregulation of miR-31 in functionally in colorectal cancer (33–35). Adding to the strength

OF8 Clin Cancer Res; 2017 Clinical Cancer Research

Role of miR-193a-3p in UC-Associated Neoplasia

of our studies, we confirmed and thereby validated changes of aberrant nuclear localization of MEK 1 and 2 leading to carcino- miR-193a-3p in an independent cohort. Although miR-193a-3p genesis. They also reported low baseline levels of IL17RD in colon has not been reported as downregulated in previous studies cancer cell lines, adenomas, and invasive carcinoma (45). examining IBD-neoplasia, a direct real time PCR analysis of Although we found similar low baseline expression of IL17RD this miRNA was not performed in the majority of prior analyses in HCT116 cells and low immunohistochemical staining in (16, 28, 15). normal controls, we identified markedly elevated IL17RD expres- miR-193a is located on chromosome 17. During processing, sion in malignant colonocytes in IBD and sporadic colon cancers. the hairpin precursor miRNA is cleaved into mature miR-193a-3p This discrepancy may be explained from the fact that the previous and miR-193a-5p. miR-193a-3p has been reported as downregu- analysis only examined one cancer, and we demonstrate that in lated in breast, medullary thyroid cancer, as well as non–small cell some cancers staining is minimal or patchy. The finding that and squamous cell lung cancer (34–38). Although there are IL17RD upregulation in the presence of EGF promotes cellular limited data on expression of this miRNA in colon cancer, a proliferation, combined with demonstration that IL17RD is previous study demonstrated that overexpression of miR-193a upregulated in a large number of IBD-cancers as assessed by both decreased cell proliferation and tumor growth in HT-29 and HCT- real-time PCR and immunohistochemistry, supports our conten- 116 tumor xenograft experiments (39). We confirmed the anti- tion of its oncogenic role in IBD-associated colon cancer. proliferative effects of miR-193a-3p in HCT116 tumor xenografts Even though we were able to demonstrate concomitant down- further supporting the tumor-suppressor role of this miRNA. regulation of miR-193a-3p in association with upregulation of Additional support for the role of miR-193a-3p in IBD comes IL17RD in the same tissues, the cell-specific localization of miR- from a recent publication, which demonstrated that downregula- 193a-3p regulation of IL17RD remains uncertain. Although miR- tion of this miRNA occurs in active ulcerative colitis and intra- 193a-3p is expressed in the epithelial cell, expression levels are colonic delivery of miR-193a-3p ameliorated dextran sodium higher in stroma cells of normal colons. By immunohistochem- sulfate–induced colitis (33). istry, IL17RD is expressed primarily in the stromal cells in normal miR-193a is located in a CpG island. In other cancer types, controls, although over-expression of IL17RD in IBD-cancer including leukemia, oral cancer, and non–small cell lung cancer, appears to be predominantly in malignant colonocytes. For this hypermethylation at the DNA loci of miR-193a has been associ- reason, we hypothesize that colonocyte miR-193a-3p downregu- ated with decreased expression of this miRNA (40–42). In con- lation contributes to IL17RD upregulation in epithelial cells trast with other cancers, we did not identify changes in methyl- (colonocytes) of IBD-cancers. Other factors are also likely driving ation associated with decreased expression of this miRNA in IBD- IL17RD upregulation in cancer cells. In this regard, stromal cell- associated neoplasia. In fact, expression of the primary transcript and colonocyte-specific regulation of IL17RD by miR193a-3p will of miR-193a was not different between normal controls and IBD- require further study. associated cancer. These results indicate that downregulation of In conclusion, we identified several dysregulated miRNAs, this miRNA in IBD-associated cancer occurs posttranscriptionally, including downregulation of the tumor-suppressor miR-193a- most likely secondary to dysregulation of processing or stability of 3p, in IBD-associated colon cancer and adjacent non-dysplastic the mature miRNA in neoplastic tissue. mucosa. In addition, we were able to demonstrate a novel IL17RD (aka hSEF) is a predicted target miR-193a-3p based on mechanism of carcinogenesis whereby loss of miR-193a-3p upre- three possible binding sites in the 30UTR of IL17RD that com- gulates expression of IL-17RD. Despite the fact that we focused plement the miRNA seed sequence. Prior studies have concluded our investigations on miR-193a-3p, it is likely that additional that IL17RD has several mechanistic properties, including func- miRNA-regulated pathways are important in inflammation asso- tioning as an orphan receptor to potentiate IL17 signaling (43). ciated colon cancer. Although miRNAs have not been widely used Interestingly, IL17RD has been described to inhibit tumorigenesis clinically for therapeutics to date, several in vivo delivery in vitro through antagonistic effects on fibroblast growth factor approaches have been developed and are currently being inves- (FGF) signaling and inhibition of MAP kinase (MAPK) signaling tigated in clinic trials (46, 47). Using these or alternative methods, (22, 26, 44). In contrast with this tumor-suppressing mechanism, the miR-193a-3p-IL17RD pathway is a potential target for future Ren and colleagues (27) demonstrated a dual role of IL17RD chemopreventive approaches in this high-risk population. whereby IL17RD potentiates EGF-mediated MAPK signaling in the presence of EGF, whereas it exerts opposing effects in the Disclosure of Potential Conflicts of Interest fi presence of FGF. Our ndings support this mechanism as basal J.H. Kwon reports receiving speakers bureau honoraria from Takeda Phar- cell proliferation was inhibited by IL17RD in the absence of EGF maceuticals and is a consultant/advisory board member for Pfizer Pharmaceu- treatment, but IL17RD transfection increased cell proliferation in ticals. No potential conflicts of interest were disclosed by the other authors. the presence of EGF. In addition, in cells stably transfected with a plasmid coding for IL17RD with wild-type 30UTR miR-193a-3p Authors' Contributions decreased pAKT, pERK, and pERBB2 in vitro and reduced tumor Conception and design: J. Pekow, J.H. Kwon, M. Bissonnette xenograft growth in vivo compared with cells expressing IL17RD 0 Development of methodology: J. Pekow, K. Meckel, U. Dougherty, X. Chen, with mutant 3 UTR. Taken together, our data support the hypoth- A. Almoghrabi, Z. Deng, H.I. Haider, M. Bissonnette esis that by preventing EGFR degradation and enhancing EGFR Acquisition of data (provided animals, acquired and managed patients, signaling, IL17RD upregulation mediated by loss of miR-193a-3p provided facilities, etc.): J. Pekow, K. Meckel, X. Chen, A. Almoghrabi, may be an important mechanism driving colon cancer growth in F. Ayaloglu-Butun, Z. Deng, J. Hart, J.H. Kwon patients with IBD. Analysis and interpretation of data (e.g., statistical analysis, biostatistics, computational analysis): J. Pekow, K. Meckel, Y. Huang, X. Chen, R. Mustafi, Only one previous study has examined the impact of IL17RD in D.T. Rubin, M. Bissonnette colon cancer (45). The authors of this in vitro study demonstrated Writing, review, and/or revision of the manuscript: J. Pekow, K. Meckel, that RAS downregulation of IL17RD in colon cancers results in D.T. Rubin, M. Bissonnette

www.aacrjournals.org Clin Cancer Res; 2017 OF9

Pekow et al.

Administrative, technical, or material support (i.e., reporting or organizing The costs of publication of this article were defrayed in part by the data, constructing databases): J. Pekow, K. Meckel, X. Chen, H.I. Haider, payment of page charges. This article must therefore be hereby marked D.T. Rubin, J.H. Kwon advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate Study supervision: J. Pekow, M. Bissonnette this fact.

Grant Support The Valerie and Lee Shapiro Family, NIH K08DK090152 (to J. Pekow), NIH Received January 19, 2017; revised May 2, 2017; accepted June 5, 2017; P40K42086 (University of Chicago DDRCC). published OnlineFirst June 9, 2017.

References 1. Eaden JA, Abrams KR, Mayberry JF. The risk of colorectal cancer in ulcerative 21. Reid Y, Storts D, Riss T, Minor L. Authentication of human cell lines by STR colitis: a meta-analysis. Gut 2001;48:526–35. DNA profiling analysis. In:Sittampalam GS, Coussens NP, Nelson H, Arkin 2. Rutter MD, Saunders BP, Wilkinson KH, Rumbles S, Schofield G, Kamm M, Auld D, Austin C, et al. , editors.Assay Guidance Manual. Bethesda (MD) MA, et al. Thirty-year analysis of a colonoscopic surveillance program for 2004. neoplasia in ulcerative colitis. Gastroenterology 2006;130:1030–8. 22. Xiong S, Zhao Q, Rong Z, Huang G, Huang Y, Chen P, et al. hSef 3. Bartel DPMicroRNAs: genomics, biogenesis, mechanism, and function. inhibits PC-12 cell differentiation by interfering with Ras-mitogen- Cell 2004;116:281–97. activated protein kinase MAPK signaling. J Biol Chem 2003;278: 4. Schetter AJ, Leung SY, Sohn JJ, Zanetti KA, Bowman ED, Yanaihara N, et al. 50273–82. MicroRNA expression profiles associated with prognosis and therapeutic 23. Tuominen VJ, Ruotoistenmaki S, Viitanen A, Jumppanen M, Isola J. outcome in colon adenocarcinoma. JAMA 2008;299:425–36. ImmunoRatio: a publicly available web application for quantitative image 5. Schepeler T, Reinert JT, Ostenfeld MS, Christensen LL, Silahtaroglu AN, analysis of estrogen receptor (ER), progesterone receptor (PR), and Ki-67. Dyrskjot L, et al. Diagnostic and prognostic microRNAs in stage II colon Breast Cancer Res 2010;12:R56. cancer. Cancer Res 2008;68:6416–24. 24. Pekow JR, Dougherty U, Mustafi R, Zhu H, Kocherginsky M, Rubin DT, et al. 6. Volinia S, Calin GA, Liu CG, Ambs S, Cimmino A, Petrocca F, et al. A miR-143 and miR-145 are downregulated in ulcerative colitis: putative microRNA expression signature of human solid tumors defines cancer gene regulators of inflammation and protooncogenes. Inflammatory Bowel Dis targets. Proc Natl Acad Sci U S A 2006;103:2257–61. 2012;18:94–100. 7. Michael MZ, SM OC, van Holst Pellekaan NG, Young GP, James RJ. 25. Agarwal V, Bell GW, Nam JW, Bartel DP. Predicting effective microRNA Reduced accumulation of specific microRNAs in colorectal neoplasia. Mol target sites in mammalian mRNAs. Elife 2015;4. Cancer Res 2003;1:882–91. 26. Yang RB, Ng CK, Wasserman SM, Komuves LG, Gerritsen ME, Topper JN. A 8. Liu W, Mao SY, Zhu WY. Impact of tiny miRNAs on cancers. World J novel interleukin-17 receptor-like protein identified in human umbilical Gastroenterol 2007;13:497–502. vein endothelial cells antagonizes basic fibroblast growth factor-induced 9. Ambros V.The functions of animal microRNAs. Nature 2004;431:350–5. signaling. J Biol Chem 2003;278:33232–8. 10. O'Connell RM, Taganov KD, Boldin MP, Cheng G, Baltimore D. Micro- 27. Ren Y, Cheng L, Rong Z, Li Z, Li Y, Zhang X, et al. hSef potentiates EGF- RNA-155 is induced during the macrophage inflammatory response. Proc mediated MAPK signaling through affecting EGFR trafficking and degra- Natl Acad Sci U S A 2007;104:1604–9. dation. Cellular signalling 2008;20:518–33. 11. Wu F, Zikusoka M, Trindade A, Dassopoulos T, Harris ML, Bayless TM, et al. 28. Ludwig K, Fassan M, Mescoli C, Pizzi M, Balistreri M, Albertoni L, et al. MicroRNAs are differentially expressed in ulcerative colitis and alter PDCD4/miR-21 dysregulation in inflammatory bowel disease-associated expression of macrophage inflammatory peptide-2 alpha. Gastroenterol- carcinogenesis. Virchows Arch 2013;462:57–63. ogy 2008;135:1624–35 e24. 29. Cekaite L, Rantala JK, Bruun J, Guriby M, Agesen TH, Danielsen SA, et al. 12. Pekow JR, Dougherty U, Mustafi R, Zhu H, Kocherginsky M, Rubin DT, et al. MiR-9, -31, and -182 deregulation promote proliferation and tumor cell miR-143 and miR-145 are downregulated in ulcerative colitis: putative survival in colon cancer. Neoplasia 2012;14:868–79. regulators of inflammation and protooncogenes. Inflamm Bowel Dis 30. Hu S, Dong TS, Dalal SR, Wu F, Bissonnette M, Kwon JH, et al. The 2012;18:94–100 microbe-derived short chain fatty acid butyrate targets miRNA-depen- 13. Pekow JR, Kwon JH. MicroRNAs in inflammatory bowel disease. Inflamm dent p21 gene expression in human colon cancer. PLoS ONE 2011;6: Bowel Dis 2012;18:187–93. e16221. 14. Olaru AV, Selaru FM, Mori Y, Vazquez C, David S, Paun B, et al. Dynamic 31. Tazawa H, Tsuchiya N, Izumiya M, Nakagama H. Tumor-suppressive miR- changes in the expression of MicroRNA-31 during inflammatory bowel 34a induces senescence-like growth arrest through modulation of the E2F disease-associated neoplastic transformation. Inflamm Bowel Dis pathway in human colon cancer cells. Proc Natl Acad Sci U S A 2011;17:221–31. 2007;104:15472–7. 15. Kanaan Z, Rai SN, Eichenberger MR, Barnes C, Dworkin AM, Weller C, et al. 32. Gao J, Li N, Dong Y, Li S, Xu L, Li X, et al. miR-34a-5p suppresses colorectal Differential microRNA expression tracks neoplastic progression in inflam- cancer metastasis and predicts recurrence in patients with stage II/III matory bowel disease-associated colorectal cancer. Hum Mutat colorectal cancer. Oncogene 2015;34:4142–52. 2012;33:551–60. 33. Dai X, Chen X, Chen Q, Shi L, Liang H, Zhou Z, et al. MicroRNA-193a-3p 16. Svrcek M, El-Murr N, Wanherdrick K, Dumont S, Beaugerie L, Cosnes J, et al. reduces intestinal inflammation in response to microbiota via down- Overexpression of microRNAs-155 and 21 targeting mismatch repair regulation of colonic PepT1. J Biol Chem 2015;290:16099–115. proteins in inflammatory bowel diseases. Carcinogenesis 2013;34:828–34. 34. Yang Y, Li X, Yang Q, Wang X, Zhou Y, Jiang T, et al. The role of microRNA in 17. Olaru AV, Yamanaka S, Vazquez C, Mori Y, Cheng Y, Abraham JM, et al. human lung squamous cell carcinoma. Cancer Genet Cytogenet MicroRNA-224 negatively regulates p21 expression during late neoplastic 2010;200:127–33. progression in inflammatory bowel disease. Inflammatory Bowel Dis 35. Tahiri A, Leivonen SK, Luders T, Steinfeld I, Ragle Aure M, Geisler J, et al. 2013;19:471–80. Deregulation of cancer-related miRNAs is a common event in both 18. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using benign and malignant human breast tumors. Carcinogenesis 2014;35: real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 76–85. 2001;25:402–8. 36. Uhlmann S, Mannsperger H, Zhang JD, Horvat EA, Schmidt C, Kublbeck M, 19. Rohde C, Zhang Y, Reinhardt R, Jeltsch A. BISMA–fast and accurate bisulfite et al. Global microRNA level regulation of EGFR-driven cell-cycle protein sequencing data analysis of individual clones from unique and repetitive network in breast cancer. Mol Syst Biol 2012;8:570. sequences. BMC Bioinformatics 2010;11:230. 37. Yu T, Li J, Yan M, Liu L, Lin H, Zhao F, et al. MicroRNA-193a-3p and -5p 20. Pekow J, Dougherty U, Huang Y, Gometz E, Nathanson J, Cohen G, et al. suppress the metastasis of human non–small cell lung cancer by down- Gene signature distinguishes patients with chronic ulcerative colitis harbor- regulating the ERBB4/PIK3R3/mTOR/S6K2 signaling pathway. Oncogene ing remote neoplastic lesions. Inflammatory Bowel Dis 2013;19:461–70. 2015;34:413–23.

OF10 Clin Cancer Res; 2017 Clinical Cancer Research

Role of miR-193a-3p in UC-Associated Neoplasia

38. Santarpia L, Calin GA, Adam L, Ye L, Fusco A, Giunti S, et al. A miRNA 43. Rong Z, Wang A, Li Z, Ren Y, Cheng L, Li Y, et al. IL-17RD (Sef or IL-17RLM) signature associated with human metastatic medullary thyroid carcinoma. interacts with IL-17 receptor and mediates IL-17 signaling. Cell Res Endocr Relat Cancer 2013;20:809–23. 2009;19:208–15. 39. Iliopoulos D, Rotem A, Struhl K. Inhibition of miR-193a expression by Max 44. Ren Y, Cheng L, Rong Z, Li Z, Li Y, Li H, et al. hSef co-localizes and interacts and RXRalpha activates K-Ras and PLAU to mediate distinct aspects of with Ras in the inhibition of Ras/MAPK signaling pathway. Biochem cellular transformation. Cancer Res 2011;71:5144–53. Biophys Res Commun 2006;347:988–93. 40. Gao XN, Lin J, Li YH, Gao L, Wang XR, Wang W, et al. MicroRNA-193a 45. Duhamel S, Hebert J, Gaboury L, Bouchard A, Simon R, Sauter G, et al. Sef represses c-kit expression and functions as a methylation-silenced tumor downregulation by Ras causes MEK1/2 to become aberrantly nuclear suppressor in acute myeloid leukemia. Oncogene 2011;30:3416–28. localized leading to polyploidy and neoplastic transformation. Cancer 41. Kozaki K, Imoto I, Mogi S, Omura K, Inazawa J. Exploration of tumor- Res 2012;72:626–35. suppressive microRNAs silenced by DNA hypermethylation in oral cancer. 46. Chapman CG, Pekow J. The emerging role of miRNAs in Cancer Res 2008;68:2094–105. inflammatory bowel disease: a review. Therap Adv Gastroenterol 2015;8: 42. Heller G, Weinzierl M, Noll C, Babinsky V, Ziegler B, Altenberger C, et al. 4–22. Genome-wide miRNA expression profiling identifies miR-9–3 and miR- 47. Christopher AF, Kaur RP, Kaur G, Kaur A, Gupta V, Bansal P. MicroRNA 193a as targets for DNA methylation in non–small cell lung cancers. Clin therapeutics: discovering novel targets and developing specific therapy. Cancer Res 2012;18:1619–29. Perspect Clin Res 2016;7:68–74.

www.aacrjournals.org Clin Cancer Res; 2017 OF11

miR-193a-3p is a Key Tumor Suppressor in Ulcerative Colitis −Associated Colon Cancer and Promotes Carcinogenesis through Upregulation of IL17RD

Joel Pekow, Katherine Meckel, Urszula Dougherty, et al.

Clin Cancer Res Published OnlineFirst June 9, 2017.

Updated version Access the most recent version of this article at: doi:10.1158/1078-0432.CCR-17-0171

Supplementary Access the most recent supplemental material at: Material http://clincancerres.aacrjournals.org/content/suppl/2017/06/09/1078-0432.CCR-17-0171.DC1

E-mail alerts Sign up to receive free email-alerts related to this article or journal.

Reprints and To order reprints of this article or to subscribe to the journal, contact the AACR Publications Subscriptions Department at [email protected].

Permissions To request permission to re-use all or part of this article, use this link http://clincancerres.aacrjournals.org/content/early/2017/07/28/1078-0432.CCR-17-0171. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC) Rightslink site.