DOCSLIB.ORG

Mir-193A-3P Is a Key Tumor Suppressor in Ulcerative Colitis

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Mir-193A-3P Is a Key Tumor Suppressor in Ulcerative Colitis Published OnlineFirst June 9, 2017; DOI: 10.1158/1078-0432.CCR-17-0171 Biology of Human Tumors Clinical Cancer Research miR-193a-3p is a Key Tumor Suppressor in Ulcerative Colitis–Associated Colon Cancer and Promotes Carcinogenesis through Upregulation of IL17RD Joel Pekow1, Katherine Meckel1, Urszula Dougherty1, Yong Huang1, Xindi Chen1, Anas Almoghrabi1, Reba Mustafi1, Fatma Ayaloglu-Butun1, Zifeng Deng1, Haider I. Haider1, John Hart2, David T. Rubin1, John H. Kwon3, and Marc Bissonnette1 Abstract Purpose: Patients with ulcerative colitis are at increased risk adjacent tissue. Significant down-regulation of miR-193a-3p for colorectal cancer, although mechanisms underlying neo- was also seen in an independent cohort of ulcerative colitis plastic transformation are poorly understood. We sought to cancers. Changes in methylation of miR-193a or expression of evaluate the role of microRNAs in neoplasia development in pri-miR-193a were not observed in ulcerative colitis cancer. this high-risk population. Transfection of miR-193a-3p resulted in decreased prolifera- Experimental Design: Tissue from 12 controls, 9 ulcerative tion, and identified IL17RD as a direct target of miR-193a-3p. colitis patients without neoplasia, and 11 ulcerative colitis IL17RD expression was increased in ulcerative colitis cancers, patients with neoplasia was analyzed. miRNA array analysis was and miR-193a-3p treatment decreased growth and EGFR sig- performed and select miRNAs assayed by real-time PCR on the naling of HCT116 cells in xenografts expressing both IL17RD discovery cohort and a validation cohort. DNA methylation of with WT 30UTR compared with cells expressing IL17RD with miR-193a was assessed. Following transfection of miR-193a-3p, mutant 30UTR. proliferation, IL17RD expression, and luciferase activity of the Conclusions: miR-193a-3p is downregulated in ulcerative 30UTR of IL17RD were measured. Tumor growth in xenografts as colitisneoplasia,anditslosspromotescarcinogenesisthrough well as EGFR signaling were assessed in HCT116 cells expressing upregulation of IL17RD. These findings provide novel insight IL17RD with either a mutant 30 untranslated region (UTR) or into inflammation-driven colorectal cancer and could suggest wild-type (WT) 30UTR. new therapeutic targets in this high-risk population. Clin Cancer Results: miR-31, miR-34a, miR-106b, and miR-193a-3p were Res; 1–11. Ó2017 AACR. significantly dysregulated in ulcerative colitis-neoplasia and Introduction Gene expression is regulated in part by a class of non-coding RNAs, termed microRNAs (miRNA). These small RNAs regulate Patients with long-standing ulcerative colitis are at increased 0 gene expression by binding to the 3 untranslated region (UTR) of risk for colorectal cancer (1, 2). Although many mechanisms of messenger RNA (mRNA) and either inhibit protein translation or carcinogenesis in IBD remain unknown, neoplastic lesions likely destabilize target mRNA (3). Changes in miRNA expression have result from a combination of genetic alterations, inflammatory been implicated in the pathogenesis of many cancer types, mediators, and activation of cell signaling pathways. Discovery of including colon cancer (4–7). miRNAs control the expression of novel genomic mediators of these pathways could greatly facil- signaling molecules and play important roles in cell growth (8). itate risk stratification as well as treatment and chemoprevention As such, growth promoting or cell death inhibiting miRNAs, if strategies. upregulated, could act as gain-of-function oncogenes, whereas growth suppressing or cell death enhancing mRNAs, if down- regulated, could act as loss-of-function tumor suppressors (9). 1University of Chicago, Section of Gastroenterology, Hepatology, and Nutrition, Prior studies, including analyses from our group, indicate that Chicago, Illinois. 2University of Chicago, Department of Pathology, Chicago, fi – 3 the miRNA pro le changes in chronic ulcerative colitis associated Illinois. University of Texas Southwestern, Digestive and Liver Disease Division, inflammation (10–13). Several small studies have also demon- Dallas, Texas. strated dysregulation of multiple miRNAs, including miR-31, Note: Supplementary data for this article are available at Clinical Cancer miR-21, and miR-224, in IBD-associated neoplastic tissue Research Online (http://clincancerres.aacrjournals.org/). (14–17). However, alterations in miRNA expression have not Corresponding Author: Joel Pekow, University of Chicago, KCBD, 900 East 57th been examined globally in a large subset of patients with Street, MB #9, Chicago, IL 60637. Phone: 773-702-7895; Fax: 773-702-2180; advanced ulcerative colitis–associated neoplasia, nor have E-mail: [email protected] miRNA changes been described in non-dysplastic tissue adjacent doi: 10.1158/1078-0432.CCR-17-0171 to a neoplastic lesion. In addition, there has been limited eval- Ó2017 American Association for Cancer Research. uation of the functional role of miRNAs dysregulated in www.aacrjournals.org OF1 Downloaded from clincancerres.aacrjournals.org on September 27, 2021. © 2017 American Association for Cancer Research. Published OnlineFirst June 9, 2017; DOI: 10.1158/1078-0432.CCR-17-0171 Pekow et al. RNA and DNA extraction Translational Relevance RNA and DNA were extracted from FFPET and fresh-frozen Approximately 1.6 million Americans have inflammatory samples as described in the Supplementary Materials and bowel disease (IBD), which is comprised of Crohn's disease Methods. and ulcerative colitis. Patients with long-standing colonic fl in ammation related to IBD have a high-risk of developing Nanostring analysis colonic neoplasia. Although cancer in IBD differs from spo- miRNA analysis was performed using the Nanostring nCounter radic colon cancer in clinical presentation, progression from expression assay v1 per the manufacturer's specifications. Details dysplasia, and outcome, few studies have mechanistically regarding the analysis of array data are presented in the Supple- examined the pathogenesis of neoplasia in IBD using human mentary Materials and Methods. samples. In this study, we investigated miRNA expression in ulcerative colitis–associated cancer and report that loss of the tumor suppressor, miR-193a-3p, promotes colon carcinogen- Real-time PCR esis in patients with ulcerative colitis. These findings uncover a Quantitative real-time PCR was performed to assess expression novel mechanism of inflammation-associated colon cancer of miR-31, miR-34a, miR-106b, miR-193a-3p, miR-376, miR- IL17RD that has the potential to be used as a target for chemopreven- 497, pri-miR-193a, and as detailed in the Supplementary Materials and Methods. Results were normalized to beta-actin, tion and treatment in this high-risk population. ÀDD comparisons made between groups using the 2 CT method (18), and significance calculated using the Student t test. inflammatory bowel disease (IBD)-carcinogenesis. In this study, Genomic bisulfite sequencing we describe miRNA changes occurring in both IBD-neoplasia as DNA bisulfite treatment was carried out using the Qiagen well as adjacent non-dysplastic tissue and investigate the func- Epitect Bisulfite Kit per the manufacturer's directions. Primers tional role of the tumor suppressor, miR-193a-3p, and a putative for miR-193a designed with methprimer software (L: TTTGAGG- target which potentiates EGFR signaling, interleukin 17 receptor D GATATTTAGAGTTT, R: AACCTAAAAAACAACCTAACC). PCR, (IL17RD), in ulcerative colitis–associated cancer. subcloning of products, and sequencing were carried out as described in the Supplementary Materials and Methods. Analysis Materials and Methods and visualization of CpG dinucleotide methylation were per- formed using BISMA software (http://services.ibc.uni-stuttgart. Tissue de/BDPC/BISMA; ref. 19). Discovery cohort. The study was approved by the institutional review board at the University of Chicago (IRB# 11-0411 and 10- Immunohistochemistry fi fi 209A). Archived formalin- xed paraf n-embedded tissues Immunohistochemistry was carried out as previously described (FFPET) were obtained from normal controls and patients with using antigen retrieval with a citrate buffer and primary antibody ulcerative colitis who underwent a colectomy. Three groups of for IL17RD at a concentration of 1:15 (R & D Systems; ref. 20). patients were examined: Normal controls (N, n ¼ 12), ulcerative colitis patients without neoplasia (ulcerative colitis, n ¼ 9), and ulcerative colitis patients with neoplasia (n ¼ 11). From the Colonocyte Isolation n ¼ ulcerative colitis patients with neoplasia, two separate tissues Colon biopsies ( 6-12/subject) were collected from the þ were analyzed, ulcerative colitis–associated neoplastic tissue sigmoid colon and stored for up to 6 hours at 4 C in transport 2þ 2þ (UCN, n ¼ 10; high-grade dysplasia [HGD]-4, colorectal cancer media which consists of Mg and Ca -free PBS containing 50 m [CRC]-6), and nondysplastic ulcerative colitis tissue adjacent to a IU/mL penicillin, 50 g/mL streptomycin and 0.5 mg/mL genta- neoplastic lesion (nUCaN, n ¼ 10). The tissue adjacent to the mycin. Isolation of colonocyte and stromal fractions was per- neoplastic lesion was obtained from the archived FFPET in closest formed as detailed in the Supplementary Materials and Methods. proximity to the neoplastic lesion. Baseline demographics, site of sample collection, and medication usage for each group is pre- Cell Culture sented in Supplementary Table S1. Additional information on the HCT116, DLD-1, LoVo, and HT29 colon cancer cells,
Load more

Recommended publications
  • Cytokine Nomenclature
    RayBiotech, Inc. The protein array pioneer company Cytokine Nomenclature Cytokine Name Official Full Name Genbank Related Names Symbol 4-1BB TNFRSF Tumor necrosis factor NP_001552 CD137, ILA, 4-1BB ligand receptor 9 receptor superfamily .2. member 9 6Ckine CCL21 6-Cysteine Chemokine NM_002989 Small-inducible cytokine A21, Beta chemokine exodus-2, Secondary lymphoid-tissue chemokine, SLC, SCYA21 ACE ACE Angiotensin-converting NP_000780 CD143, DCP, DCP1 enzyme .1. NP_690043 .1. ACE-2 ACE2 Angiotensin-converting NP_068576 ACE-related carboxypeptidase, enzyme 2 .1 Angiotensin-converting enzyme homolog ACTH ACTH Adrenocorticotropic NP_000930 POMC, Pro-opiomelanocortin, hormone .1. Corticotropin-lipotropin, NPP, NP_001030 Melanotropin gamma, Gamma- 333.1 MSH, Potential peptide, Corticotropin, Melanotropin alpha, Alpha-MSH, Corticotropin-like intermediary peptide, CLIP, Lipotropin beta, Beta-LPH, Lipotropin gamma, Gamma-LPH, Melanotropin beta, Beta-MSH, Beta-endorphin, Met-enkephalin ACTHR ACTHR Adrenocorticotropic NP_000520 Melanocortin receptor 2, MC2-R hormone receptor .1 Activin A INHBA Activin A NM_002192 Activin beta-A chain, Erythroid differentiation protein, EDF, INHBA Activin B INHBB Activin B NM_002193 Inhibin beta B chain, Activin beta-B chain Activin C INHBC Activin C NM005538 Inhibin, beta C Activin RIA ACVR1 Activin receptor type-1 NM_001105 Activin receptor type I, ACTR-I, Serine/threonine-protein kinase receptor R1, SKR1, Activin receptor-like kinase 2, ALK-2, TGF-B superfamily receptor type I, TSR-I, ACVRLK2 Activin RIB ACVR1B
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Open Chen-Thesis Finalv5.Pdf
    The Pennsylvania State University The Graduate School Department of Neural and Behavioral Sciences EPIGENETIC ANALYSIS OF IMMUNE ASSOCIATED SIGNALING MOLECULES DURING MOUSE RETINA DEVELOPMENT A Thesis in Anatomy by Chen Yang © 2013 Chen Yang Submitted in Partial Fulfillment of the Requirements for the Degree of Master of Science May 2013 The thesis of Chen Yang was reviewed and approved* by the following: Samuel Shao-Min Zhang Assistant Professor of Neural and Behavioral Sciences Thesis Advisor Colin J. Barnstable Department Head of Neural and Behavioral Sciences Professor of Neural and Behavioral Sciences Patricia J. McLaughlin Professor of Neural and Behavioral Sciences Director of Graduate Program in Anatomy *Signatures are on file in the Graduate School. ii ABSTRACT The retina is an immune-privileged organ. Many autoimmune diseases, such as AMD, glaucoma, and diabetic retinopathy, are caused by excessive inflammatory responses targeting self-tissue. The physiological functions of extracellular and intracellular signaling molecules of immune responses have been well characterized. The epigenetic aspects of these molecules in the retina, however, have not been well elucidated. In this study, we examined the expression of selected immune-related genes, and their transcriptional accessibility via epigenetic mapping, cluster analysis, and RT-PCR. Among these genes, interleukin receptor related genes and intracellular signaling molecules exhibit higher transcriptional accessibility. Epigenetic mapping of the toll-like receptor (TLR) family revealed that 3 out of 13 TLRs exhibit H3K4me2 accumulation during retina development, suggesting that TLR2, TLR3, and TLR9 are the only TLR members expressed in the retina. Most of the NF-κB signaling molecules exhibited transcriptional accessibility, implying their essential roles in inflammatory regulation during retina maturation.
    [Show full text]
  • IL-17A ELISA Kit
    Supplemental Materials: Contains Methods, Supplemenral text, Supplemental Figure Legend, Supplemental References. Supplemental Methods: Experimental model of acute alcoholic steatohepatitis (the NIAAA model: chronic ethanol Lieber-DeCarlie diet + single alcohol binge)1. Mice (♂ C57BL/6, 12 w old, n=7/group, 2 independent experiments) were fed with a liquid diet containing 5% ethanol for 10 days, and at day 11 gavaged with a single dose of ethanol (5g/kg, 20% ethanol), and sacrificed 9 h post binge. Control littermates were pair-fed with 9 g maltose dextrin/kg of body weight. Experimental model of chronic alcoholic steatohepatitis (chronic ethanol Lieber- DeCarlie diet + weekly binges2): Mice (♂ C57BL/6, 12 w old, n=8-10/group, 2 independent experiments) were fed ad libitum for 2 weeks with a liquid “Western diet” (high in cholesterol (1%) and saturated fat (27% Cal), followed by 8 weeks of an ethanol- containing Western diet. Ethanol intake was gradually increased from 1% (w/v) on day 1 to 4.5% (w/v) on day 12 until the end of 8th week of feeding. From the second week of ethanol feeding, a weekly binge dose of ethanol (gradually increased from 3.5 g/kg to 4.5 g/kg) was given via a stomach tube and repeated 7 times. Mice were sacrificed 24 h after the alcohol-binge treatment. Detection of serum IL17A in patients with severe alcohol use disorder. Healthy controls (n=18, non-smokers without underlying medical illnesses) were recruited at the Roudebush Veterans Administration Medical Center (Indianapolis, IN). Excessive drinkers (n=57, defined by NIH/NIAAA guideline: ≥ 21 years of age; > 4 standard drinks/day (or >14 drinks/week) in men; and > 3 drinks/day (or >7 drinks/week) in women3 were recruited from Fairbanks Drug and Alcohol Treatment Center (Indianapolis, IN).
    [Show full text]
  • Human Colon Cancer Primer Library
    Human Colon Cancer Primer Library Catalog No: HCCR-1 Supplier: RealTimePrimers Lot No: XXXXX Supplied as: solid Stability: store at -20°C Description Contains 88 primer sets directed against cytokine and chemokine receptor genes and 8 housekeeping gene primer sets. Provided in a 96-well microplate (20 ul - 10 uM). Perform up to 100 PCR arrays (based on 20 ul assay volume per reaction). Just add cDNA template and SYBR green master mix. Gene List: • CCR1 chemokine (C-C motif) receptor 1 • IL11RA interleukin 11 receptor, alpha • CCR2 chemokine (C-C motif) receptor 2 • IL11RB interleukin 11 receptor, beta • CCR3 chemokine (C-C motif) receptor 3 • IL12RB1 interleukin 12 receptor, beta 1 • CCR4 chemokine (C-C motif) receptor 4 • IL12RB2 interleukin 12 receptor, beta 2 • CCR5 chemokine (C-C motif) receptor 5 • IL13RA1 interleukin 13 receptor, alpha 1 • CCR6 chemokine (C-C motif) receptor 6 • IL13RA2 interleukin 13 receptor, alpha 2 • CCR7 chemokine (C-C motif) receptor 7 • IL15RA interleukin 15 receptor, alpha • CCR8 chemokine (C-C motif) receptor 8 • IL15RB interleukin 15 receptor, beta • CCR9 chemokine (C-C motif) receptor 9 • IL17RA interleukin 17 receptor A • CCR10 chemokine (C-C motif) receptor 10 • IL17RB interleukin 17 receptor B • CX3CR1 chemokine (C-X3-C motif) receptor 1 • IL17RC interleukin 17 receptor C • CXCR1 chemokine (C-X-C motif) receptor 1 • IL17RD interleukin 17 receptor D • CXCR2 chemokine (C-X-C motif) receptor 2 • IL17RE interleukin 17 receptor E • CXCR3 chemokine (C-X-C motif) receptor 3 • IL18R1 interleukin 18 receptor
    [Show full text]
  • Predicting the Potential Ankylosing Spondylitis-Related Genes Utilizing Bioinformatics Approaches
    Rheumatol Int (2015) 35:973–979 Rheumatology DOI 10.1007/s00296-014-3178-9 INTERNATIONAL ORIGINAL ARTICLE - GENES AND DISEASE Predicting the potential ankylosing spondylitis-related genes utilizing bioinformatics approaches Hao Zhao · Dan Wang · Deyu Fu · Luan Xue Received: 25 August 2014 / Accepted: 11 November 2014 / Published online: 29 November 2014 © Springer-Verlag Berlin Heidelberg 2014 Abstract Given that ankylosing spondylitis (AS) occurs down-regulated genes. These DEGs were significantly in approximately 5 out of 1,000 adults of European descent enriched in phosphorylation (p 1.21E 05) and positive = − and the unclear pathogenesis, the aim of the research was regulation of gene expression (p 1.25E 03). Further- = − to further predict the molecular mechanism of this dis- more, one module was screened out from the up-regulated ease. The Affymetrix chip data GSE25101 were available network, which contained 39 nodes and 205 edges. More- from Gene Expression Omnibus database. First of all, dif- over, the nodes in the module were significantly enriched ferentially expressed genes (DEGs) were identified by in ribosomal protein (RPL17, ribosomal protein L17 and Limma package in R. Moreover, DAVID was used to per- MRPL22, mitochondrial ribosomal protein L22) and pro- form gene set enrichment analysis of DEGs. In addition, teasome (PSMA6, proteasome subunit, alpha type 6, miRanda, miRDB, miRWalk, RNA22 and TargetScan were PSMA4)-related domains. Our findings that might explore applied to predict microRNA-target associations. Mean- the potential pathogenesis of AS and RPL17, MRPL22, while, STRING 9.0 was utilized to collect protein–protein PSMA6 and PSMA4 have the potential to be the biomark- interactions (PPIs) with confidence score >0.4.
    [Show full text]
  • T Cells Favoring Tumor Growth CCR5-Dependent Recruitment Of
    Tumor-Infiltrating Monocytic Myeloid-Derived Suppressor Cells Mediate CCR5-Dependent Recruitment of Regulatory T Cells Favoring Tumor Growth This information is current as of September 27, 2021. Eva Schlecker, Ana Stojanovic, Christian Eisen, Christian Quack, Christine S. Falk, Viktor Umansky and Adelheid Cerwenka J Immunol 2012; 189:5602-5611; Prepublished online 14 November 2012; Downloaded from doi: 10.4049/jimmunol.1201018 http://www.jimmunol.org/content/189/12/5602 http://www.jimmunol.org/ Supplementary http://www.jimmunol.org/content/suppl/2012/11/14/jimmunol.120101 Material 8.DC1 References This article cites 49 articles, 28 of which you can access for free at: http://www.jimmunol.org/content/189/12/5602.full#ref-list-1 Why The JI? Submit online. by guest on September 27, 2021 • Rapid Reviews! 30 days* from submission to initial decision • No Triage! Every submission reviewed by practicing scientists • Fast Publication! 4 weeks from acceptance to publication *average Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2012 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology Tumor-Infiltrating Monocytic Myeloid-Derived Suppressor Cells Mediate CCR5-Dependent Recruitment of Regulatory T Cells Favoring Tumor Growth Eva Schlecker,* Ana Stojanovic,* Christian Eisen,† Christian Quack,‡ Christine S.
    [Show full text]
  • Orphan Receptor IL-17RD Tunes IL-17A Signalling and Is Required for Neutrophilia
    ARTICLE Received 11 Jul 2012 | Accepted 7 Sep 2012 | Published 9 Oct 2012 DOI: 10.1038/ncomms2127 Orphan receptor IL-17RD tunes IL-17A signalling and is required for neutrophilia Mark Mellett1, Paola Atzei1, Alan Horgan1, Emily Hams2, Thomas Floss3, Wolfgang Wurst3, Padraic G. Fallon2,4,5 & Paul N. Moynagh1 Interleukin-17A, the prototypical member of the interleukin-17 cytokine family, coordinates local tissue inflammation by recruiting neutrophils to sites of infection. Dysregulation of interleukin-17 signalling has been linked to the pathogenesis of inflammatory diseases and autoimmunity. The interleukin-17 receptor family members (A–E) have a broad range of functional effects in immune signalling yet no known role has been described for the remaining orphan receptor, interleukin-17 receptor D, in regulating interleukin-17A-induced signalling pathways. Here we demonstrate that interleukin-17 receptor D can differentially regulate the various pathways employed by interleukin-17A. Neutrophil recruitment, in response to in vivo administration of interleukin-17A, is abolished in interleukin-17 receptor D-deficient mice, correlating with reduced interleukin-17A-induced activation of p38 mitogen-activated protein kinase and expression of the neutrophil chemokine MIP-2. In contrast, interleukin-17 receptor D deficiency results in enhanced interleukin-17A-induced activation of nuclear factor-kappa B and interleukin-6 and keratinocyte chemoattractant expression. Interleukin-17 receptor D disrupts the interaction of Act1 and TRAF6 causing differential regulation of nuclear factor- kappa B and p38 mitogen-activated protein kinase signalling pathways. 1 Department of Biology, Institute of Immunology, National University of Ireland Maynooth, Maynooth, Ireland. 2 Institute of Molecular Medicine, School of Medicine, Trinity College Dublin, Dublin 8, Ireland.
    [Show full text]
  • Impact of Polyunsaturated Fatty Acids on Mirna Profiles of Monocytes/Macrophages and Endothelial Cells—A Pilot Study
    Article Impact of Polyunsaturated Fatty Acids on miRNA Profiles of Monocytes/Macrophages and Endothelial Cells—A Pilot Study Claudia Roessler, Kevin Kuhlmann, Christine Hellwing, Anja Leimert and Julia Schumann * Clinic for Anesthesiology and Surgical Intensive Care, University Hospital Halle (Saale), Franzosenweg 1a, 06112 Halle (Saale), Germany; [email protected] (C.R.); [email protected] (K.K.); [email protected] (C.H.); [email protected] (A.L.) * Correspondence: [email protected]; Tel.: +49-345-557-1776 Academic Editor: Y-h. Taguchi Received: 21 November 2016; Accepted: 23 January 2017; Published: 28 January 2017 Abstract: Alteration of miRNAs and dietary polyunsaturated fatty acids (PUFAs) underlies vascular inflammation. PUFAs are known to be incorporated into the cell membrane of monocytes/macrophages or endothelial cells, the major cellular players of vascular diseases, thereby affecting cellular signal transduction. Nevertheless, there are no investigations concerning the PUFA impact on miRNA expression by these cells. With regard to the key role miRNAs play for overall cellular functionality, this study aims to elucidate whether PUFAs affect miRNA expression profiles. To this end, the monocyte/macrophage cell line RAW264.7 and the endothelial cell line TIME were enriched with either docosahexaenoic acid (DHA; n3-PUFA) or arachidonic acid (AA; n6-PUFA) until reaching a stable incorporation into the plasma membrane and, at least in part, exposed to an inflammatory milieu. Expressed miRNAs were determined by deep sequencing, and compared to unsupplemented/unstimulated controls. Data gained clearly show that PUFAs in fact modulate miRNA expression of both cell types analyzed regardless the presence/absence of an inflammatory stimulator.
    [Show full text]
  • Maternal Obesity Alters C19MC Micrornas Expression Profile In
    Jing et al. Nutrition & Metabolism (2020) 17:52 https://doi.org/10.1186/s12986-020-00475-7 RESEARCH Open Access Maternal obesity alters C19MC microRNAs expression profile in fetal umbilical cord blood Jia Jing1†, Yingjin Wang2†, Yanmei Quan1, Zhijie Wang2*, Yue Liu1* and Zhide Ding1* Abstract Background: To determine if overweight/obese pregnant women have altered microRNA expression patterns in fetal umbilical cord blood that may affect the development of offspring. Methods: Umbilical cord blood samples were obtained from the fetuses of 34 overweight/obese and 32 normal- weight women after delivery. Next generation sequencing (NGS) analyzed their miRNA expression patterns. miRanda and TargetScan databases were used to predict the miRNAs’ target genes followed by analyses of Gene ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) to perform function grouping and pathway analyses. qRT-PCR verified the identity of differentially expressed miRNAs that were revealed in the NGS results. Results: There was a positive correlation between newborn body weight and pregestational BMI of pregnant individuals (r = 0.48, P < 0.001). One hundred and eight miRNAs were differentially expressed between the normal and overweight/obese groups, which target genes were enriched in the metabolic pathway. Five C19MC miRNAs (miR-516a-5p, miR-516b-5p, miR-520a-3p, miR-1323, miR-523-5p) were upregulated in the overweight/obese group. Target enrichment analysis suggests their involvement in post-embryonic development, lipid and glucose homeostasis, T cell differentiation and nervous system development. Conclusions: C19MC miRNA expression upregulation in the fetal circulation during the gestation of overweight/ obese pregnant women may contribute to altered multisystem metabolic pathway development in their offspring.
    [Show full text]
  • Cytokines Mapping for Tissue-Specific Expression, Eqtls and GWAS Traits
    www.nature.com/scientificreports OPEN Cytokines mapping for tissue‑specifc expression, eQTLs and GWAS traits Lyubov E. Salnikova1,2*, Maryam B. Khadzhieva1,2, Dmitry S. Kolobkov1,3,4, Alesya S. Gracheva1,2, Artem N. Kuzovlev2 & Serikbay K. Abilev1 Dysregulation in cytokine production has been linked to the pathogenesis of various immune‑ mediated traits, in which genetic variability contributes to the etiopathogenesis. GWA studies have identifed many genetic variants in or near cytokine genes, nonetheless, the translation of these fndings into knowledge of functional determinants of complex traits remains a fundamental challenge. In this study we aimed at collection, analysis and interpretation of data on cytokines focused on their tissue‑specifc expression, eQTLs and GWAS traits. Using GO annotations, we generated a list of 314 cytokines and analyzed them with the GTEx resource. Cytokines were highly tissue‑specifc, 82.3% of cytokines had Tau expression metrics ≥ 0.8. In total, 3077 associations for 1760 unique SNPs in or near 244 cytokines were mapped in the NHGRI‑EBI GWAS Catalog. According to the Experimental Factor Ontology resource, the largest numbers of disease associations were related to ‘Infammatory disease’, ‘Immune system disease’ and ‘Asthma’. The GTEx‑based analysis revealed that among GWAS SNPs, 1142 SNPs had eQTL efects and infuenced expression levels of 999 eGenes, among them 178 cytokines. Several types of enrichment analysis showed that it was cytokines expression variability that fundamentally contributed to the molecular origins of considered immune-mediated conditions. Cytokines are regulatory proteins and glycoproteins that are synthesized and secreted by immune system cells and other cell types. Tey regulate innate and acquired immunity, embryogenesis, hematopoiesis, infammation and regeneration processes, and proliferation.
    [Show full text]
  • Cytokine and Growth Factor Catalog
    Cytokines & Growth Factors Catalogue { 2017-2018) Sino Biological Biological Solution Specialist Index Advantages .................................................................. 1 Product List (by research areas) ................................ 2 Product List (by family) ................................................ 8 Product List (by molecule) .......................................... 14 Popular Factors (small package) .............................. 47 References (section) ................................................... 52 Advantages √ ISO9001 certifications Comparison Diagram of Bioactivity with different brands 1000 0 √ Apply to cell culture 50 1000 √ Rigorous QC 100 Relative ED Relative √ High purity (SDS-PAGE) (Normalization) 10 √ Low endotoxin level (LAL assay) 1 CSF3 aFGF bFGF HGFIIFN FNβIβ IFNFNγIγ IL21L21TTNFSF10 NFSF10 √ Carrier Free (no BSA) Sinobiological 10 10 10 10 10 10 10 10 LT 36 400992 25 50 04417 17 58 25 40 PT 1434400 00 42 508333 83332250 50 2084208 40 0 √ Animal Free for most reagents RD 10 16 58 50167 167115 51142 42 160 HZ 14 50 50 VEGF165, measured in a cell proliferation assay using HUVEC hESC cultured with TGF-β1+bFGF NGF, measured in a cell proliferation assay using TF-1 hESC hESC cultured with bFGF Sino Biological 01 Cytokines & Growth Factors (by research areas) AIDS / HIV CCL21 CCL5 IFNB1 IL15 IL3 CCL22 CSF3 IFNG IL16 OSM CCL3 CX3CL1 IL10 IL17A TNF CCL4 CXCL12 IL13 IL2 Allergy CCL5 IL10 IL12B IL4 IL8 CD40LG IL12A IL1B IL5 TNF CXCL10 IL12A & IL12B IL2 IL6 TNFSF8 IFNG Angiogenesis / Cardiovascular
    [Show full text]