DOCSLIB.ORG

Mechanism of Fibrosis in HNF1B-Related Autosomal Dominant Tubulointerstitial Kidney Disease

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Mechanism of Fibrosis in HNF1B-Related Autosomal Dominant Tubulointerstitial Kidney Disease BASIC RESEARCH www.jasn.org Mechanism of Fibrosis in HNF1B-Related Autosomal Dominant Tubulointerstitial Kidney Disease Siu Chiu Chan,1 Ying Zhang,2 Annie Shao,1 Svetlana Avdulov,1 Jeremy Herrera,1 Karam Aboudehen,1 Marco Pontoglio,3 and Peter Igarashi 1 1Department of Medicine and 2Minnesota Supercomputing Institute, University of Minnesota, Minneapolis, Minnesota; and 3Department of Development, Reproduction and Cancer, Institut Cochin, Institut National de la Santé et de la Recherche Médicale U1016/Centre National de la Recherche Scientifique Unité Mixte de Recherche 8104, Université Paris-Descartes, Paris, France ABSTRACT Background Mutation of HNF1B, the gene encoding transcription factor HNF-1b, is one cause of auto- somal dominant tubulointerstitial kidney disease, a syndrome characterized by tubular cysts, renal fibrosis, and progressive decline in renal function. HNF-1b has also been implicated in epithelial–mesenchymal transition (EMT) pathways, and sustained EMT is associated with tissue fibrosis. The mechanism whereby mutated HNF1B leads to tubulointerstitial fibrosis is not known. Methods To explore the mechanism of fibrosis, we created HNF-1b–deficient mIMCD3 renal epithelial cells, used RNA-sequencing analysis to reveal differentially expressed genes in wild-type and HNF-1b–deficient mIMCD3 cells, and performed cell lineage analysis in HNF-1b mutant mice. Results The HNF-1b–deficient cells exhibited properties characteristic of mesenchymal cells such as fi- broblasts, including spindle-shaped morphology, loss of contact inhibition, and increased cell migration. These cells also showed upregulation of fibrosis and EMT pathways, including upregulation of Twist2, Snail1, Snail2, and Zeb2, which are key EMT transcription factors. Mechanistically, HNF-1b directly re- presses Twist2, and ablation of Twist2 partially rescued the fibroblastic phenotype of HNF-1b mutant cells. Kidneys from HNF-1b mutant mice showed increased expression of Twist2 and its downstream target Snai2. Cell lineage analysis indicated that HNF-1b mutant epithelial cells do not transdifferentiate into kidney myofibroblasts. Rather, HNF-1b mutant epithelial cells secrete high levels of TGF-b ligands that activate downstream Smad transcription factors in renal interstitial cells. Conclusions Ablation of HNF-1b in renal epithelial cells leads to the activation of a Twist2-dependent transcriptional network that induces EMT and aberrant TGF-b signaling, resulting in renal fibrosis through a cell-nonautonomous mechanism. J Am Soc Nephrol 29: 2493–2509, 2018. doi: https://doi.org/10.1681/ASN.2018040437 Autosomal dominant tubulointerstitial kidney that cause interstitial nephritis. Gout, hyperurice- disease (ADTKD) is a recently recognized clinico- mia, and hypomagnesemia may be present. Renal pathological entity characterized by autosomal pathologic features comprise interstitial fibrosis, dominant inheritance and progressive decline in renal function.1 Clinical and laboratory features in- Received April 26, 2018. Accepted July 12, 2018. clude normal or small kidney size, elevated serum Published online ahead of print. Publication date available at creatinine, bland urinary sediment, absent or low- www.jasn.org. grade proteinuria, and impaired urinary concentra- Correspondence: Dr. Peter Igarashi, Department of Medicine, tion.2 Systemic BP is generally not elevated during University of Minnesota Medical School, 420 Delaware Street SE, early stages of the disease, and there is no prior MMC 194, Minneapolis, MN 55455. Email: [email protected] history of exposure to drugs, metals, or toxins Copyright © 2018 by the American Society of Nephrology J Am Soc Nephrol 29: 2493–2509, 2018 ISSN : 1046-6673/2910-2493 2493 BASIC RESEARCH www.jasn.org tubular atrophy, thickening and lamellation of tubular base- Significance Statement ment membranes, kidney microcysts or macrocysts, and absence of immune complex deposits. ADTKD encompasses Mutation of HNF1B, which encodes the transcription factor HNF-1b,isa disorders previously known as medullary cystic kidney disease cause of autosomal dominant tubulointerstitial kidney disease (ADTKD), b fi and familial juvenile hyperuricemic nephropathy. ADTKD is but the mechanism whereby mutated HNF-1 leads to renal brosis is not known. The authors demonstrated that ablation of HNF-1b is suf- genetically heterogeneous and can arise from mutations in at ficient to induce epithelial–mesenchymal transition (EMT) in vitro and in – least five genes3 7: UMOD, which encodes uromodulin/ vivo through derepression of the HNF-1b–regulated gene Twist2 and Tamm–Horsfall protein, the major urinary protein produced its downstream target Snai2. Lineage tracing revealed that ablation of in the loop of Henle; MUC1, which encodes the apical mem- HNF-1b induces renal fibrosis via a cell-nonautonomous process in- brane protein mucin-1; REN, which encodes the enzyme renin volving epithelial/mesenchymal crosstalk. Further, they showed that epithelial cells with mutant HNF-1b secrete high levels of profibrotic that catalyzes the conversion of angiotensinogen to angioten- TGF-b ligands that activate downstream Smad transcription factors sin-1; SEC61A1, which is involved in protein translocation in in renal interstitial cells. Collectively, these findings reveal a novel the endoplasmic reticulum; and HNF1B, which encodes the Twist2-dependent EMT pathway that underlies renal fibrosis in HNF1B- transcription factor hepatocyte NF-1b (HNF-1b). Causative related ADTKD. genes have not yet been identified in a significant portion of affected individuals. and the mechanisms whereby human mutations lead to a b HNF-1 is a homeodomain-containing transcription fac- broad spectrum of clinical phenotypes remain to be fully fi tor that regulates tissue-speci c gene expression in the kidney, elucidated. Constitutive ablation of Hnf1b in mice results in 8 b liver, pancreas, and other epithelial organs. HNF-1 is essen- embryonic lethality due to failure of endoderm development,23 b tial for normal kidney development; ablation of HNF-1 in and kidney-specificdeletionofHnf1b using the Ksp/Cre deleter nephron progenitors leads to disturbances in Notch-depen- strain results in postnatal kidney failure.14,18 We recently used dent nephron patterning, and ablation in the ureteric bud Pkhd1/Cre24 mice to ablate Hnf1b specifically in renal collecting inhibits branching morphogenesis and Wnt9b-dependent ducts.21 Collecting duct-specific deletion of Hnf1b results in 9,10 nephron induction and GDNF/Ret signaling. In humans, longer survival and slower progression of cystic disease, renal mutations of HNF1B have been linked to congenital abnor- fibrosis, and hydronephrosis. Mutant mice also exhibit polyuria, malities of the kidney and urinary tract, including renal agen- polydipsia, and impaired urinary concentration recapitulating esis/hypoplasia, multicystic dysplastic kidneys, horseshoe clinical features of ADTKD in humans with mutations in 11 kidneys, and glomerulocystic kidney disease. Mutations HNF1B. of HNF1B can also produce ADTKD, often associated with To investigate the pathogenesis of renal interstitial fibrosis in hyperuricemia, hypomagnesemia, hypokalemia, diabetes ADTKD, three ADTKD-UMOD mouse models had been 12,13 mellitus, and Müllerian duct abnormalities. Previous generated.25–27 Characterization of the mutant mice suggests b studies suggested that HNF-1 regulates the transcription of that renal fibrosis arises from endoplasmic reticulum (ER) UMOD, raising the possibility that disturbances in a common stress and secondary mitochondrial dysfunction. However, transcriptional network may underlie the pathogenesis of the mechanism whereby mutations of HNF1B produce 14 ADTKD. Abnormalities in unfolded protein response tubulointerstitial fibrosis has not been explored. Using HNF-1b (UPR) and mitochondrial metabolism have also been mutant cell lines and mouse models, we found that loss of 15 implicated. In addition to inherited kidney diseases, muta- HNF-1b induces epithelial–mesenchymal transition (EMT) via tions of HNF1B have been detected in sporadic cases of derepression of the transcription factor Twist2. As a consequence, 16 renal hypoplasia/dysplasia. Expression of HNF1B is also the expression of TGF-b ligands is upregulated in renal tubules, 17 downregulated in polycystic kidney disease. which leads to renal fibrosis via a cell-nonautonomous process. Several genetically modified mouse models have been de- veloped to unravel the pathogenesis of human HNF1B-related kidney disease.14,18 Common features of the HNF-1b mutant METHODS mouse models are enlarged kidneys with fluid-filled cysts, multilayered cyst epithelium, and hydronephrosis. Molecular Transgenic Mice characterization of HNF-1b mutant mice has shown that Ksp/Cre mice that express Cre recombinase under the control HNF-1b plays a significant role in cystic kidney diseases of the Ksp-cadherin (Cdh16)promoterandHnf1bf/f mice through the regulation of cystogenes such as Pkhd1, Pkd2, containing loxP sites flanking exon 1 of Hnf1b have been de- Umod,andKif12.14,18,19 Recent chromatin immunoprecipita- scribed previously.14 R26R-EYFP mice that express EYFP after tion sequencing (ChIP-seq) experiments have shown that Cre/loxP recombination were provided by Dr. Frank Costantini HNF-1b regulates cholesterol metabolism through transcrip- (Columbia University).28 Ksp/Cre mice were crossed with tional activation of Srebp2 and Pcsk9,20 urinary concentration Hnf1bf/+ mice, and the bitransgenic progeny were intercrossed through activation of Fxr,21 and potassium
Load more

Recommended publications
  • Screening and Identification of Key Biomarkers in Clear Cell Renal Cell Carcinoma Based on Bioinformatics Analysis
    bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423889; this version posted December 23, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Screening and identification of key biomarkers in clear cell renal cell carcinoma based on bioinformatics analysis Basavaraj Vastrad1, Chanabasayya Vastrad*2 , Iranna Kotturshetti 1. Department of Biochemistry, Basaveshwar College of Pharmacy, Gadag, Karnataka 582103, India. 2. Biostatistics and Bioinformatics, Chanabasava Nilaya, Bharthinagar, Dharwad 580001, Karanataka, India. 3. Department of Ayurveda, Rajiv Gandhi Education Society`s Ayurvedic Medical College, Ron, Karnataka 562209, India. * Chanabasayya Vastrad [email protected] Ph: +919480073398 Chanabasava Nilaya, Bharthinagar, Dharwad 580001 , Karanataka, India bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423889; this version posted December 23, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Abstract Clear cell renal cell carcinoma (ccRCC) is one of the most common types of malignancy of the urinary system. The pathogenesis and effective diagnosis of ccRCC have become popular topics for research in the previous decade. In the current study, an integrated bioinformatics analysis was performed to identify core genes associated in ccRCC. An expression dataset (GSE105261) was downloaded from the Gene Expression Omnibus database, and included 26 ccRCC and 9 normal kideny samples. Assessment of the microarray dataset led to the recognition of differentially expressed genes (DEGs), which was subsequently used for pathway and gene ontology (GO) enrichment analysis.
    [Show full text]
  • Dedifferentiation by Adenovirus E1A Due to Inactivation of Hippo Pathway Effectors YAP and TAZ
    Downloaded from genesdev.cshlp.org on October 3, 2021 - Published by Cold Spring Harbor Laboratory Press Dedifferentiation by adenovirus E1A due to inactivation of Hippo pathway effectors YAP and TAZ Nathan R. Zemke, Dawei Gou, and Arnold J. Berk Molecular Biology Institute, University of California at Los Angeles, Los Angeles, California 90095, USA Adenovirus transformed cells have a dedifferentiated phenotype. Eliminating E1A in transformed human embryonic kidney cells derepressed ∼2600 genes, generating a gene expression profile closely resembling mesenchymal stem cells (MSCs). This was associated with a dramatic change in cell morphology from one with scant cytoplasm and a globular nucleus to one with increased cytoplasm, extensive actin stress fibers, and actomyosin-dependent flat- tening against the substratum. E1A-induced hypoacetylation at histone H3 Lys27 and Lys18 (H3K27/18) was reversed. Most of the increase in H3K27/18ac was in enhancers near TEAD transcription factors bound by Hippo signaling-regulated coactivators YAP and TAZ. E1A causes YAP/TAZ cytoplasmic sequestration. After eliminating E1A, YAP/TAZ were transported into nuclei, where they associated with poised enhancers with DNA-bound TEAD4 and H3K4me1. This activation of YAP/TAZ required RHO family GTPase signaling and caused histone acetylation by p300/CBP, chromatin remodeling, and cohesin loading to establish MSC-associated enhancers and then superenhancers. Consistent results were also observed in primary rat embryo kidney cells, human fibroblasts, and human respiratory tract epithelial cells. These results together with earlier studies suggest that YAP/TAZ function in a developmental checkpoint controlled by signaling from the actin cytoskeleton that prevents differ- entiation of a progenitor cell until it is in the correct cellular and tissue environment.
    [Show full text]
  • HHS Public Access Author Manuscript
    HHS Public Access Author manuscript Author Manuscript Author ManuscriptNat Genet Author Manuscript. Author manuscript; Author Manuscript available in PMC 2013 June 01. Published in final edited form as: Nat Genet. 2012 December ; 44(12): 1349–1354. doi:10.1038/ng.2466. Common genetic variants in the CLDN2 and PRSS1-PRSS2 loci alter risk for alcohol-related and sporadic pancreatitis A full list of authors and affiliations appears at the end of the article. Abstract Pancreatitis is a complex, progressively destructive inflammatory disorder. Alcohol was long thought to be the primary causative agent, but genetic contributions have been of interest since the discovery that rare PRSS1, CFTR, and SPINK1 variants were associated with pancreatitis risk. We now report two significant genome-wide associations identified and replicated at PRSS1-PRSS2 (1×10-12) and x-linked CLDN2 (p < 1×10-21) through a two-stage genome-wide study (Stage 1, 676 cases and 4507 controls; Stage 2, 910 cases and 4170 controls). The PRSS1 variant affects susceptibility by altering expression of the primary trypsinogen gene. The CLDN2 risk allele is associated with atypical localization of claudin-2 in pancreatic acinar cells. The homozygous (or hemizygous male) CLDN2 genotype confers the greatest risk, and its alleles interact with alcohol consumption to amplify risk. These results could partially explain the high frequency of alcohol- related pancreatitis in men – male hemizygous frequency is 0.26, female homozygote is 0.07. The exocrine pancreas is a simple digestive gland of only two primary cell types, each with a single function (Supplementary Figure 1). Recurrent acute pancreatic inflammation can, but does not always, progress to irreversible damage of the gland, including fibrosis, atrophy, pain, and exocrine and endocrine insufficiency,1-3 known as chronic pancreatitis Different genetic and environmental factors produce the same clinical phenotype4.
    [Show full text]
  • Viewed Under 23 (B) Or 203 (C) fi M M Male Cko Mice, and Largely Unaffected Magni Cation; Scale Bars, 500 M (B) and 50 M (C)
    BRIEF COMMUNICATION www.jasn.org Renal Fanconi Syndrome and Hypophosphatemic Rickets in the Absence of Xenotropic and Polytropic Retroviral Receptor in the Nephron Camille Ansermet,* Matthias B. Moor,* Gabriel Centeno,* Muriel Auberson,* † † ‡ Dorothy Zhang Hu, Roland Baron, Svetlana Nikolaeva,* Barbara Haenzi,* | Natalya Katanaeva,* Ivan Gautschi,* Vladimir Katanaev,*§ Samuel Rotman, Robert Koesters,¶ †† Laurent Schild,* Sylvain Pradervand,** Olivier Bonny,* and Dmitri Firsov* BRIEF COMMUNICATION *Department of Pharmacology and Toxicology and **Genomic Technologies Facility, University of Lausanne, Lausanne, Switzerland; †Department of Oral Medicine, Infection, and Immunity, Harvard School of Dental Medicine, Boston, Massachusetts; ‡Institute of Evolutionary Physiology and Biochemistry, St. Petersburg, Russia; §School of Biomedicine, Far Eastern Federal University, Vladivostok, Russia; |Services of Pathology and ††Nephrology, Department of Medicine, University Hospital of Lausanne, Lausanne, Switzerland; and ¶Université Pierre et Marie Curie, Paris, France ABSTRACT Tight control of extracellular and intracellular inorganic phosphate (Pi) levels is crit- leaves.4 Most recently, Legati et al. have ical to most biochemical and physiologic processes. Urinary Pi is freely filtered at the shown an association between genetic kidney glomerulus and is reabsorbed in the renal tubule by the action of the apical polymorphisms in Xpr1 and primary fa- sodium-dependent phosphate transporters, NaPi-IIa/NaPi-IIc/Pit2. However, the milial brain calcification disorder.5 How- molecular identity of the protein(s) participating in the basolateral Pi efflux remains ever, the role of XPR1 in the maintenance unknown. Evidence has suggested that xenotropic and polytropic retroviral recep- of Pi homeostasis remains unknown. Here, tor 1 (XPR1) might be involved in this process. Here, we show that conditional in- we addressed this issue in mice deficient for activation of Xpr1 in the renal tubule in mice resulted in impaired renal Pi Xpr1 in the nephron.
    [Show full text]
  • CCDC109B (MCUB) (NM 017918) Human Untagged Clone Product Data
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for SC327798 CCDC109B (MCUB) (NM_017918) Human Untagged Clone Product data: Product Type: Expression Plasmids Product Name: CCDC109B (MCUB) (NM_017918) Human Untagged Clone Tag: Tag Free Symbol: MCUB Synonyms: CCDC109B Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin Fully Sequenced ORF: >OriGene SC327798 ORF sequence for NM_017918, the custom clone sequence may differ by one or more nucleotides ATGTTGTCAACAGTTGGTTCATTCCTTCAGGACCTACAAAATGAAGATAAGGGTATCAAAACTGCAGCCA TCTTCACAGCAGATGGCAACATGATTTCAGCTTCTACCTTGATGGATATTTTGCTAATGAATGATTTTAA ACTTGTCATTAATAAAATAGCATATGATGTGCAGTGTCCAAAGAGAGAAAAACCAAGTAATGAGCACACT GCTGAGATGGAACACATGAAATCCTTGGTTCACAGACTATTTACAATCTTGCATTTAGAAGAGTCTCAGA AAAAGAGAGAGCACCATTTACTGGAGAAAATTGACCACCTGAAGGAACAGCTGCAGCCCCTTGAACAGGT GAAAGCTGGAATAGAAGCTCATTCGGAAGCCAAAACCAGTGGACTCCTGTGGGCTGGATTGGCACTGCTG TCCATTCAGGGTGGGGCACTGGCCTGGCTCACGTGGTGGGTGTACTCCTGGGATATCATGGAGCCAGTTA CATACTTCATCACATTTGCAAATTCTATGGTCTTTTTTGCATACTTTATAGTCACTCGACAGGATTATAC TTACTCAGCTGTTAAGAGTAGGCAATTTCTTCAGTTCTTCCACAAGAAATCAAAGCAACAGCACTTTGAT GTGCAGCAATACAACAAGTTAAAAGAAGACCTTGCTAAGGCTAAAGAATCCCTGAAACAGGCGCGTCATT CTCTCTGTTTGCAAATGCAAGTAGAAGAACTCAATGAAAAGAATTAA Restriction Sites: SgfI-MluI ACCN: NM_017918 OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point
    [Show full text]
  • Regulation of Cdc42 and Its Effectors in Epithelial Morphogenesis Franck Pichaud1,2,*, Rhian F
    © 2019. Published by The Company of Biologists Ltd | Journal of Cell Science (2019) 132, jcs217869. doi:10.1242/jcs.217869 REVIEW SUBJECT COLLECTION: ADHESION Regulation of Cdc42 and its effectors in epithelial morphogenesis Franck Pichaud1,2,*, Rhian F. Walther1 and Francisca Nunes de Almeida1 ABSTRACT An overview of Cdc42 Cdc42 – a member of the small Rho GTPase family – regulates cell Cdc42 was discovered in yeast and belongs to a large family of small – polarity across organisms from yeast to humans. It is an essential (20 30 kDa) GTP-binding proteins (Adams et al., 1990; Johnson regulator of polarized morphogenesis in epithelial cells, through and Pringle, 1990). It is part of the Ras-homologous Rho subfamily coordination of apical membrane morphogenesis, lumen formation and of GTPases, of which there are 20 members in humans, including junction maturation. In parallel, work in yeast and Caenorhabditis elegans the RhoA and Rac GTPases, (Hall, 2012). Rho, Rac and Cdc42 has provided important clues as to how this molecular switch can homologues are found in all eukaryotes, except for plants, which do generate and regulate polarity through localized activation or inhibition, not have a clear homologue for Cdc42. Together, the function of and cytoskeleton regulation. Recent studies have revealed how Rho GTPases influences most, if not all, cellular processes. important and complex these regulations can be during epithelial In the early 1990s, seminal work from Alan Hall and his morphogenesis. This complexity is mirrored by the fact that Cdc42 can collaborators identified Rho, Rac and Cdc42 as main regulators of exert its function through many effector proteins.
    [Show full text]
  • A Cell Line P53 Mutation Type UM
    A Cell line p53 mutation Type UM-SCC 1 wt UM-SCC5 Exon 5, 157 GTC --> TTC Missense mutation by transversion (Valine --> Phenylalanine UM-SCC6 wt UM-SCC9 wt UM-SCC11A wt UM-SCC11B Exon 7, 242 TGC --> TCC Missense mutation by transversion (Cysteine --> Serine) UM-SCC22A Exon 6, 220 TAT --> TGT Missense mutation by transition (Tyrosine --> Cysteine) UM-SCC22B Exon 6, 220 TAT --> TGT Missense mutation by transition (Tyrosine --> Cysteine) UM-SCC38 Exon 5, 132 AAG --> AAT Missense mutation by transversion (Lysine --> Asparagine) UM-SCC46 Exon 8, 278 CCT --> CGT Missense mutation by transversion (Proline --> Alanine) B 1 Supplementary Methods Cell Lines and Cell Culture A panel of ten established HNSCC cell lines from the University of Michigan series (UM-SCC) was obtained from Dr. T. E. Carey at the University of Michigan, Ann Arbor, MI. The UM-SCC cell lines were derived from eight patients with SCC of the upper aerodigestive tract (supplemental Table 1). Patient age at tumor diagnosis ranged from 37 to 72 years. The cell lines selected were obtained from patients with stage I-IV tumors, distributed among oral, pharyngeal and laryngeal sites. All the patients had aggressive disease, with early recurrence and death within two years of therapy. Cell lines established from single isolates of a patient specimen are designated by a numeric designation, and where isolates from two time points or anatomical sites were obtained, the designation includes an alphabetical suffix (i.e., "A" or "B"). The cell lines were maintained in Eagle's minimal essential media supplemented with 10% fetal bovine serum and penicillin/streptomycin.
    [Show full text]
  • Seq2pathway Vignette
    seq2pathway Vignette Bin Wang, Xinan Holly Yang, Arjun Kinstlick May 19, 2021 Contents 1 Abstract 1 2 Package Installation 2 3 runseq2pathway 2 4 Two main functions 3 4.1 seq2gene . .3 4.1.1 seq2gene flowchart . .3 4.1.2 runseq2gene inputs/parameters . .5 4.1.3 runseq2gene outputs . .8 4.2 gene2pathway . 10 4.2.1 gene2pathway flowchart . 11 4.2.2 gene2pathway test inputs/parameters . 11 4.2.3 gene2pathway test outputs . 12 5 Examples 13 5.1 ChIP-seq data analysis . 13 5.1.1 Map ChIP-seq enriched peaks to genes using runseq2gene .................... 13 5.1.2 Discover enriched GO terms using gene2pathway_test with gene scores . 15 5.1.3 Discover enriched GO terms using Fisher's Exact test without gene scores . 17 5.1.4 Add description for genes . 20 5.2 RNA-seq data analysis . 20 6 R environment session 23 1 Abstract Seq2pathway is a novel computational tool to analyze functional gene-sets (including signaling pathways) using variable next-generation sequencing data[1]. Integral to this tool are the \seq2gene" and \gene2pathway" components in series that infer a quantitative pathway-level profile for each sample. The seq2gene function assigns phenotype-associated significance of genomic regions to gene-level scores, where the significance could be p-values of SNPs or point mutations, protein-binding affinity, or transcriptional expression level. The seq2gene function has the feasibility to assign non-exon regions to a range of neighboring genes besides the nearest one, thus facilitating the study of functional non-coding elements[2]. Then the gene2pathway summarizes gene-level measurements to pathway-level scores, comparing the quantity of significance for gene members within a pathway with those outside a pathway.
    [Show full text]
  • A Gene-Level Methylome-Wide Association Analysis Identifies Novel
    bioRxiv preprint doi: https://doi.org/10.1101/2020.07.13.201376; this version posted July 14, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. 1 A gene-level methylome-wide association analysis identifies novel 2 Alzheimer’s disease genes 1 1 2 3 4 3 Chong Wu , Jonathan Bradley , Yanming Li , Lang Wu , and Hong-Wen Deng 1 4 Department of Statistics, Florida State University; 2 5 Department of Biostatistics & Data Science, University of Kansas Medical Center; 3 6 Population Sciences in the Pacific Program, University of Hawaii Cancer center; 4 7 Tulane Center for Biomedical Informatics and Genomics, Deming Department of Medicine, 8 Tulane University School of Medicine 9 Corresponding to: Chong Wu, Assistant Professor, Department of Statistics, Florida State 10 University, email: [email protected] 1 bioRxiv preprint doi: https://doi.org/10.1101/2020.07.13.201376; this version posted July 14, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. 11 Abstract 12 Motivation: Transcriptome-wide association studies (TWAS) have successfully facilitated the dis- 13 covery of novel genetic risk loci for many complex traits, including late-onset Alzheimer’s disease 14 (AD). However, most existing TWAS methods rely only on gene expression and ignore epige- 15 netic modification (i.e., DNA methylation) and functional regulatory information (i.e., enhancer- 16 promoter interactions), both of which contribute significantly to the genetic basis ofAD.
    [Show full text]
  • Functional Screening of Alzheimer Risk Loci Identifies PTK2B
    OPEN Molecular Psychiatry (2017) 22, 874–883 www.nature.com/mp ORIGINAL ARTICLE Functional screening of Alzheimer risk loci identifies PTK2B as an in vivo modulator and early marker of Tau pathology P Dourlen1,2,3, FJ Fernandez-Gomez4,5,6, C Dupont1,2,3, B Grenier-Boley1,2,3, C Bellenguez1,2,3, H Obriot4,5,6, R Caillierez4,5,6, Y Sottejeau1,2,3, J Chapuis1,2,3, A Bretteville1,2,3, F Abdelfettah1,2,3, C Delay1,2,3, N Malmanche1,2,3, H Soininen7, M Hiltunen7,8, M-C Galas4,5,6, P Amouyel1,2,3,9, N Sergeant4,5,6, L Buée4,5,6, J-C Lambert1,2,3,11 and B Dermaut1,2,3,10,11 A recent genome-wide association meta-analysis for Alzheimer’s disease (AD) identified 19 risk loci (in addition to APOE) in which the functional genes are unknown. Using Drosophila, we screened 296 constructs targeting orthologs of 54 candidate risk genes within these loci for their ability to modify Tau neurotoxicity by quantifying the size of 46000 eyes. Besides Drosophila Amph (ortholog of BIN1), which we previously implicated in Tau pathology, we identified p130CAS (CASS4), Eph (EPHA1), Fak (PTK2B) and Rab3-GEF (MADD) as Tau toxicity modulators. Of these, the focal adhesion kinase Fak behaved as a strong Tau toxicity suppressor in both the eye and an independent focal adhesion-related wing blister assay. Accordingly, the human Tau and PTK2B proteins biochemically interacted in vitro and PTK2B co-localized with hyperphosphorylated and oligomeric Tau in progressive pathological stages in the brains of AD patients and transgenic Tau mice.
    [Show full text]
  • Investigation of Copy Number Variations on Chromosome 21 Detected by Comparative Genomic Hybridization
    Li et al. Molecular Cytogenetics (2018) 11:42 https://doi.org/10.1186/s13039-018-0391-3 RESEARCH Open Access Investigation of copy number variations on chromosome 21 detected by comparative genomic hybridization (CGH) microarray in patients with congenital anomalies Wenfu Li, Xianfu Wang and Shibo Li* Abstract Background: The clinical features of Down syndrome vary among individuals, with those most common being congenital heart disease, intellectual disability, developmental abnormity and dysmorphic features. Complex combination of Down syndrome phenotype could be produced by partially copy number variations (CNVs) on chromosome 21 as well. By comparing individual with partial CNVs of chromosome 21 with other patients of known CNVs and clinical phenotypes, we hope to provide a better understanding of the genotype-phenotype correlation of chromosome 21. Methods: A total of 2768 pediatric patients sample collected at the Genetics Laboratory at Oklahoma University Health Science Center were screened using CGH Microarray for CNVs on chromosome 21. Results: We report comprehensive clinical and molecular descriptions of six patients with microduplication and seven patients with microdeletion on the long arm of chromosome 21. Patients with microduplication have varied clinical features including developmental delay, microcephaly, facial dysmorphic features, pulmonary stenosis, autism, preauricular skin tag, eye pterygium, speech delay and pain insensitivity. We found that patients with microdeletion presented with developmental delay, microcephaly, intrauterine fetal demise, epilepsia partialis continua, congenital coronary anomaly and seizures. Conclusion: Three patients from our study combine with four patients in public database suggests an association between 21q21.1 microduplication of CXADR gene and patients with developmental delay. One patient with 21q22.13 microdeletion of DYRK1A shows association with microcephaly and scoliosis.
    [Show full text]
  • 4-6 Weeks Old Female C57BL/6 Mice Obtained from Jackson Labs Were Used for Cell Isolation
    Methods Mice: 4-6 weeks old female C57BL/6 mice obtained from Jackson labs were used for cell isolation. Female Foxp3-IRES-GFP reporter mice (1), backcrossed to B6/C57 background for 10 generations, were used for the isolation of naïve CD4 and naïve CD8 cells for the RNAseq experiments. The mice were housed in pathogen-free animal facility in the La Jolla Institute for Allergy and Immunology and were used according to protocols approved by the Institutional Animal Care and use Committee. Preparation of cells: Subsets of thymocytes were isolated by cell sorting as previously described (2), after cell surface staining using CD4 (GK1.5), CD8 (53-6.7), CD3ε (145- 2C11), CD24 (M1/69) (all from Biolegend). DP cells: CD4+CD8 int/hi; CD4 SP cells: CD4CD3 hi, CD24 int/lo; CD8 SP cells: CD8 int/hi CD4 CD3 hi, CD24 int/lo (Fig S2). Peripheral subsets were isolated after pooling spleen and lymph nodes. T cells were enriched by negative isolation using Dynabeads (Dynabeads untouched mouse T cells, 11413D, Invitrogen). After surface staining for CD4 (GK1.5), CD8 (53-6.7), CD62L (MEL-14), CD25 (PC61) and CD44 (IM7), naïve CD4+CD62L hiCD25-CD44lo and naïve CD8+CD62L hiCD25-CD44lo were obtained by sorting (BD FACS Aria). Additionally, for the RNAseq experiments, CD4 and CD8 naïve cells were isolated by sorting T cells from the Foxp3- IRES-GFP mice: CD4+CD62LhiCD25–CD44lo GFP(FOXP3)– and CD8+CD62LhiCD25– CD44lo GFP(FOXP3)– (antibodies were from Biolegend). In some cases, naïve CD4 cells were cultured in vitro under Th1 or Th2 polarizing conditions (3, 4).
    [Show full text]