Mechanism of Fibrosis in HNF1B-Related Autosomal Dominant Tubulointerstitial Kidney Disease

Home , ARHGAP31, BAG2, BNIP2, CASS4, CBR3, Ccdc109b

BASIC RESEARCH www.jasn.org

Siu Chiu Chan,1 Ying Zhang,2 Annie Shao,1 Svetlana Avdulov,1 Jeremy Herrera,1 Karam Aboudehen,1 Marco Pontoglio,3 and Peter Igarashi 1

1Department of Medicine and 2Minnesota Supercomputing Institute, University of Minnesota, Minneapolis, Minnesota; and 3Department of Development, Reproduction and Cancer, Institut Cochin, Institut National de la Santé et de la Recherche Médicale U1016/Centre National de la Recherche Scientiﬁque Unité Mixte de Recherche 8104, Université Paris-Descartes, Paris, France

ABSTRACT Background Mutation of HNF1B, the gene encoding transcription factor HNF-1b, is one cause of autosomal dominant tubulointerstitial kidney disease, a syndrome characterized by tubular cysts, renal fibrosis, and progressive decline in renal function. HNF-1b has also been implicated in epithelial–mesenchymal transition (EMT) pathways, and sustained EMT is associated with tissue fibrosis. The mechanism whereby mutated HNF1B leads to tubulointerstitial fibrosis is not known. Methods To explore the mechanism of fibrosis, we created HNF-1b–deficient mIMCD3 renal epithelial cells, used RNA-sequencing analysis to reveal differentially expressed genes in wild-type and HNF-1b–deficient mIMCD3 cells, and performed cell lineage analysis in HNF-1b mutant mice. Results The HNF-1b–deficient cells exhibited properties characteristic of mesenchymal cells such as fibroblasts, including spindle-shaped morphology, loss of contact inhibition, and increased cell migration. These cells also showed upregulation of fibrosis and EMT pathways, including upregulation of Twist2, Snail1, Snail2, and Zeb2, which are key EMT transcription factors. Mechanistically, HNF-1b directly represses Twist2, and ablation of Twist2 partially rescued the fibroblastic phenotype of HNF-1b mutant cells. Kidneys from HNF-1b mutant mice showed increased expression of Twist2 and its downstream target Snai2. Cell lineage analysis indicated that HNF-1b mutant epithelial cells do not transdifferentiate into kidney myofibroblasts. Rather, HNF-1b mutant epithelial cells secrete high levels of TGF-b ligands that activate downstream Smad transcription factors in renal interstitial cells. Conclusions Ablation of HNF-1b in renal epithelial cells leads to the activation of a Twist2-dependent transcriptional network that induces EMT and aberrant TGF-b signaling, resulting in renal fibrosis through a cell-nonautonomous mechanism.

J Am Soc Nephrol 29: 2493–2509, 2018. doi: https://doi.org/10.1681/ASN.2018040437

Autosomal dominant tubulointerstitial kidney that cause interstitial nephritis. Gout, hyperurice- disease (ADTKD) is a recently recognized clinico- mia, and hypomagnesemia may be present. Renal pathological entity characterized by autosomal pathologic features comprise interstitial ﬁbrosis, dominant inheritance and progressive decline in renal function.1 Clinical and laboratory features in- Received April 26, 2018. Accepted July 12, 2018. clude normal or small kidney size, elevated serum Published online ahead of print. Publication date available at creatinine, bland urinary sediment, absent or low- www.jasn.org. grade proteinuria, and impaired urinary concentra- Correspondence: Dr. Peter Igarashi, Department of Medicine, tion.2 Systemic BP is generally not elevated during University of Minnesota Medical School, 420 Delaware Street SE, early stages of the disease, and there is no prior MMC 194, Minneapolis, MN 55455. Email: [email protected] history of exposure to drugs, metals, or toxins Copyright © 2018 by the American Society of Nephrology

J Am Soc Nephrol 29: 2493–2509, 2018 ISSN : 1046-6673/2910-2493 2493 BASIC RESEARCH www.jasn.org tubular atrophy, thickening and lamellation of tubular base- Significance Statement ment membranes, kidney microcysts or macrocysts, and absence of immune complex deposits. ADTKD encompasses Mutation of HNF1B, which encodes the transcription factor HNF-1b,isa disorders previously known as medullary cystic kidney disease cause of autosomal dominant tubulointerstitial kidney disease (ADTKD), b fi and familial juvenile hyperuricemic nephropathy. ADTKD is but the mechanism whereby mutated HNF-1 leads to renal brosis is not known. The authors demonstrated that ablation of HNF-1b is suf- genetically heterogeneous and can arise from mutations in at ficient to induce epithelial–mesenchymal transition (EMT) in vitro and in – least five genes3 7: UMOD, which encodes uromodulin/ vivo through derepression of the HNF-1b–regulated gene Twist2 and Tamm–Horsfall protein, the major urinary protein produced its downstream target Snai2. Lineage tracing revealed that ablation of in the loop of Henle; MUC1, which encodes the apical mem- HNF-1b induces renal fibrosis via a cell-nonautonomous process in- brane protein mucin-1; REN, which encodes the enzyme renin volving epithelial/mesenchymal crosstalk. Further, they showed that epithelial cells with mutant HNF-1b secrete high levels of profibrotic that catalyzes the conversion of angiotensinogen to angioten- TGF-b ligands that activate downstream Smad transcription factors sin-1; SEC61A1, which is involved in protein translocation in in renal interstitial cells. Collectively, these findings reveal a novel the endoplasmic reticulum; and HNF1B, which encodes the Twist2-dependent EMT pathway that underlies renal fibrosis in HNF1B- transcription factor hepatocyte NF-1b (HNF-1b). Causative related ADTKD. genes have not yet been identified in a significant portion of affected individuals. and the mechanisms whereby human mutations lead to a b HNF-1 is a homeodomain-containing transcription fac- broad spectrum of clinical phenotypes remain to be fully fi tor that regulates tissue-speci c gene expression in the kidney, elucidated. Constitutive ablation of Hnf1b in mice results in 8 b liver, pancreas, and other epithelial organs. HNF-1 is essen- embryonic lethality due to failure of endoderm development,23 b tial for normal kidney development; ablation of HNF-1 in and kidney-specificdeletionofHnf1b using the Ksp/Cre deleter nephron progenitors leads to disturbances in Notch-depen- strain results in postnatal kidney failure.14,18 We recently used dent nephron patterning, and ablation in the ureteric bud Pkhd1/Cre24 mice to ablate Hnf1b specifically in renal collecting inhibits branching morphogenesis and Wnt9b-dependent ducts.21 Collecting duct-specific deletion of Hnf1b results in 9,10 nephron induction and GDNF/Ret signaling. In humans, longer survival and slower progression of cystic disease, renal mutations of HNF1B have been linked to congenital abnor- fibrosis, and hydronephrosis. Mutant mice also exhibit polyuria, malities of the kidney and urinary tract, including renal agen- polydipsia, and impaired urinary concentration recapitulating esis/hypoplasia, multicystic dysplastic kidneys, horseshoe clinical features of ADTKD in humans with mutations in 11 kidneys, and glomerulocystic kidney disease. Mutations HNF1B. of HNF1B can also produce ADTKD, often associated with To investigate the pathogenesis of renal interstitial fibrosis in hyperuricemia, hypomagnesemia, hypokalemia, diabetes ADTKD, three ADTKD-UMOD mouse models had been 12,13 mellitus, and Müllerian duct abnormalities. Previous generated.25–27 Characterization of the mutant mice suggests b studies suggested that HNF-1 regulates the transcription of that renal fibrosis arises from endoplasmic reticulum (ER) UMOD, raising the possibility that disturbances in a common stress and secondary mitochondrial dysfunction. However, transcriptional network may underlie the pathogenesis of the mechanism whereby mutations of HNF1B produce 14 ADTKD. Abnormalities in unfolded protein response tubulointerstitial fibrosis has not been explored. Using HNF-1b (UPR) and mitochondrial metabolism have also been mutant cell lines and mouse models, we found that loss of 15 implicated. In addition to inherited kidney diseases, muta- HNF-1b induces epithelial–mesenchymal transition (EMT) via tions of HNF1B have been detected in sporadic cases of derepression of the transcription factor Twist2. As a consequence, 16 renal hypoplasia/dysplasia. Expression of HNF1B is also the expression of TGF-b ligands is upregulated in renal tubules, 17 downregulated in polycystic kidney disease. which leads to renal fibrosis via a cell-nonautonomous process. Several genetically modified mouse models have been developed to unravel the pathogenesis of human HNF1B-related kidney disease.14,18 Common features of the HNF-1b mutant METHODS mouse models are enlarged kidneys with fluid-filled cysts, multilayered cyst epithelium, and hydronephrosis. Molecular Transgenic Mice characterization of HNF-1b mutant mice has shown that Ksp/Cre mice that express Cre recombinase under the control HNF-1b plays a significant role in cystic kidney diseases of the Ksp-cadherin (Cdh16)promoterandHnf1bf/f mice through the regulation of cystogenes such as Pkhd1, Pkd2, containing loxP sites flanking exon 1 of Hnf1b have been de- Umod,andKif12.14,18,19 Recent chromatin immunoprecipita- scribed previously.14 R26R-EYFP mice that express EYFP after tion sequencing (ChIP-seq) experiments have shown that Cre/loxP recombination were provided by Dr. Frank Costantini HNF-1b regulates cholesterol metabolism through transcrip- (Columbia University).28 Ksp/Cre mice were crossed with tional activation of Srebp2 and Pcsk9,20 urinary concentration Hnf1bf/+ mice, and the bitransgenic progeny were intercrossed through activation of Fxr,21 and potassium and magnesium to generate Ksp/Cre;Hnf1bf/f mice (HNF-1b mutant mice). homeostasis through activation of Kir5.1.22 However, the Cre-negative or Ksp/Cre;Hnf1bf/+ littermates were used as complete gene network governed by HNF-1b in the kidney negative controls. Mice of both sexes were used for experiments.

2494 Journal of the American Society of Nephrology J Am Soc Nephrol 29: 2493–2509, 2018 www.jasn.org BASIC RESEARCH

Cell Culture considered differentially expressed. R package biomaRt mIMCD3 cells were obtained from American Type Culture Col- (v2.26.1)32 and pheatmap (v1.0.8) were used for the down- lection and maintained in DMEM supplemented with 10% FBS stream data exploration and visualization. Raw and processed andantibiotics(100U/mlpenicillinand100mg/mlstreptomycin). data have deposited with the National Center for Biotechnol- Cells were cultured at 37°C under 5% CO2. ogy Information Gene Expression Omnibus under accession number GSE97770. Gene Editing Cells were seeded on six-well plates (Corning) at a density Lentiviral Transduction of 200,000 cells per well. After 24 hours, when 60%–70% A lentiviral vector expressing HA-tagged GFP (pLV-HA-GFP) confluent, the cells were transfected with 2 mgCas9and has been described previously.29 To generate a vector express- U6-sgRNA vector (PX459, #48139; Addgene) using Lipofect- ing HA-tagged Twist2 (pLV-HA-Twist2), the Twist2 coding amine 3000 (Life Technologies) according to the manufac- sequence was amplified with primers containing EcoRV and turer’s directions. The single-guide RNA (sgRNA) sequences SalI restriction sites at the 59 and 39 ends, respectively. The are listed in Supplemental Table 1. After incubation for 72 PCR product was cloned in-frame into compatible restriction hours, an aliquot of the transfected cells was lysed using sites of pLV-HA-GFP. mIMCD3 cells were infected with QuickExtract DNA extraction kits (Epicentre), following the lentivirus and selected by growth in hygromycin (200 mg/ml) manufacturer’s directions. Genomic DNAwas amplified using for 10 days. Surviving cells were pooled for subsequent PCR kits (Quanta Biosciences). The sequences of PCR primers experiments. are listed in Supplemental Table 2. PCR products were cloned using CloneJET PCR cloning kits (Thermo Fisher Scientific), Chromatin Immunoprecipitation (ChIP) and plasmids were sequenced using the Sanger method, with a Quantitative ChIP was performed using an antibody specific universal T7 primer. for anti–HNF-1b (sc-22840; Santa Cruz Biotechnology) as described previously.29 Isotype-specific IgG (sc-2027; Santa Quantitative Real-Time RT-PCR Cruz Biotechnology) was used as a negative control. DNA Total RNA was extracted from cells or kidneys using TRIzol (ChIP-enriched or input) was quantified by real-time PCR (Invitrogen) or RNeasy Mini Kits (Qiagen) according to the using PerfeCTa SYBR Green FastMix. Sequences of gene- manufacturers’ directions. Complementary DNA was synthe- specific primers are listed in Supplemental Table 4. sized using cDNA Synthesis Kit (Roche), and quantitative real-time PCR was performed with PerfeCTa SYBR Green Immunoblot Analysis FastMix (Quanta Biosciences) using a CFX Connect Real- Cells were lysed in Laemmli buffer and subjected to immunoblot Time System (Bio-Rad). Gene expression levels in cell lines analysis as described previously.33 Immunoblots were or whole kidneys were normalized to 18S ribosomal RNA and incubated with primary antibodies overnight at 4°C then incu- b2 microglobulin, respectively. Fold changes in messenger bated with the appropriate horseradish peroxidase-conjugated RNA (mRNA) expression levels were calculated using the secondary antibodies at room temperature for 1 hour. Immu- comparative Ct method, as described.29 Primers used for noblots were developed by incubation with chemiluminescence quantitative real-time PCR are listed in Supplemental Table 3. reagent (Amersham) and exposed to x-ray film. Antibodies are listed in Supplemental Table 5. RNA-Sequencing TruSeq stranded mRNA libraries were generated from each Wound Healing Assays sample and sequenced in a 50 bp paired-end run on a HiSeq Cells (53105) were seeded in 24-well Culture-Insert plates 2500 instrument using v4 chemistry by the University of Min- (#80241; iBidi) containing silicon inserts with a 500 mm nesota Genomics Center. Raw paired-end RNA-sequencing cellfree gap. After incubation for 36 hours to 100% confluency, (RNA-seq) reads in fastq format were analyzed using go- the inserts were removed and culture medium was replaced. pher-pipeline software (Rnaseq-Pipeline version 1.4; https:// Phase-contrast photomicrographs were obtained at time bitbucket.org/jgarbe/gopher-pipelines), which (1) assesses 0 hours and after 12 hours incubation at 37°C. The area of base call quality, cycle uniformity, and contamination using thecellfreegapwasmeasuredusingPhotoshop,andthe fastQC, (2) maps reads to the reference mouse genome percentage of gap closure was calculated. (ensembl GRCm38) via HiSAT2,30 using ensembl mouse an- notation (Mus_musculus.GRCm38.83), (3) cleans the align- Cell Invasion Assays ments using picard tools (https://broadinstitute.github.io/ Cells (53103) were seeded in Transwell cell culture inserts picard/), and (4)quantifies the reads mapped per gene using containing permeable membranes with 3 mmporesize subread.31 The resultant count table was imported into (#353096; Falcon), and placed in 24-well plates with 0.5 ml DESeq2 (v1.10.1)31 to test for differential expression using culture medium. After 48 hours, the inserts were fixed and defaultparameters.Genesthatshowedatleastatwo-fold stained with Giemsa. Phase-contrast photomicrographs were change in expression with a raw P value ,0.05 were obtained using a Nikon microscope.

J Am Soc Nephrol 29: 2493–2509, 2018 Fibrosis in HNF1B-Related Tubulointerstitial Kidney Disease 2495 BASIC RESEARCH www.jasn.org

Cell Cycle Analysis instructions (Advanced Cell Diagnostics). Then, 4-mm-thick Trypsinized cells were centrifuged at 5243g for 5 minutes. The kidney sections were prepared and RNAscope was performed, cell pellets were washed with ice-cold PBS and fixed in 70% using commercial probes for TGF-b2 (cat#406181, accession ethanol overnight at 4°C. Fixed cells were centrifuged at #NM_009367.3) and TGF-b3 (cat#406211, accession 5243g for 5 minutes and stained with 500 ml propidium #NM_009368.3). Hybridization signals were detected after iodide master mix (0.1% Triton X-100, 1 mM EDTA, kit amplification and incubated with 3–39-diaminobenzidine. 0.05 mg/ml RNase A [50 U/mg], 50 mg/ml propidium iodide, Nuclei were counterstained with hematoxylin, and slides were and PBS; pH 7.4) for 1 hour. Stained cells were analyzed mounted with Permount (Sigma). Images were captured with a LSRII (Becton Dickinson) using the 20-mW blue laser using a Leica DM5500 B upright microscope with DFC7000 (488 nm) and a 610/20 band pass filter with a 600LP filter to T camera. register the fluorescence signal. Doublet discrimination was used to analyze the cellular expression of propidium iodide via Collagen Level Determination histogram and to collect a statistically relevant percentage of The Masson trichrome method was used to stain wild-type and single cells to analyze for the cell cycle profile. To quantify HNF-1b knockout p28 kidney paraffin sections. All sections apoptosis, the percentage of cells with hypodiploid DNA were stained at the same time, and blue collagen stain was content was measured by flow cytometry. quantified using ImageJ. The blue channel was separated using the IHC Toolbox plugin (https://imagej.nih.gov/ij/plugins/ Antibody Staining ihc-toolbox/index). Area fraction of blue collagen staining Mice were euthanized, and kidneys were fixed by perfusion and in total non-cystic area was calculated from wild-type and incubation with 4% paraformaldehyde for 48 hours. Tissues HNF-1b knockout kidneys. A two-tailed t test was used to were incubated overnight in 70% ethanol, embedded in par- compare the relative collagen deposition between wild-type affin, and sectioned at 4 mm. For immunohistochemistry, and HNF-1b knockout littermates. slides were incubated in heat-induced antigen retrieval 13 Reveal Decloaker (RV100M; Biocare Medica) for 30 minutes, ELISA treated with 3% hydrogen peroxide, and blocked in 100% Two confluent T175 flasks of cells were rinsed with serum-free Rodent Block M (RBM961; Biocare Medical) for 1 hour. Pri- Advanced/F12 medium and replenished with 20 ml Advanced/ mary antibodies were added in 10% Rodent Block and incu- F12 medium, then incubated at 37°C for 24 hours. Then, 40 ml bated overnight at 4°C. The following primary antibodies were of the conditioned medium was centrifuged at 37243g for used: Twist (#15393, 1:200; Santa Cruz Biotechnology), Snail 10 minutes, and the supernatant was concentrated by centri- (#ab85936, 1:10,000; Abcam), E-Cadherin (#3195, 1: 2000; fugation (Centricon Plus 70 with NMWL:10K) at 35003g Cell Signaling Technology), Vimentin (#5741, 1:2000; Cell for 30 minutes at 4°C. TGF-b2 was measured using TGF-b2 Signaling Technology), and a-SMA (#5694, 10,000; Abcam). Quantikine ELISA Kits according to the manufacturer’s Slides were incubated in Rabbit-on-Rodent HRP-Polymer directions (cat#MB200; R&D Systems). (RMR622; Biocare Medical) for 30 minutes and then treated with 3–39-diaminobenzidine (926603-buffer A, Fibroblast Activation 926503-buffer B; BioLegend) for 5 minutes. Sections were NRK-49F normal rat kidney fibroblasts (American Type Cul- counterstained with hematoxylin. For immunofluorescence, ture Collection) were seeded in six-well plates at 23105 cells the following antibodies were used: HNF-1b (#sc22840, per well and incubated for 48 hours in DMEM containing 5% 1:500; Santa Cruz Biotechnology), GFP (#600–901–215S, FBS, then switched to serum-free Advanced/F12 medium for 1:400; Rockland), Entactin (#ab14511, 1:2000; Abcam), 4 hours. NFK-49F cells were then incubated with an equal Smad3 (#ab40854, 1:2000; Abcam), phospho-Smad3 volume of conditioned medium and fresh Advanced/F12 (#SAB4300253, 1:50; Sigma), SMA-Cy3 (#C6198, 1:500; Sigma), medium containing 0.5% BSA at 37°C for 48 hours. Cells and Vimentin-Alexa Fluor 647 (#9855, 1:2000; Cell Signaling were lysed in 0.5 ml Laemmli buffer and subjected to immu- Technology). Secondary antibodies were conjugated to Cy3 or noblot analysis. Alexa Fluor 647 (1:2000; Jackson ImmunoResearch). Nuclei were counterstained with DAPI (496-diamidino-2-phenylindol). Statistical Analyses Images were captured using a Leica DM5500 B upright micro- A Student two-tailed unpaired t test was used for pairwise scope with DFC7000 T camera. Confocal laser scanning micros- comparisons. One-way ANOVA followed by Tukey test was copy was performed by the Imaging Core of the University of used for multiple comparisons. P,0.05 was considered Minnesota Center for Immunology with an Olympus FV1000 significant. Confocal Microscope. Study Approval In Situ Hybridization All experiments involving animals were performed under the RNA in situ hybridization was performed using RNAscope 2.0 auspices of the Institutional Animal Care and Use Committee HD-Assay-Brown Kit (cat#210020) per the manufacturer’s at the University of Minnesota.

2496 Journal of the American Society of Nephrology J Am Soc Nephrol 29: 2493–2509, 2018 www.jasn.org BASIC RESEARCH

Figure 1. Ablation of HNF-1b alters epithelial cell morphology. (A) Diagram showing the Hnf1b locus before (above) and after (below) CRISPR-based nonhomologous end joining (NHEJ). Blue arrows indicate sgRNA binding sites. F1 and R1 indicate PCR primers used for genotyping. (B) PCR of genomic DNA showing deletion of exon of Hnf1b in three independent mIMCD3 cell lines. (C) Sanger sequencing of the NHEJ junction from an HNF-1b knockout cell line. (D) Immunoblot analysis showing undetectable HNF-1b protein in three knockout cell lines compared with wild-type cell lines. b-actin was used as a loading control. (E and F) Quantitative RT-PCR showing greatly reduced expression of Hnf1b and Pkhd1 in three HNF-1b knockout cell lines compared with wild-type mIMCD3 cells. Error bars indicate SD. (G) Phase-contrast photomicrographs showing polygonal morphology of wild-type mIMCD3 cell lines and spindle-shaped morphology of HNF-1b knockout cell lines. Scale bars, 100 mm. KO, knockout; WT, wild-type.

RESULTS seen in HNF-1b mutant mice. These findings suggest that this new cell line model recapitulates the in vivo phenotype of Ablation of HNF-1b in mIMCD3 Renal Epithelial Cells HNF-1b mutant kidneys. Genotyping of mouse simple se- Alters Cell Morphology quence repeats confirmed that the HNF-1b null cell lines Weused CRISPR-based gene-editing to delete exon 1 of Hnf1b in were derived from the parental mIMCD3 cell line (data not the collecting duct-derived cell line mIMCD3. Previous studies shown). When grown on plastic dishes, wild-type mIMCD3 using homologous recombination in mice showed that deletion cells formed monolayers of polygonal-shaped cells typical of of exon 1 produces a null allele.14 We synthesized sgRNAs com- epithelial cells. In contrast, all three HNF-1b knockout cell lines plementary to sequences flanking exon 1 and cotransfected cells adopted a spindle-shaped morphology that is characteristic of with Cas9 to delete the intervening sequence by nonhomologous mesenchymal cells, such as fibroblasts (Figure 1G). These results end joining (Figure 1A). Deletion-spanning PCR confirmed the suggest that ablation of HNF-1b in renal epithelial cells alters complete removal of exon 1 from the Hnf1b locus. Three in- cell morphology. dependent clones lacking exon 1 were generated and used to establish permanent lines (Figure 1B). Sanger sequencing of HNF-1b Null mIMCD3 Cells Exhibit EMT Characteristics the PCR fragments confirmed deletion of the first exon and and Form Multilayered Epithelia In Vitro end-joining at the predicted cut sites (Figure 1C). Immunoblot To determine the whole-genome transcriptome that is regulated analysis using an antibody against the N-terminus of HNF-1b by HNF-1b, we performed RNA-seq on three wild-type showed absent protein in all three HNF-1b–deficient cell lines mIMCD3 cell lines and three HNF-1b–deficient cell lines. (Figure 1D). Antibodies against the C-terminus showed low HNF-1b–deficient cells showed upregulation of 1135 genes levels of truncated HNF-1b (not shown), in which the absence and repression of 759 genes compared with control cells of the essential N-terminal dimerization domain would abolish (Figure 2A). All differentially expressed genes are listed in Sup- activity. To confirm the loss of functional HNF-1b, we used plemental Table 6. As a positive control, we confirmed changes quantitative RT-PCR to measure the expression of the canonical in expression of previously identified HNF-1b–dependent genes, downstream target gene Pkhd1.18 The expression of Pkhd1 was such as Pkhd1, Pcsk9, Cdh16, Kif12,andSocs3.14,20 To identify almost undetectable in HNF-1b null cell lines, similar to results the differentially expressed genes that are directly regulated by

J Am Soc Nephrol 29: 2493–2509, 2018 Fibrosis in HNF1B-Related Tubulointerstitial Kidney Disease 2497 BASIC RESEARCH www.jasn.org

Figure 2. Ablation of HNF-1b in renal epithelial cells induces EMT. (A) Heatmap showing differentially expressed genes in three independent HNF-1b–deﬁcient cell lines (KO) compared with three wild-type mIMCD3 clones (WT). Genes with log2 fold-change .1or,21 are shown. (B) Heatmap (left panel) showing dysregulation of 36 genes in the EMT pathway identiﬁed by IPA (n=3).

Histogram (right panel) shows the genes ranked by log2 fold-change in expression between wild-type (WT) and mutant (KO) cells. (C) Wound healing assay showing more rapid gap closure in HNF-1b mutant cells (KO) compared with wild-type cells (WT). Data shown represent means from three independent experiments; error bars indicate SEM. (D) Transwell assay using 3-mmporesize polyvinylidene ﬂuoride insert showing greater invasiveness of mutant cells (KO) compared with wild-type cells (WT); error bars indicate SEM. (E) Cross-sections of wild-type cells (WT) and HNF-1b mutant cells (KO) grown on Lumox discs and visualized using differential interference contrast microscopy. Arrowheads indicate cell–cell junctions in the multilayered mutant epithelium. *P value ,0.05.

HNF-1b, we compared the RNA-seq results with our previous HNF-1b–deficient mIMCD3 cells (Supplemental Figure ChIP-seq analysis of genome-wide binding of HNF-1b in 1A). Examination of the EMT gene set in HNF-1b–deficient native chromatin from mIMCD3 cells.20 This analysis cells showed upregulation of key EMT transcription factors revealed that 75% of the differentially expressed genes Snail1, Snail2, Zeb2, and Twist2 and increased expression of contained nearby HNF-1b binding sites and were therefore TGF-b ligands TGF-b2, and TGF-b3. Conversely, the expres- likely to be directly regulated by HNF-1b. sion of E-cadherin (Cdh1) was reduced (Figure 2B). Exami- Ingenuity Pathway Analysis (IPA) revealed that EMT nation of 44 genes within the fibrosis gene set showed that and fibrosis were the two most dysregulated pathways in genes involved in collagen synthesis were significantly

2498 Journal of the American Society of Nephrology J Am Soc Nephrol 29: 2493–2509, 2018 www.jasn.org BASIC RESEARCH

Figure 3. Ablation of HNF-1b activates an EMT transcriptional network in vivo. (A). Immunoblot showing increased levels of Twist, Snail1, Snail2, Zeb1, and Zeb2 and unchanged levels of E-cadherin in protein lysates from wild-type (WT) and HNF-1b mutant (KO) kidneys (n=5). GAPDH was used as a loading control. (B–G) Protein bands were quantified by Image Studio Lite software (LI-COR). Relative abundance was normalized to GAPDH. Error bars indicate SD. *P,0.05. (H and I) Immunohistochemical staining using an (H) anti-Twist antibody or (I) anti-Snail antibody on P28 kidney sections from control mice (left) and HNF-1b mutant mice (right) (n=3). Positive staining is indicated in brown. Strong staining is seen in nuclei of epithelial cells (arrowheads) lining the cysts (cy). Scale bars, 10 mm. KO, knockout; WT, wild-type. upregulated in HNF-1b–deficient cells (Supplemental Figure Ablation of HNF-1b Induces Partial EMT In Vivo 1B). Expression of other known ADTKD genes was either To determine whether ablation of HNF-1b also induces EMT undetectable (Umod, Ren1)orunchanged(Sec61a1, Muc1) in vivo, we measured the expression of master EMT transcrip- (Supplemental Figure 2). tion factors in kidneys from HNF-1b mutant mice. For these Next, we determined whether the molecular signature of experiments, we utilized Ksp/Cre;Hnf1bF/F mice in which the EMT was associated with corresponding changes in cell first exon of Hnf1b is deleted by Cre/loxP recombination phenotype. First, we performed wound healing assays to specifically in renal tubules. Previous studies have shown measure cell migration. Compared with wild-type mIMCD3 that kidney-specific deletion of Hnf1b results in the formation cells, HNF-1b–deficient cells exhibited faster rates of wound of kidney cysts and rapid decline in kidney function.14 Kidneys healing (Figure 2C). The rates of cell growth and cell-cycle were harvested from wild-type and mutant mice at P28, and progression were similar, whereas apoptosis was decreased protein lysates were analyzed by immunoblotting and in HNF-1b–deficient cells (Supplemental Figure 3). To con- quantified by band densitometry. Like the findings in firm the increased cell motility, we performed cell invasion HNF-1b–deficient mIMCD3 cells, the expression of EMT assays using Transwell filters. HNF-1b–deficient mIMCD3 transcription factors Twist, Snail1, Snail2, Zeb1, and Zeb2 cells could invade through the 3-mm pores of a permeable was significantly higher in kidneys from HNF-1b mutant filter, whereas wild-type cells exhibited no invasion (Figure mice compared with wild-type kidneys (Figure 3, A–G). How- 2D). When grown to confluence on Lumox discs, wild-type ever, in contrast to HNF-1b mutant cells, the expression of mIMCD3 cells exhibited contact inhibition and formed E-cadherin was not significantly altered in mutant kidneys. an epithelial monolayer. In contrast, HNF-1b–deficient To confirm the presence of EMT in epithelial cells, we per- cells produced a multilayered epithelium reminiscent of the formed immunohistochemistry on kidney sections using multilayered cyst epithelium seen in HNF-1b mutant mice antibodies against Twist and Snail. As shown in Figure 3, H and humans (Figure 2E).14 These cellular and molecular and I, the nuclei of cyst epithelial cells in HNF-1b mutant phenotypes indicate that ablation of HNF-1b in renal kidneys showed more intense staining for Twist and Snail pro- epithelial cells is sufficient to induce EMT. teins compared with wild-type tubular epithelial cells. Taken

J Am Soc Nephrol 29: 2493–2509, 2018 Fibrosis in HNF1B-Related Tubulointerstitial Kidney Disease 2499 BASIC RESEARCH www.jasn.org

Figure 4. Twist2 is a novel HNF-1b–regulated EMT transcription factor. (A) ChIP-seq analysis of wild-type mIMCD3 cells showing HNF- 1b binding sites in the first intron (BSI) and 39 flanking region (BSII) of Twist2. Filled boxes indicate exon, and the arrow indicates the direction of transcription. Data were visualized using IGV software. (B–D) Quantitative ChIP confirms binding of HNF-1b to two sites in the Twist2 locus (open bars). (B) shows the absence of binding to an irrelevant DNA sequence. ChIP was performed on HNF-1b mutant cells as an additional negative control (filled bars). Data shown represent the mean6SD from two independent experiments performed in triplicate. (E) Quantitative RT-PCR showing upregulation of Twist2 mRNA transcripts in HNF-1b mutant cells (KO) compared with wild-type cells (WT). (F) Quantitative ChIP showing binding of HA-tagged Twist2 to the Snail2 promoter (filled bars). HA-tagged GFP was used as a negative control (open bars). (G) Quantitative RT-PCR showing decreased expression ofSnail2 mRNA transcripts in Twist2 knockout cells (KO) compared with wild-type mIMCD3 cells (WT). Data shown represent mean6SEM from three independent experiments. *P,0.05. together, these results suggest that ablation of HNF-1b in bind to an E-box sequence in DNA, are essential for the vivo results in partial EMT, as evidenced by induction of development of mesodermal tissues, and promote EMT and EMT transcription factors but preserved expression of cancer metastasis.34 E-cadherin. Analysis of our previous ChIP-seq data20 indicated that Twist1 was unlikely to be regulated by HNF-1b (data not Twist2 Is a Novel EMT Transcription Factor Regulated shown). In contrast, Twist2, which encodes a protein with by HNF-1b similar DNA-binding properties, contained two potential Knowledge-based IPA suggested that the induction of EMT binding sites for HNF-1b.Onesite(HNF-1b BSI) was located genes in HNF-1b–deficient mIMCD3 cells could be explained in the first intron 16 kb downstream from the transcription by upstream activation of the transcription factor Twist1 start site and a second site (HNF-1b BSII) was located in the 39 (Supplemental Figure 4). Twist1 and its homolog Twist2 flanking region 4 kb downstream from the gene body (Figure constitute a family of basic-helix–loop-helix transcription 4A). Using quantitative ChIP, we validated the binding factors that are highly expressed in mesenchymal cells, of HNF-1b to the Twist2 locus in wild-type mIMCD3 cells

2500 Journal of the American Society of Nephrology J Am Soc Nephrol 29: 2493–2509, 2018 www.jasn.org BASIC RESEARCH

Figure 5. Ablation of Twist2 rescues the EMT phenotype in HNF1b–deﬁcient cells. (A) Representative phase-contrast images of wild- type mIMCD3 (WT), HNF-1b knockout cells (KO), and HNF-1b and Twist2 double knockout cells (DKO). Scale bar, 100 mm. (B–G) Quantitative RT-PCR showing normalized expression of E-Cadherin, TGF-b2, TGF-b3, Snail2, Zeb1, and Zeb2 in HNF-1b and Twist2 double knockout cells (DKO) compared with HNF-1b single knockout cells (KO). WT indicates expression in wild-type mIMCD3 cells. (H) Cell migration measured by wound healing assays in wild-type (WT), HNF-1b mutant (KO), and HNF-1b and Twist2 double knockout (DKO) cells. (I) Cell invasiveness measured by Transwell assays in wild-type (WT), HNF-1b mutant (KO), and HNF-1b and Twist2 double knockout (DKO) cells. Data shown represent mean6SEM from three independent experiments. *P,0.05.

(Figure 4, B–D). Compared with control IgG, immunoprecip- binding of HNF-1b was functionally significant, we measured itation with an HNF-1b antibody resulted in enrichment of Tw ist2 mRNA transcripts by quantitative RT-PCR (Figure 4E). chromatin containing BSI and BSII but no enrichment of an The level of Twist2 transcripts was significantly increased in irrelevant genomic region. No significant binding was de- HNF-1b mutant mIMCD3 cells compared with wild-type tected in HNF-1b–deficient mIMCD3 cells, further indicating cells, suggesting that HNF-1b normally represses Twist2 that the binding was specific. To determine whether the transcription (Figure 4E).

J Am Soc Nephrol 29: 2493–2509, 2018 Fibrosis in HNF1B-Related Tubulointerstitial Kidney Disease 2501 BASIC RESEARCH www.jasn.org

Previous studies showed that Twist1 regulates the expres- immunohistochemistry showed accumulation of vimentin sion of Snail2 (Slug), a zinc-finger transcription factor that is and a-SMA in the interstitium and maintenance of E-cadherin upregulated during EMT.35 Because the expression of Snail2 is in the epithelium (Supplemental Figure 5, B–D). elevated in HNF-1b mutant cells, and Twist1 and Twist2 share Earlier studies suggested that EMT is a source of myofibro- similar DNA-binding properties, we tested whether Twist2 blasts that are responsible for renal interstitial fibrosis.37 How- can also regulate Snai2 transcription. We used lentiviruses ever, more recent studies suggest that myofibroblasts originate to generate mIMCD3 cell lines stably expressing HA-tagged from resident interstitial cells, which may include fibroblasts, Twist2, or HA-tagged GFP as a negative control. Quantitative pericytes, endothelial cells, and macrophages.38 To test ChIP with an anti-HA antibody demonstrated that Twist2 whether myofibroblasts in HNF-1b mutant kidneys originate (but not GFP) was bound to the Snai2 promoter (Figure by EMT, we performed genetic cell fate mapping. First, we 4F). Using CRISPR-based gene editing, we deleted Twist2 used Cre/loxP recombination to label renal tubular epithelial in mIMCD3 cells. Quantitative RT-PCR showed that the cells with an enhanced yellow fluorescent protein (EYFP) re- expression of Snai2 was reduced in Twist2-deficient mIMCD3 porter gene.28 Kidney sections were costained with antibodies cells compared with wild-type cells. (Figure 4G). Taken against HNF-1b and GFP (which also recognizes EYFP). together, these studies identify Snai2 as a novel transcriptional In wild-type mice, EYFP was expressed exclusively in renal target of Twist2. Upregulation of Twist2 and subsequent tubules that also expressed HNF-1b (Supplemental Figure activation of Snail2 may underlie the induction of EMT in 6A). Next, we generated Ksp/Cre;Hnf1bF/F;R26R-EYFP mice HNF-1b–deficient renal epithelial cells. in which HNF-1b mutant renal epithelial cells were labeled with EYFP. Antibody staining showed that EYFP was Ablation of Twist2 Rescues the Fibroblastic Phenotype expressed in cyst epithelial cells that lacked HNF-1b and of Hnf1b Null Cells was not expressed in surrounding non-cystic tubules in which To determine whether Twist2 is required for the induction of the expression of HNF-1b was maintained (Supplemental EMT, we generated HNF-1b and Twist2 double-knockout cells Figure 6B). using CRISPR-based gene editing. Ablation of Twist2 in To assess whether HNF-1b mutant cells migrate into the HNF-1b–deficient cells converted the cells to a more epithelial interstitium, we costained kidney sections with antibodies morphology (Figure 5A). Quantitative RT-PCR showed that against EYFP and the basement membrane marker entactin. ablation of Twist2 restored the normal expression of E-cadherin EYFP-positive cells were located exclusively on the luminal and reduced the overexpression of EMT transcription factors side of the basement membrane and were not detected in the Snail2, Zeb1, and Zeb2 (Figure 5, B and E–G). Importantly, renal interstitium, indicating that the mutant cells did not the expression of TGF-b ligands TGF-b2andTGF-b3was migrate out of the tubules (Supplemental Figure 6C). To also increased in HNF-1b–deficient cells and was reduced determine whether HNF-1b–deficient epithelial cells can in double-knockout cells (Figure 5, C and D). Functionally, transdifferentiate into myofibroblasts, we costained kidney HNF-1b and Twist2 double-knockout cells migrated sections with antibodies against EYFP and a-SMA. As more slowly and were less invasive compared with HNF-1b shown in (Supplemental Figure 6D), a-SMA–positive cells single-knockout cells (Figure 5, H and I). These findings indicate were present in the interstitium but did not express EYFP, that the induction of EMT in HNF-1b–deficient mIMCD3 indicating that they were not derived from HNF-1b mutant cells is Twist2-dependent. epithelial cells. Taken together, these findings indicate that HNF-1b mutant epithelial cells undergo EMT but do not HNF-1b Mutant Kidneys Develop Interstitial Fibrosis transdifferentiate into myofibroblasts in vivo. through a Cell-Nonautonomous Mechanism Previous studies have shown that collecting duct-specific Aberrant TGFb Signaling Underlies Interstitial Fibrosis deletion of HNF-1b using the Pkhd1/Cre deleter strain in HNF-1b Mutant Kidneys produces renal fibrosis.21 To ablate HNF-1b in additional The preceding studies suggested that renal myofibroblasts orig- nephron segments, we generated kidney HNF-1b mutant inate via a cell-nonautonomous mechanism in which HNF-1b mice using the Ksp/Cre deleter strain, which expresses Cre mutant kidney tubules produce signals that activate interstitial recombinase in all nephron segments and collecting ducts.36 cells. RNA-seq analysis of HNF-1b–deficient mIMCD3 cells Trichrome staining showed that significant interstitial fibrosis showed increased expression of profibrotic signaling mole- was present in kidneys from Ksp/Cre;Hnf1bF/F mice at age cules TGF-b2andTGF-b3 (Figure 5, C and D). Quantitative 28 days (Supplemental Figure 5A). Quantitative RT-PCR RT-PCR analysis confirmed upregulation of Tgfb2 and Tgfb3 showed that mRNA transcripts encoding the mesenchymal mRNA transcripts in HNF-1b mutant kidneys (Figure 6, A marker vimentin and the myofibroblast marker a-smooth and B). In contrast, the expression of TGF-b1 was only slightly muscle actin (a-SMA) were upregulated in HNF-1b mutant increased in mutant cells and kidneys, and the increase was kidneys, whereas the expression of E-cadherin, a canonical not statistically significant (Supplemental Figure 7). To marker of epithelial cell polarity, was unchanged (Sup- confirm that TGF-b2andTGF-b3 were upregulated in epi- plemental Figure 5, B–D). Consistent with these results, thelial cells, we performed in situ hybridization (RNAscope).

2502 Journal of the American Society of Nephrology J Am Soc Nephrol 29: 2493–2509, 2018 www.jasn.org BASIC RESEARCH

Figure 6. Expression of TGF-b2andTGF-b3 is upregulated in HNF-1b mutant kidneys. (A and B) Quantitative RT-PCR showing increased expression of mRNA transcripts encoding TGF-b2 and TGF-b3 in kidneys from Ksp/Cre;Hnf1bf/f mice (KO) compared with wild- type littermates (WT) at P28. Data shown represent mean6SEM from three independent experiments. (C and D) In situ hybridization (RNAscope) using probes to TGF-b2 and TGF-b3 in P28 kidneys from Ksp/Cre;Hnf1bf/f mice (KO) and wild-type littermates (WT); n=3. Scale bar, 25 mm. *P,0.05. Cy, cyst.

Transcripts encoding TGF-b2andTGF-b3werestrongly present in the nucleus in mutant kidneys (Figure 7C). These expressed in the cyst epithelium of HNF-1b mutant kidneys results indicate hyperactivation of canonical TGF-b signal- compared with wild-type tubules, consistent with the cell line ing in HNF-1b mutant kidneys. model results and further supporting the EMT phenotype of To confirm the epithelial–mesenchymal crosstalk, we HNF-1b mutant cells (Figure 6, C and D). measured TGF-b2 levels in conditioned medium using In the canonical TGF-b signaling pathway, active TGF-b ELISA. The levels of immunoreactive TGF-b2were ligands bind to the TGF-b receptor type II (TbRII), resulting elevated in conditioned medium from HNF-1b–deficient in activation of the TGF-b receptor type I (TbRI) kinase mIMCD3 cells compared with wild-type cells (Figure 7D). and phosphorylation of downstream effectors Smad2 and To confirm that the secreted TGF-b2 was biologically active, Smad3. Phosphorylated Smad2 and Smad3 bind to Smad4 we incubated the conditioned medium with normal rat forming a heteromeric complex that translocates to the kidney fibroblasts (NRK-49F) and measured Smad3 phos- nucleus and activates transcription of ECM genes. Immu- phorylation. Incubation with conditioned medium from noblot analysis with phosphospecific antibodies showed in- HNF-1b–deficient mIMCD3 cells produced greater creased phosphorylation of Smad2 and Smad3 in protein Smad3 phosphorylation than wild-type cells (Figure 7E). lysates from HNF-1b mutant kidneys (Figure 7A). The levels Total Smad3 was unchanged, and treatment with the TbRI of total Smad2 and Smad3 were also increased. Antibody (ALK5) inhibitor SB431542 reduced Smad3 phosphoryla- staining showed increased phospho-Smad3 within the tion. Taken together, these findings indicate that ablation nuclei of both cyst epithelial cells and interstitial cells in of HNF-1b activates a transcriptional network that results HNF-1b mutant kidneys compared with wild-type tubules in increased production of TGF-b2andTGF-b3, which (Figure 7B). Costaining with antibodies against vimentin signal in a paracrine manner to interstitial cells and thereby and a-SMA showed that phospho-Smad3 accumulated in stimulate renal fibrosis (Figure 8). the nuclei of interstitial fibroblasts and myofibroblasts, respectively (Supplemental Figure 8). Consistent with activation of downstream TGF-b signaling, staining with an DISCUSSION antibody that recognizes both the phosphorylated and de- phosphorylated forms of the protein showed that Smad3 was Germline mutations of the transcription factor HNF-1b primarily cytoplasmic in wild-type kidneys, whereas it was produce a spectrum of inherited human diseases. First

J Am Soc Nephrol 29: 2493–2509, 2018 Fibrosis in HNF1B-Related Tubulointerstitial Kidney Disease 2503 BASIC RESEARCH www.jasn.org

Figure 7. TGFb signaling is aberrant in HNF-1b mutant kidneys. (A) Immunoblot analysis showing increased phosphorylation of Smad2 and Smad3 and increased total levels of Smad2 and Smad3 in kidneys from Ksp/Cre;Hnf1bf/f mice (KO) and wild-type littermates (WT) at P28. b-actin was used as a loading control; n=5. (B) Indirect immunoﬂuorescence of kidney sections from Ksp/Cre;Hnf1bf/f;

2504 Journal of the American Society of Nephrology J Am Soc Nephrol 29: 2493–2509, 2018 www.jasn.org BASIC RESEARCH identified as a cause of maturity-onset diabetes of the young type 5,39 mutations of HNF1B are strongly associated with congenital cystic kidney diseases, including multicystic dysplastic kidneys and glomerulocystic kidney disease. The association of maturity-onset diabetes of the young type 5 with cystic kidney abnormalities has been coined renal cysts and diabetes.40 A link between HNF1B mutations and cyst formation was strengthened by studies showing that HNF-1b directly controls the transcription of the autosomal dominant polycystic kidney disease gene PKD2 and the autosomal re- cessive polycystic kidney disease gene PKHD1.14 Transgenic expression of dominant-negative mutant HNF-1b in mice confirmed the causal association between mutations of HNF1B and cystic kidney disease.18 ChIP-seq experiments have revealed that HNF-1b plays a central role in a transcriptional network that regulates the expression of multiple cystogenes. Besides PKD2 and PKHD1,HNF-1b regulates the transcription of UMOD, which is mutated in medullary cystic kidney disease; CYS1, which is mutated in the cpk mouse model of ARPKD; and KIF12,acpk modifier gene.14 The development of kidney cysts in individuals with HNF1B mutations can be attributed to global inhibition of this transcriptional network. In addition to the formation of kidney cysts, HNF-1b mutant kidneys are characterized by increased interstitial fibrosis.21 A similar phenotype is seen in humans with heterozygous mutations of UMOD, MUC1, REN,andSEC61A1, which has led to the recent nosology of ADTKD.1 The result- Figure 8. Tubular-interstitial crosstalk mediates renal fibrosis in ing clinical manifestations include small kidneys, absence of HNF1B-related ADTKD. Normally, HNF-1b binds to the Twist2 b significant hematuria or proteinuria, slowly progressive de- locus and inhibits Twist2 expression. Loss of HNF-1 results in cline in GFR, and tubular abnormalities such as hyperurice- depression of Twist2 and activation of its downstream target Snai2. Snail2 is known to increase TGF-b3 production through mia, hypomagnesemia, and reduced urinary concentrating b b fi activation of -catenin/TCF4 and may also regulate TGF- 2 ability. The mechanism of renal brosis in ADTKD is poorly expression. Excess TGF-b2andTGF-b3producedbymutant understood. Previous studies of UMOD-related ADTKD have epithelial cells signals to interstitial cells (green) where activation shown that impaired trafficking of mutant uromodulin pro- of TGF-b receptors leads to Smad2/3 phosphorylation and duces ER stress, activation of the UPR, and secondary mito- increased fibrogenesis. chondrial dysfunction.15,26,27 Although the transcription of UMOD is regulated by HNF-1b, it is unlikely that this mechanism is responsible for the phenotype of HNF1B-related Here, we used HNF-1b mutant cells and mice to identify a ADTKD because most patients with UMOD-related ADTKD novel mechanism of renal fibrosis in HNF1B-related ADTKD harbor missense mutations, which produce misfolded pro- (Figure 8). We show that ablation of HNF-1b in renal epithe- teins that accumulate in the ER,27 whereas patients with lial cells results in derepression of its target gene, Twist2,which HNF1B-related ADTKD have wild-type UMOD sequence. in turn causes upregulation of Snail2 and its downstream

R26R-EYFP mice (KO) and wild-type littermates (WT) stained with an antibody against phospho-Smad3 (red). Nuclei were counterstained with DAPI (blue), and merged images are shown in the right panels. Arrowheads indicate nuclear localization of phospho-Smad3 in HNF-1b mutant kidneys but not in wild-type kidneys; n=3. (C) Indirect immunofluorescence of kidney sections from Ksp/Cre;Hnf1bf/f;R26R-EYFP mice (KO) and wild-type littermates (WT) stained with an antibody against total Smad3 (red). Nuclei were counterstained with DAPI (blue), and merged images are shown in the right panels. Arrowheads indicate that Smad3 is excluded from nuclei in wild-type kidneys in HNF-1b mutant kidneys but not in wild-type kidneys; n=3. (D) ELISA assay showing increased levels of TGF-b2 in the culture supernatant from HNF-1b–deficient cells (KO) compared with wild-type mIMCD3 cells (WT). Data shown represent mean6SEM from three independent experiments; *P,0.05. (E) Immunoblot analysis showing increased phosphorylation of Smad3 in NRK-49F cells incubated with conditioned medium from HNF-1b–deficient cells (KO) compared with wild-type cells (WT). Addition of the TGF-b receptor inhibitor SB431542 and purified TGF-b2 was used as a negative and positive control of phosphorylation of Smad3 in NRK-49F cells, respectively. Scale bar, 10 mm.

J Am Soc Nephrol 29: 2493–2509, 2018 Fibrosis in HNF1B-Related Tubulointerstitial Kidney Disease 2505 BASIC RESEARCH www.jasn.org targets, TGF-b3andTGF-b2. Increased TGF-b2 and TGF-b3 expression in mouse tubular epithelial cells. Importantly, abla- produced in renal epithelial cells signal to interstitial cells, tion of Twist2 in HNF-1b–deficient cells reduced cell migration where activation of Smad proteins is known to stimulate and invasiveness and normalized the expression of EMT tran- fibrogenesis.41 Consistent with this model, cell-lineage analy- scription factors and TGF-b ligands, indicating that EMT is sis demonstrated that renal fibroblasts in HNF-1b mutant Twist2-dependent. Twist2 has previously been identified as a kidneys arise via a cell-nonautonomous mechanism. Al- “master” transcription factor in EMT.Twist2 is upregulated dur- though HNF-1b–deficient epithelial cells do not directly gen- ing EMT,and ectopic expression of Twist2 in ovarian cancer cells erate interstitial myofibroblasts, expression of collagen is sufficient to induce EMT.51 Twist2 is homologous to Twist1, genes is upregulated and may contribute to the expansion of which is well studied for its roles in EMT and cancer progres- extracellular matrix (Supplemental Figure 1). sion.52 Although Twist1 and Twist2 are highly conserved and EMT refers to a process in which epithelial cells undergo contain similar protein motifs encoded by a single exon,34 they phenotypic changes, including loss of cell–cell adhesion and have distinct functions and different knockout phenotypes.53 By apical–basal polarity, and acquire mesenchymal characteris- IHC, we detected increased nuclear Twist and Snail proteins in tics, such as spindle-shaped morphology, increased motility, HNF-1b mutant kidneys, indicating activation of an EMT tran- and loss of contact inhibition.42 EMT is essential for normal scriptional network in cyst lining cells. In Drosophila, Twist has ontogeny, wound healing, and tissue regeneration, but sus- been shown to activate Snail,54 and human Twist1 activates tained EMT is associated with tissue fibrosis.43 Cancer cells Snail2 in carcinoma cells.35 Here, we demonstrated that the that undergo EMT produce distant metastasis. The converse homologous protein Twist2 binds to the Snai2 promoter and process, mesenchymal–epithelial transition, is responsible for regulates its expression in kidney epithelial cells. Collectively, the conversion of metanephric mesenchyme into renal tubules these studies demonstrate that HNF-1b regulates EMT during nephrogenesis. EMT is regulated by transcription by repressing transcription of Twist2, thereby inhibiting its factorssuchasTwist1,Twist2,Snail1,Snail2,Zeb1,and downstream target Snai2 (Figure 8). Zeb2, and signaling pathways such as TGF-b,Wnt/b-catenin, HNF-1b was first implicated in renal fibrosis by studies Hedgehog, Notch, and receptor tyrosine kinases.44 HNF-1b showing that the HNF1B gene promoter is repressed by has previously been implicated in EMT in renal fibrosis and Snail1.45 Fibrosis induced by Snail1 was attributed to de- cancer.45,46 A dominant negative form of HNF-1b induces creased expression of HNF-1b, which leads to downregulation EMT when expressed in an ovarian carcinoma cell line of Ksp-cadherin (Cadherin-16), a putative cell adhesion pro- SKOV3.47 HNF-1b cooperates with ERBB2 to induce EMT tein that we previously identified as an HNF-1b–dependent in NMuMG cells.46 However, the precise mechanism whereby gene. However, a Cdh16 knockout phenotype has not been loss of HNF-1b induces EMT is poorly understood. Here, we reported, so the significance of this mechanism remains un- show that loss of HNF-1b by itself is sufficient to induce EMT clear. Recently, we reported the identification of the members in cultured renal epithelial cells, as evidenced by changes in cell of the epithelial-specific miR-200 family of microRNAs as morphology, increased motility, increased invasiveness, de- novel transcriptional targets of HNF-1b.55 HNF-1b binds to creased expression of E-cadherin, and induction of an EMT two evolutionarily conserved sites located 28 kb upstream to gene signature. Importantly, HNF-1b mutant epithelial cells miR-200b and regulates the transcription of a 28-kb long non- also exhibit EMT in vivo, as evidenced by increased expression coding RNA encoding the miR-200b/200a/429 cluster. The of EMT transcription factors and TGF-b ligands. However, expression of the miR-200 cluster was decreased in kidney epi- the expression of E-cadherin was unchanged, which contrasts thelial cells expressing dominant-negative mutant HNF-1b and with the decreased expression in HNF-1b mutant cells. The in in HNF-1b mutant kidneys, resulting in the upregulation of vivo phenotype suggests partial EMT, in which epithelial Zeb2.Thesefindings suggest that HNF-1b may regulate EMT cells dedifferentiate and express both epithelial and through both transcriptional and post-transcriptional mesenchymal characteristics.38,48 Similar findings of mechanisms. complete EMT in vitro and partial EMT in vivo have been Interstitial fibrosis is a common feature of ADTKD and made previously. For example, overexpression of Twist1 or other CKDs. Sustained activation of fibroblast and myofibro- Snail1 induces complete EMT in cultured epithelial cells but blast cell populations within the interstitium results in laying partial EMT with preserved E-cadherin expression in tissues down of excessive extracellular matrix causing renal failure.56 and organoids.49,50 The absence of complete EMT explains The origin of activated myofibroblasts is controversial.38 Cell why HNF-1b mutant epithelial cells fail to differentiate into lineage analysis in mice subjected to unilateral ureteral ob- myofibroblasts and migrate into the renal interstitium. struction suggested that myofibroblasts were derived from RNA-seq analysis of HNF-1b–deficient mIMCD3 cells kidney tubular epithelial cells through a process of EMT.37 showed increased expression of EMT transcription factors Other studies have suggested that myofibroblasts originate Twist2, Snail1, Snail2, and Zeb2. Integration of this RNA-seq from fibrocytes,pericytes,macrophages,orendothelial dataset with our published ChIP-seq dataset20 identified Twist2 cells.57,58 The disparate findings could reflect differences in as a novel HNF-1b–regulated gene. We found that HNF-1b the nephron segments or fibrosis models that were studied. binds to two sites in the Twist2 gene and inhibits Twist2 The results presented here in a mouse model of HNF1B-

2506 Journal of the American Society of Nephrology J Am Soc Nephrol 29: 2493–2509, 2018 www.jasn.org BASIC RESEARCH related ADTKD indicate that interstitial myofibroblasts do not ACKNOWLEDGMENTS originate from tubular epithelial cells. Although kidney epithelial transdifferentiation does not generate myofibroblasts We thank Sophia Vrba, Shayan Farahani, Alan Mickelson, and Steffan in HNF1B-related ADTKD, partial EMT may promote renal Nye for expert technical assistance; Colleen Forster for her excellent fibrosis, as proposed by two recent studies.49,59 histology support and consultation (Bionet, Clinical and Transla- Consistent with a cell-nonautonomous mechanism of fibro- tional Science Institute, University of Minnesota); and Dr. Brian Fife sis, HNF-1b mutant epithelial cells showed marked upregula- (University of Minnesota) for assistance with laser scanning confocal tion of profibrotic signaling molecules TGF-b2 and TGF-b3 microscopy. both in vitro and in vivo. Expression of TGF-b1 was slightly S.C.C., A.S., S.A., J.H., and K.A. conducted experiments. Y.Z. increased in mutant cells and kidneys compared with controls, conducted bioinformatics analysis. M.P. provided the HNF-1b floxed but the difference was not statistically significant. These results mice. S.C.C. and P.I. designed studies, analyzed data, and wrote the suggest that TGF-b2andTGF-b3arethemajorTGF-b ligands manuscript. that are dysregulated in HNF-1b mutant kidneys. TGF-b This work was supported by National Institutes of Health grant signaling is a central mechanism for renal fibrosis through R37DK042921 (to P.I.). the activation of genes required for fibrogenesis41,60 and the 61 initiation and maintenance of EMT. In situ hybridization DISCLOSURES confirmed that Tgfb2 and Tgfb3 mRNA transcripts were upregulated in HNF-1b mutant epithelial cells in the kidney. None. Increased mRNA expression is likely due to upregulation of Snail2, which is known to stimulate Tgfb3 transcription through REFERENCES induction of b-catenin/TCF4 complexes.62 Both TGF-b2 and TGF-b3 have been implicated in renal fi fi 1. Eckardt KU, Alper SL, Antignac C, Bleyer AJ, Chauveau D, Dahan K, et al.; brosis, although anti brotic activity has also been de- Kidney Disease: Improving Global Outcomes: Autosomal dominant tu- 63 fi scribed. Consistent with pro brotic activity, we observed bulointerstitial kidney disease: Diagnosis, classification, and manage- increased phosphorylation and nuclear translocation of ment–A KDIGO consensus report. Kidney Int 88: 676–683, 2015 Smad3 in interstitial cells in HNF-1b mutant kidneys. We 2. Bleyer AJ, Kidd K, Zivná M, Kmoch S: Autosomal dominant tubu- – further showed that conditioned medium from HNF-1b lointerstitial kidney disease. Adv Chronic Kidney Dis 24: 86 93, 2017 b 3. Hart TC, Gorry MC, Hart PS, Woodard AS, Shihabi Z, Sandhu J, et al.: knockout cells could stimulate T RI-dependent phosphory- Mutations of the UMOD gene are responsible for medullary cystic lation of Smad3 in cultured fibroblasts. These results support kidney disease 2 and familial juvenile hyperuricaemic nephropathy. epithelial/myofibroblast crosstalk as an important mechanism JMedGenet39: 882–892, 2002 of renal fibrosis in HNF1B-related ADTKD (Figure 8).64 Pre- 4. Kirby A, Gnirke A, Jaffe DB, Barešová V, Pochet N, Blumenstiel B, et al.: vious studies have shown that transgenic overexpression of Mutations causing medullary cystic kidney disease type 1 lie in a large VNTR in MUC1 missed by massively parallel sequencing. Nat Genet 45: b fi 65 TGF- 1 in renal tubules increases renal brosis and knock- – b fi fi 299 303, 2013 out of T RII in SMA-positive myo broblasts, but not bro- 5. Zivná M, Hůlková H, Matignon M, Hodanová K, Vylet’al P, Kalbácová M, blasts, reduces fibrosis.58,66 Besides TGF-b, epithelial cells et al.: Dominant renin gene mutations associated with early-onset hy- undergoing EMT can produce other cytokines and peruricemia, anemia, and chronic kidney failure. Am J Hum Genet 85: – fi 38 204 213, 2009 signaling molecules that promote renal brosis. In this 6. Bolar NA, Golzio C, Zivná M, Hayot G, Van Hemelrijk C, Schepers D, regard, PDGF ligands and receptors were also upregulated in et al.: Heterozygous loss-of-function SEC61A1 mutations cause auto- HNF-1b null cells (data not shown). Phosphorylation of somal-dominant tubulo-interstitial and glomerulocystic kidney disease Smads was also observed in the HNF-1b mutant epithelium with anemia. Am J Hum Genet 99: 174–187, 2016 itself, suggesting that TGF-b maysignalinanautocrineman- 7. Faguer S, Decramer S, Chassaing N, Bellanné-Chantelot C, Calvas P, fi ner. Because TGF-b can induce Snail proteins, such signaling Beau ls S, et al.: Diagnosis, management, and prognosis of HNF1B nephropathy in adulthood. Kidney Int 80: 768–776, 2011 would provide a feed-forward mechanism for potentiating 8. Ferrè S, Igarashi P: New insights into the role of HNF-1b in kidney 61 EMT and further stimulating renal fibrosis. Alternatively, (patho)physiology [published online ahead of print July 1, 2018]. Pe- autocrine TGF-b signaling may be protective, as evidenced diatr Nephrol doi:10.1007/s00467-018-3990-7 by increased fibrosis after collecting duct-specificablation 9. Massa F, Garbay S, Bouvier R, Sugitani Y, Noda T, Gubler MC, et al.: b of TbRII.67 Hepatocyte nuclear factor 1 controls nephron tubular development. Development 140: 886–896, 2013 In summary, we have identified a novel EMT transcriptional b 10. Desgrange A, Heliot C, Skovorodkin I, Akram SU, Heikkilä J, Ronkainen network in renal epithelial cells. Mutation of HNF-1 upregu- VP, et al.: HNF1B controls epithelial organization and cell polarity lates this network through depression of Twist2 and its tran- during ureteric bud branching and collecting duct morphogenesis. scriptional target Snail2. Renal interstitial fibrosis arises Development 144: 4704–4719, 2017 through a cell-nonautonomous mechanism that may involve ab- 11. Verhave JC, Bech AP, Wetzels JF, Nijenhuis T: Hepatocyte nuclear b factor 1b-associated kidney disease: More than renal cysts and di- errant TGF- signaling. Targeting this new axis may provide op- abetes. JAmSocNephrol27: 345–353, 2016 portunities for treating HNF1B-related ADTKD and other kidney 12. van der Made CI, Hoorn EJ, de la Faille R, Karaaslan H, Knoers NV, diseases associated with decreased expression of HNF-1b. Hoenderop JG, et al.: Hypomagnesemia as first clinical manifestation

J Am Soc Nephrol 29: 2493–2509, 2018 Fibrosis in HNF1B-Related Tubulointerstitial Kidney Disease 2507 BASIC RESEARCH www.jasn.org

of ADTKD-HNF1B: A case series and literature review. Am J Nephrol 32. Durinck S, Spellman PT, Birney E, Huber W: Mapping identifiers for the 42: 85–90, 2015 integration of genomic datasets with the R/Bioconductor package bi- 13. Adalat S, Woolf AS, Johnstone KA, Wirsing A, Harries LW, Long DA, omaRt. Nat Protoc 4: 1184–1191, 2009 et al.: HNF1B mutations associate with hypomagnesemia and renal 33. Chan SC, Li Y, Dehm SM: Androgen receptor splice variants activate magnesium wasting. JAmSocNephrol20: 1123–1131, 2009 androgen receptor target genes and support aberrant prostate cancer 14. Gresh L, Fischer E, Reimann A, Tanguy M, Garbay S, Shao X, et al.: cell growth independent of canonical androgen receptor nuclear lo- A transcriptional network in polycystic kidney disease. EMBO J 23: calization signal. JBiolChem287: 19736–19749, 2012 1657–1668, 2004 34. Franco HL, Casasnovas J, Rodríguez-Medina JR, Cadilla CL: Re- 15. Kemter E, Fröhlich T, Arnold GJ, Wolf E, Wanke R: Mitochondrial dys- dundantorseparateentities?–roles of Twist1 and Twist2 as molecular regulation secondary to endoplasmic reticulum stress in autosomal switches during gene transcription. Nucleic Acids Res 39: 1177–1186, dominant tubulointerstitial kidney disease - UMOD (ADTKD-UMOD). 2011 Sci Rep 7: 42970, 2017 35. Casas E, Kim J, Bendesky A, Ohno-Machado L, Wolfe CJ, Yang J: Snail2 16. Ulinski T, Lescure S, Beaufils S, Guigonis V, Decramer S, Morin D, et al.: is an essential mediator of Twist1-induced epithelial mesenchymal Renal phenotypes related to hepatocyte nuclear factor-1beta (TCF2) transition and metastasis. Cancer Res 71: 245–254, 2011 mutations in a pediatric cohort. JAmSocNephrol17: 497–503, 2006 36. Shao X, Johnson JE, Richardson JA, Hiesberger T, Igarashi P: A minimal 17. Song X, Di Giovanni V, He N, Wang K, Ingram A, Rosenblum ND, et al.: Ksp-cadherin promoter linked to a green fluorescent protein reporter Systems biology of autosomal dominant polycystic kidney disease gene exhibits tissue-specific expression in the developing kidney and (ADPKD): Computational identification of gene expression pathways and genitourinary tract. J Am Soc Nephrol 13: 1824–1836, 2002 integrated regulatory networks. Hum Mol Genet 18: 2328–2343, 2009 37. Iwano M, Plieth D, Danoff TM, Xue C, Okada H, Neilson EG: Evidence 18. Hiesberger T, Bai Y, Shao X, McNally BT, Sinclair AM, Tian X, et al.: Mu- that fibroblasts derive from epithelium during tissue fibrosis. JClinIn- tation of hepatocyte nuclear factor-1beta inhibits Pkhd1 gene expression vest 110: 341–350, 2002 and produces renal cysts in mice. J Clin Invest 113: 814–825, 2004 38. Lovisa S, Zeisberg M, Kalluri R: Partial epithelial-to-mesenchymal 19. Gong Y, Ma Z, Patel V, Fischer E, Hiesberger T, Pontoglio M, et al.: transition and other new mechanisms of kidney fibrosis. Trends En- HNF-1beta regulates transcription of the PKD modifier gene Kif12. docrinol Metab 27: 681–695, 2016 JAmSocNephrol20: 41–47, 2009 39. Horikawa Y, Iwasaki N, Hara M, Furuta H, Hinokio Y, Cockburn BN, 20. Aboudehen K, Kim MS, Mitsche M, Garland K, Anderson N, et al.: Mutation in hepatocyte nuclear factor-1 beta gene (TCF2) asso- Noureddine L, et al.: Transcription factor hepatocyte nuclear factor-1b ciated with MODY. Nat Genet 17: 384–385, 1997 regulates renal cholesterol metabolism. JAmSocNephrol27: 2408– 40. Bingham C, Hattersley AT: Renal cysts and diabetes syndrome resulting 2421, 2016 from mutations in hepatocyte nuclear factor-1beta. Nephrol Dial 21. Aboudehen K, Noureddine L, Cobo-Stark P, Avdulov S, Farahani S, Transplant 19: 2703–2708, 2004 Gearhart MD, et al.: Hepatocyte nuclear factor-1b regulates urinary 41. Zavadil J, Böttinger EP: TGF-beta and epithelial-to-mesenchymal concentration and response to hypertonicity. JAmSocNephrol28: transitions. Oncogene 24: 5764–5774, 2005 2887–2900, 2017 42. Hay ED: An overview of epithelio-mesenchymal transformation. Acta 22. Kompatscher A, de Baaij JHF, Aboudehen K, Hoefnagels APWM, Anat (Basel) 154: 8–20, 1995 Igarashi P, Bindels RJM, et al.: Loss of transcriptional activation of the 43. Kalluri R, Weinberg RA: The basics of epithelial-mesenchymal transi- potassium channel Kir5.1 by HNF1b drives autosomal dominant tu- tion. JClinInvest119: 1420–1428, 2009 bulointerstitial kidney disease. Kidney Int 92: 1145–1156, 2017 44. Huang S, Susztak K: Epithelial plasticity versus EMT in kidney fibrosis. 23. Coffinier C, Thépot D, Babinet C, Yaniv M, Barra J: Essential role for the Trends Mol Med 22: 4–6, 2016 homeoprotein vHNF1/HNF1beta in visceral endoderm differentiation. 45. Boutet A, De Frutos CA, Maxwell PH, Mayol MJ, Romero J, Nieto MA: Development 126: 4785–4794, 1999 Snail activation disrupts tissue homeostasis and induces fibrosis in the 24. Williams SS, Cobo-Stark P, Hajarnis S, Aboudehen K, Shao X, Richardson adult kidney. EMBO J 25: 5603–5613, 2006 JA, et al.: Tissue-specific regulation of the mouse Pkhd1 (ARPKD) gene 46. Matsui A, Fujimoto J, Ishikawa K, Ito E, Goshima N, Watanabe S, et al.: promoter. Am J Physiol Renal Physiol 307: F356–F368, 2014 Hepatocyte nuclear factor 1 beta induces transformation and epithelial- 25. Bernascone I, Janas S, Ikehata M, Trudu M, Corbelli A, Schaeffer C, to-mesenchymal transition. FEBS Lett 590: 1211–1221, 2016 et al.: A transgenic mouse model for uromodulin-associated kidney 47. Tomassetti A, De Santis G, Castellano G, Miotti S, Mazzi M, Tomasoni diseases shows specifi c tubulo-interstitial damage, urinary concen- D, et al.: Variant HNF1 modulates epithelial plasticity of normal and trating defect and renal failure. Hum Mol Genet 19: 2998–3010, 2010 transformed ovary cells. Neoplasia 10: 1481–1492, 2008 26. Piret SE, Olinger E, Reed AAC, Nesbit MA, Hough TA, Bentley L, et al.: 48. Nieto MA, Huang RY, Jackson RA, Thiery JP: Emt: 2016. Cell 166: 21– A mouse model for inherited renal fibrosis associated with endoplasmic 45, 2016 reticulum stress. Dis Model Mech 10: 773–786, 2017 49. Grande MT, Sánchez-Laorden B, López-Blau C, De Frutos CA, Boutet 27. Johnson BG, Dang LT, Marsh G, Roach AM, Levine ZG, Monti A, et al.: A, Arévalo M, et al.: Snail1-induced partial epithelial-to-mesenchymal Uromodulin p.Cys147Trp mutation drives kidney disease by activating transition drives renal fibrosis in mice and can be targeted to reverse ER stress and apoptosis. JClinInvest127: 3954–3969, 2017 established disease. Nat Med 21: 989–997, 2015 28. Srinivas S, Watanabe T, Lin CS, William CM, Tanabe Y, Jessell TM, et al.: 50. Shamir ER, Pappalardo E, Jorgens DM, Coutinho K, Tsai WT, Aziz K, Cre reporter strains produced by targeted insertion of EYFP and ECFP et al.: Twist1-induced dissemination preserves epithelial identity and intotheROSA26locus.BMC Dev Biol 1: 4, 2001 requires E-cadherin. JCellBiol204: 839–856, 2014 29. Chan SC, Selth LA, Li Y, Nyquist MD, Miao L, Bradner JE, et al.: Tar- 51. Mao Y, Xu J, Li Z, Zhang N, Yin H, Liu Z: The role of nuclear b-catenin geting chromatin binding regulation of constitutively active AR variants accumulation in the Twist2-induced ovarian cancer EMT. PLoS One 8: to overcome prostate cancer resistance to endocrine-based therapies. e78200, 2013 Nucleic Acids Res 43: 5880–5897, 2015 52. Yang J, Mani SA, Donaher JL, Ramaswamy S, Itzykson RA, Come C, 30. Kim D, Langmead B, Salzberg SL: HISAT: A fast spliced aligner with low et al.: Twist, a master regulator of morphogenesis, plays an essential memory requirements. Nat Methods 12: 357–360, 2015 role in tumor metastasis. Cell 117: 927–939, 2004 31. Liao Y, Smyth GK, Shi W: featureCounts: An efficient general purpose 53. Sošic D, Richardson JA, Yu K, Ornitz DM, Olson EN: Twist regulates program for assigning sequence reads to genomic features. Bio- cytokine gene expression through a negative feedback loop that re- informatics 30: 923–930, 2014 presses NF-kappaB activity. Cell 112: 169–180, 2003

2508 Journal of the American Society of Nephrology J Am Soc Nephrol 29: 2493–2509, 2018 www.jasn.org BASIC RESEARCH

54. Ip YT, Park RE, Kosman D, Yazdanbakhsh K, Levine M: dorsal-twist in- 62. Medici D, Hay ED, Olsen BR: Snail and Slug promote epithelial-mes- teractions establish snail expression in the presumptive mesoderm of enchymal transition through beta-catenin-T-cell factor-4-dependent the Drosophila embryo. Genes Dev 6: 1518–1530, 1992 expression of transforming growth factor-beta3. MolBiolCell19: 55. Hajarnis SS, Patel V, Aboudehen K, Attanasio M, Cobo-Stark P, 4875–4887, 2008 Pontoglio M, et al.: Transcription factor hepatocyte nuclear factor-1b 63. Sureshbabu A, Muhsin SA, Choi ME: TGF-b signaling in the kidney: (HNF-1b) regulates microRNA-200 expression through a long non- Profibrotic and protective effects. Am J Physiol Renal Physiol 310: coding RNA. JBiolChem290: 24793–24805, 2015 F596–F606, 2016 56. Tan RJ, Zhou D, Liu Y: Signaling crosstalk between tubular epithelial 64. Gewin L, Zent R, Pozzi A: Progression of chronic kidney disease: Too cells and interstitial fibroblasts after kidney injury. Kidney Dis (Basel) 2: much cellular talk causes damage. Kidney Int 91: 552–560, 2017 136–144, 2016 65. Koesters R, Kaissling B, Lehir M, Picard N, Theilig F, Gebhardt R, et al.: 57. Humphreys BD, Lin SL, Kobayashi A, Hudson TE, Nowlin BT, Tubular overexpression of transforming growth factor-beta1 induces Bonventre JV, et al.: Fate tracing reveals the pericyte and not epithelial autophagy and fibrosis but not mesenchymal transition of renal epi- origin of myofibroblasts in kidney fibrosis. Am J Pathol 176: 85–97, thelial cells. Am J Pathol 177: 632–643, 2010 2010 66. Neelisetty S, Alford C, Reynolds K, Woodbury L, Nlandu-Khodo S, Yang H, 58. LeBleu VS, Taduri G, O’Connell J, Teng Y, Cooke VG, Woda C, et al.: et al.: Renal fibrosis is not reduced by blocking transforming growth factor-b Origin and function of myofibroblasts in kidney fibrosis. Nat Med 19: signaling in matrix-producing interstitial cells. Kidney Int 88: 503–514, 2015 1047–1053, 2013 67. Gewin L, Bulus N, Mernaugh G, Moeckel G, Harris RC, Moses HL, et al.: 59. Lovisa S, LeBleu VS, Tampe B, Sugimoto H, Vadnagara K, Carstens JL, TGF-beta receptor deletion in the renal collecting system exacerbates et al.: Epithelial-to-mesenchymal transition induces cell cycle arrest and fibrosis. J Am Soc Nephrol 21: 1334–1343, 2010 parenchymal damage in renal fibrosis. Nat Med 21: 998–1009, 2015 60. Meng XM, Nikolic-Paterson DJ, Lan HY: TGF-b: The master regulator of fibrosis. Nat Rev Nephrol 12: 325–338, 2016 61. Lamouille S, Xu J, Derynck R: Molecular mechanisms of epithelial- This article contains supplemental material online at http://jasn.asnjournals. mesenchymal transition. Nat Rev Mol Cell Biol 15: 178–196, 2014 org/lookup/suppl/doi:10.1681/ASN.2018040437/-/DCSupplemental.

J Am Soc Nephrol 29: 2493–2509, 2018 Fibrosis in HNF1B-Related Tubulointerstitial Kidney Disease 2509 Supplement to: Mechanism of fibrosis in HNF1B-related autosomal dominant tubulointerstitial kidney disease

Siu Chiu Chan,1 Ying Zhang,2 Annie Shao,1 Svetlana Avdulov,1 Jeremy Herrera,1 Karam

Aboudehen,1 Marco Pontoglio,3 and Peter Igarashi1

1Department of Medicine and 2Minnesota Supercomputing Institute, University of Minnesota,

Minneapolis, Minnesota, USA. 3Department of Development, Reproduction and Cancer, Institut

Cochin, Institut National de la Santé et de la Recherche Médicale U1016/Centre National de la

Recherche Scientifique Unité Mixte de Recherche 8104, Université Paris-Descartes, Paris,

France

Supplemental Table of Contents

Supplemental Figure 1. Fibrosis is the most dysregulated pathway in HNF-1β-deficient cells ...... 1 Supplemental Figure 2. Expression of ADTKD-related genes remains unchanged in HNF- 1β-deficient cells ...... 2 Supplemental Figure 3. Effects of HNF-1β ablation on cell growth, cell-cycle progression, and apoptosis ...... 3 Supplemental Figure 4. Twist1 and TGF-β1 signaling are the top two upstream regulators by pathway analysis ...... 4 Supplemental Figure 5. Ablation of HNF-1β induces renal fibrosis ...... 5 Supplemental Figure 6. Renal interstitial myofibroblasts do not originate from tubular epithelial cells ...... 6 Supplemental Figure 7. Expression of TGF-β1 is not altered in HNF-1β-deficient cells and HNF-1β mutant kidneys ...... 7 Supplemental Figure 8. Activation of TGF-β signaling in interstitial fibroblasts and myofibroblasts in HNF-1β mutant kidneys ...... 8 Supplemental Table 1. Differentially expressed genes in HNF-1β-deficient cells ...... 10 Supplemental Table 2. sgRNA sequences ...... 11 Supplemental Table 3. Genomic PCR primers ...... 12 Supplemental Table 4. qRT-PCR primers ...... 13 Supplemental Table 5. ChIP-qPCR primers...... 14 Supplemental Table 6. List of immunoblot antibodies ...... 15

Supplemental Figures

Supplemental Figure 1. Fibrosis is the most dysregulated pathway in HNF-1β-deficient cells. (A) Volcano plot of -log (p-value of canonical pathways) against ratio (enriched genes /total gene in the IPA database). (B) Heatmap (left panel) showing dysregulation of genes in the fibrosis pathway identified by IPA. Differentially-expressed genes with log2 fold-change >1 or <-1 in HNF-1β mutant cells (KO) compared to wild-type cells (WT) are shown (n=3). Histogram (right panel) shows the genes ranked by log2 fold-change in expression between wild-type and mutant cells.

1 Supplemental Figure 2. Expression of ADTKD-related genes remains unchanged in HNF- 1β-deficient cells. RNA-seq analysis showing expression of Muc1, Sec61a1, Umod, and Ren1 in three independent HNF-1β-deficient cell lines (closed bars) compared to wild-type mIMCD3 cells (open bars). Data represent mean±S.D. n.s. indicates p>0.05.

2 Supplemental Figure 3. Effects of HNF-1β ablation on cell growth, cell-cycle progression, and apoptosis. (A) Wild-type mIMCD3 cells (WT) and HNF-1β mutant cells (KO) were seeded at 2×104 cell/well. At the times indicated, cells were trypsinized and counted using an electronic Coulter Counter. (B) Cells were trypsinized at day 4, fixed, stained with propidium iodide, and cell cycle profiles were obtained by flow cytometry. (C) Apoptosis in wild-type mIMCD3 cells (WT) and HNF-1β mutant cells (KO) was measured as the percentage of cells with hypodiploid DNA content. Data represent mean±S.E. n.s. indicates non-significant. * indicates p<0.05.

3 Supplemental Figure 4. Twist1 and TGF-β1 signaling are the top two upstream regulators by pathway analysis. Knowledge-based IPA of upstream regulators of differentially expressed genes in HNF-1β mutant cells. Ranking of activation Z-scores is shown for the 12 highest scoring positive (red) and negative (green) regulators. TGF-β- and Twist-dependent pathways showed the highest activation scores. As a control, HNF-1α, which binds to the same sequence as HNF-1β, showed the lowest score.

4 Supplemental Figure 5. Ablation of HNF-1β induces renal fibrosis. (A) Trichrome staining of kidney sections from Ksp/Cre;Hnf1bf/f mice (KO) and wild-type littermates (WT) at P28. Scale bar: 10 µm. Quantification of the collagen levels in WT and HNF-1β mutant kidneys is shown on the right. n=3. *, p<0.05. (B-D) Quantitative RT-PCR showing expression of E-cadherin (B), vimentin (C), and α-SMA (D) in P28 kidneys from HNF-1β mutant mice (KO) and wild-type littermates (WT). Data shown represent mean±S.E. from three independent experiments. *, p<0.05. n.s., non-significant. Lower panels show antibody staining of the respective proteins in wild-type and mutant kidneys. Cy=cyst. Scale bar: 50 µm.

5 Supplemental Figure 6. Renal interstitial myofibroblasts do not originate from tubular epithelial cells. (A) Schematic of the lineage tracing strategy. Expression of Cre recombinase in renal tubules driven by the Ksp-cadherin promoter simultaneously results in deletion of Hnf1b and activation of the EYFP reporter gene. (B, upper panels) Indirect immunofluorescence of kidney sections from Ksp/Cre;Hnf1bf/+;R26R-EYFP mice at P28 costained with an antibody against HNF-1β (red) and an antibody against GFP that also recognizes EYFP (green). Arrowheads indicate expression of HNF-1β protein and EYFP in wild-type P28 kidney sections. Merged images are shown in the right panel. (B, lower panels) Indirect immunofluorescence of kidney sections from Ksp/Cre;Hnf1bf/f;R26R-EYFP mice at P28 costained with antibodies against HNF-1β (red) and GFP (green). Arrows indicate expression of EYFP in HNF-1β- deficient kidney cysts (cy). Arrowheads indicate absence of EYFP in surrounding non-cystic, HNF-1β-positive tubules. (C) Indirect immunofluorescence of kidney sections from Ksp/Cre;Hnf1bf/f;R26R-EYFP mice costained with antibodies against entactin (red) and GFP (green). EYFP-positive cells are only located on the luminal side of the tubular basement membrane (arrowheads). (D) Indirect immunofluorescence of kidney sections from Ksp/Cre;Hnf1bf/f;R26R-EYFP mice costained with antibodies against smooth muscle α-actin (α- SMA, red) and GFP (green). EYFP is not expressed in α-SMA-positive myofibroblasts in the renal interstitium (arrowheads). Cy=cyst, n=3. Scale bar: 20 µm.

6 Supplemental Figure 7. Expression of TGF-β1 is not altered in HNF-1β-deficient cells and HNF-1β mutant kidneys. (A) Quantitative RT-PCR showing Tgfb1 mRNA levels in three HNF- 1β knockout cell lines (KO) compared to wild-type cells (WT). (B) Quantitative RT-PCR showing expression of mRNA transcripts encoding TGF-β1 in kidneys from Ksp/Cre;Hnf1bf/f mice (KO) compared to wild-type littermates (WT) at P28. Data shown represent mean±SE from three independent experiments. n.s. indicates p>0.05.

7 8 Supplemental Figure 8. Activation of TGF-β signaling in interstitial fibroblasts and myofibroblasts in HNF-1β mutant kidneys. (A) Indirect immunofluorescence of kidney sections from Ksp/Cre;Hnf1bf/f mice (KO) and wild-type littermates (WT) costained with antibodies against phospho-Smad3 (red) and α-SMA (green). Merged images are shown on the right. Arrowheads indicate cytoplasmic expression of α-SMA and nuclear expression of phospho-Smad3 in interstitial myofibroblasts in KO kidneys. (B) Indirect immunofluorescence of kidney sections from Ksp/Cre;Hnf1bf/f mice (KO) and wild-type littermates (WT) costained with antibodies against phospho-Smad3 (red) and Vimentin (green). Merged images are shown on the right. Arrowheads indicate cytoplasmic expression of vimentin and nuclear expression of phospho-Smad3 in interstitial fibroblasts in KO kidneys. n=3. Scale bar: 10 µm.

9 Supplemental Table 1. sgRNA sequences Gene Target sequence 5' oligo fwd 3' oligo rev sgHNF-1β#1 TATCTTATATGGCCTAATGG CACCGTATCTTATATGGCCTAATGG AAACCCATTAGGCCATATAAGATAC sgHNF-1β#2 GGCCCCTCACCGGAGGCATG CACCGGGCCCCTCACCGGAGGCATG AAACCATGCCTCCGGTGAGGGGCCC sgTwist2#1 ACCCGGGAGCCTGTGCTCGG CACCGACCCGGGAGCCTGTGCTCGG AAACCCGAGCACAGGCTCCCGGGTC sgTwist2#2 GGGCATCCACGACGCACGGG CACCGGGGCATCCACGACGCACGGG AAACCCCGTGCGTCGTGGATGCCCC

10 Supplemental Table 2. Genomic PCR primers Primer Name Gene Sequence 5' to 3' Size of amplicon (bp) HNF-1β Fwd HNF-1β AGCGTGAGTAGAATGGGCTCTG 506 HNF-1β Rev HNF-1β CCTCTGGTCATGTGACCTAAGGC Twist2 Fwd Twist2 ACCCAGCCGGGATAGAGTTTCC 869 Twist2 Rev Twist2 GGTAGGAGAGTTTTCTCAGGTCG

11 Supplemental Table 3. qRT-PCR primers Gene Seuence 5' to 3' Size of product 18S-F GTAACCCGTTGAACCCCATT 151 bp 18S-R CCATCCAATCGGTAGTAGCG Hnf1b-F TCAAAGAGCTCCAGGCGCTCAA 130 bp Hnf1b-R GGGATATTGTGCTGTTGCATG Pkhd1-F AAGTCAAGGGCCATCACATC 127 bp Pkhd1-R ATGTTTCTGGTCAACAGCCC β2M-F ACCCCCACTGAGACTGATAC 115 bp β2M-R ATCTTCAGAGCATCATGATG Cdh1-F ATCCTCGCCCTGCTGATT 62 bp Cdh1-R ACCACCGTTCTCCTCCGTA Vim-F TGCGAGAGAAATTGCAGGA 96 bp Vim-R GTGCCAGAGAAGCATTGTCA αSMA-F CTCTCTTCCAGCCATCTTTCAT 60 bp αSMA-R TATAGGTGGTTTCGTGGATGC Twist2-F CATGTCCGCCTCCCACTA 74 bp Twist2-R GATGTGCAGGTGGGTCCT Snai2-F ACATTGCCTTGTGTCTGCAA 94 bp Snai2-R GAAAGGCTTTTCCCCAGTGT Zeb1-F ATTCCCCAAGTGGCATATACA 111 bp Zeb1-R GCTAGTGTCTTGTCTTTCATCCTG Zeb2-F TGCCCAACCATGAGTCCTC 121bp Zeb2-R GCTTGCAGAATCTCGCCACT TGF-β1-F TGGAGCAACATGTGGAACTC 73bp TGF-β1-R GTCAGCAGCCGGTTACCA TGF-β2-F AGGAGGTTTATAAAATCGACATGC 67 bp TGF-β2-R TAGAAAGTGGGCGGGATG TGF-β3-F CGAGTGGCTGTTGAGGAGA 74 bp TGF-β3-R GCTGAAAGGTGTGACATGGA

12 Supplemental Table 4. ChIP-qPCR primers Name Sequence 5' to 3' Size of product Neg Ctr Fwd CCATTGGGAGAATGCAAATC 109 bp Neg Ctr Rev GCCAGCATTTGTTGCTAGGT Intron 1 HNF-1β BSI Fwd TGACGCATACTTCTGGCAAA 107 bp Intron 1 HNF-1β BSI Rev CGCCTAGCTGATGGAAACTC 3'FR HNF-1β BSII Fwd CTTCTGGGGTGGGTAGATGA 100 bp 3'FR HNF-1β BSII Rev AAAGGCATTGTTGGCTTCTG

13 Supplemental Table 5. Antibodies for immunoblot Antibody Vendor Catalog No. HNF-1β (N-terminal) Santa Cruz SC-22840 HNF-1β (C-terminal) Abcam 128912 β-Actin Sigma A2066 Twist Santa Cruz SC-81417 Snail1 Cell Signaling 3879 Snail2 Cell Signaling 9585 Zeb1 Cell Signaling 3396 Zeb2 Santa Cruz SC-48789 E-Cadherin Cell Signaling 3195 GAPDH Santa Cruz SC-25778 Phospho-Smad3 Abcam ab52903 Smad3 Abcam ab40854 Phospho-Smad2 Cell Signaling 3108 Smad2 Cell Signaling 5339

14 Supplemental Table 6. Differentially expressed genes in HNF-1β-deficient cells ensembl gene id chromosome start end strand mgi symbol log2 fold change p value fdr gene biotype ENSMUSG00000044254 4 106442329 106464329 -ve Pcsk9 -7.301807787 1.62E-228 3.08E-224 protein_coding ENSMUSG00000035000 2 62330073 62412231 -ve Dpp4 -6.717420651 5.94E-85 3.76E-81 protein_coding ENSMUSG00000043760 1 20057779 20618064 -ve Pkhd1 -6.263788557 1.96E-49 1.86E-46 protein_coding ENSMUSG00000032500 9 111439081 111489118 ve Dclk3 -6.248630716 1.10E-57 1.49E-54 protein_coding ENSMUSG00000031853 8 125910450 125947439 ve BC021891 -5.982390278 4.91E-60 7.77E-57 protein_coding ENSMUSG00000029086 5 43993620 44102032 -ve Prom1 -5.867577194 2.97E-43 2.09E-40 protein_coding ENSMUSG00000032278 9 61953481 62026856 -ve Paqr5 -5.62295227 2.72E-71 7.37E-68 protein_coding ENSMUSG00000032908 1 78310345 78420289 ve Sgpp2 -5.534275893 1.09E-63 2.07E-60 protein_coding ENSMUSG00000062563 12 24665838 24681813 -ve Cys1 -5.489739325 4.51E-39 2.68E-36 protein_coding ENSMUSG00000010435 8 12573049 12600738 ve Spaca7 -5.431838092 8.70E-42 5.70E-39 protein_coding ENSMUSG00000039349 1 184871926 184883218 -ve C130074G19Rik -5.402482623 1.24E-59 1.81E-56 protein_coding ENSMUSG00000025885 18 74440936 74771493 ve Myo5b -5.325592543 8.46E-35 4.34E-32 protein_coding ENSMUSG00000031842 8 70723720 70751186 ve Pde4c -5.008121249 4.44E-75 1.69E-71 protein_coding ENSMUSG00000057614 5 18265135 18360355 -ve Gnai1 -4.949549143 3.21E-31 1.42E-28 protein_coding ENSMUSG00000021565 13 73679745 73704865 -ve Slc6a19 -4.827550493 2.45E-38 1.41E-35 protein_coding ENSMUSG00000029189 5 53107083 53213927 -ve Sel1l3 -4.63977349 2.42E-52 2.70E-49 protein_coding ENSMUSG00000032357 9 76951693 77045794 -ve Tinag -4.610020947 3.47E-26 9.54E-24 protein_coding ENSMUSG00000029369 5 90518932 90553543 ve Afm -4.540913373 1.05E-25 2.81E-23 protein_coding ENSMUSG00000075520 2 15526479 16255555 ve Malrd1 -4.535748616 1.36E-25 3.49E-23 protein_coding ENSMUSG00000021336 13 23897738 23915007 -ve Slc17a4 -4.513529033 9.60E-27 2.85E-24 protein_coding ENSMUSG00000044279 17 57059105 57065918 ve Crb3 -4.411978146 1.46E-73 4.63E-70 protein_coding ENSMUSG00000022123 14 103513341 103613346 ve Scel -4.364764805 2.74E-50 2.74E-47 protein_coding ENSMUSG00000026380 1 118627945 118685168 ve Tfcp2l1 -4.347600802 2.07E-29 7.55E-27 protein_coding ENSMUSG00000028064 3 88435959 88461182 -ve Sema4a -4.258672204 1.73E-40 1.06E-37 protein_coding ENSMUSG00000022419 15 55112317 55259271 ve Deptor -4.191060473 1.68E-44 1.33E-41 protein_coding ENSMUSG00000023122 17 53829637 53846339 -ve Sult1c2 -4.173767908 1.75E-19 3.00E-17 protein_coding ENSMUSG00000035349 12 59095799 59109130 ve Mia2 -4.032365998 6.28E-44 4.59E-41 protein_coding ENSMUSG00000029032 4 154278486 154301676 -ve Arhgef16 -4.031406623 4.27E-85 3.76E-81 protein_coding ENSMUSG00000031618 8 76899442 77245012 ve Nr3c2 -3.983078646 7.53E-19 1.23E-16 protein_coding ENSMUSG00000002668 17 57066056 57078510 -ve Dennd1c -3.980914581 5.61E-22 1.17E-19 protein_coding ENSMUSG00000047040 11 96928104 96937830 ve Prr15l -3.979730665 2.80E-19 4.70E-17 protein_coding ENSMUSG00000025082 19 56874249 56912078 ve Vwa2 -3.960475704 7.77E-31 3.28E-28 protein_coding ENSMUSG00000050359 3 92483952 92485895 -ve Sprr1a -3.954070753 4.01E-28 1.39E-25 protein_coding ENSMUSG00000018126 15 79258195 79285537 -ve Baiap2l2 -3.915444973 4.58E-25 1.14E-22 protein_coding ENSMUSG00000022790 16 38901471 39027159 ve Igsf11 -3.881805982 5.71E-20 1.03E-17 protein_coding ENSMUSG00000020990 12 69746848 69790707 -ve Cdkl1 -3.86746258 8.31E-19 1.34E-16 protein_coding ENSMUSG00000024008 17 29156550 29237797 -ve Cpne5 -3.819888372 5.62E-37 3.05E-34 protein_coding ENSMUSG00000097421 8 12554270 12573320 -ve D630011A20Rik -3.80697902 1.52E-17 2.24E-15 protein_coding ENSMUSG00000038807 11 74383356 74610915 -ve Rap1gap2 -3.806016002 1.97E-23 4.67E-21 protein_coding ENSMUSG00000028716 4 115088708 115093899 ve Pdzk1ip1 -3.78305953 4.20E-17 6.00E-15 protein_coding ENSMUSG00000005320 13 55152640 55168759 ve Fgfr4 -3.757063013 1.05E-15 1.29E-13 protein_coding ENSMUSG00000023914 17 43474324 43502812 -ve Mep1a -3.75488879 2.51E-15 3.04E-13 protein_coding ENSMUSG00000059974 9 28994750 29963141 -ve Ntm -3.610687078 4.87E-17 6.90E-15 protein_coding ENSMUSG00000020992 12 69790288 69840479 ve 4930512B01Rik -3.604167759 8.99E-18 1.34E-15 antisense ENSMUSG00000068011 6 115583544 115592576 -ve Mkrn2os -3.554537874 1.57E-17 2.30E-15 protein_coding ENSMUSG00000048003 4 134211970 134227383 -ve Catsper4 -3.547327491 1.11E-16 1.51E-14 protein_coding ENSMUSG00000036957 7 30355489 30362772 -ve Lrfn3 -3.526380426 8.77E-23 1.98E-20 protein_coding ENSMUSG00000061947 12 103614786 103631444 -ve Serpina10 -3.520699863 7.39E-15 8.36E-13 protein_coding ENSMUSG00000021211 13 4268172 4279433 -ve Akr1c12 -3.510251177 1.69E-16 2.24E-14 protein_coding ENSMUSG00000028518 4 105029874 105109890 -ve Prkaa2 -3.498962018 4.48E-27 1.39E-24 protein_coding ENSMUSG00000028357 4 63165634 63172131 -ve Kif12 -3.496721752 7.00E-13 6.24E-11 protein_coding ENSMUSG00000079497 2 29744919 29751685 -ve Gm13420 -3.490376258 7.03E-15 8.00E-13 protein_coding ENSMUSG00000020669 12 30911668 30960162 ve Sh3yl1 -3.46879471 6.92E-38 3.87E-35 protein_coding ENSMUSG00000056162 18 84610509 84650084 -ve Cndp1 -3.454686894 2.00E-14 2.12E-12 protein_coding ENSMUSG00000021335 13 23867750 23895730 ve Slc17a1 -3.437748127 5.63E-13 5.14E-11 protein_coding ENSMUSG00000010122 11 61343401 61378345 -ve Slc47a1 -3.383775065 1.74E-12 1.47E-10 protein_coding ENSMUSG00000031734 8 91798525 91801916 -ve Irx3 -3.364983094 8.31E-14 8.44E-12 protein_coding ENSMUSG00000020798 11 72494919 72550506 -ve Spns3 -3.358303537 8.09E-30 3.14E-27 protein_coding ENSMUSG00000028217 4 11758147 11817895 ve Cdh17 -3.357570474 1.44E-12 1.24E-10 protein_coding ENSMUSG00000042284 13 114958079 115101964 -ve Itga1 -3.292971664 6.93E-18 1.05E-15 protein_coding ENSMUSG00000019312 11 98446394 98455373 ve Grb7 -3.261626624 2.83E-16 3.70E-14 protein_coding ENSMUSG00000046318 18 66045302 66302739 -ve Ccbe1 -3.257573044 1.52E-16 2.04E-14 protein_coding ENSMUSG00000029108 5 57717967 58133230 ve Pcdh7 -3.247623549 4.17E-13 3.90E-11 protein_coding ENSMUSG00000035104 6 82041043 82093099 ve Eva1a -3.241228597 2.68E-16 3.54E-14 protein_coding ENSMUSG00000020486 11 87568903 87590539 ve Septin4 -3.172250712 5.86E-20 1.05E-17 protein_coding ENSMUSG00000015879 5 45529705 45639614 -ve Fam184b -3.16476508 1.21E-12 1.05E-10 protein_coding ENSMUSG00000051497 11 110968033 111027968 ve Kcnj16 -3.130880988 3.34E-13 3.21E-11 protein_coding ENSMUSG00000027690 3 28697903 28731359 ve Slc2a2 -3.123136107 1.60E-14 1.72E-12 protein_coding ENSMUSG00000036813 2 25080304 25085716 ve Entpd8 -3.112297085 1.05E-10 6.94E-09 protein_coding ENSMUSG00000005364 6 106710357 106749037 -ve Il5ra -3.102222965 3.06E-10 1.89E-08 protein_coding ENSMUSG00000027820 3 63241537 63386030 ve Mme -3.089390844 6.28E-14 6.48E-12 protein_coding ENSMUSG00000026259 1 87476834 87573870 -ve Ngef -3.079967239 6.44E-23 1.49E-20 protein_coding ENSMUSG00000031881 8 104614141 104624396 -ve Cdh16 -3.062618413 3.97E-10 2.38E-08 protein_coding ENSMUSG00000058174 3 37714190 37724490 -ve Gm5148 -3.039371047 2.41E-12 1.98E-10 protein_coding ENSMUSG00000034918 13 54701461 54736662 ve Cdhr2 -3.014896078 9.23E-11 6.13E-09 protein_coding ENSMUSG00000036006 13 24582189 24733816 ve Fam65b -2.993769019 1.16E-26 3.39E-24 protein_coding ENSMUSG00000017868 2 162987330 163014127 ve Sgk2 -2.983677585 9.10E-14 9.19E-12 protein_coding ENSMUSG00000024621 18 61105572 61132149 ve Csf1r -2.935399428 3.53E-13 3.35E-11 protein_coding ENSMUSG00000042195 9 53771535 53818161 ve Slc35f2 -2.934816057 6.50E-16 8.17E-14 protein_coding ENSMUSG00000021612 13 73661750 73678023 -ve Slc6a18 -2.934251095 4.48E-10 2.63E-08 protein_coding ENSMUSG00000039865 3 121459528 121532404 -ve Slc44a3 -2.92097471 7.67E-16 9.58E-14 protein_coding ENSMUSG00000019647 18 47235598 47368870 -ve Sema6a -2.881665251 7.71E-10 4.28E-08 protein_coding

15 ENSMUSG00000019966 10 100015630 100100413 ve Kitl -2.862433506 1.55E-24 3.78E-22 protein_coding ENSMUSG00000103082 3 45269987 45272567 -ve Gm38124 -2.859063407 1.30E-09 6.97E-08 TEC ENSMUSG00000037747 10 70557682 70655965 -ve Phyhipl -2.85483055 3.80E-10 2.29E-08 protein_coding ENSMUSG00000026870 2 34874396 34892132 ve Cutal -2.8136739 8.95E-29 3.21E-26 protein_coding ENSMUSG00000035131 1 146494760 146902472 ve Brinp3 -2.792523672 1.21E-08 5.44E-07 protein_coding ENSMUSG00000029102 5 35041509 35048461 ve Hgfac -2.788333388 1.89E-08 8.29E-07 protein_coding ENSMUSG00000001763 6 29694222 29718559 ve Tspan33 -2.777595776 4.89E-20 9.02E-18 protein_coding ENSMUSG00000029335 5 98854415 98884396 ve Bmp3 -2.759813711 1.23E-08 5.51E-07 protein_coding ENSMUSG00000025494 7 141091175 141100546 -ve Sigirr -2.745864227 3.13E-22 6.75E-20 protein_coding ENSMUSG00000064293 6 105677660 106699310 ve Cntn4 -2.731378491 2.91E-08 1.22E-06 protein_coding ENSMUSG00000097040 3 45280437 45378260 -ve 2610316D01Rik -2.729313811 2.02E-10 1.28E-08 processed_transcript ENSMUSG00000027765 3 61002795 61008982 ve P2ry1 -2.704679315 5.26E-15 6.09E-13 protein_coding ENSMUSG00000036834 3 63696234 63899472 -ve Plch1 -2.700185738 5.73E-15 6.60E-13 protein_coding ENSMUSG00000062296 9 111311739 111395775 ve Trank1 -2.686828478 5.24E-10 3.03E-08 protein_coding ENSMUSG00000027831 3 66053558 66296837 -ve Veph1 -2.648289672 2.69E-14 2.83E-12 protein_coding ENSMUSG00000026888 2 64912476 65024987 -ve Grb14 -2.643568191 6.92E-13 6.20E-11 protein_coding ENSMUSG00000020782 11 115824049 115855780 ve Llgl2 -2.642038387 5.14E-44 3.90E-41 protein_coding ENSMUSG00000055639 14 97786853 98169765 -ve Dach1 -2.637367003 4.99E-09 2.43E-07 protein_coding ENSMUSG00000085421 11 113203315 113209669 -ve 4732490B19Rik -2.632118945 6.08E-09 2.91E-07 lincRNA ENSMUSG00000026255 1 87264363 87310839 ve Efhd1 -2.631468465 1.17E-07 4.37E-06 protein_coding ENSMUSG00000013584 9 71215789 71296243 ve Aldh1a2 -2.619069151 1.36E-07 4.98E-06 protein_coding ENSMUSG00000071369 10 19934472 20142753 ve Map3k5 -2.611121368 4.07E-10 2.42E-08 protein_coding ENSMUSG00000056413 5 139271876 139325622 -ve Adap1 -2.610453502 8.40E-11 5.62E-09 protein_coding ENSMUSG00000002847 16 38396119 38433145 -ve Pla1a -2.59930269 1.22E-19 2.12E-17 protein_coding ENSMUSG00000022598 15 74714839 74717069 ve Psca -2.595042119 1.22E-07 4.54E-06 protein_coding ENSMUSG00000028737 4 139622866 139649690 ve Aldh4a1 -2.567541658 1.86E-47 1.61E-44 protein_coding ENSMUSG00000005232 2 69211073 69227841 ve G6pc2 -2.566379641 1.80E-07 6.43E-06 protein_coding ENSMUSG00000049493 9 95752642 95845311 -ve Pls1 -2.54308647 9.53E-09 4.41E-07 protein_coding ENSMUSG00000015085 2 25395874 25401321 ve Entpd2 -2.540410892 8.14E-10 4.51E-08 protein_coding ENSMUSG00000034472 8 75213944 75224113 ve Rasd2 -2.524019477 2.73E-07 9.35E-06 protein_coding ENSMUSG00000044249 2 152538714 152540098 -ve Defb29 -2.521894796 2.93E-07 9.99E-06 protein_coding ENSMUSG00000041046 11 6658521 6677475 ve Ramp3 -2.521003277 3.22E-08 1.33E-06 protein_coding ENSMUSG00000061718 11 98348404 98357796 ve Ppp1r1b -2.507570432 2.35E-09 1.21E-07 protein_coding ENSMUSG00000046101 1 9908638 9942085 ve Mcmdc2 -2.489802708 2.16E-07 7.53E-06 protein_coding ENSMUSG00000025081 19 56826209 56870012 ve Tdrd1 -2.483683292 3.00E-07 1.02E-05 protein_coding ENSMUSG00000031137 X 59062145 59568071 -ve Fgf13 -2.479798115 6.04E-08 2.37E-06 protein_coding ENSMUSG00000078597 4 115411624 115439034 ve Cyp4a12b -2.469479743 2.05E-07 7.21E-06 protein_coding ENSMUSG00000097838 13 24631918 24638567 -ve C530050E15Rik -2.463444981 1.97E-08 8.57E-07 lincRNA ENSMUSG00000026832 2 58129137 58195532 -ve Cytip -2.463415741 2.27E-09 1.17E-07 protein_coding ENSMUSG00000054757 13 4486972 4523344 -ve Akr1c20 -2.460249876 2.13E-07 7.46E-06 protein_coding ENSMUSG00000027375 2 127633226 127656695 -ve Mal -2.425674528 4.24E-11 2.97E-09 protein_coding ENSMUSG00000073077 X 79266559 79517285 -ve Gm7173 -2.416252417 1.27E-06 3.81E-05 protein_coding ENSMUSG00000021213 13 4191184 4205596 ve Akr1c13 -2.41279662 3.15E-10 1.94E-08 protein_coding ENSMUSG00000064225 9 95559657 95568023 ve Paqr9 -2.402730346 5.07E-08 2.02E-06 protein_coding ENSMUSG00000044393 18 20558074 20604521 ve Dsg2 -2.395723226 1.27E-08 5.67E-07 protein_coding ENSMUSG00000040405 11 46735080 46779578 ve Havcr1 -2.386741361 1.23E-06 3.70E-05 protein_coding ENSMUSG00000028356 4 63143275 63154799 -ve Ambp -2.383476185 1.46E-06 4.37E-05 protein_coding ENSMUSG00000030157 6 129180615 129186534 ve Clec2d -2.370557095 3.33E-15 3.98E-13 protein_coding ENSMUSG00000070780 5 66016549 66173118 -ve Rbm47 -2.369838017 8.32E-19 1.34E-16 protein_coding ENSMUSG00000040606 4 142102390 142239401 -ve Kazn -2.368349974 3.17E-11 2.25E-09 protein_coding ENSMUSG00000060487 10 9627259 9675208 -ve Samd5 -2.359059459 2.24E-06 6.38E-05 protein_coding ENSMUSG00000024924 19 27216484 27254231 ve Vldlr -2.351513203 1.10E-16 1.51E-14 protein_coding ENSMUSG00000103477 3 45273424 45274967 -ve 5930409G06Rik -2.327403732 1.36E-08 6.08E-07 TEC ENSMUSG00000022780 16 31878810 31899020 ve Mfi2 -2.326899474 2.97E-06 8.12E-05 protein_coding ENSMUSG00000034413 17 26414829 26446349 ve Neurl1b -2.309198446 2.38E-10 1.49E-08 protein_coding ENSMUSG00000028517 4 105157347 105232764 ve Plpp3 -2.286117914 5.83E-08 2.29E-06 protein_coding ENSMUSG00000020173 11 12236608 12464960 -ve Cobl -2.285708733 4.37E-13 4.07E-11 protein_coding ENSMUSG00000037661 3 30855950 30897192 ve Gpr160 -2.28266967 7.67E-22 1.55E-19 protein_coding ENSMUSG00000041237 3 89136142 89146784 ve Pklr -2.271036323 3.10E-06 8.46E-05 protein_coding ENSMUSG00000041782 1 135818598 135833342 ve Lad1 -2.268914776 4.32E-06 0.000114416 protein_coding ENSMUSG00000072962 5 44100442 44102515 ve Gm16401 -2.268792969 5.17E-06 0.000133327 antisense ENSMUSG00000031919 8 107061484 107065644 -ve Tmed6 -2.251336797 5.71E-06 0.000145446 protein_coding ENSMUSG00000037370 10 24637914 24712159 -ve Enpp1 -2.235345047 1.60E-10 1.02E-08 protein_coding ENSMUSG00000087259 11 113043895 113201838 -ve 2610035D17Rik -2.228338722 1.05E-10 6.94E-09 lincRNA ENSMUSG00000024485 18 36528157 36541293 ve Slc4a9 -2.227508946 3.27E-06 8.89E-05 protein_coding ENSMUSG00000029811 6 48872896 48909188 ve Aoc1 -2.22429563 8.24E-06 0.000198815 protein_coding ENSMUSG00000041757 1 133181321 133303435 ve Plekha6 -2.22402379 1.36E-09 7.24E-08 protein_coding ENSMUSG00000026959 2 25291181 25319187 -ve Grin1 -2.213423957 4.44E-06 0.000117369 protein_coding ENSMUSG00000099032 1 9960163 9967932 -ve Tcf24 -2.205508956 2.10E-11 1.53E-09 protein_coding ENSMUSG00000047230 X 139800828 139811386 ve Cldn2 -2.205442883 2.18E-06 6.22E-05 protein_coding ENSMUSG00000006711 13 24845135 24901270 ve D130043K22Rik -2.199467131 6.61E-08 2.57E-06 protein_coding ENSMUSG00000029074 4 156034840 156059414 -ve Ttll10 -2.183730304 7.18E-06 0.000176571 protein_coding ENSMUSG00000053559 15 100621342 100636865 -ve Smagp -2.179407956 1.39E-13 1.39E-11 protein_coding ENSMUSG00000024694 19 12695786 12719902 ve Keg1 -2.176438941 3.44E-07 1.16E-05 protein_coding ENSMUSG00000032452 9 97444395 98033181 -ve Clstn2 -2.17003969 1.30E-05 0.000294208 protein_coding ENSMUSG00000020961 12 91638542 91788387 -ve Ston2 -2.169410035 5.17E-10 3.01E-08 protein_coding ENSMUSG00000073102 5 30281388 30366695 ve Drc1 -2.169349565 5.22E-06 0.000134557 protein_coding ENSMUSG00000002111 2 91082390 91115756 ve Spi1 -2.168894937 1.23E-06 3.72E-05 protein_coding ENSMUSG00000058488 5 150952607 150993817 ve Kl -2.16876648 1.18E-05 0.000271313 protein_coding ENSMUSG00000097814 1 96871126 96907796 ve Panct2 -2.162395932 1.07E-05 0.00025014 antisense ENSMUSG00000038296 7 111471661 111779977 -ve Galnt18 -2.149644468 5.78E-06 0.000146877 protein_coding ENSMUSG00000025089 19 58235604 58455909 -ve Gfra1 -2.144500701 6.67E-07 2.10E-05 protein_coding ENSMUSG00000051435 4 141890438 142015082 -ve Fhad1 -2.141455102 3.43E-12 2.77E-10 protein_coding ENSMUSG00000085772 11 31790113 31824524 -ve D630024D03Rik -2.135636659 9.56E-06 0.000227081 lincRNA

16 ENSMUSG00000034295 18 24709445 25133500 ve Fhod3 -2.13543697 2.06E-13 2.02E-11 protein_coding ENSMUSG00000062785 7 44590664 44604754 ve Kcnc3 -2.122657072 1.57E-05 0.000347159 protein_coding ENSMUSG00000000915 5 123973628 124005558 ve Hip1r -2.105394096 2.14E-12 1.79E-10 protein_coding ENSMUSG00000048826 17 14195231 14203831 -ve Dact2 -2.103396408 1.14E-07 4.26E-06 protein_coding ENSMUSG00000027901 3 106482405 106503030 ve Dennd2d -2.102626397 5.89E-13 5.35E-11 protein_coding ENSMUSG00000000159 16 96361668 96525580 ve Igsf5 -2.101029019 6.15E-09 2.93E-07 protein_coding ENSMUSG00000028713 4 115624725 115647723 -ve Cyp4b1 -2.097495981 1.16E-05 0.000268641 protein_coding ENSMUSG00000024810 19 29925114 29960718 ve Il33 -2.087343978 1.71E-05 0.0003726 protein_coding ENSMUSG00000022323 15 34484021 34495255 -ve Hrsp12 -2.087122907 9.05E-13 8.00E-11 protein_coding ENSMUSG00000057315 5 102481391 102897937 ve Arhgap24 -2.085243501 2.91E-05 0.000590317 protein_coding ENSMUSG00000044313 3 101813076 101848959 -ve Mab21l3 -2.085194409 1.26E-10 8.23E-09 protein_coding ENSMUSG00000020839 11 76902159 76916587 ve Tmigd1 -2.083638527 2.75E-05 0.000561567 protein_coding ENSMUSG00000025993 1 45908068 45926523 -ve Slc40a1 -2.080185493 1.29E-14 1.43E-12 protein_coding ENSMUSG00000028278 4 32983037 33022180 ve Rragd -2.075741996 9.70E-10 5.26E-08 protein_coding ENSMUSG00000036553 5 35697180 35739987 -ve Sh3tc1 -2.074000102 7.03E-10 3.96E-08 protein_coding ENSMUSG00000086265 13 4248735 4249025 ve Marcksl1-ps4 -2.06069291 3.44E-05 0.000684321 processed_pseudogene ENSMUSG00000051359 15 37366175 37792570 -ve Ncald -2.059776943 6.70E-11 4.54E-09 protein_coding ENSMUSG00000052302 10 121263824 121311189 -ve Tbc1d30 -2.053558749 1.61E-07 5.86E-06 protein_coding ENSMUSG00000021662 13 97898595 98206165 -ve Arhgef28 -2.045527357 1.06E-21 2.12E-19 protein_coding ENSMUSG00000049100 3 45378398 45435623 ve Pcdh10 -2.043297505 3.18E-09 1.61E-07 protein_coding ENSMUSG00000040525 7 19778881 19796809 -ve Cblc -2.04279673 1.73E-05 0.000376348 protein_coding ENSMUSG00000032796 17 67697265 67822645 ve Lama1 -2.040379295 4.30E-05 0.000825403 protein_coding ENSMUSG00000030268 6 144993835 145076184 -ve Bcat1 -2.039887009 3.77E-05 0.000741756 protein_coding ENSMUSG00000073413 17 35071443 35078065 -ve Ly6g6d -2.039538148 3.99E-05 0.000777203 protein_coding ENSMUSG00000043461 3 69819542 69859940 -ve Sptssb -2.038547342 4.25E-05 0.000817578 protein_coding ENSMUSG00000006345 10 75561604 75586200 ve Ggt1 -2.035003623 3.68E-05 0.000727759 protein_coding ENSMUSG00000021356 13 30749226 30766927 ve Irf4 -2.022148224 2.73E-05 0.00055746 protein_coding ENSMUSG00000018581 12 117877982 118199043 -ve Dnah11 -2.014492409 3.30E-07 1.12E-05 protein_coding ENSMUSG00000029322 5 100553725 100572245 -ve Plac8 -2.012652719 3.12E-16 4.05E-14 protein_coding ENSMUSG00000045667 11 72389164 72411713 -ve Smtnl2 -2.003869516 8.89E-11 5.93E-09 protein_coding ENSMUSG00000055301 3 138217760 138233382 ve Adh7 -1.999138589 9.80E-07 3.00E-05 protein_coding ENSMUSG00000046699 X 64264885 64276996 -ve Slitrk4 -1.989565987 6.62E-05 0.001194201 protein_coding ENSMUSG00000037541 7 144001928 144424494 ve Shank2 -1.986469351 3.26E-06 8.86E-05 protein_coding ENSMUSG00000032224 9 70089310 70142560 -ve Fam81a -1.985149631 5.22E-10 3.03E-08 protein_coding ENSMUSG00000057228 8 60506124 60545677 ve Aadat -1.964786442 2.81E-06 7.76E-05 protein_coding ENSMUSG00000035540 5 89417522 89457898 -ve Gc -1.959831447 8.52E-05 0.001486249 protein_coding ENSMUSG00000021696 13 108214404 108287105 ve Elovl7 -1.950214167 4.31E-08 1.74E-06 protein_coding ENSMUSG00000019838 10 40033535 40142254 -ve Slc16a10 -1.947817854 3.64E-16 4.67E-14 protein_coding ENSMUSG00000033278 17 66666848 67354459 -ve Ptprm -1.944754285 1.13E-07 4.23E-06 protein_coding ENSMUSG00000021509 13 56438355 56474239 ve Slc25a48 -1.943962583 1.80E-05 0.00038857 protein_coding ENSMUSG00000046447 4 138454314 138460123 ve Camk2n1 -1.92756728 1.05E-29 3.91E-27 protein_coding ENSMUSG00000013846 15 67102875 67113992 -ve St3gal1 -1.922319253 2.48E-08 1.04E-06 protein_coding ENSMUSG00000085826 16 45945606 45971370 ve Gm15638 -1.918808352 1.93E-05 0.00041359 antisense ENSMUSG00000020080 10 62383137 62422491 -ve Hkdc1 -1.913409654 0.000114971 0.001913791 protein_coding ENSMUSG00000055069 9 53684110 53706232 -ve Rab39 -1.913160738 9.83E-05 0.001685441 protein_coding ENSMUSG00000044522 3 121634936 121643485 -ve A730020M07Rik -1.909067308 7.66E-05 0.001352925 lincRNA ENSMUSG00000015314 1 171917515 171953170 ve Slamf6 -1.908058873 0.000130054 0.002129416 protein_coding ENSMUSG00000085307 11 96918941 96922493 -ve Gm11525 -1.906579221 8.26E-05 0.001443816 antisense ENSMUSG00000069825 11 73329741 73355913 ve Spata22 -1.901642285 0.000112193 0.001877431 protein_coding ENSMUSG00000020679 11 83850063 83905819 ve Hnf1b -1.895688308 2.96E-11 2.12E-09 protein_coding ENSMUSG00000027297 2 119751320 119760431 -ve Ltk -1.893663391 2.34E-06 6.63E-05 protein_coding ENSMUSG00000001622 5 87925579 87932665 ve Csn3 -1.893154658 0.000146038 0.002352581 protein_coding ENSMUSG00000059252 9 37696515 37697033 ve Tpt1-ps5 -1.892781971 0.000137802 0.002236978 processed_pseudogene ENSMUSG00000028841 4 134228041 134238399 -ve Cnksr1 -1.890041542 3.22E-07 1.09E-05 protein_coding ENSMUSG00000027188 2 102550012 102643041 ve Pamr1 -1.883113249 5.80E-07 1.85E-05 protein_coding ENSMUSG00000029260 5 86889767 86906937 -ve Ugt2b34 -1.88168367 0.000160331 0.002552533 protein_coding ENSMUSG00000087187 2 36216777 36222934 ve Gm13431 -1.881134246 4.72E-06 0.000123206 lincRNA ENSMUSG00000038298 3 96829284 96870926 ve Pdzk1 -1.868568867 0.000172757 0.002718447 protein_coding ENSMUSG00000098557 14 102976581 102982637 -ve Kctd12 -1.867764104 4.87E-05 0.000913251 protein_coding ENSMUSG00000030108 6 121300227 121337733 ve Slc6a13 -1.86418582 0.000153826 0.002459281 protein_coding ENSMUSG00000025854 5 138754514 138810077 ve Fam20c -1.863128844 5.50E-07 1.77E-05 protein_coding ENSMUSG00000028370 4 65124174 65357509 ve Pappa -1.861488639 0.000188291 0.002909847 protein_coding ENSMUSG00000026405 1 130634773 130661632 -ve C4bp -1.83560972 0.000225826 0.003385248 protein_coding ENSMUSG00000026420 1 130882074 130887454 -ve Il24 -1.835008244 0.000231632 0.003450503 protein_coding ENSMUSG00000015533 13 114835916 114932041 -ve Itga2 -1.834632939 3.98E-05 0.000777203 protein_coding ENSMUSG00000034227 11 116330704 116335399 -ve Foxj1 -1.832677417 1.48E-06 4.40E-05 protein_coding ENSMUSG00000026923 2 26457903 26516663 -ve Notch1 -1.826741012 5.65E-10 3.23E-08 protein_coding ENSMUSG00000047797 X 101376378 101385629 ve Gjb1 -1.817418763 0.000242347 0.003578302 protein_coding ENSMUSG00000000303 8 106603351 106670246 ve Cdh1 -1.815534424 4.93E-06 0.00012831 protein_coding ENSMUSG00000038168 16 25959288 26105784 -ve P3h2 -1.810528478 1.13E-06 3.44E-05 protein_coding ENSMUSG00000068205 2 140395309 142392966 ve Macrod2 -1.810130253 7.04E-10 3.96E-08 protein_coding ENSMUSG00000049985 13 112288451 112384002 ve Ankrd55 -1.806817489 0.000135433 0.002206066 protein_coding ENSMUSG00000000731 10 78030022 78043610 -ve Aire -1.798534906 0.00030391 0.004333453 protein_coding ENSMUSG00000045005 1 64730558 64737751 -ve Fzd5 -1.790953244 4.81E-23 1.13E-20 protein_coding ENSMUSG00000079598 6 38663069 38680864 ve Clec2l -1.786988711 0.000130575 0.002134267 protein_coding ENSMUSG00000026343 1 125676995 125873862 ve Gpr39 -1.782245605 1.83E-12 1.54E-10 protein_coding ENSMUSG00000047986 8 84021471 84030295 ve Palm3 -1.777314261 2.68E-11 1.94E-09 protein_coding ENSMUSG00000027603 2 155490379 155518237 -ve Ggt7 -1.771858907 6.76E-05 0.001212491 protein_coding ENSMUSG00000020183 10 117629500 117687352 ve Cpm -1.762693193 6.06E-09 2.90E-07 protein_coding ENSMUSG00000075302 2 70508819 70540884 ve Erich2 -1.756647365 5.48E-10 3.15E-08 protein_coding ENSMUSG00000090509 17 35601549 35650571 ve Sfta2 -1.756540819 0.00040533 0.00548321 protein_coding ENSMUSG00000027900 3 106547798 106575890 ve Dram2 -1.753672545 1.84E-14 1.96E-12 protein_coding ENSMUSG00000040447 11 72451638 72489904 -ve Spns2 -1.750879303 8.89E-07 2.73E-05 protein_coding ENSMUSG00000014158 5 114622152 114658421 -ve Trpv4 -1.749232786 2.48E-10 1.55E-08 protein_coding

17 ENSMUSG00000039385 15 13034200 13173639 -ve Cdh6 -1.749058196 0.00045346 0.005968517 protein_coding ENSMUSG00000025915 1 9798107 9900845 ve Sgk3 -1.740189433 7.59E-22 1.55E-19 protein_coding ENSMUSG00000020151 10 116018213 116274932 ve Ptprr -1.737659718 0.000142221 0.002298896 protein_coding ENSMUSG00000032238 9 68653786 69388246 ve Rora -1.734367074 0.000162456 0.002573417 protein_coding ENSMUSG00000002565 12 40059769 40134228 -ve Scin -1.731090136 4.46E-05 0.000848291 protein_coding ENSMUSG00000042510 1 130731976 130744622 ve AA986860 -1.728410151 4.35E-10 2.58E-08 protein_coding ENSMUSG00000026637 1 191997205 192092559 -ve Traf5 -1.726543761 3.51E-20 6.53E-18 protein_coding ENSMUSG00000040710 1 95587682 95667571 -ve St8sia4 -1.72537114 0.000129112 0.002115811 protein_coding ENSMUSG00000004864 17 28769307 28778698 ve Mapk13 -1.723603999 0.000211442 0.003212736 protein_coding ENSMUSG00000064065 10 6885796 7052478 -ve Ipcef1 -1.721468759 0.000420975 0.00563863 protein_coding ENSMUSG00000050530 2 3114224 3227806 ve Fam171a1 -1.721404924 2.28E-09 1.18E-07 protein_coding ENSMUSG00000084128 8 106130319 106136974 -ve Esrp2 -1.714007304 4.96E-06 0.000128806 protein_coding ENSMUSG00000071551 13 4228700 4248681 ve Akr1c19 -1.712732843 0.000473878 0.006198904 protein_coding ENSMUSG00000016552 15 77940522 77956722 -ve Foxred2 -1.712495783 0.00026875 0.003908393 protein_coding ENSMUSG00000021720 13 105149352 105271039 -ve Rnf180 -1.711284217 0.000574544 0.007300836 protein_coding ENSMUSG00000079173 5 137378637 137477064 -ve Zan -1.708002163 1.15E-05 0.000266911 protein_coding ENSMUSG00000005220 5 72300025 72504473 -ve Corin -1.706169896 0.000557073 0.007120116 protein_coding ENSMUSG00000021594 13 69573449 69611442 -ve Srd5a1 -1.70512771 2.02E-14 2.14E-12 protein_coding ENSMUSG00000034912 12 66469568 67222549 -ve Mdga2 -1.704234258 0.000454128 0.005973168 protein_coding ENSMUSG00000039942 15 5206661 5244187 -ve Ptger4 -1.703596518 0.000109476 0.001836819 protein_coding ENSMUSG00000047180 1 36264597 36274679 -ve Neurl3 -1.699517441 1.94E-07 6.90E-06 protein_coding ENSMUSG00000032578 9 107296026 107302784 ve Cish -1.69729111 2.76E-19 4.68E-17 protein_coding ENSMUSG00000047638 10 89454234 89533585 -ve Nr1h4 -1.692451211 2.90E-08 1.21E-06 protein_coding ENSMUSG00000057963 12 102568582 102704930 -ve Itpk1 -1.690405781 1.03E-12 9.05E-11 protein_coding ENSMUSG00000048728 11 50872720 50887651 -ve Zfp454 -1.688617812 0.000250954 0.003686282 protein_coding ENSMUSG00000031737 8 92357796 92361456 ve Irx5 -1.688439801 4.97E-06 0.000129037 protein_coding ENSMUSG00000097124 3 121531619 121536206 ve A530020G20Rik -1.684529295 0.000228966 0.003422752 antisense ENSMUSG00000084284 X 101768535 101769057 ve Tpt1-ps6 -1.682423381 0.000697954 0.008475857 processed_pseudogene ENSMUSG00000026866 2 43555329 43682715 ve Kynu -1.682361758 0.000643808 0.007976411 protein_coding ENSMUSG00000020019 10 93640681 93747207 ve Ntn4 -1.678294097 2.78E-08 1.17E-06 protein_coding ENSMUSG00000079434 1 87509889 87597845 ve Neu2 -1.677689443 0.000753347 0.009038738 protein_coding ENSMUSG00000039116 10 14402583 14545179 -ve Adgrg6 -1.676487807 1.45E-07 5.30E-06 protein_coding ENSMUSG00000054662 7 141101219 141117806 -ve Ano9 -1.673611834 0.000237933 0.003527761 protein_coding ENSMUSG00000044641 2 168081004 168101203 ve Pard6b -1.672071404 9.08E-33 4.11E-30 protein_coding ENSMUSG00000053111 7 133776861 133881532 ve Fank1 -1.671163699 3.48E-05 0.000691963 protein_coding ENSMUSG00000026994 2 66082766 66124994 -ve Galnt3 -1.669362877 0.000818505 0.009614012 protein_coding ENSMUSG00000025176 19 42045610 42070953 ve Hoga1 -1.668332607 3.82E-08 1.56E-06 protein_coding ENSMUSG00000032358 9 76490054 76567116 -ve Fam83b -1.666276539 0.000835365 0.009769756 protein_coding ENSMUSG00000025196 19 43956307 43986556 -ve Cpn1 -1.66626944 3.74E-05 0.000736581 protein_coding ENSMUSG00000020121 10 121780991 122047315 -ve Srgap1 -1.664227515 0.000796939 0.009424827 protein_coding ENSMUSG00000052415 3 93442330 93449077 ve Tchh -1.661381077 0.000137204 0.002231091 protein_coding ENSMUSG00000030562 7 87246096 87398710 ve Nox4 -1.658504623 1.18E-05 0.000271208 protein_coding ENSMUSG00000041992 12 117516479 117756978 ve Rapgef5 -1.658138502 0.000769751 0.009189119 protein_coding ENSMUSG00000024039 17 31612623 31637199 -ve Cbs -1.658135344 0.000885793 0.010249909 protein_coding ENSMUSG00000047822 9 21835510 21837346 ve Angptl8 -1.657291211 0.000216994 0.003270929 protein_coding ENSMUSG00000090124 1 88095062 88220002 ve Ugt1a7c -1.656872248 0.000890614 0.010292477 protein_coding ENSMUSG00000034382 17 47436615 47470638 ve AI661453 -1.646365378 0.000150387 0.002411369 protein_coding ENSMUSG00000057265 12 84409071 84433780 ve Bbof1 -1.642734923 1.31E-05 0.00029764 protein_coding ENSMUSG00000026971 2 60598292 60722643 -ve Itgb6 -1.640214643 9.51E-06 0.000226389 protein_coding ENSMUSG00000029925 6 38875404 39084585 ve Tbxas1 -1.632591471 0.000636013 0.007895294 protein_coding ENSMUSG00000048142 5 33995984 34005916 ve Nat8l -1.631278213 0.000936304 0.010712787 protein_coding ENSMUSG00000035910 13 25056004 25210706 ve Dcdc2a -1.631156232 0.000998259 0.011245513 protein_coding ENSMUSG00000040350 11 48826140 48852209 ve Trim7 -1.628148655 4.54E-06 0.000118998 protein_coding ENSMUSG00000086549 4 156052715 156059802 -ve Gm13648 -1.626142497 0.000778708 0.009255315 processed_transcript ENSMUSG00000078864 2 177759288 177770472 ve Gm14322 -1.625967227 0.000543122 0.006979373 protein_coding ENSMUSG00000090142 1 20444258 20444810 -ve Gm15795 -1.618214733 0.001109768 0.012197819 processed_pseudogene ENSMUSG00000103421 1 133309800 133323026 ve Golt1a -1.617200856 0.001148436 0.012542986 protein_coding ENSMUSG00000008999 2 172868012 172940321 -ve Bmp7 -1.615403132 1.70E-05 0.000371498 protein_coding ENSMUSG00000025916 1 9968624 10009136 -ve Ppp1r42 -1.612209886 0.001226578 0.013221559 protein_coding ENSMUSG00000104095 1 20062070 20065548 -ve Gm37315 -1.607441037 0.001184878 0.01286461 TEC ENSMUSG00000053886 8 68276567 68347694 ve Sh2d4a -1.606140308 0.000102436 0.00173712 protein_coding ENSMUSG00000052085 19 24999529 25202432 ve Dock8 -1.605981521 0.000161814 0.002569676 protein_coding ENSMUSG00000021236 12 84373857 84409029 -ve Entpd5 -1.604859649 1.68E-07 6.05E-06 protein_coding ENSMUSG00000044216 15 79483718 79505241 -ve Kcnj4 -1.600546503 5.95E-07 1.89E-05 protein_coding ENSMUSG00000044220 19 43612325 43615892 ve Nkx2-3 -1.599663558 0.00133321 0.014098914 protein_coding ENSMUSG00000091575 3 106481982 106485913 -ve 2010016I18Rik -1.598528418 0.000398518 0.00541807 processed_transcript ENSMUSG00000048450 5 37820485 37824583 -ve Msx1 -1.595400813 0.001301015 0.013866541 protein_coding ENSMUSG00000020009 10 19591949 19610229 ve Ifngr1 -1.595308549 3.44E-30 1.39E-27 protein_coding ENSMUSG00000046413 8 91800415 91807539 ve Irx3os -1.592482492 0.000972728 0.011003583 lincRNA ENSMUSG00000031736 8 92326038 92356120 -ve Crnde -1.588778689 5.12E-08 2.04E-06 lincRNA ENSMUSG00000037548 17 34143307 34151553 ve H2-DMb2 -1.584167655 0.001369101 0.014406285 protein_coding ENSMUSG00000001520 6 128399296 128416427 ve Nrip2 -1.577682053 5.25E-07 1.69E-05 protein_coding ENSMUSG00000022240 15 30172593 31029311 ve Ctnnd2 -1.573865315 0.001585792 0.01620127 protein_coding ENSMUSG00000055322 1 73910231 74124449 -ve Tns1 -1.572137183 1.03E-07 3.92E-06 protein_coding ENSMUSG00000014329 10 70922832 71159700 -ve Bicc1 -1.570808117 5.25E-12 4.19E-10 protein_coding ENSMUSG00000029556 5 114948980 114971094 -ve Hnf1a -1.568479289 0.001653844 0.01677963 protein_coding ENSMUSG00000059456 14 66153257 66281052 -ve Ptk2b -1.566556475 0.000184741 0.002867045 protein_coding ENSMUSG00000032860 7 100996568 101012866 -ve P2ry2 -1.566463389 0.000101323 0.00172595 protein_coding ENSMUSG00000098176 15 75979872 75982455 -ve Ccdc166 -1.563553455 0.000640701 0.007943106 protein_coding ENSMUSG00000025738 17 25809085 25821244 ve Fbxl16 -1.563549915 0.00011928 0.001973416 protein_coding ENSMUSG00000040891 7 19013284 19023538 -ve Foxa3 -1.56331451 0.000153818 0.002459281 protein_coding ENSMUSG00000020102 10 125226464 125328963 -ve Slc16a7 -1.562971838 0.00131356 0.013968894 protein_coding ENSMUSG00000001827 7 101858331 101870788 -ve Folr1 -1.562047006 0.00015823 0.002525426 protein_coding ENSMUSG00000024867 19 24294794 24555872 -ve Pip5k1b -1.560485236 0.000293513 0.004194651 protein_coding

18 ENSMUSG00000004661 9 57790353 57836793 -ve Arid3b -1.553552198 9.31E-10 5.07E-08 protein_coding ENSMUSG00000069862 8 123206623 123207021 ve Rps12-ps9 -1.552620553 0.001742534 0.017501822 processed_pseudogene ENSMUSG00000072663 15 9578193 9748868 -ve Spef2 -1.551992185 0.001213072 0.013098285 protein_coding ENSMUSG00000037172 6 40401375 40436135 -ve E330009J07Rik -1.551624116 1.42E-05 0.000318955 protein_coding ENSMUSG00000097232 15 41758060 41788911 -ve Gm26854 -1.550189918 0.000993556 0.011205826 lincRNA ENSMUSG00000021196 13 6579768 6648777 -ve Pfkp -1.548147985 0.000103356 0.001751151 protein_coding ENSMUSG00000058740 2 25863734 25918273 ve Kcnt1 -1.546684404 0.001204814 0.013046195 protein_coding ENSMUSG00000053916 2 151029685 151039398 -ve Nanp -1.543355027 0.000843936 0.009839697 protein_coding ENSMUSG00000021339 13 24992483 25020379 -ve Mrs2 -1.539450207 5.56E-07 1.78E-05 protein_coding ENSMUSG00000051022 5 39613935 39755475 -ve Hs3st1 -1.533168683 0.001973667 0.019442867 protein_coding ENSMUSG00000033308 3 118562129 119432924 ve Dpyd -1.529979703 1.19E-05 0.000272612 protein_coding ENSMUSG00000037509 1 34678188 34813309 ve Arhgef4 -1.52959591 0.00100203 0.01127462 protein_coding ENSMUSG00000043289 9 81863670 82206007 ve Mei4 -1.523965969 0.0012263 0.013221559 protein_coding ENSMUSG00000040610 11 33200752 33203589 -ve Tlx3 -1.522875769 0.001483008 0.015388672 protein_coding ENSMUSG00000086279 8 46152610 46156100 ve Gm15634 -1.518150306 0.002241741 0.021482032 antisense ENSMUSG00000074577 2 167980164 168010618 -ve Fam65c -1.516100684 0.002365235 0.022405444 protein_coding ENSMUSG00000039438 9 44799400 44802951 -ve Ttc36 -1.515632918 0.001116324 0.012241538 protein_coding ENSMUSG00000097354 6 129208412 129238725 -ve 2310001H17Rik -1.510052556 0.001865902 0.018502907 lincRNA ENSMUSG00000081957 2 72633936 72634607 ve Ak3l2-ps -1.507753615 4.32E-05 0.000826996 processed_pseudogene ENSMUSG00000028780 5 17574281 17730268 ve Sema3c -1.506723754 0.001766279 0.017702868 protein_coding ENSMUSG00000044026 19 38395980 38405607 ve Slc35g1 -1.506155737 3.22E-09 1.62E-07 protein_coding ENSMUSG00000021636 13 100595957 100616971 -ve Marveld2 -1.502914332 0.000415919 0.005595303 protein_coding ENSMUSG00000087613 6 34179232 34186392 ve Gm13855 -1.501417326 0.002204365 0.021252541 lincRNA ENSMUSG00000073678 1 54472994 54557684 -ve Pgap1 -1.494151279 1.29E-07 4.76E-06 protein_coding ENSMUSG00000008206 8 4493026 4531680 ve Cers4 -1.491678558 0.002648888 0.02431257 protein_coding ENSMUSG00000059022 6 29473162 29507952 -ve Kcp -1.487994988 0.000333695 0.004698192 protein_coding ENSMUSG00000054619 15 100304817 100314348 ve Mettl7a1 -1.486978434 6.34E-10 3.60E-08 protein_coding ENSMUSG00000096001 14 37102140 37114022 -ve 2610528A11Rik -1.486177939 0.001738344 0.017496753 protein_coding ENSMUSG00000017688 3 3508030 3658052 ve Hnf4g -1.480885232 0.002904005 0.025967875 protein_coding ENSMUSG00000085083 11 101264762 101266303 -ve Gm11615 -1.479030525 0.000162222 0.002573417 antisense ENSMUSG00000030022 6 92772699 92943492 -ve Adamts9 -1.478814863 0.000393564 0.005373806 protein_coding ENSMUSG00000028434 4 56991972 57143437 -ve Epb41l4b -1.474188325 0.00259769 0.024032109 protein_coding ENSMUSG00000102503 1 54737166 54738575 -ve Gm37370 -1.472559828 0.002848281 0.025577966 TEC ENSMUSG00000028527 4 101419277 101466995 ve Ak4 -1.471608587 5.44E-06 0.000139588 protein_coding ENSMUSG00000096215 16 5007288 5008309 ve Smim22 -1.468073856 0.002649767 0.02431257 protein_coding ENSMUSG00000091313 6 39653450 39653965 -ve Fth-ps2 -1.465514847 0.003277169 0.028460575 processed_pseudogene ENSMUSG00000084616 X 36363899 36364002 ve Gm25047 -1.460997788 0.000890898 0.010292477 snRNA ENSMUSG00000034648 6 107529768 107570214 ve Lrrn1 -1.460151069 0.001753052 0.017579577 protein_coding ENSMUSG00000012350 2 103263433 103303278 -ve Ehf -1.459290587 0.003097159 0.027208646 protein_coding ENSMUSG00000022332 15 68928420 69093512 ve Khdrbs3 -1.458766235 0.00337697 0.029087889 protein_coding ENSMUSG00000086245 11 48843648 48853493 -ve Gm16170 -1.458268863 0.000408587 0.005523342 processed_transcript ENSMUSG00000030849 7 130162451 133123350 -ve Fgfr2 -1.456632957 0.000430658 0.005730783 protein_coding ENSMUSG00000092250 19 43609077 43610625 -ve Gm20467 -1.452925897 0.003573441 0.030367052 lincRNA ENSMUSG00000099707 1 71888112 71891204 ve Gm8883 -1.450696424 0.002845946 0.025569085 lincRNA ENSMUSG00000062168 X 160623094 160735765 -ve Ppef1 -1.45064151 0.002418366 0.022783746 protein_coding ENSMUSG00000022947 16 93683215 93690990 ve Cbr3 -1.449582374 0.001541998 0.015865209 protein_coding ENSMUSG00000090369 19 42052248 42053627 ve 4933411K16Rik -1.449231441 3.44E-08 1.41E-06 protein_coding ENSMUSG00000000385 16 97564684 97611195 -ve Tmprss2 -1.446071195 0.00311472 0.027324658 protein_coding ENSMUSG00000026479 1 153122756 153186447 -ve Lamc2 -1.443842801 2.14E-06 6.13E-05 protein_coding ENSMUSG00000038349 1 55405921 55754285 ve Plcl1 -1.44347757 0.00260753 0.024080551 protein_coding ENSMUSG00000023067 17 29090979 29100722 ve Cdkn1a -1.443155707 3.47E-12 2.79E-10 protein_coding ENSMUSG00000040543 11 72047528 72135778 -ve Pitpnm3 -1.442575473 2.32E-06 6.56E-05 protein_coding ENSMUSG00000030930 7 132235780 132317228 -ve Chst15 -1.442171097 0.000358267 0.004962246 protein_coding ENSMUSG00000103292 1 90520496 90523297 ve Gm35048 -1.441304038 0.003750283 0.031406138 TEC ENSMUSG00000056665 15 74721204 74724639 ve Them6 -1.44106519 1.21E-06 3.65E-05 protein_coding ENSMUSG00000091133 13 69610498 69614901 -ve Gm17108 -1.431131136 0.000113812 0.001897838 processed_transcript ENSMUSG00000022797 16 32608920 32632794 ve Tfrc -1.430429693 2.05E-08 8.91E-07 protein_coding ENSMUSG00000040729 9 8076633 8134294 -ve Cep126 -1.429048678 0.002377823 0.022497067 protein_coding ENSMUSG00000021340 13 24943152 24990753 ve Gpld1 -1.42842836 7.90E-06 0.000191849 protein_coding ENSMUSG00000028572 4 95967240 96025413 ve Hook1 -1.427933137 9.53E-09 4.41E-07 protein_coding ENSMUSG00000108084 6 48860329 48866083 ve Gm7932 -1.42744795 0.003492292 0.029813434 lincRNA ENSMUSG00000038600 6 38048483 38124586 -ve Atp6v0a4 -1.421333211 5.65E-06 0.000144151 protein_coding ENSMUSG00000037139 4 135759715 135815564 ve Myom3 -1.420886562 0.000246209 0.003625004 protein_coding ENSMUSG00000055493 10 11343404 11459644 ve Epm2a -1.420797984 0.000293469 0.004194651 protein_coding ENSMUSG00000097675 6 129531950 129533817 -ve 1700101I11Rik -1.418346328 0.002083392 0.020336117 processed_transcript ENSMUSG00000039131 3 152093533 152166230 -ve Gipc2 -1.413950436 6.48E-05 0.001174139 protein_coding ENSMUSG00000039782 5 43233170 43289724 ve Cpeb2 -1.412582264 5.74E-05 0.001060129 protein_coding ENSMUSG00000018427 11 86936425 86993707 -ve Ypel2 -1.411255174 3.40E-21 6.52E-19 protein_coding ENSMUSG00000063804 10 45376620 45470201 -ve Lin28b -1.410131265 0.004688953 0.037197331 protein_coding ENSMUSG00000037196 17 10403012 10840311 -ve Pacrg -1.403191977 0.000361583 0.005001849 protein_coding ENSMUSG00000015396 13 43785107 43803130 ve Cd83 -1.401376653 0.003132776 0.027445023 protein_coding ENSMUSG00000047496 1 105276914 105356710 -ve Rnf152 -1.399099062 0.004853361 0.038233051 protein_coding ENSMUSG00000021219 12 82588292 83162056 ve Rgs6 -1.398561681 0.004452781 0.035729474 protein_coding ENSMUSG00000061601 5 14514918 14863459 ve Pclo -1.397834853 0.004505462 0.036045591 protein_coding ENSMUSG00000058794 15 103248212 103258403 -ve Nfe2 -1.397537297 0.003589428 0.030475639 protein_coding ENSMUSG00000058152 18 59175401 59410446 ve Chsy3 -1.396804568 0.004175291 0.034034896 protein_coding ENSMUSG00000068587 6 40628831 40769123 ve Mgam -1.395480612 0.002800161 0.025253301 protein_coding ENSMUSG00000001663 10 75783813 75798584 -ve Gstt1 -1.395425194 0.000607333 0.007593861 protein_coding ENSMUSG00000001497 12 56691767 56712822 ve Pax9 -1.394856076 0.000127139 0.002089879 protein_coding ENSMUSG00000087001 6 84093772 84107007 -ve Gm15475 -1.393624544 0.000736069 0.008870658 antisense ENSMUSG00000034427 11 115858406 115892603 ve Myo15b -1.392334803 0.002378461 0.022497067 protein_coding ENSMUSG00000020396 11 4938754 4948064 -ve Nefh -1.391561865 0.001871543 0.018542628 protein_coding ENSMUSG00000024589 18 64887756 65217826 ve Nedd4l -1.391334377 1.13E-06 3.42E-05 protein_coding ENSMUSG00000038522 10 40001575 40025268 -ve AI317395 -1.388619277 0.001165304 0.012690723 protein_coding

19 ENSMUSG00000038756 11 96133786 96165451 ve Ttll6 -1.386419898 0.001506057 0.015562865 protein_coding ENSMUSG00000019789 10 30832359 30842801 -ve Hey2 -1.386357914 0.003954056 0.03266245 protein_coding ENSMUSG00000018554 11 69935796 69941605 ve Ybx2 -1.382686233 0.000874791 0.010143408 protein_coding ENSMUSG00000029273 5 87554645 87569027 -ve Sult1d1 -1.380385037 0.004086097 0.033462223 protein_coding ENSMUSG00000048960 1 10993465 11303681 ve Prex2 -1.377997846 0.001718341 0.017341363 protein_coding ENSMUSG00000020431 11 7063489 7178506 ve Adcy1 -1.374580395 0.005341214 0.040856092 protein_coding ENSMUSG00000006651 7 30434982 30445535 -ve Aplp1 -1.373951184 1.20E-05 0.0002741 protein_coding ENSMUSG00000078878 2 176708328 176721813 ve Gm14305 -1.371675445 0.005874363 0.043908609 protein_coding ENSMUSG00000103558 17 71391838 71393284 -ve Gm38220 -1.370690672 0.002956676 0.026314973 TEC ENSMUSG00000099146 3 138210716 138240405 -ve 0610031O16Rik -1.368967071 0.004672545 0.037101024 antisense ENSMUSG00000006574 11 102348824 102366203 -ve Slc4a1 -1.36891259 0.005242796 0.040298029 protein_coding ENSMUSG00000027276 2 137081456 137116644 -ve Jag1 -1.368057066 0.005381609 0.041082352 protein_coding ENSMUSG00000032014 9 43221278 43239816 -ve Oaf -1.365613966 2.58E-06 7.23E-05 protein_coding ENSMUSG00000043833 5 25100983 25110109 ve 2900005J15Rik -1.363598235 0.003814936 0.031835271 processed_transcript ENSMUSG00000108101 6 48045548 48045955 -ve -1.358690219 0.000503408 0.006521978 sense_intronic ENSMUSG00000031111 X 49782536 49797749 -ve Igsf1 -1.358001631 0.003347716 0.028914582 protein_coding ENSMUSG00000032456 9 98287435 98420438 ve Nmnat3 -1.355328746 4.58E-10 2.68E-08 protein_coding ENSMUSG00000066392 12 88722876 90334935 ve Nrxn3 -1.354184657 0.006538599 0.047709414 protein_coding ENSMUSG00000040998 3 132881745 132950291 -ve Npnt -1.353866957 6.98E-06 0.000172363 protein_coding ENSMUSG00000095288 6 148900968 148901138 -ve Gm7618 -1.353088803 0.004831953 0.038111827 processed_pseudogene ENSMUSG00000030781 7 128265657 128272430 ve Slc5a2 -1.352712467 0.00584915 0.043754594 protein_coding ENSMUSG00000034917 10 81273207 81291267 -ve Tjp3 -1.35050123 4.02E-13 3.80E-11 protein_coding ENSMUSG00000002799 12 112908590 112929495 -ve Jag2 -1.349407821 0.000268042 0.003901083 protein_coding ENSMUSG00000026153 1 24011093 24100341 -ve Fam135a -1.34928854 2.20E-08 9.40E-07 protein_coding ENSMUSG00000041362 19 58973358 59076069 -ve Shtn1 -1.346595841 0.006763842 0.048846253 protein_coding ENSMUSG00000036466 9 64385626 64709205 ve Megf11 -1.345794933 0.000150449 0.002411369 protein_coding ENSMUSG00000036492 17 36942918 36947986 ve Rnf39 -1.345378988 0.002744358 0.024891879 protein_coding ENSMUSG00000021850 14 49226358 49245428 -ve 1700011H14Rik -1.342471245 0.005050854 0.039342291 protein_coding ENSMUSG00000001227 17 56123085 56140343 -ve Sema6b -1.339423347 0.005635925 0.042578806 protein_coding ENSMUSG00000051107 13 51685529 51701041 -ve Gm15440 -1.338840645 0.001319238 0.014005745 protein_coding ENSMUSG00000021879 14 26693274 26891703 ve Dnah12 -1.338671161 0.006732095 0.048746734 protein_coding ENSMUSG00000016239 X 36328353 36362341 ve Lonrf3 -1.337248533 0.000112888 0.001885731 protein_coding ENSMUSG00000038112 9 39587396 39604403 -ve AW551984 -1.337226433 0.004226626 0.034343749 protein_coding ENSMUSG00000027111 2 71745616 71858416 ve Itga6 -1.336448714 8.24E-08 3.16E-06 protein_coding ENSMUSG00000062480 17 12923833 12940402 -ve Acat3 -1.334519765 0.007456315 0.052783377 protein_coding ENSMUSG00000038009 15 99093170 99104737 ve Dnajc22 -1.333888343 0.004147574 0.033852543 protein_coding ENSMUSG00000050050 5 92607954 92675271 -ve Ccdc158 -1.333046322 0.004034496 0.033200682 protein_coding ENSMUSG00000086862 2 58164001 58177063 ve Gm13546 -1.332065866 0.007497627 0.052878737 antisense ENSMUSG00000044667 3 117319139 117360876 -ve Plppr4 -1.330688532 0.004275769 0.034616232 protein_coding ENSMUSG00000040808 X 162961992 162964599 -ve S100g -1.32925807 0.002743136 0.024891879 protein_coding ENSMUSG00000036931 7 30421732 30428746 ve Nfkbid -1.327693051 6.31E-07 2.00E-05 protein_coding ENSMUSG00000032350 9 77754535 77794485 ve Gclc -1.32559342 5.14E-06 0.000132967 protein_coding ENSMUSG00000045664 19 5917556 5924816 -ve Cdc42ep2 -1.323448734 0.000118135 0.001959593 protein_coding ENSMUSG00000057729 10 79874476 79883174 ve Prtn3 -1.323423637 2.47E-05 0.000509036 protein_coding ENSMUSG00000021957 14 30548359 30574722 ve Tkt -1.321133161 2.15E-10 1.35E-08 protein_coding ENSMUSG00000094174 12 114406474 114406961 -ve Ighv6-4 -1.320548645 0.006872913 0.049399471 IG_V_gene ENSMUSG00000024922 19 5549137 5560575 -ve Ovol1 -1.317866715 0.000345568 0.004836681 protein_coding ENSMUSG00000026202 1 75214228 75219865 -ve Tuba4a -1.31764083 1.43E-14 1.55E-12 protein_coding ENSMUSG00000032702 19 25236975 25434496 ve Kank1 -1.3172445 6.37E-10 3.61E-08 protein_coding ENSMUSG00000073207 X 52791200 52799468 ve Ccdc160 -1.315280072 0.002960467 0.026324042 protein_coding ENSMUSG00000086515 2 70503433 70509199 -ve Erich2os -1.315218852 0.000317329 0.004501149 antisense ENSMUSG00000034613 10 122678762 122945795 ve Ppm1h -1.311725545 0.000596208 0.007486368 protein_coding ENSMUSG00000020429 11 7197782 7202546 ve Igfbp1 -1.30846254 0.007991828 0.055539259 protein_coding ENSMUSG00000018849 11 35838400 35980527 -ve Wwc1 -1.305181973 1.58E-05 0.000349389 protein_coding ENSMUSG00000026765 2 49787688 49948849 ve Lypd6b -1.304201802 0.008933116 0.060208189 protein_coding ENSMUSG00000067851 1 10137571 10232670 -ve Arfgef1 -1.303808847 4.44E-13 4.11E-11 protein_coding ENSMUSG00000049791 7 89404355 89413134 ve Fzd4 -1.302532036 0.003460478 0.029632492 protein_coding ENSMUSG00000045314 5 93041123 93045022 -ve Sowahb -1.301669882 0.000775113 0.009224132 protein_coding ENSMUSG00000021451 13 51701246 51793747 -ve Sema4d -1.300227399 7.39E-09 3.48E-07 protein_coding ENSMUSG00000030246 6 142490249 142507957 -ve Ldhb -1.291411924 0.009618825 0.063500294 protein_coding ENSMUSG00000074217 8 84010222 84012171 -ve 2210011C24Rik -1.287519099 0.002750049 0.024919694 protein_coding ENSMUSG00000029123 5 37446825 37717171 -ve Stk32b -1.286872329 0.003829659 NA protein_coding ENSMUSG00000029167 5 51454250 51567726 -ve Ppargc1a -1.286774927 0.003955333 0.03266245 protein_coding ENSMUSG00000085541 9 97015966 97022043 ve Gm16010 -1.285343371 0.009957931 0.065127748 antisense ENSMUSG00000092090 6 28981634 29028922 ve Gm3294 -1.285032383 0.008076017 0.056054576 lincRNA ENSMUSG00000030621 7 89632392 89854359 ve Me3 -1.285030719 1.58E-06 4.69E-05 protein_coding ENSMUSG00000106498 5 19198483 19201605 -ve Gm43032 -1.273243923 0.008443137 0.057912784 TEC ENSMUSG00000038742 9 20873809 20879727 -ve Angptl6 -1.270852781 0.00185041 0.018410081 protein_coding ENSMUSG00000086448 13 24937401 24941417 ve 9330162012Rik -1.269875756 0.006750205 0.048814447 processed_transcript ENSMUSG00000040978 11 9048594 9069356 ve Gm11992 -1.265827767 0.000124531 0.002052038 protein_coding ENSMUSG00000041930 5 114568016 114613220 ve Fam222a -1.265081959 0.004152411 0.033877463 protein_coding ENSMUSG00000042686 1 16964560 17097889 -ve Jph1 -1.264209447 0.006439956 0.04717088 protein_coding ENSMUSG00000073295 X 6047453 6055110 ve Nudt11 -1.261258854 0.002742295 0.024891879 protein_coding ENSMUSG00000004113 2 24603887 24763152 -ve Cacna1b -1.261066231 0.010947527 0.06994129 protein_coding ENSMUSG00000033949 18 46165302 46212607 -ve Trim36 -1.260823298 2.79E-05 0.000567821 protein_coding ENSMUSG00000095026 8 70718543 70722635 ve Gm3336 -1.260806082 0.003137715 0.027462958 protein_coding ENSMUSG00000005045 4 152338651 152390194 ve Chd5 -1.258303988 0.0116224 0.072756838 protein_coding ENSMUSG00000103039 3 32454587 32455757 ve Gm37123 -1.257648292 0.000521631 0.006730534 TEC ENSMUSG00000037999 5 62602445 62766159 -ve Arap2 -1.257450852 0.010285918 0.066789895 protein_coding ENSMUSG00000082226 X 60548019 60548849 ve Gm715 -1.256757359 0.011666657 0.072889743 processed_pseudogene ENSMUSG00000047735 6 3372257 3399572 -ve Samd9l -1.253052964 0.000486483 0.006341644 protein_coding ENSMUSG00000024843 19 3851773 3894369 ve Chka -1.251290918 1.53E-08 6.79E-07 protein_coding ENSMUSG00000069808 11 76179671 76214827 ve Fam57a -1.248549686 0.000928781 0.01063312 protein_coding ENSMUSG00000085944 11 98350718 98358283 -ve 1700003D09Rik -1.246999501 0.01196735 0.074266261 processed_transcript

20 ENSMUSG00000026527 1 175059087 175492500 -ve Rgs7 -1.246826133 0.004508072 0.036051291 protein_coding ENSMUSG00000026915 2 37483228 37703859 -ve Strbp -1.246723393 4.36E-11 3.05E-09 protein_coding ENSMUSG00000089712 8 94377921 94379622 ve Gm15889 -1.245906586 0.006769825 0.048870882 lincRNA ENSMUSG00000054065 7 141078218 141090510 ve Pkp3 -1.24434381 0.003261169 0.028360525 protein_coding ENSMUSG00000028004 3 82538383 82548084 -ve Npy2r -1.242956873 0.012126564 0.074926965 protein_coding ENSMUSG00000019852 10 18588011 18743758 -ve Arfgef3 -1.241073871 0.011660674 0.072876337 protein_coding ENSMUSG00000057715 1 11414105 11975901 ve A830018L16Rik -1.240305145 0.009381062 0.062471583 protein_coding ENSMUSG00000004633 6 54039554 54301810 ve Chn2 -1.239933367 0.000210783 0.003205281 protein_coding ENSMUSG00000048490 16 76287400 76373827 -ve Nrip1 -1.235830622 6.94E-06 0.000171621 protein_coding ENSMUSG00000037035 1 119415465 119422248 -ve Inhbb -1.23539368 0.0132352 0.079700745 protein_coding ENSMUSG00000106838 5 114975456 114976013 ve 1810017P11Rik -1.235162481 0.012081671 0.074769362 TEC ENSMUSG00000101439 19 11090598 11092077 -ve Gm336 -1.235015174 0.012607946 0.077270965 processed_pseudogene ENSMUSG00000028637 4 119322893 119415521 -ve Ccdc30 -1.231475709 6.46E-06 0.0001624 protein_coding ENSMUSG00000021367 13 42301270 42307989 ve Edn1 -1.230951319 0.001115349 0.012241538 protein_coding ENSMUSG00000035835 10 79860475 79874634 -ve Plppr3 -1.229493067 0.000336567 0.004726742 protein_coding ENSMUSG00000056900 3 32817546 32938071 ve Usp13 -1.228982947 0.000290961 0.00417388 protein_coding ENSMUSG00000031785 8 94977109 95014208 ve Adgrg1 -1.228525243 9.40E-05 0.001616153 protein_coding ENSMUSG00000102758 3 23798102 25144261 -ve Naaladl2 -1.226437373 0.002496003 0.023330009 protein_coding ENSMUSG00000028488 4 85205126 85639195 ve Sh3gl2 -1.224761507 0.011650436 0.072860301 protein_coding ENSMUSG00000064181 10 116905784 116950380 -ve Rab3ip -1.223379177 5.69E-28 1.93E-25 protein_coding ENSMUSG00000020799 11 72344722 72362442 -ve Tekt1 -1.220872033 0.010170383 0.066084873 protein_coding ENSMUSG00000026893 2 62664285 62694109 ve Gca -1.220295273 0.000292238 0.004184292 protein_coding ENSMUSG00000051439 18 36725074 36726736 -ve Cd14 -1.218537338 0.000658792 0.00812496 protein_coding ENSMUSG00000097216 5 57570082 57720201 -ve 4932441J04Rik -1.218129417 0.014110902 0.083532387 processed_transcript ENSMUSG00000074912 2 119321187 119326194 -ve Gm14207 -1.217197099 0.014672443 0.086276692 processed_transcript ENSMUSG00000028051 3 89146074 89160196 -ve Hcn3 -1.21683576 0.001574719 0.016149372 protein_coding ENSMUSG00000046997 9 96943482 97018843 -ve Spsb4 -1.216135253 0.000649583 0.008032247 protein_coding ENSMUSG00000020407 11 9118103 9136170 ve Upp1 -1.214716695 0.008274984 0.057112517 protein_coding ENSMUSG00000060183 5 92359544 92365485 -ve Cxcl11 -1.213646838 0.010802197 0.069336308 polymorphic_pseudogene ENSMUSG00000052364 X 8892382 8894964 ve B630019K06Rik -1.213108189 0.007543083 0.053120944 protein_coding ENSMUSG00000022214 14 55560006 55570065 ve Dcaf11 -1.208391611 8.74E-20 1.54E-17 protein_coding ENSMUSG00000021090 12 72441866 72514334 ve Lrrc9 -1.208254439 0.000752438 0.00903354 protein_coding ENSMUSG00000026979 2 24367580 24414954 ve Psd4 -1.206810014 0.005474827 0.041593358 protein_coding ENSMUSG00000078289 15 85116870 85117287 ve Gm10923 -1.206737174 0.013911805 0.08275193 processed_pseudogene ENSMUSG00000027562 3 14886273 14900770 ve Car2 -1.206551785 0.004059081 0.033293466 protein_coding ENSMUSG00000024065 17 73804841 73832093 ve Ehd3 -1.20335402 0.011417045 0.071897854 protein_coding ENSMUSG00000041624 9 3532354 3897342 ve Gucy1a2 -1.202310024 0.000749663 0.009005908 protein_coding ENSMUSG00000074227 7 29256323 29281912 -ve Spint2 -1.199141365 6.79E-06 0.000169247 protein_coding ENSMUSG00000028199 3 154596711 154623182 ve Cryz -1.196874197 4.25E-07 1.40E-05 protein_coding ENSMUSG00000029211 5 71569749 71658308 -ve Gabra4 -1.194905764 0.006295502 0.046381099 protein_coding ENSMUSG00000044433 8 3587293 3609075 ve Camsap3 -1.194077539 1.98E-05 0.00042015 protein_coding ENSMUSG00000034164 11 5106265 5152257 -ve Emid1 -1.193599621 0.016125182 0.092443579 protein_coding ENSMUSG00000037259 2 144470557 144527414 -ve Dzank1 -1.19357831 0.000681876 0.008333897 protein_coding ENSMUSG00000020325 10 79777272 79782630 ve Fstl3 -1.191855205 6.74E-05 0.001210482 protein_coding ENSMUSG00000019851 10 18845071 18857073 ve Perp -1.189301314 0.016266539 0.092917408 protein_coding ENSMUSG00000029304 5 104435118 104441050 ve Spp1 -1.188102469 0.00227025 0.021656881 protein_coding ENSMUSG00000045790 5 52374651 52471521 -ve Ccdc149 -1.187530435 0.003550437 0.030225664 protein_coding ENSMUSG00000035834 13 81673843 81711013 -ve Polr3g -1.187098666 3.70E-06 9.94E-05 protein_coding ENSMUSG00000032313 9 55326913 55438345 ve Tmem266 -1.186848867 0.017212293 0.096834445 protein_coding ENSMUSG00000035936 13 24907579 24937661 -ve Aldh5a1 -1.185413086 8.37E-06 0.000201199 protein_coding ENSMUSG00000103324 17 11249344 11254343 ve Gm37402 -1.185275609 0.016140875 0.092504415 TEC ENSMUSG00000009378 19 34668403 34747289 -ve Slc16a12 -1.184940435 0.012960207 0.078618081 protein_coding ENSMUSG00000036402 6 66896397 67021350 ve Gng12 -1.183986503 3.65E-07 1.22E-05 protein_coding ENSMUSG00000025408 10 127290774 127296288 ve Ddit3 -1.181926029 0.001254094 0.013465557 protein_coding ENSMUSG00000020847 11 75830999 75938429 -ve Rph3al -1.181756774 2.80E-07 9.58E-06 protein_coding ENSMUSG00000004771 9 64715299 64737758 -ve Rab11a -1.179022272 5.66E-10 3.23E-08 protein_coding ENSMUSG00000064778 10 128084143 128084216 ve Snord59a -1.178568149 0.003492597 0.029813434 snoRNA ENSMUSG00000062488 19 34607970 34613401 ve Ifit3b -1.178527562 0.006526166 0.047655312 protein_coding ENSMUSG00000020717 11 106654217 106750628 -ve Pecam1 -1.176735062 0.010915138 0.069825267 protein_coding ENSMUSG00000038732 13 30136498 30246717 ve Mboat1 -1.176320879 1.46E-12 1.25E-10 protein_coding ENSMUSG00000095847 13 66874081 66874659 ve Gm5451 -1.174932989 0.005135039 0.039717438 processed_pseudogene ENSMUSG00000042215 1 33745484 33757795 -ve Bag2 -1.174771976 1.65E-05 0.000363011 protein_coding ENSMUSG00000040703 7 25802475 25816913 -ve Cyp2s1 -1.174253402 0.016156261 0.092504415 protein_coding ENSMUSG00000026418 1 135779434 135810989 ve Tnni1 -1.174063411 0.010939284 0.069932623 protein_coding ENSMUSG00000036304 16 43969078 43979093 -ve Zdhhc23 -1.170185898 0.001487746 0.015415576 protein_coding ENSMUSG00000020826 11 78920787 78960254 ve Nos2 -1.166976532 0.011846436 0.073794476 protein_coding ENSMUSG00000059742 2 62693414 63184287 -ve Kcnh7 -1.165376648 0.000886134 0.010249909 protein_coding ENSMUSG00000043843 7 25306106 25316195 ve Tmem145 -1.163930127 0.012486697 0.076846633 protein_coding ENSMUSG00000026430 1 131176410 131245258 -ve Rassf5 -1.163554638 0.000219237 0.003302113 protein_coding ENSMUSG00000086841 11 62602877 62604807 ve 2410006H16Rik -1.162441669 2.66E-05 0.000544773 processed_transcript ENSMUSG00000040570 5 8490334 8622952 -ve Rundc3b -1.162389805 0.012052164 0.074635395 protein_coding ENSMUSG00000032377 9 92457373 92492456 ve Plscr4 -1.162317077 0.001425745 0.014903236 protein_coding ENSMUSG00000019590 11 105933702 105953336 -ve Cyb561 -1.160904514 0.001090032 0.012078753 protein_coding ENSMUSG00000078877 2 176798612 176811223 ve Gm14295 -1.160586571 0.01914883 0.104120736 protein_coding ENSMUSG00000036908 19 3935186 3949340 ve Unc93b1 -1.160206924 0.012590847 0.077216003 protein_coding ENSMUSG00000028758 4 138250435 138301967 ve Kif17 -1.157782064 0.000225541 0.003385248 protein_coding ENSMUSG00000078451 10 41490439 41514284 ve Ppil6 -1.157745357 0.000337967 0.004740779 protein_coding ENSMUSG00000078234 4 139960220 139968026 -ve Klhdc7a -1.15382482 0.00461235 0.036684404 protein_coding ENSMUSG00000028927 4 140906344 140952586 ve Padi2 -1.152033602 0.011168406 0.070783261 protein_coding ENSMUSG00000032839 9 95705082 95750375 -ve Trpc1 -1.149958449 0.000529908 0.00682805 protein_coding ENSMUSG00000021000 12 59129720 59191583 ve Ctage5 -1.149407748 1.08E-11 8.17E-10 protein_coding ENSMUSG00000079614 18 67774876 67795461 ve Seh1l -1.147692491 1.76E-05 0.000381459 protein_coding ENSMUSG00000053550 7 4825552 4844696 -ve Shisa7 -1.146488614 0.016223134 0.092725242 protein_coding ENSMUSG00000035105 12 54178981 54203860 -ve Egln3 -1.145968269 0.000557845 0.007125191 protein_coding

21 ENSMUSG00000079547 17 34153072 34160230 ve H2-DMb1 -1.144473286 1.50E-05 0.000333749 protein_coding ENSMUSG00000027931 3 90450591 90465866 -ve Npr1 -1.144296028 0.009560341 0.063327799 protein_coding ENSMUSG00000042272 2 77180340 77280592 -ve Sestd1 -1.144293003 9.54E-09 4.41E-07 protein_coding ENSMUSG00000097248 8 87472812 87525554 ve Gm2694 -1.142526778 0.01773064 0.09880074 lincRNA ENSMUSG00000035403 2 37776249 37799103 ve Crb2 -1.141182949 0.003665957 0.03090436 protein_coding ENSMUSG00000057058 11 96464593 96759130 ve Skap1 -1.140889066 0.00458725 0.036576676 protein_coding ENSMUSG00000050914 8 45996902 45999867 -ve Ankrd37 -1.137746007 0.003437432 0.029501647 protein_coding ENSMUSG00000098656 5 114719515 114719578 ve Mir7028 -1.137452946 0.020597321 0.109489201 miRNA ENSMUSG00000035775 11 99428403 99438150 -ve Krt20 -1.136424192 0.006263095 0.046178173 protein_coding ENSMUSG00000083049 X 104746482 104746772 ve Gm14822 -1.136153143 0.009849971 0.064599621 processed_pseudogene ENSMUSG00000084834 16 36880519 36897189 -ve 4930565N06Rik -1.136098369 0.002547863 0.023642711 antisense ENSMUSG00000072889 5 72513301 72559684 -ve Nfxl1 -1.13568319 2.50E-07 8.62E-06 protein_coding ENSMUSG00000038764 4 57190841 57301837 -ve Ptpn3 -1.134450948 3.44E-05 0.000684321 protein_coding ENSMUSG00000042604 2 107290639 107298502 ve Kcna4 -1.13409729 0.01585668 0.091382811 protein_coding ENSMUSG00000015305 10 8722219 8886070 -ve Sash1 -1.133506185 1.46E-25 3.71E-23 protein_coding ENSMUSG00000028072 3 87778244 87795162 -ve Ntrk1 -1.132891832 0.02199526 0.114359694 protein_coding ENSMUSG00000041798 11 5900820 5950081 -ve Gck -1.132484474 0.022888952 0.117367674 protein_coding ENSMUSG00000098186 3 14973569 14974552 -ve Gm7132 -1.132371434 0.022860113 0.117251452 processed_pseudogene ENSMUSG00000036611 9 25481547 25604110 ve Eepd1 -1.131332521 0.000402393 0.005460074 protein_coding ENSMUSG00000028893 4 132492032 132510501 -ve Sesn2 -1.12949987 1.64E-06 4.83E-05 protein_coding ENSMUSG00000019437 11 78176711 78181909 ve Tlcd1 -1.124742174 3.11E-05 0.000624571 protein_coding ENSMUSG00000035948 10 106936164 107123668 -ve Acss3 -1.12449742 0.015553354 0.090199954 protein_coding ENSMUSG00000018411 11 104231390 104332090 ve Mapt -1.123049305 0.017040576 0.096239252 protein_coding ENSMUSG00000103160 14 21992436 21996100 ve C130012C08Rik -1.122953126 0.020777978 0.110058163 TEC ENSMUSG00000051177 2 134786067 135475258 ve Plcb1 -1.119829448 0.011234457 0.070988753 protein_coding ENSMUSG00000034761 12 69803750 69893200 -ve Map4k5 -1.119588337 3.87E-08 1.57E-06 protein_coding ENSMUSG00000097448 1 136696211 136726142 ve Platr22 -1.119538026 0.000669296 0.008227792 lincRNA ENSMUSG00000084346 4 115452604 115471062 ve Cyp4a30b -1.116747714 0.010612828 NA protein_coding ENSMUSG00000040616 4 142030992 142084304 -ve Tmem51 -1.115631756 5.57E-06 0.000142318 protein_coding ENSMUSG00000005362 6 106780201 106800077 -ve Crbn -1.114562522 1.75E-06 5.12E-05 protein_coding ENSMUSG00000004508 7 97081586 97308946 ve Gab2 -1.114050837 0.000865562 0.010049904 protein_coding ENSMUSG00000020354 11 46896253 47988969 -ve Sgcd -1.112278844 0.019324691 0.104717221 protein_coding ENSMUSG00000031216 X 99003248 99074728 ve Stard8 -1.111586311 0.006763839 0.048846253 protein_coding ENSMUSG00000099373 9 105470520 105480194 ve Gm19667 -1.111475176 0.024497849 0.123385743 antisense ENSMUSG00000034818 10 81459227 81482709 -ve Celf5 -1.111146549 0.001818809 0.018152729 protein_coding ENSMUSG00000062054 12 21316392 21323605 ve Iah1 -1.110905208 0.000367356 0.005066945 protein_coding ENSMUSG00000023951 17 46016993 46032377 -ve Vegfa -1.109174072 3.71E-06 9.96E-05 protein_coding ENSMUSG00000035637 4 44981395 44990734 ve Grhpr -1.108339439 2.24E-05 0.000468258 protein_coding ENSMUSG00000073728 4 142083972 142088099 ve Tmem51os1 -1.10805631 0.018954618 0.103509219 antisense ENSMUSG00000032577 9 107254927 107289877 -ve Mapkapk3 -1.106262381 8.24E-05 0.00144156 protein_coding ENSMUSG00000104043 3 84174104 84175132 ve Gm6525 -1.105846533 0.001957753 0.019296112 protein_coding ENSMUSG00000033060 14 101729957 101934710 ve Lmo7 -1.104851606 0.002436502 0.022909151 protein_coding ENSMUSG00000095651 8 92336668 92339250 -ve Gm21817 -1.10319106 0.011120875 0.070673643 lincRNA ENSMUSG00000016624 15 84785381 84856049 -ve Phf21b -1.102046781 4.91E-05 0.000920133 protein_coding ENSMUSG00000003051 1 135253575 135258568 -ve Elf3 -1.101514241 4.43E-05 0.000843879 protein_coding ENSMUSG00000078202 2 25180758 25183339 ve Nrarp -1.101200247 0.002307464 0.021945755 protein_coding ENSMUSG00000048000 1 87326998 87450796 ve Gigyf2 -1.101024345 1.61E-13 1.59E-11 protein_coding ENSMUSG00000024601 18 58659482 58679570 ve Isoc1 -1.100215633 8.76E-10 4.81E-08 protein_coding ENSMUSG00000041696 9 65398488 65414853 ve Rasl12 -1.09925243 0.026649877 0.13082479 protein_coding ENSMUSG00000052566 8 84990595 85003364 ve Hook2 -1.098824734 3.43E-05 0.000684321 protein_coding ENSMUSG00000037813 2 158182533 158229222 -ve D630003M21Rik -1.098113766 0.015310189 0.089116282 protein_coding ENSMUSG00000082465 9 53689534 53690283 -ve Rps6-ps3 -1.09429204 0.019115199 0.104057029 processed_pseudogene ENSMUSG00000052563 11 51650954 51657681 ve D930048N14Rik -1.093931587 4.45E-05 0.000846971 protein_coding ENSMUSG00000003746 10 53904788 54075796 -ve Man1a -1.093239916 0.00186656 0.018502907 protein_coding ENSMUSG00000001095 11 78397087 78422217 -ve Slc13a2 -1.092883477 0.02457621 0.123594657 protein_coding ENSMUSG00000043484 5 69461152 69461743 ve Gm5867 -1.092563254 0.024791155 0.124368306 processed_pseudogene ENSMUSG00000020234 10 81363067 81365816 -ve 4930404N11Rik -1.091934561 0.002512982 0.023454088 protein_coding ENSMUSG00000082305 5 32720330 32736194 ve Gm2420 -1.091235163 0.00687825 0.049409459ribed_unprocessed_pseudogene ENSMUSG00000096549 17 47688517 47694736 -ve Prickle4 -1.090619842 0.028478218 0.137071423 protein_coding ENSMUSG00000044364 2 151702008 151712157 ve Tmem74b -1.090595265 0.028770379 0.137710635 protein_coding ENSMUSG00000030510 7 66743504 66823691 ve Cers3 -1.09033943 0.026952235 0.131730261 protein_coding ENSMUSG00000040146 9 21971527 21989453 -ve Rgl3 -1.089540746 0.000215688 0.00325382 protein_coding ENSMUSG00000002486 5 114707760 114722327 ve Tchp -1.088948039 8.25E-06 0.000198935 protein_coding ENSMUSG00000042451 1 134193448 134201232 ve Mybph -1.087512854 0.021220937 0.111647995 protein_coding ENSMUSG00000097439 9 21225371 21233046 ve Gm16754 -1.08672108 7.51E-06 0.000183613 processed_transcript ENSMUSG00000020541 11 90643465 90688366 -ve Tom1l1 -1.086716327 1.60E-06 4.72E-05 protein_coding ENSMUSG00000031586 8 33782643 33929863 -ve Rbpms -1.086237184 0.000264392 0.003856828 protein_coding ENSMUSG00000064202 19 28893042 28967800 -ve 4430402I18Rik -1.085988437 0.025066763 0.125287639 protein_coding ENSMUSG00000052912 4 145464204 145467420 ve Smarca5-ps -1.08574497 0.007041561 0.050297245 scribed_processed_pseudogene ENSMUSG00000038550 3 95878503 95882251 -ve Ciart -1.084616714 0.005071713 0.039417503 protein_coding ENSMUSG00000078965 11 20335012 20336013 -ve Gm12033 -1.084445607 0.005187547 0.039970416 processed_pseudogene ENSMUSG00000002204 7 44572380 44586862 ve Napsa -1.084297288 0.024953061 0.124916576 protein_coding ENSMUSG00000071335 10 39946907 39960153 -ve G630090E17Rik -1.08375031 0.005574728 0.042217231 protein_coding ENSMUSG00000100280 1 34468834 34473148 -ve Gm28417 -1.083572122 0.029777578 0.14107397 processed_transcript ENSMUSG00000087141 16 45959263 46010218 -ve Plcxd2 -1.082449919 2.93E-09 1.49E-07 protein_coding ENSMUSG00000020098 10 61089343 61094328 ve Pcbd1 -1.080539933 7.27E-07 2.26E-05 protein_coding ENSMUSG00000084984 7 113530489 113564987 -ve Far1os -1.077728565 0.00587969 0.043921328 antisense ENSMUSG00000008489 4 91250763 91400785 -ve Elavl2 -1.077563202 0.013497671 0.080915162 protein_coding ENSMUSG00000015222 1 66175273 66442583 ve Map2 -1.077163035 0.029762614 0.141038254 protein_coding ENSMUSG00000039714 9 57600019 57606281 -ve Cplx3 -1.07644734 0.02329206 0.118889033 protein_coding ENSMUSG00000040663 19 4214238 4223490 ve Clcf1 -1.074575081 1.07E-08 4.89E-07 protein_coding ENSMUSG00000032625 6 12311610 12749410 -ve Thsd7a -1.074549688 0.027927289 0.135036405 protein_coding ENSMUSG00000027702 3 30624267 30647869 -ve Lrrc34 -1.072656741 0.031439226 0.14635422 protein_coding ENSMUSG00000073062 X 94724569 94730187 ve Zxdb -1.070935697 0.00346781 0.029658135 protein_coding

22 ENSMUSG00000042359 2 76406508 76600647 ve Osbpl6 -1.070243092 0.027477735 0.133440202 protein_coding ENSMUSG00000053783 11 75999912 76003569 ve 1700016K19Rik -1.069484725 0.024558248 0.123591626 protein_coding ENSMUSG00000021754 13 111746428 111808993 -ve Map3k1 -1.068975371 9.29E-07 2.85E-05 protein_coding ENSMUSG00000020473 11 5861947 5872088 ve Aebp1 -1.06653682 0.032410278 0.149383832 protein_coding ENSMUSG00000042680 18 21127201 21300138 -ve Garem -1.065352759 0.000286262 0.004121176 protein_coding ENSMUSG00000047854 16 62814676 62824346 ve Stx19 -1.064903786 0.022259337 0.115133875 protein_coding ENSMUSG00000080811 X 11684002 11684124 -ve Gm14513 -1.06405699 0.031792352 0.147276133 processed_pseudogene ENSMUSG00000034127 10 115817284 115849893 ve Tspan8 -1.063254425 0.032161045 0.148657759 protein_coding ENSMUSG00000029644 5 147269959 147275848 ve Pdx1 -1.063170334 0.030913443 0.144664763 protein_coding ENSMUSG00000028555 4 109406623 109444745 ve Ttc39a -1.062806147 0.000401144 0.005449881 protein_coding ENSMUSG00000107412 6 81984321 81992413 ve Gm20383 -1.059905184 0.032541833 0.149761822 lincRNA ENSMUSG00000087412 7 93178983 93184176 -ve Gm15501 -1.059111767 0.00432832 0.034892948 scribed_processed_pseudogene ENSMUSG00000030688 7 101317086 101346626 ve Stard10 -1.058540113 6.47E-07 2.05E-05 protein_coding ENSMUSG00000061411 2 153407462 153529971 -ve Nol4l -1.058301892 2.25E-07 7.85E-06 protein_coding ENSMUSG00000022383 15 85734983 85802819 ve Ppara -1.055457741 0.012599755 0.077245692 protein_coding ENSMUSG00000031075 7 144588549 144751974 -ve Ano1 -1.055430364 0.009688617 0.063872235 protein_coding ENSMUSG00000039585 9 59750896 59928866 ve Myo9a -1.05435363 1.52E-10 9.73E-09 protein_coding ENSMUSG00000024306 18 21810897 22171396 -ve Ccdc178 -1.050068139 0.005930675 0.044207737 protein_coding ENSMUSG00000019996 10 20148471 20281589 ve Map7 -1.049254041 0.034150035 0.154910822 protein_coding ENSMUSG00000029640 5 146734809 146795006 -ve Usp12 -1.048851057 4.23E-05 0.000815179 protein_coding ENSMUSG00000029419 2 25575416 25581757 -ve Gm996 -1.0475905 0.031395841 0.146233214 protein_coding ENSMUSG00000030030 6 83156404 83162945 ve 1700003E16Rik -1.047118052 0.001691332 0.017132515 protein_coding ENSMUSG00000025938 1 12866549 12992650 -ve Slco5a1 -1.046921556 0.016426338 0.093604991 protein_coding ENSMUSG00000031770 8 94386438 94395377 ve Herpud1 -1.044747389 1.16E-08 5.24E-07 protein_coding ENSMUSG00000000531 15 101224207 101232755 ve Grasp -1.044055932 0.00119701 0.012976493 protein_coding ENSMUSG00000026166 1 83116766 83119167 ve Ccl20 -1.043957768 0.013277862 0.079881673 protein_coding ENSMUSG00000028545 4 111415006 111460298 ve Bend5 -1.04345535 0.034273702 0.155249325 protein_coding ENSMUSG00000020083 10 62107655 62143920 -ve 2010107G23Rik -1.04272536 0.001096312 0.012120057 protein_coding ENSMUSG00000022253 15 9071260 9110487 ve Nadk2 -1.042381969 0.001456693 0.015151684 protein_coding ENSMUSG00000066771 9 35281518 35281835 -ve Gm5614 -1.041790055 0.036692656 0.161681028 processed_pseudogene ENSMUSG00000022211 14 55491093 55508246 ve Lrrc16b -1.037453488 0.004360757 0.035124621 protein_coding ENSMUSG00000041559 1 134037254 134048277 ve Fmod -1.036642776 0.032025457 0.148121424 protein_coding ENSMUSG00000000157 16 96422288 96443619 -ve Itgb2l -1.036576632 0.036522422 0.161356211 protein_coding ENSMUSG00000037600 4 133518963 133530790 ve Kdf1 -1.036312167 0.025520221 0.127029641 protein_coding ENSMUSG00000035112 11 101260567 101277409 ve Wnk4 -1.035590918 0.000490463 0.006380485 protein_coding ENSMUSG00000000440 6 115360951 115490399 ve Pparg -1.035548434 0.021682498 0.113354168 protein_coding ENSMUSG00000028943 4 152120331 152152371 -ve Espn -1.034582355 0.027244834 0.132784482 protein_coding ENSMUSG00000021338 13 24012344 24280795 -ve Lrrc16a -1.033758211 0.00289441 0.025921071 protein_coding ENSMUSG00000055137 13 16857855 17694732 -ve Sugct -1.033506934 0.000618844 0.007714523 protein_coding ENSMUSG00000070880 2 70553072 70602014 ve Gad1 -1.033140863 0.022651113 0.116588776 protein_coding ENSMUSG00000043165 3 92080271 92083142 -ve Lor -1.032765872 0.013637643 0.08157678 protein_coding ENSMUSG00000073007 X 107792590 107872909 ve Fam46d -1.031411097 0.031412573 NA protein_coding ENSMUSG00000105943 3 38223451 38223793 ve Gm2965 -1.031265093 0.015792325 0.091085218 processed_pseudogene ENSMUSG00000081151 2 161287220 161287669 ve Gm11448 -1.029971647 0.033778488 0.153813193 processed_pseudogene ENSMUSG00000032688 18 65430963 65478823 ve Malt1 -1.029784519 7.23E-06 0.000177495 protein_coding ENSMUSG00000039697 10 30645584 30803107 -ve Ncoa7 -1.029306081 6.82E-11 4.61E-09 protein_coding ENSMUSG00000045104 19 21938079 21938384 ve Gm5514 -1.029302988 0.026908895 0.13158616 processed_pseudogene ENSMUSG00000052698 9 67217087 67559703 -ve Tln2 -1.026658574 9.40E-05 0.001616153 protein_coding ENSMUSG00000084148 4 38263918 38264461 ve Gm12380 -1.026582328 0.032620712 0.150015784 processed_pseudogene ENSMUSG00000034391 18 84935158 84981376 ve Fbxo15 -1.025763432 0.006987466 0.050004875 protein_coding ENSMUSG00000028865 4 133212131 133224555 ve Cd164l2 -1.025229929 0.032610364 0.150004517 protein_coding ENSMUSG00000072568 15 60818994 60853778 -ve Fam84b -1.025223693 0.019750074 0.106174117 protein_coding ENSMUSG00000022353 15 58941244 59082026 -ve Mtss1 -1.024205573 0.001220159 0.013167313 protein_coding ENSMUSG00000097304 3 37734730 37735104 ve Rpl31-ps15 -1.023862083 0.035563378 0.158625203 processed_pseudogene ENSMUSG00000040471 11 72435526 72438400 ve Ggt6 -1.023809166 0.014858544 0.08707937 protein_coding ENSMUSG00000020911 11 100140810 100148665 -ve Krt19 -1.023516936 0.011598165 0.072629064 protein_coding ENSMUSG00000051980 16 36493696 36562141 -ve Casr -1.022830599 0.026620143 0.13074641 protein_coding ENSMUSG00000087518 2 62357071 62470913 ve Gm13561 -1.021504637 0.037638741 0.164376318 antisense ENSMUSG00000020904 11 67924806 67965651 -ve Cfap52 -1.021425372 0.013347367 0.080198212 protein_coding ENSMUSG00000040794 2 90885860 90890525 ve C1qtnf4 -1.021359517 0.032412508 0.149383832 protein_coding ENSMUSG00000079262 6 142085761 142208521 -ve Slco1a6 -1.020637127 0.032836102 0.150860203 protein_coding ENSMUSG00000063568 6 52768797 53068631 -ve Jazf1 -1.020369973 0.009823443 0.064447896 protein_coding ENSMUSG00000040502 10 127055011 127060184 -ve 'March9 -1.019802957 5.40E-07 1.74E-05 protein_coding ENSMUSG00000032788 10 78436744 78464975 -ve Pdxk -1.019312939 0.000307208 0.004373915 protein_coding ENSMUSG00000040943 3 133463679 133545139 -ve Tet2 -1.01909122 0.000411045 0.005546771 protein_coding ENSMUSG00000067235 17 35470089 35474563 ve H2-Q10 -1.01848763 0.040637843 0.173368048 protein_coding ENSMUSG00000102559 1 66765626 66768731 -ve Gm37570 -1.018377935 0.002831138 0.025472193 TEC ENSMUSG00000005251 16 97741933 97763737 -ve Ripk4 -1.017163214 0.041446668 0.175675489 protein_coding ENSMUSG00000069378 18 53464546 53575907 ve Prdm6 -1.017015713 0.031745076 0.147175746 protein_coding ENSMUSG00000031788 8 95099832 95142540 -ve Kifc3 -1.016791838 0.000490471 0.006380485 protein_coding ENSMUSG00000005125 15 66929321 66969640 -ve Ndrg1 -1.015900296 0.002076246 0.020300885 protein_coding ENSMUSG00000087264 2 70489940 70563357 -ve Gad1os -1.013896426 0.014224689 0.08406021 antisense ENSMUSG00000022237 15 31291479 31367759 -ve Ankrd33b -1.013574565 0.01974538 0.106174117 protein_coding ENSMUSG00000024535 18 53245662 53390823 ve Snx24 -1.012357989 0.000411196 0.005546771 protein_coding ENSMUSG00000103789 13 38150477 38151792 -ve Gm10129 -1.009852124 0.039251901 0.169416579 TEC ENSMUSG00000035456 5 98180978 98188991 ve Prdm8 -1.009293934 0.040421501 0.172677816 protein_coding ENSMUSG00000081895 7 72648757 72649311 -ve Rpl17-ps10 -1.00859312 6.47E-05 0.001173343 processed_pseudogene ENSMUSG00000035916 10 107517049 107720051 -ve Ptprq -1.00823936 0.042992152 0.179562343 protein_coding ENSMUSG00000049588 11 55049731 55078131 -ve Ccdc69 -1.007945442 0.022731635 0.11684491 protein_coding ENSMUSG00000025019 19 41482645 41562246 ve Lcor -1.007861916 1.94E-09 1.02E-07 protein_coding ENSMUSG00000032715 2 152337422 152344032 -ve Trib3 -1.007559389 0.019351974 0.104804983 protein_coding ENSMUSG00000058446 6 54816916 54893500 ve Znrf2 -1.006849013 1.64E-07 5.93E-06 protein_coding ENSMUSG00000021749 14 8348948 8378763 -ve Oit1 -1.006493524 0.039631029 0.170451116 protein_coding ENSMUSG00000040289 3 8663359 8667256 -ve Hey1 -1.006388904 0.012689949 0.077573287 protein_coding

23 ENSMUSG00000080727 3 95871522 95889093 ve C920021L13Rik -1.006047791 0.017188807 0.096788324 antisense ENSMUSG00000038415 13 31558324 31560976 ve Foxq1 -1.005889579 0.016566734 0.094207179 protein_coding ENSMUSG00000044005 10 128194457 128210004 ve Gls2 -1.003973308 0.005101393 0.039555332 protein_coding ENSMUSG00000075595 11 95712673 95835115 ve Zfp652 -1.000545391 3.20E-09 1.61E-07 protein_coding ENSMUSG00000034854 10 81357491 81366225 ve Mfsd12 -1.000244382 1.76E-06 5.12E-05 protein_coding ENSMUSG00000022438 15 84232043 84315688 ve Parvb 1.000021204 0.001056418 0.011754271 protein_coding ENSMUSG00000025779 1 16688051 16709611 ve Ly96 1.000216922 0.01016584 0.066077963 protein_coding ENSMUSG00000105044 5 109833501 109834145 -ve Gm10416 1.000778338 0.037063993 0.162726864 TEC ENSMUSG00000022246 15 10568979 10714631 -ve Rai14 1.001210769 0.000655042 0.008089214 protein_coding ENSMUSG00000025555 14 121035200 121283744 ve Farp1 1.001802143 2.05E-07 7.21E-06 protein_coding ENSMUSG00000042988 11 120653788 120661175 -ve Notum 1.00190666 0.037440266 0.163822459 protein_coding ENSMUSG00000095280 14 19415857 19418930 -ve Gm21738 1.00255282 0.042248659 0.177489224 protein_coding ENSMUSG00000104571 3 126625880 126628757 ve Gm43010 1.002625041 0.031013352 NA TEC ENSMUSG00000061272 2 156410897 156411174 -ve Gm14173 1.002845931 0.034546235 0.155851933 processed_pseudogene ENSMUSG00000023236 2 113776362 113829121 -ve Scg5 1.003439955 0.038131269 0.165974591 protein_coding ENSMUSG00000031775 8 94674895 94696242 -ve Pllp 1.004155111 0.039770792 0.170858777 protein_coding ENSMUSG00000104943 3 100497429 100500125 ve Gm42868 1.004213268 0.029379406 0.139605468 sense_intronic ENSMUSG00000090558 5 107404823 107431910 -ve Gm17202 1.004325309 0.012390612 NA antisense ENSMUSG00000030653 7 101421691 101512829 ve Pde2a 1.004440524 0.039101946 0.169058425 protein_coding ENSMUSG00000085782 6 83166152 83172755 -ve Gm15624 1.004939335 0.039232618 0.169416579 antisense ENSMUSG00000020963 12 91400994 91540509 ve Tshr 1.004968493 0.016401095 NA protein_coding ENSMUSG00000037568 1 190947646 190979296 -ve Vash2 1.005318767 3.83E-05 0.000751601 protein_coding ENSMUSG00000086417 4 116824903 116830603 ve Gm12996 1.006349626 0.043440548 0.180802241 antisense ENSMUSG00000068417 14 50955992 50964749 ve Pnp2 1.006500827 0.007612417 0.053450144 protein_coding ENSMUSG00000030513 7 65861734 66050386 ve Pcsk6 1.006517557 0.014337409 NA protein_coding ENSMUSG00000036446 10 97565501 97572703 ve Lum 1.006659469 0.020589488 0.109478203 protein_coding ENSMUSG00000093677 15 58780461 58781951 -ve Gm20712 1.00766163 0.00855588 0.058369909 sense_overlapping ENSMUSG00000086196 2 60338188 60371234 ve Gm13571 1.007692028 0.029989978 0.141691455 antisense ENSMUSG00000096449 13 85126999 85127514 -ve Gm4076 1.008698092 0.039585989 0.170334548 protein_coding ENSMUSG00000027386 2 128862981 128897034 ve Fbln7 1.008698332 0.037524215 0.164027024 protein_coding ENSMUSG00000009731 X 7822289 7838280 ve Kcnd1 1.009278945 0.027224436 0.132736373 protein_coding ENSMUSG00000100215 1 55335401 55335796 ve Gm8292 1.00931052 0.005691023 0.042892701 processed_pseudogene ENSMUSG00000056031 9 85820241 85844323 -ve 9330154J02Rik 1.009335435 0.014002764 0.08313676 processed_transcript ENSMUSG00000101013 5 20950989 20956398 ve A630072M18Rik 1.009686945 0.040097091 0.17179428 antisense ENSMUSG00000008193 7 44525993 44532071 -ve Spib 1.01111152 0.038973 0.168725341 protein_coding ENSMUSG00000021245 12 85234529 85270591 -ve Mlh3 1.011126851 0.041881784 0.17673275 protein_coding ENSMUSG00000039563 5 36447611 36464853 -ve 2210406O10Rik 1.011163611 0.040247342 0.172243751 lincRNA ENSMUSG00000031209 X 96455359 96574485 ve Heph 1.011313729 0.024583733 0.123594657 protein_coding ENSMUSG00000107709 6 43467979 43474318 ve 9430018G01Rik 1.01145921 0.022884618 NA antisense ENSMUSG00000024334 17 34092340 34095234 ve H2-Oa 1.011535342 0.029157395 0.138793585 protein_coding ENSMUSG00000026452 1 134646677 134762593 ve Syt2 1.012848725 0.025083544 0.125338529 protein_coding ENSMUSG00000012889 8 84125989 84132527 ve Podnl1 1.013607559 0.039332604 0.169551554 protein_coding ENSMUSG00000011958 9 69989466 70008317 ve Bnip2 1.014608087 3.68E-07 1.23E-05 protein_coding ENSMUSG00000000253 13 45507444 45546382 ve Gmpr 1.015971666 0.003043345 0.026859778 protein_coding ENSMUSG00000094622 10 81745983 81747503 -ve Gm3055 1.016475644 0.013509047 0.08093922 protein_coding ENSMUSG00000102752 1 170298199 170306332 -ve Gm7694 1.016977172 0.020784234 0.110058163 protein_coding ENSMUSG00000103174 1 191267178 191288714 ve Gm37168 1.017370519 0.036948204 0.162519044 lincRNA ENSMUSG00000040613 6 122577792 122602444 -ve Apobec1 1.017374973 0.02873683 0.137684884 protein_coding ENSMUSG00000026175 1 74409376 74435559 ve Vil1 1.017927623 0.041153054 0.174832581 protein_coding ENSMUSG00000090173 11 62847069 62877465 ve Fbxw10 1.018011949 0.028748085 0.137684884 protein_coding ENSMUSG00000102319 1 44560885 44565447 ve Gm37626 1.018226227 0.017289438 NA TEC ENSMUSG00000037679 12 112588784 112615556 ve Inf2 1.018788238 1.51E-05 0.000336551 protein_coding ENSMUSG00000032281 9 54604877 54661870 -ve Acsbg1 1.019131598 0.038926347 0.168719329 protein_coding ENSMUSG00000029861 6 42315312 42324643 -ve Fam131b 1.01969531 0.026555525 0.1305979 protein_coding ENSMUSG00000015452 17 34597862 34600936 ve Ager 1.020421027 0.014981667 0.087633756 protein_coding ENSMUSG00000045350 15 99918348 99967075 -ve Fam186a 1.020713172 0.019757938 NA protein_coding ENSMUSG00000039431 8 40551095 40634797 -ve Mtmr7 1.020760497 0.000659665 0.008130444 protein_coding ENSMUSG00000051498 5 64952031 64960097 -ve Tlr6 1.021964857 0.038952398 0.168725341 protein_coding ENSMUSG00000020176 11 11930508 12038683 -ve Grb10 1.022544225 0.011569145 0.072543007 protein_coding ENSMUSG00000087017 2 122702047 122721456 ve 4930417H01Rik 1.022584984 0.027533088 0.133543127 processed_transcript ENSMUSG00000097377 2 73892996 73900850 ve Gm10822 1.022819154 0.039872368 0.1712177 lincRNA ENSMUSG00000064369 MT 14071 14139 -ve mt-Te 1.02335905 0.002988791 0.026506142 Mt_tRNA ENSMUSG00000051367 12 73040015 73053887 -ve Six1 1.023576554 0.000919247 0.010555781 protein_coding ENSMUSG00000024900 19 3323301 3385732 ve Cpt1a 1.023845659 4.82E-05 0.000907865 protein_coding ENSMUSG00000102692 3 83127948 83357209 ve Dchs2 1.02416213 0.038292878 0.166510453 protein_coding ENSMUSG00000022297 15 39006280 39038186 ve Fzd6 1.024163555 0.000319204 0.004517622 protein_coding ENSMUSG00000024063 17 72918305 72941942 ve Lbh 1.024606715 0.000547856 0.007021208 protein_coding ENSMUSG00000024043 17 67842713 68004120 -ve Arhgap28 1.026121028 5.74E-08 2.26E-06 protein_coding ENSMUSG00000034881 10 81328732 81335171 ve Tbxa2r 1.026361765 0.039485795 0.170057531 protein_coding ENSMUSG00000021010 12 53248677 54072175 ve Npas3 1.027294143 0.031747435 0.147175746 protein_coding ENSMUSG00000035711 13 55523235 55528538 -ve Dok3 1.02758723 0.015587296 0.090341625 protein_coding ENSMUSG00000015850 3 95676201 95687917 -ve Adamtsl4 1.028250248 4.57E-11 3.18E-09 protein_coding ENSMUSG00000021806 14 19751257 19811787 ve Nid2 1.029587285 0.017383774 0.097481552 protein_coding ENSMUSG00000097183 3 145650312 145677580 ve Gm17501 1.030644 0.003839891 0.032029447 lincRNA ENSMUSG00000041779 1 20996299 21079229 -ve Tram2 1.032053563 0.001720889 0.017357855 protein_coding ENSMUSG00000024987 19 37697808 37701528 ve Cyp26a1 1.032703809 0.036571493 0.161425119 protein_coding ENSMUSG00000003849 8 107388225 107403206 -ve Nqo1 1.032742703 0.037135095 0.162963694 protein_coding ENSMUSG00000025743 4 130792537 130826319 ve Sdc3 1.033521759 0.001564374 0.016069311 protein_coding ENSMUSG00000034911 8 71384274 71395801 -ve Ushbp1 1.033534146 0.028467696 0.137056261 protein_coding ENSMUSG00000028475 4 43730034 43734534 ve 5430416O09Rik 1.033608661 0.037812917 0.164955189 lincRNA ENSMUSG00000022208 14 55106830 55116935 -ve Jph4 1.033772042 0.0370568 0.162726864 protein_coding ENSMUSG00000027977 3 123526166 123690853 -ve Ndst3 1.034647517 0.018459443 0.101655826 protein_coding ENSMUSG00000024598 18 58008623 58209926 -ve Fbn2 1.035188081 0.011169243 0.070783261 protein_coding ENSMUSG00000090386 16 77236317 77691403 ve Mir99ahg 1.035598377 0.002271941 0.021662132 processed_transcript

24 ENSMUSG00000091968 17 32788394 32789591 ve Gm17115 1.036557487 0.033062436 0.151578579 antisense ENSMUSG00000097129 10 62449489 62451322 ve 4930507D05Rik 1.037330066 0.023219802 0.118636294 protein_coding ENSMUSG00000019326 11 101330605 101341938 ve Aoc3 1.03795618 0.028234079 0.136138581 protein_coding ENSMUSG00000106269 5 23387109 23388601 ve 4930580E04Rik 1.038105156 0.031269373 0.14586746 lincRNA ENSMUSG00000003153 6 122727809 122801640 -ve Slc2a3 1.038722083 0.016152444 0.092504415 protein_coding ENSMUSG00000030672 7 127208890 127214298 ve Mylpf 1.039439307 0.000475054 0.006205437 protein_coding ENSMUSG00000056569 1 171150711 171161130 ve Mpz 1.042806605 0.022375654 0.115546708 protein_coding ENSMUSG00000038679 15 50654752 50890463 -ve Trps1 1.043383839 4.94E-08 1.98E-06 protein_coding ENSMUSG00000054342 7 24370263 24386690 ve Kcnn4 1.043886825 0.027208918 0.132736373 protein_coding ENSMUSG00000078134 11 98624351 98625661 -ve Gm12355 1.044055337 0.01822516 0.100654396 protein_coding ENSMUSG00000047810 19 6844623 6858211 -ve Ccdc88b 1.044093518 0.0180767 0.099979837 protein_coding ENSMUSG00000039903 16 90826719 90905109 ve Eva1c 1.045090707 0.036093113 0.159943184 protein_coding ENSMUSG00000090958 7 98489283 98502181 ve Lrrc32 1.046208564 0.025753264 0.127873549 protein_coding ENSMUSG00000027985 3 131110471 131224356 ve Lef1 1.046339444 0.025363802 0.126464254 protein_coding ENSMUSG00000001025 3 90612882 90624181 ve S100a6 1.047099101 5.57E-06 0.000142318 protein_coding ENSMUSG00000075602 15 74994877 74998031 -ve Ly6a 1.047119178 0.006184199 0.045783885 protein_coding ENSMUSG00000025352 10 128882295 128891718 -ve Gdf11 1.047971002 0.000766162 0.0091751 protein_coding ENSMUSG00000105837 3 129527467 129532388 -ve Gm35986 1.048926058 0.028757749 0.137684884 antisense ENSMUSG00000085201 2 38823257 38852370 ve Nr6a1os 1.049003142 0.018831217 0.103150666 antisense ENSMUSG00000107879 6 128169704 128183803 -ve 9330102E08Rik 1.049039578 0.009481295 0.062946955 lincRNA ENSMUSG00000061488 10 61309830 61310276 ve Rpl27a-ps1 1.049187755 0.035274163 0.157861023 processed_pseudogene ENSMUSG00000024053 17 71252176 71310965 -ve Emilin2 1.049851686 0.028952373 0.138337715 protein_coding ENSMUSG00000089808 1 132284453 132284809 ve Gm7241 1.050105693 0.022323642 0.115403629 processed_pseudogene ENSMUSG00000107271 5 149367636 149393596 ve BC028471 1.050346972 0.0315389 0.146602627 lincRNA ENSMUSG00000097418 16 84703167 84715245 ve Mir155hg 1.050839947 0.022187199 0.114917226 lincRNA ENSMUSG00000079681 9 21062393 21067093 -ve Zglp1 1.051464294 0.024034448 0.121438218 protein_coding ENSMUSG00000046240 9 37367368 37386572 ve Hepacam 1.052178514 0.034012943 0.154510364 protein_coding ENSMUSG00000048120 19 40612366 40741602 ve Entpd1 1.052303119 0.028224157 0.136125297 protein_coding ENSMUSG00000090399 1 135606447 135688105 -ve Gm38399 1.052910202 0.002495732 0.023330009 lincRNA ENSMUSG00000049916 16 17113399 17125140 -ve 2610318N02Rik 1.053720586 0.028620502 0.137339364 protein_coding ENSMUSG00000097467 9 44112923 44121947 ve Gm26737 1.05381331 0.034414499 0.155512414 lincRNA ENSMUSG00000083518 X 8034212 8035079 ve Gm9429 1.054474315 0.025916008 0.128450612 processed_pseudogene ENSMUSG00000050762 17 24038144 24045954 ve Prss27 1.054512864 0.025925554 0.128464398 protein_coding ENSMUSG00000108678 7 73404350 73406417 ve 1.055392558 0.034175681 0.154953142 TEC ENSMUSG00000029860 6 42349630 42360213 ve Zyx 1.056369362 7.45E-06 0.000182419 protein_coding ENSMUSG00000043501 15 78850862 78855529 -ve Lgals2 1.057084796 0.023696718 0.12037223 protein_coding ENSMUSG00000082196 2 156789812 156790403 -ve Gm14231 1.058044596 0.009863981 NA processed_pseudogene ENSMUSG00000102562 16 77685277 77687409 ve Gm37694 1.058060897 0.011376768 0.071691756 TEC ENSMUSG00000014846 8 105467493 105471526 -ve Tppp3 1.060723203 7.62E-06 0.000186058 protein_coding ENSMUSG00000032038 9 35046579 35116810 -ve St3gal4 1.061600532 6.95E-07 2.17E-05 protein_coding ENSMUSG00000091971 17 34969190 34972156 -ve Hspa1a 1.062046565 0.001211165 0.013086249 protein_coding ENSMUSG00000004891 3 87971078 87980451 ve Nes 1.064142069 9.28E-05 0.001599338 protein_coding ENSMUSG00000036040 2 27079379 27108981 ve Adamtsl2 1.06417457 0.012050897 NA protein_coding ENSMUSG00000028681 4 117096075 117116101 ve Ptch2 1.064544041 0.026309123 0.129764455 protein_coding ENSMUSG00000064365 MT 11613 11671 ve mt-Ts2 1.064758114 0.001785575 0.017862966 Mt_tRNA ENSMUSG00000060459 16 22985854 23029101 -ve Kng2 1.064911814 0.008816349 0.059675308 protein_coding ENSMUSG00000036036 17 37001163 37010635 ve Zfp57 1.065509317 0.002381788 0.022506121 protein_coding ENSMUSG00000040152 2 118111876 118127133 ve Thbs1 1.065613249 0.002108803 0.020508189 protein_coding ENSMUSG00000103735 3 12975359 12975701 ve Gm38317 1.065681227 0.004462313 0.035760634 processed_pseudogene ENSMUSG00000028012 3 129804408 129822587 -ve Rrh 1.065923874 0.031919857 0.147758677 protein_coding ENSMUSG00000045009 6 113493639 113501931 -ve Prrt3 1.066996797 0.008947404 0.060240356 protein_coding ENSMUSG00000022799 16 38598340 38713274 -ve Arhgap31 1.067399582 0.000596371 0.007486368 protein_coding ENSMUSG00000057060 8 126298558 126395482 ve Slc35f3 1.067665997 0.032198131 0.148700283 protein_coding ENSMUSG00000096971 15 10717144 10722471 ve 4930556M19Rik 1.068040066 0.001697938 0.017181104 lincRNA ENSMUSG00000054555 7 133883199 134232146 -ve Adam12 1.068054674 0.028884625 0.138118248 protein_coding ENSMUSG00000038677 17 28142316 28174852 ve Scube3 1.068093955 7.09E-07 2.21E-05 protein_coding ENSMUSG00000053007 6 53287270 53700376 ve Creb5 1.06816183 0.00490595 0.038535447 protein_coding ENSMUSG00000024304 18 16588877 16809246 -ve Cdh2 1.069026424 0.00017507 0.002745749 protein_coding ENSMUSG00000025330 4 140745865 140774236 -ve Padi4 1.070025227 0.029944251 0.141556998 protein_coding ENSMUSG00000037306 4 134561690 134704290 -ve Man1c1 1.071341853 0.002121848 0.02058236 protein_coding ENSMUSG00000061082 X 53069995 53240111 -ve Plac1 1.072818696 0.019790911 0.106243295 protein_coding ENSMUSG00000068220 15 78926725 78930465 ve Lgals1 1.073371429 1.67E-11 1.24E-09 protein_coding ENSMUSG00000031778 8 94772009 94782423 ve Cx3cl1 1.074180435 7.27E-05 0.001290331 protein_coding ENSMUSG00000033316 5 110544355 110621380 ve Galnt9 1.074188738 0.008700358 NA protein_coding ENSMUSG00000074785 10 94790866 94944578 -ve Plxnc1 1.074921248 0.016530925 NA protein_coding ENSMUSG00000045636 8 40990914 41133726 -ve Mtus1 1.07765435 0.00526158 0.040393367 protein_coding ENSMUSG00000032816 9 65101486 65137940 ve Igdcc4 1.079255945 0.029181283 0.138860921 protein_coding ENSMUSG00000100620 1 135409622 135414186 -ve Gm28277 1.080255559 0.029967672 0.141621299 sense_intronic ENSMUSG00000089877 1 44644279 44644698 ve Gm16102 1.08048196 0.023896278 0.120947223 processed_pseudogene ENSMUSG00000029919 6 65117293 65144908 -ve Hpgds 1.08075064 0.022012841 0.114388481 protein_coding ENSMUSG00000025934 1 21240589 21265661 ve Gsta3 1.080797585 0.008113183 0.056258248 protein_coding ENSMUSG00000057157 5 147408982 147409359 ve Gm6054 1.083119997 0.00503827 0.039282374 processed_pseudogene ENSMUSG00000040183 4 32804035 32950841 -ve Ankrd6 1.083407753 6.75E-05 0.001211795 protein_coding ENSMUSG00000063820 5 77004055 77010606 ve Arl9 1.084849923 0.017965109 NA protein_coding ENSMUSG00000099876 Y 1048393 1049134 ve Gm29650 1.085477049 0.000229954 0.003430892 lincRNA ENSMUSG00000041734 3 87078593 87174747 -ve Kirrel 1.085518676 3.14E-08 1.30E-06 protein_coding ENSMUSG00000006205 7 130936111 130985660 ve Htra1 1.086690689 0.003144543 0.027497376 protein_coding ENSMUSG00000021373 13 46501848 46649642 ve Cap2 1.087088959 0.008235163 0.056917925 protein_coding ENSMUSG00000103567 18 37694380 37841873 ve Pcdhga5 1.087103856 0.027668647 0.134024641 protein_coding ENSMUSG00000047945 4 129513581 129515985 ve Marcksl1 1.087869831 0.000244788 0.003609669 protein_coding ENSMUSG00000026932 2 26055535 26123220 -ve Nacc2 1.087891121 7.43E-05 0.00131442 protein_coding ENSMUSG00000091155 14 62663667 62692243 ve Serpine3 1.088404407 0.007856432 0.054778712 protein_coding ENSMUSG00000031026 7 109449006 109508134 -ve Trim66 1.088440258 0.017353573 0.097340934 protein_coding ENSMUSG00000054920 5 65107539 65168188 ve Klhl5 1.088547825 1.17E-11 8.88E-10 protein_coding

25 ENSMUSG00000084881 16 17092815 17096350 ve Gm15585 1.089731532 0.008931368 0.060208189 antisense ENSMUSG00000074676 2 152931898 152933208 -ve Foxs1 1.090043242 0.010767384 NA protein_coding ENSMUSG00000022218 14 55700009 55713492 -ve Tgm1 1.090450764 0.024212848 0.122112219 protein_coding ENSMUSG00000028076 3 86995834 86999441 -ve Cd1d1 1.090729848 0.00106827 0.011858356 protein_coding ENSMUSG00000002104 2 91035620 91045729 ve Rapsn 1.092555689 0.018583198 0.102186071 protein_coding ENSMUSG00000075271 2 75978247 75981967 -ve Ttc30a1 1.09356455 0.009716827 0.064014623 protein_coding ENSMUSG00000086416 2 125207529 125217512 -ve Gm14002 1.093687758 0.01734795 0.097338142 antisense ENSMUSG00000039899 5 21372642 21378374 ve Fgl2 1.094908109 0.01716884 0.09670456 protein_coding ENSMUSG00000034777 6 83711264 83738313 ve Vax2 1.095301555 0.022146057 0.114829393 protein_coding ENSMUSG00000027833 3 66971727 66981771 -ve Shox2 1.095302035 0.019204412 0.104243899 protein_coding ENSMUSG00000096937 10 22402883 22407470 ve Gm10825 1.096265564 0.023547582 0.119841534 lincRNA ENSMUSG00000036067 2 27021363 27027998 -ve Slc2a6 1.098542906 0.021662164 0.113279042 protein_coding ENSMUSG00000027239 2 91929805 91932297 -ve Mdk 1.099050152 0.021468595 0.112618261 protein_coding ENSMUSG00000020086 10 61738665 61784147 -ve H2afy2 1.099292275 1.91E-08 8.37E-07 protein_coding ENSMUSG00000038172 4 83220300 83324255 -ve Ttc39b 1.099775717 0.000387957 0.005304875 protein_coding ENSMUSG00000085596 2 167553314 167607845 ve Gm11476 1.100872533 0.021726128 0.113502947 processed_transcript ENSMUSG00000081056 2 119878069 119878403 -ve Gm13998 1.101455783 0.015183765 0.088570411 processed_pseudogene ENSMUSG00000026480 1 152800194 152836991 ve Ncf2 1.102533287 0.026922887 0.131620694 protein_coding ENSMUSG00000091530 17 3532554 3533213 ve Cldn20 1.103379517 0.008737128 0.059265809 protein_coding ENSMUSG00000022261 15 32920723 33034730 ve Sdc2 1.106132674 4.37E-06 0.000115476 protein_coding ENSMUSG00000029660 5 149439660 149470979 ve Tex26 1.107359134 0.003563734 0.030298116 protein_coding ENSMUSG00000004360 10 29211643 29230779 ve 9330159F19Rik 1.10806994 0.024116791 0.1217571 protein_coding ENSMUSG00000030717 7 126623249 126630861 -ve Nupr1 1.108674431 3.68E-06 9.90E-05 protein_coding ENSMUSG00000066607 9 58488603 58499742 ve 6030419C18Rik 1.10953688 0.003062871 0.026985714 protein_coding ENSMUSG00000075590 15 76085595 76090013 -ve Nrbp2 1.109747256 0.00069218 0.00842729 protein_coding ENSMUSG00000035385 11 82035571 82037453 ve Ccl2 1.110604373 0.002546043 0.023642711 protein_coding ENSMUSG00000026069 1 40429570 40465415 ve Il1rl1 1.111128605 0.024826569 0.124480206 protein_coding ENSMUSG00000013033 8 83900105 83941954 ve Adgrl1 1.111151228 0.003994547 0.032943309 protein_coding ENSMUSG00000074650 13 113039301 113042243 -ve Gm10735 1.111483362 0.023481515 0.119644226 protein_coding ENSMUSG00000043313 18 37496991 37504128 ve Pcdhb19 1.111953537 0.003141903 0.027486944 protein_coding ENSMUSG00000025780 2 10153571 10256529 ve Itih5 1.112104902 0.007136427 NA protein_coding ENSMUSG00000020000 10 24223517 24302790 ve Moxd1 1.113429772 0.02506047 0.125287639 protein_coding ENSMUSG00000034266 12 85686669 85709087 ve Batf 1.113478052 0.007310158 NA protein_coding ENSMUSG00000030276 6 113389260 113414587 ve Ttll3 1.114340553 6.37E-05 0.001159633 protein_coding ENSMUSG00000057098 11 44617317 45008091 ve Ebf1 1.115494289 0.010303036 0.066855333 protein_coding ENSMUSG00000085735 2 69885728 69888155 ve Mettl5os 1.116729433 0.010912976 0.069825267 antisense ENSMUSG00000027068 2 69380445 69404533 ve Dhrs9 1.116932822 0.004973871 0.038951198 protein_coding ENSMUSG00000057606 14 31523082 31591343 -ve Colq 1.118901821 0.01897338 0.103581893 protein_coding ENSMUSG00000031328 X 74223461 74249820 -ve Flna 1.11999747 1.40E-06 4.20E-05 protein_coding ENSMUSG00000024806 19 29697921 29708448 ve Mlana 1.120015226 0.022366498 0.115530838 protein_coding ENSMUSG00000019843 10 39368855 39565381 ve Fyn 1.120415878 3.49E-07 1.17E-05 protein_coding ENSMUSG00000062515 3 10204088 10208576 -ve Fabp4 1.120792105 0.006992234 NA protein_coding ENSMUSG00000058715 1 171229572 171234365 -ve Fcer1g 1.121780903 0.007705314 0.053923005 protein_coding ENSMUSG00000087519 2 120850705 120866689 ve AV039307 1.122433862 0.011154987 0.070783261 processed_transcript ENSMUSG00000039384 1 184013302 184075636 ve Dusp10 1.123016841 1.01E-07 3.86E-06 protein_coding ENSMUSG00000042759 7 126584942 126589112 ve Apobr 1.123576142 6.56E-08 2.56E-06 protein_coding ENSMUSG00000025815 2 5896115 5942792 -ve Dhtkd1 1.125136626 0.022093631 0.114651456 protein_coding ENSMUSG00000025921 1 16105774 16133734 ve Rdh10 1.125539947 0.023223806 0.118636294 protein_coding ENSMUSG00000028497 4 88396144 88438928 -ve Hacd4 1.125884124 0.001577908 0.016164622 protein_coding ENSMUSG00000051832 11 83582056 83623693 ve E230016K23Rik 1.12624201 0.017805127 0.098996713 processed_transcript ENSMUSG00000103527 3 51672801 51673901 ve Gm37261 1.126852444 0.021542577 0.112840089 TEC ENSMUSG00000028883 5 13125414 13602565 ve Sema3a 1.126923449 0.017617088 0.098441116 protein_coding ENSMUSG00000038523 2 154547085 154550003 ve 1700003F12Rik 1.127010428 0.01180374 0.07360093 protein_coding ENSMUSG00000031990 9 27097385 27155421 -ve Jam3 1.127612527 0.006751727 0.048814447 protein_coding ENSMUSG00000020604 11 109473374 109573330 ve Arsg 1.127729258 0.017616798 0.098441116 protein_coding ENSMUSG00000097261 1 185359461 185362865 -ve 4930532G15Rik 1.127738071 0.020146953 0.107794915 lincRNA ENSMUSG00000028860 4 133253090 133263113 -ve Sytl1 1.128166187 0.015431731 0.089686312 protein_coding ENSMUSG00000040187 6 146796055 146833529 ve Arntl2 1.129546821 6.67E-07 2.10E-05 protein_coding ENSMUSG00000028539 4 117926162 117929763 -ve Artn 1.129735135 0.009998342 0.065234802 protein_coding ENSMUSG00000024049 17 71019521 71126856 ve Myom1 1.130308294 0.004255003 0.034492221 protein_coding ENSMUSG00000039057 8 10153911 10634742 ve Myo16 1.130658128 0.022785269 0.116974838 protein_coding ENSMUSG00000038648 6 37327255 37442146 -ve Creb3l2 1.132366796 0.000946617 0.010791777 protein_coding ENSMUSG00000086070 4 7560688 7573801 ve 8430436N08Rik 1.132409459 0.006867367 NA lincRNA ENSMUSG00000026247 1 87147655 87156521 -ve Ecel1 1.132641264 0.019593196 0.105607028 protein_coding ENSMUSG00000069273 13 23561534 23562369 -ve Hist1h3e 1.132941053 0.022457336 0.115842525 protein_coding ENSMUSG00000000693 6 83034173 83052562 ve Loxl3 1.133520993 0.000673766 0.008272039 protein_coding ENSMUSG00000034706 11 114727408 114757889 ve Dnaic2 1.133823251 0.010050211 0.065505718 protein_coding ENSMUSG00000064361 MT 9808 9875 ve mt-Tr 1.135455819 0.001100171 0.012134338 Mt_tRNA ENSMUSG00000042834 18 33437019 33464029 -ve Nrep 1.136024447 0.003639441 0.030776452 protein_coding ENSMUSG00000074570 2 172393794 172433757 ve Cass4 1.136318917 0.013170536 0.079518988 protein_coding ENSMUSG00000097610 18 44661665 44676271 ve A930012L18Rik 1.136707281 0.021967672 0.114278825 antisense ENSMUSG00000020844 11 76257198 76399140 -ve Nxn 1.138151862 7.20E-06 0.000176976 protein_coding ENSMUSG00000032841 2 101714285 101883027 -ve Prr5l 1.140399135 0.002720737 0.024772275 protein_coding ENSMUSG00000050944 11 77089915 77188968 -ve Efcab5 1.140816953 0.00023658 0.00351318 protein_coding ENSMUSG00000095990 17 17121415 17146831 ve Zfp97 1.14128236 0.012826282 0.078169154 protein_coding ENSMUSG00000021994 14 28504750 28527447 ve Wnt5a 1.141848448 0.022076646 0.114594628 protein_coding ENSMUSG00000031875 8 104340594 104347672 ve Cmtm3 1.142426802 1.79E-07 6.40E-06 protein_coding ENSMUSG00000022219 14 55754045 55758458 -ve Cideb 1.143118025 0.012888598 0.078383969 protein_coding ENSMUSG00000073427 10 82378593 82381237 ve Gm4924 1.145424986 0.017594193 0.098371067 protein_coding ENSMUSG00000019055 4 147909753 147936767 -ve Plod1 1.146701487 6.88E-06 0.000170489 protein_coding ENSMUSG00000033209 5 110879803 111289780 ve Ttc28 1.147532832 6.26E-09 2.97E-07 protein_coding ENSMUSG00000021699 13 108449948 109953461 ve Pde4d 1.148325733 1.32E-05 0.000298324 protein_coding ENSMUSG00000049871 16 3945007 3976632 -ve Nlrc3 1.148730478 0.008732387 0.059254817 protein_coding ENSMUSG00000025272 X 150645304 150657583 -ve Tro 1.14875976 0.02044843 0.108880581 protein_coding

26 ENSMUSG00000023391 2 71543408 71546754 -ve Dlx2 1.149440728 0.005247013 0.040314123 protein_coding ENSMUSG00000022358 15 58175879 58214892 -ve Fbxo32 1.150713028 6.87E-06 0.000170489 protein_coding ENSMUSG00000007122 1 172209894 172219868 -ve Casq1 1.152344679 0.0208044 0.110096955 protein_coding ENSMUSG00000063130 13 3802893 3804318 -ve Calml3 1.152818359 0.008427039 NA protein_coding ENSMUSG00000090210 3 96645584 96664519 ve Itga10 1.153747212 0.000278798 0.004029836 protein_coding ENSMUSG00000021680 13 95431371 95444831 -ve Crhbp 1.153831846 0.00605987 NA protein_coding ENSMUSG00000086746 14 46387519 46389282 ve Gm15222 1.154022948 0.016634275 0.094506367 antisense ENSMUSG00000066755 1 161494655 161505290 ve Tnfsf18 1.154230614 0.017252902 0.096993975 protein_coding ENSMUSG00000085327 10 81409575 81411579 ve Gm16104 1.155143382 0.019490655 0.105235171 antisense ENSMUSG00000046598 16 31422280 31458901 ve Bdh1 1.155185106 0.010135553 0.065953178 protein_coding ENSMUSG00000027318 2 131050591 131063814 -ve Adam33 1.156247221 0.002320172 0.02204454 protein_coding ENSMUSG00000017697 2 163726584 163750239 -ve Ada 1.156450763 0.000588099 0.007402102 protein_coding ENSMUSG00000086498 4 99146914 99161642 -ve Gm12681 1.156674153 0.017048389 0.096239252 lincRNA ENSMUSG00000051373 2 32095528 32110820 ve Plpp7 1.156843656 0.013047123 0.079011576 protein_coding ENSMUSG00000034041 8 84701457 84704715 ve Lyl1 1.157610484 0.017797499 0.098996713 protein_coding ENSMUSG00000028926 5 4803391 5420312 -ve Cdk14 1.158217485 0.008501243 0.058164303 protein_coding ENSMUSG00000021913 14 32322019 32347820 ve Ogdhl 1.159579086 0.005971305 0.04442342 protein_coding ENSMUSG00000024793 4 152115934 152120119 ve Tnfrsf25 1.160179073 0.016217686 0.092725242 protein_coding ENSMUSG00000037852 8 64592558 64693040 -ve Cpe 1.160423671 4.76E-07 1.57E-05 protein_coding ENSMUSG00000069516 10 117277334 117282274 -ve Lyz2 1.16051845 0.013205677 0.079573422 protein_coding ENSMUSG00000085235 11 83817682 83849493 -ve Gm12576 1.16053045 2.64E-06 7.36E-05 lincRNA ENSMUSG00000069372 18 57468486 57478134 ve Ctxn3 1.161524206 0.015732635 0.090906583 protein_coding ENSMUSG00000069518 10 116956824 116972609 -ve Gm10271 1.161895759 0.016085331 0.092326182 protein_coding ENSMUSG00000018008 15 78597047 78622019 ve Cyth4 1.162042025 0.016218495 0.092725242 protein_coding ENSMUSG00000063087 18 5491503 5593505 -ve Gm10125 1.162631569 0.019108389 0.104049779 processed_transcript ENSMUSG00000058672 13 34074301 34078008 -ve Tubb2a 1.164065484 6.83E-08 2.65E-06 protein_coding ENSMUSG00000038530 1 169741477 169747642 -ve Rgs4 1.165844579 0.005500202 NA protein_coding ENSMUSG00000001334 4 129136999 129144593 ve Fndc5 1.165865661 0.019267314 0.104465916 protein_coding ENSMUSG00000034457 X 97333840 97377216 -ve Eda2r 1.165874548 0.013987778 0.083073757 protein_coding ENSMUSG00000050271 8 36094828 36147787 ve D8Ertd82e 1.166400027 1.96E-08 8.57E-07 protein_coding ENSMUSG00000023393 2 180725263 180742280 ve Slc17a9 1.166551709 0.0103993 0.067307725 protein_coding ENSMUSG00000028794 4 128755364 128769298 ve A3galt2 1.166646446 0.018273326 0.100891069 protein_coding ENSMUSG00000045008 10 43174704 43176562 ve 9030612E09Rik 1.166808433 0.005465527 NA protein_coding ENSMUSG00000019817 10 13060504 13131694 ve Plagl1 1.167310566 0.017722161 0.098795718 protein_coding ENSMUSG00000073771 4 117119219 117125725 -ve Btbd19 1.168052042 0.000127199 0.002089879 protein_coding ENSMUSG00000026728 2 13573927 13582826 ve Vim 1.168609262 2.68E-06 7.40E-05 protein_coding ENSMUSG00000052384 16 32142785 32165594 -ve Nrros 1.169022239 0.000237028 0.003517086 protein_coding ENSMUSG00000074793 2 131127280 131146321 ve Hspa12b 1.170423799 0.000206591 0.003152958 protein_coding ENSMUSG00000006204 7 131174402 131250945 ve 5430419D17Rik 1.170743531 0.00564476 NA protein_coding ENSMUSG00000076433 11 118332360 118342500 -ve BC100451 1.171895268 0.018075431 0.099979837 protein_coding ENSMUSG00000057969 9 107597674 107609229 -ve Sema3b 1.172425026 0.001166497 0.012696435 protein_coding ENSMUSG00000074280 9 57483913 57484585 ve Gm6166 1.173529443 1.46E-09 7.74E-08 pseudogene ENSMUSG00000070424 7 102096879 102102845 -ve Art5 1.176214116 0.00948519 0.062946955 protein_coding ENSMUSG00000037010 X 48025146 48034853 -ve Apln 1.176793031 6.11E-06 0.000154732 protein_coding ENSMUSG00000070871 1 64690455 64725644 ve Ccnyl1 1.176996121 3.27E-09 1.64E-07 protein_coding ENSMUSG00000028270 3 142620602 142638008 ve Gbp2 1.177691574 0.01687559 0.095562935 protein_coding ENSMUSG00000044041 11 100117327 100121566 -ve Krt13 1.178005085 0.00678649 0.048953973 protein_coding ENSMUSG00000064380 9 120129351 120129553 ve Gm26448 1.178235687 0.016552529 0.094199237 snoRNA ENSMUSG00000074782 13 91701665 91741872 -ve 4833422C13Rik 1.178525798 0.00213261 0.020665641 antisense ENSMUSG00000053395 7 3390683 3415648 ve Cacng8 1.178656083 0.008202634 0.056775737 protein_coding ENSMUSG00000062373 15 58782269 58823530 -ve Tmem65 1.178663864 1.35E-09 7.23E-08 protein_coding ENSMUSG00000075267 2 76648476 76658556 ve Dfnb59 1.178700439 0.017907932 0.099356769 protein_coding ENSMUSG00000026177 1 74375195 74386062 ve Slc11a1 1.180109505 0.009144915 NA protein_coding ENSMUSG00000046169 13 104287873 104494763 ve Adamts6 1.180352673 0.000107784 0.001814838 protein_coding ENSMUSG00000058743 7 45816461 45824756 -ve Kcnj14 1.180561865 0.000730165 0.008821892 protein_coding ENSMUSG00000053702 2 17343909 17731464 -ve Nebl 1.180595809 0.004288157 0.034686956 protein_coding ENSMUSG00000102748 18 37689828 37841873 ve Pcdhgb2 1.180715658 0.013309989 0.080014916 protein_coding ENSMUSG00000039745 7 49759115 49773975 ve Htatip2 1.180812313 0.008827556 0.05972988 protein_coding ENSMUSG00000063193 11 114922781 114934386 -ve Cd300lb 1.181993065 0.016674601 0.094650535 protein_coding ENSMUSG00000027224 2 122302191 122313730 -ve Duoxa1 1.182055502 0.011148668 0.070783261 protein_coding ENSMUSG00000020461 11 29547950 29578367 ve Clhc1 1.183796725 0.007651287 0.053623948 protein_coding ENSMUSG00000041731 19 24683016 24861855 -ve Pgm5 1.184549046 0.008207906 0.056777779 protein_coding ENSMUSG00000030306 6 148232430 148444389 -ve Tmtc1 1.185510485 0.005439051 0.041423366 protein_coding ENSMUSG00000102428 18 37765580 37841873 ve Pcdhga12 1.186483669 0.014493368 0.085382298 protein_coding ENSMUSG00000043795 7 142491074 142506771 -ve Prr33 1.187210935 0.00726266 0.051676001 protein_coding ENSMUSG00000020333 11 54303798 54364756 ve Acsl6 1.187627325 0.010072065 0.065625635 protein_coding ENSMUSG00000041423 3 88364584 88368541 ve Paqr6 1.187652378 0.017158749 0.09670456 protein_coding ENSMUSG00000029163 5 30913402 30921277 ve Emilin1 1.188571759 0.003919769 0.032495928 protein_coding ENSMUSG00000036053 2 52857860 53134202 ve Fmnl2 1.189310898 4.65E-09 2.28E-07 protein_coding ENSMUSG00000037362 15 54745702 54754039 ve Nov 1.189500275 0.016543941 0.094190371 protein_coding ENSMUSG00000030771 7 112368308 112413104 ve Micalcl 1.190100202 0.009716957 0.064014623 protein_coding ENSMUSG00000046196 17 80207460 80217936 ve Ttc39d 1.190125237 0.016357206 0.09329502 protein_coding ENSMUSG00000027408 2 130390775 130397574 -ve Cpxm1 1.192062965 0.001113864 0.012235759 protein_coding ENSMUSG00000055980 1 82233101 82291416 -ve Irs1 1.19216655 3.31E-05 0.000660994 protein_coding ENSMUSG00000029832 6 51432670 51458768 ve Nfe2l3 1.192736134 0.000947327 0.010793388 protein_coding ENSMUSG00000031273 X 141165403 141474076 -ve Col4a6 1.192975125 0.003415109 0.029323311 protein_coding ENSMUSG00000079654 6 29169232 29179584 -ve Prrt4 1.193483093 0.015931739 0.091722192 protein_coding ENSMUSG00000030643 7 92741603 92844535 ve Rab30 1.193666929 0.000241539 0.003572854 protein_coding ENSMUSG00000016763 15 83602583 83725021 -ve Scube1 1.193674136 0.00367438 0.030947895 protein_coding ENSMUSG00000024076 17 78508063 78627409 ve Vit 1.194328054 0.00388506 0.032278631 protein_coding ENSMUSG00000001131 X 20870166 20874735 ve Timp1 1.194438486 3.62E-08 1.48E-06 protein_coding ENSMUSG00000028226 4 17852893 18119145 ve Mmp16 1.194863473 0.002723164 0.024782493 protein_coding ENSMUSG00000024910 19 5465240 5468498 -ve Ctsw 1.195706152 0.004596325 0.036618285 protein_coding ENSMUSG00000028444 4 41657498 41697089 -ve Cntfr 1.195879258 0.008939774 0.060231687 protein_coding

27 ENSMUSG00000029231 5 75152292 75198215 ve Pdgfra 1.196126422 0.014025116 0.083233637 protein_coding ENSMUSG00000052848 5 111581422 111604932 ve C130026L21Rik 1.196309563 0.004724014 NA lincRNA ENSMUSG00000028789 4 128930233 128962442 -ve Azin2 1.197284048 1.51E-06 4.48E-05 protein_coding ENSMUSG00000055172 6 124512405 124523443 ve C1ra 1.197581261 2.02E-05 0.000426161 protein_coding ENSMUSG00000099662 6 90905819 90906453 ve Ppp1r2-ps2 1.198216438 0.001414276 0.014807802 processed_pseudogene ENSMUSG00000080966 13 74018793 74020134 -ve Gm6263 1.19911008 0.00094059 0.010751357 processed_pseudogene ENSMUSG00000015134 7 66390890 66427517 -ve Aldh1a3 1.199276544 0.012496536 0.076846633 protein_coding ENSMUSG00000032419 9 87702800 87731260 -ve Tbx18 1.199330862 0.011206938 0.070903858 protein_coding ENSMUSG00000078588 4 117866524 117872557 -ve Ccdc24 1.199911642 0.0127771 0.077930465 protein_coding ENSMUSG00000032036 9 34485894 35036716 ve Kirrel3 1.200495533 0.015694491 0.090769023 protein_coding ENSMUSG00000072572 14 51892889 51896745 ve Slc39a2 1.200847823 0.008040641 0.05583762 protein_coding ENSMUSG00000071604 19 23972751 24031019 -ve Fam189a2 1.200866047 0.004229839 0.034346874 protein_coding ENSMUSG00000037169 12 12936096 12941914 -ve Mycn 1.202754585 0.008095956 0.056160148 protein_coding ENSMUSG00000048078 7 96171246 96911093 ve Tenm4 1.204808065 0.01570343 0.090780537 protein_coding ENSMUSG00000042106 9 107984223 107985879 -ve Fam212a 1.205059252 0.00936586 0.06239417 protein_coding ENSMUSG00000054146 11 100131758 100135928 -ve Krt15 1.205148671 0.010316741 0.066917451 protein_coding ENSMUSG00000091997 16 32923218 32924489 ve Gm6611 1.206571165 0.011415127 0.071897854 processed_pseudogene ENSMUSG00000033545 8 111536097 111626030 ve Znrf1 1.207036909 7.97E-06 0.000193226 protein_coding ENSMUSG00000022817 16 33829665 33949153 ve Itgb5 1.207649338 0.000427525 0.005706239 protein_coding ENSMUSG00000008734 7 118972047 118995211 -ve Gprc5b 1.208372281 0.007301652 0.051823722 protein_coding ENSMUSG00000032186 9 75565621 75611325 -ve Tmod2 1.209285623 0.014027846 0.083233637 protein_coding ENSMUSG00000023903 17 23629458 23645269 -ve Mmp25 1.210392055 0.012191827 0.07520603 protein_coding ENSMUSG00000038119 9 35421128 35507652 ve Cdon 1.210721338 2.28E-07 7.92E-06 protein_coding ENSMUSG00000022037 14 65968483 65981548 ve Clu 1.210755709 1.16E-05 0.000268761 protein_coding ENSMUSG00000041358 2 112247948 112259291 -ve Nutm1 1.210976106 0.013191139 0.079561547 protein_coding ENSMUSG00000025930 1 14753346 14755992 -ve Msc 1.211219978 0.011070266 0.070461646 protein_coding ENSMUSG00000086050 11 117257649 117263437 -ve Gm16045 1.211905527 0.006789353 0.048956032 antisense ENSMUSG00000007279 7 109798676 109865679 -ve Scube2 1.212828716 0.007371943 NA protein_coding ENSMUSG00000082035 X 96484859 96485479 ve Rpl17-ps8 1.21292225 0.01257861 0.077190804 processed_pseudogene ENSMUSG00000020682 11 83440768 83463071 -ve Mmp28 1.21494853 0.00588069 0.043921328 protein_coding ENSMUSG00000022952 16 92601466 92826149 -ve Runx1 1.214984566 2.28E-11 1.66E-09 protein_coding ENSMUSG00000026829 2 28496891 28505415 ve Gbgt1 1.215884596 0.004460379 NA protein_coding ENSMUSG00000086095 18 16816407 16822783 ve Gm15328 1.217002327 0.009873732 0.064710763 lincRNA ENSMUSG00000067577 19 10740947 10786043 ve A430093F15Rik 1.218260028 0.01437623 0.084823777 processed_transcript ENSMUSG00000023495 9 106453291 106464012 ve Pcbp4 1.218502148 3.73E-11 2.62E-09 protein_coding ENSMUSG00000033022 18 46713205 46728342 -ve Cdo1 1.218889265 0.005111243 0.039607441 protein_coding ENSMUSG00000024664 19 10041548 10059671 ve Fads3 1.218970661 4.40E-08 1.78E-06 protein_coding ENSMUSG00000073535 1 155520173 155527143 -ve Gm5532 1.21899882 0.000445144 0.005881812 lincRNA ENSMUSG00000032366 9 67022590 67049406 -ve Tpm1 1.219939697 6.79E-06 0.000169247 protein_coding ENSMUSG00000097289 11 96712982 96747436 -ve 2010300F17Rik 1.220447727 0.006681652 0.048510942 lincRNA ENSMUSG00000032643 4 124700701 124708611 ve Fhl3 1.221054033 2.07E-12 1.73E-10 protein_coding ENSMUSG00000057329 1 106538178 106714274 -ve Bcl2 1.222389466 8.98E-05 0.001556064 protein_coding ENSMUSG00000038188 11 75513540 75526582 ve Scarf1 1.223460705 0.005203702 0.040046156 protein_coding ENSMUSG00000004837 11 61653265 61672784 ve Grap 1.224578003 0.01029637 0.066834912 protein_coding ENSMUSG00000053647 5 139423151 139427800 ve Gper1 1.2249661 0.002140727 0.020712595 protein_coding ENSMUSG00000030124 6 124904361 124911705 -ve Lag3 1.225882098 1.25E-05 0.0002842 protein_coding ENSMUSG00000032243 9 62677826 62783982 ve Itga11 1.226086741 0.013848188 0.082476835 protein_coding ENSMUSG00000060206 4 54945048 55083563 ve Zfp462 1.228174728 0.000100915 0.001722084 protein_coding ENSMUSG00000032363 9 90163069 90208071 ve Adamts7 1.22846314 0.000371732 0.005112454 protein_coding ENSMUSG00000020099 10 60762610 60831581 -ve Unc5b 1.230253179 0.010411569 0.067329566 protein_coding ENSMUSG00000038236 6 52214491 52221854 -ve Hoxa7 1.230925321 7.31E-05 0.001296346 protein_coding ENSMUSG00000032501 15 59648350 59656550 ve Trib1 1.230986723 0.001291615 0.013781825 protein_coding ENSMUSG00000019823 10 41476314 41487032 ve Mical1 1.232364054 0.000396832 0.005402887 protein_coding ENSMUSG00000104850 3 53038585 53041755 -ve Gm42901 1.232452232 0.011532298 0.072436655 antisense ENSMUSG00000027994 3 129914960 129970206 -ve Ccdc109b 1.232530535 0.000242472 0.003578302 protein_coding ENSMUSG00000031294 10 116964707 116969105 ve D630029K05Rik 1.234336402 0.009416289 0.062620299 lincRNA ENSMUSG00000037762 10 70245100 70285968 ve Slc16a9 1.234558478 0.012727514 0.077702883 protein_coding ENSMUSG00000022986 15 101563345 101573904 -ve Krt75 1.235924087 0.003219937 0.028040467 protein_coding ENSMUSG00000040364 7 45677689 45694404 -ve Sec1 1.23644245 0.005589455 0.0423103 protein_coding ENSMUSG00000053318 1 172581758 172590568 -ve Slamf8 1.236678786 0.003984001 NA protein_coding ENSMUSG00000106022 3 121428046 121429331 ve Gm42929 1.236954903 0.000743915 0.008953846 TEC ENSMUSG00000106547 5 146188620 146194809 -ve B230303O12Rik 1.237034078 0.013002264 0.078807969 lincRNA ENSMUSG00000098470 6 124570294 124581171 ve C1rb 1.237375799 6.96E-05 0.00124282 protein_coding ENSMUSG00000038521 6 124530345 124542359 -ve C1s1 1.238367413 0.012734774 0.077709791 protein_coding ENSMUSG00000046191 18 37504264 37507822 ve Pcdhb20 1.239913952 0.002253815 0.021531642 protein_coding ENSMUSG00000052117 4 57908483 57916297 -ve D630039A03Rik 1.240086701 0.009968918 0.065154735 protein_coding ENSMUSG00000034839 9 60712989 60738801 ve Larp6 1.243481174 0.003615891 NA protein_coding ENSMUSG00000056758 10 120361275 120476469 -ve Hmga2 1.246080992 8.38E-06 0.000201323 protein_coding ENSMUSG00000040249 10 127538161 127621148 -ve Lrp1 1.246709326 1.05E-12 9.13E-11 protein_coding ENSMUSG00000069920 8 105252638 105255153 -ve B3gnt9 1.249821595 0.000205143 0.003137104 protein_coding ENSMUSG00000013367 7 43472904 43490075 -ve Iglon5 1.250793835 0.004079657 0.033427495 protein_coding ENSMUSG00000028480 4 43957401 43979118 ve Glipr2 1.250802804 5.91E-27 1.81E-24 protein_coding ENSMUSG00000047643 13 103356250 103357704 ve Gm5454 1.250927049 0.009176283 0.061303254 processed_pseudogene ENSMUSG00000025534 5 129989011 130003049 -ve Gusb 1.250979717 1.52E-05 0.000338769 protein_coding ENSMUSG00000031765 8 94179089 94180325 ve Mt1 1.251099514 0.000521611 0.006730534 protein_coding ENSMUSG00000099094 9 77544959 77546467 ve Gm19569 1.253454622 0.000259688 0.003796963 processed_transcript ENSMUSG00000023011 15 99497005 99528017 -ve Faim2 1.253890869 0.00459999 0.03663212 protein_coding ENSMUSG00000071042 17 75435905 75529043 ve Rasgrp3 1.254872178 0.003633488 NA protein_coding ENSMUSG00000071552 16 43648861 43664184 -ve Tigit 1.255450593 0.009939617 0.065075196 protein_coding ENSMUSG00000035208 11 83002158 83020810 -ve Slfn8 1.255954953 0.009995853 0.065234802 protein_coding ENSMUSG00000034614 11 3330401 3342971 ve Pik3ip1 1.255961817 0.000184679 0.002867045 protein_coding ENSMUSG00000016356 2 180986535 181017540 ve Col20a1 1.25674919 0.002103757 0.020486952 protein_coding ENSMUSG00000103865 2 16023108 16023425 -ve Gm37416 1.25698123 0.000212993 0.003223411 TEC ENSMUSG00000048458 3 105704599 105720842 ve Fam212b 1.257499111 0.001586745 0.01620127 protein_coding

28 ENSMUSG00000107203 6 85938439 85939215 ve Gm7542 1.258436703 0.00650053 NA processed_pseudogene ENSMUSG00000040852 17 84511895 84622142 ve Plekhh2 1.258546271 4.58E-06 0.000120041 protein_coding ENSMUSG00000024481 18 46850039 46905446 ve Lvrn 1.258739285 0.004213183 0.03427023 protein_coding ENSMUSG00000087014 10 39556071 39558062 -ve Gm16364 1.258957335 0.011289275 0.071187651 antisense ENSMUSG00000101603 X 53051194 53053159 -ve Gm28730 1.259355985 0.010734338 0.068970666 lincRNA ENSMUSG00000021265 12 108825873 108835883 -ve Slc25a29 1.259416316 1.80E-06 5.24E-05 protein_coding ENSMUSG00000025324 7 58656166 58829420 ve Atp10a 1.25961332 2.27E-07 7.88E-06 protein_coding ENSMUSG00000015243 4 53030787 53159895 -ve Abca1 1.259664568 0.00238647 0.022539144 protein_coding ENSMUSG00000066196 4 43651335 43653594 -ve Spag8 1.259771405 0.000786786 0.009327979 protein_coding ENSMUSG00000034780 2 67565871 68122689 ve B3galt1 1.260364828 0.002504182 0.023383444 protein_coding ENSMUSG00000073067 6 54269681 54430221 -ve 9130019P16Rik 1.260396989 0.008339542 0.057422328 processed_transcript ENSMUSG00000031465 8 18690263 18741562 -ve Angpt2 1.260911909 0.003878153 0.032249456 protein_coding ENSMUSG00000034205 14 69609068 69695834 ve Loxl2 1.26177292 0.001863016 0.018487073 protein_coding ENSMUSG00000022102 14 70766036 70778495 ve Dok2 1.262362547 0.010348089 0.067033172 protein_coding ENSMUSG00000032724 2 103566310 103718423 ve Abtb2 1.264186682 6.62E-05 0.001194201 protein_coding ENSMUSG00000042428 15 80173721 80215519 ve Mgat3 1.26449544 0.003791116 0.031681545 protein_coding ENSMUSG00000048399 16 25286817 25422344 ve Tprg 1.265472707 0.003403421 NA protein_coding ENSMUSG00000057530 4 137862237 137965229 ve Ece1 1.26604109 7.43E-06 0.000181978 protein_coding ENSMUSG00000027947 3 89864059 89913196 -ve Il6ra 1.266447637 0.006811272 0.049076818 protein_coding ENSMUSG00000031925 9 13619990 13709533 ve Maml2 1.267923281 0.000387001 0.005295615 protein_coding ENSMUSG00000053931 3 121426497 121458207 ve Cnn3 1.269372267 2.52E-09 1.29E-07 protein_coding ENSMUSG00000029570 5 140607320 140615545 ve Lfng 1.270271732 8.31E-10 4.58E-08 protein_coding ENSMUSG00000029651 5 147957320 148316065 ve Mtus2 1.271724239 0.008275346 0.057112517 protein_coding ENSMUSG00000056091 6 72097592 72154571 ve St3gal5 1.271789343 1.83E-06 5.31E-05 protein_coding ENSMUSG00000025867 13 54371349 54383917 ve Cplx2 1.27276314 0.002214161 0.021292945 protein_coding ENSMUSG00000007888 8 70493158 70504081 ve Crlf1 1.273054531 0.005665254 0.042715429 protein_coding ENSMUSG00000044006 8 69880369 69887687 -ve Cilp2 1.273696142 0.010500237 0.067764526 protein_coding ENSMUSG00000029378 5 91139599 91148432 ve Areg 1.275685276 0.010481858 0.067691915 protein_coding ENSMUSG00000103364 1 34032100 34033797 ve Gm38157 1.275955357 0.010319655 0.066917451 TEC ENSMUSG00000038152 13 45965253 45966508 ve 5033430I15Rik 1.277581587 0.000177779 0.002779055 lincRNA ENSMUSG00000064246 1 134182176 134190181 ve Chil1 1.277977575 0.010093682 0.065721393 protein_coding ENSMUSG00000046961 16 37916496 38007527 ve Gpr156 1.278683253 0.009985282 0.065194382 protein_coding ENSMUSG00000033722 1 155212471 155244444 -ve BC034090 1.279016726 0.010085054 0.065687736 protein_coding ENSMUSG00000044365 3 134236484 134262161 ve Cxxc4 1.279023863 0.008282953 0.05714425 protein_coding ENSMUSG00000052957 13 60174405 60177365 -ve Gas1 1.279033088 0.009028674 0.06063706 protein_coding ENSMUSG00000045763 15 25363285 25413764 -ve Basp1 1.27929153 4.52E-06 0.000118845 protein_coding ENSMUSG00000057897 11 5969644 6066362 -ve Camk2b 1.28270016 0.000681063 0.008333897 protein_coding ENSMUSG00000020032 10 84370905 84440597 -ve Nuak1 1.286303733 5.22E-08 2.07E-06 protein_coding ENSMUSG00000041120 4 139082284 139092993 -ve Nbl1 1.288426745 0.009769366 0.064248467 protein_coding ENSMUSG00000024059 17 71781947 71858351 ve Clip4 1.289445349 0.009554473 0.063317549 protein_coding ENSMUSG00000027360 2 126593667 126619299 -ve Hdc 1.290358645 0.008329732 0.057404428 protein_coding ENSMUSG00000052316 16 30269302 30283256 -ve Lrrc15 1.290467022 0.009601929 0.063449946 protein_coding ENSMUSG00000071064 8 79028437 79193766 ve Zfp827 1.291396965 0.000839811 0.009803645 protein_coding ENSMUSG00000021838 14 46882854 47105817 ve Samd4 1.29293674 4.71E-08 1.90E-06 protein_coding ENSMUSG00000070436 7 99345376 99353239 -ve Serpinh1 1.293341165 0.00945923 0.062861844 protein_coding ENSMUSG00000097113 1 136670769 136690804 ve Gm19705 1.294819727 0.000108824 0.001829105 lincRNA ENSMUSG00000001493 11 101877510 101894374 -ve Meox1 1.295669003 0.002640711 0.024267797 protein_coding ENSMUSG00000051331 6 118587240 119196418 -ve Cacna1c 1.296180808 0.008970149 0.06037209 protein_coding ENSMUSG00000048332 3 53041528 53261679 ve Lhfp 1.296524744 8.27E-10 4.56E-08 protein_coding ENSMUSG00000056498 3 84666192 84704575 ve Tmem154 1.297070909 0.006956818 0.049841888 protein_coding ENSMUSG00000071226 6 120666369 120771190 ve Cecr2 1.300580559 0.000403404 0.005464942 protein_coding ENSMUSG00000079470 1 78658038 78671512 ve Utp14b 1.300907758 3.63E-09 1.82E-07 protein_coding ENSMUSG00000035095 14 63436394 63465498 ve Fam167a 1.301688388 0.007330331 0.052007836 protein_coding ENSMUSG00000097376 15 38243160 38244976 -ve Gm8705 1.302146643 0.00894624 0.060240356 lincRNA ENSMUSG00000028108 3 95734147 95739569 -ve Ecm1 1.302291412 5.62E-10 3.23E-08 protein_coding ENSMUSG00000051236 10 120781096 120899101 -ve Msrb3 1.30285328 0.000192313 0.00296876 protein_coding ENSMUSG00000072620 11 83065112 83070678 ve Slfn2 1.30763449 0.008462151 0.058001312 protein_coding ENSMUSG00000026764 2 49619298 49774778 ve Kif5c 1.307682248 0.001539388 0.015846939 protein_coding ENSMUSG00000041886 12 119443410 119466934 ve Macc1 1.308329766 0.00500626 0.039113076 protein_coding ENSMUSG00000018593 11 55394500 55420080 -ve Sparc 1.30882364 1.19E-11 8.94E-10 protein_coding ENSMUSG00000106417 3 129285269 129286032 ve Gm42628 1.310123784 0.005989974 0.044544858 processed_pseudogene ENSMUSG00000108143 6 87332752 87334860 -ve Gm44414 1.311562511 0.002873222 0.025777568 TEC ENSMUSG00000079017 12 103442167 103443680 -ve Ifi27l2a 1.311799799 0.00847554 0.058043062 protein_coding ENSMUSG00000021136 12 81026808 81186414 ve Smoc1 1.312379959 0.004246624 0.034439 protein_coding ENSMUSG00000020264 11 55158470 55185077 -ve Slc36a2 1.314329201 0.008369604 0.057553903 protein_coding ENSMUSG00000045027 17 23993535 23998100 -ve Prss22 1.315467985 0.005591473 0.0423103 protein_coding ENSMUSG00000039934 5 21186255 21315132 ve Gsap 1.315670937 2.82E-05 0.000573648 protein_coding ENSMUSG00000022844 16 35397313 35490873 -ve Pdia5 1.316547946 2.37E-05 0.000492646 protein_coding ENSMUSG00000048520 5 21483847 21645634 -ve Fbxl13 1.317588303 0.005907159 0.044067033 protein_coding ENSMUSG00000085569 4 89100664 89128226 -ve Gm12602 1.32002913 0.005058162 0.039367352 processed_transcript ENSMUSG00000030806 7 127803900 127824549 -ve Stx1b 1.321073003 0.005154334 0.039811412 protein_coding ENSMUSG00000019368 11 4031462 4048024 ve Sec14l4 1.321290978 0.007049509 0.050335087 protein_coding ENSMUSG00000022871 16 22918382 22939766 ve Fetub 1.322561159 0.00644734 0.047206757 protein_coding ENSMUSG00000057880 16 8513429 8621568 ve Abat 1.322654818 0.00266908 0.024425598 protein_coding ENSMUSG00000055632 2 31314415 31460738 ve Hmcn2 1.322910242 0.005998911 0.044593864 protein_coding ENSMUSG00000046841 10 84526305 84534036 -ve Ckap4 1.322919755 8.02E-08 3.09E-06 protein_coding ENSMUSG00000101701 1 44739676 44744949 -ve 4930521E06Rik 1.323163687 0.002792693 0.025221879 antisense ENSMUSG00000043219 6 52206288 52208722 -ve Hoxa6 1.323165398 2.96E-06 8.12E-05 protein_coding ENSMUSG00000047604 19 41845978 41848132 -ve Frat2 1.323205803 5.60E-05 0.00103654 protein_coding ENSMUSG00000005836 18 11052510 11085635 ve Gata6 1.323982922 1.31E-06 3.95E-05 protein_coding ENSMUSG00000044499 10 36506814 36834397 ve Hs3st5 1.324812 0.006720152 0.048697385 protein_coding ENSMUSG00000022203 14 54916543 54926788 -ve Efs 1.325388438 0.006273593 0.046237623 protein_coding ENSMUSG00000105376 5 111791555 111805689 ve Gm42487 1.32589682 0.004520546 NA lincRNA ENSMUSG00000107436 6 87171944 87174009 -ve Gm44416 1.326793474 0.002446667 NA TEC

29 ENSMUSG00000024084 17 79051906 79090243 ve Qpct 1.328834221 0.000460095 0.006043285 protein_coding ENSMUSG00000036295 12 41451673 41485751 -ve Lrrn3 1.329732502 0.004438614 0.035645918 protein_coding ENSMUSG00000029503 5 110339812 110343212 -ve P2rx2 1.333632477 0.002631092 0.024211405 protein_coding ENSMUSG00000015709 7 84246278 84410176 -ve Arnt2 1.333814598 0.007468185 0.052816798 protein_coding ENSMUSG00000033763 8 110721476 110741400 ve Mtss1l 1.334056727 1.26E-07 4.67E-06 protein_coding ENSMUSG00000021453 13 51846678 51848468 ve Gadd45g 1.334701149 1.26E-14 1.40E-12 protein_coding ENSMUSG00000003948 11 90187684 90278589 ve Mmd 1.334716912 3.34E-10 2.03E-08 protein_coding ENSMUSG00000052105 17 66336982 66449750 -ve Mtcl1 1.335860914 7.07E-05 0.001260543 protein_coding ENSMUSG00000024736 19 10857822 10869940 -ve Tmem132a 1.335941522 5.56E-11 3.82E-09 protein_coding ENSMUSG00000027570 2 180597790 180622189 ve Col9a3 1.337394706 0.002853084 0.025608987 protein_coding ENSMUSG00000040717 14 27039001 27107286 ve Il17rd 1.337756008 7.89E-06 0.000191849 protein_coding ENSMUSG00000085310 11 87121567 87126958 -ve Gm11491 1.338702077 0.005656609 0.04268414 antisense ENSMUSG00000056313 8 24437180 24438984 -ve 1810011O10Rik 1.341803847 1.96E-05 0.000417141 protein_coding ENSMUSG00000075254 16 33684466 33771576 ve Heg1 1.342968976 0.001405035 0.014743548 protein_coding ENSMUSG00000021614 13 89655312 89742509 -ve Vcan 1.343338027 4.12E-05 0.000798664 protein_coding ENSMUSG00000024190 17 26505590 26508519 -ve Dusp1 1.345215167 7.94E-07 2.46E-05 protein_coding ENSMUSG00000024427 18 38586268 38601268 -ve Spry4 1.34544582 0.001517968 0.015651883 protein_coding ENSMUSG00000047557 3 67457998 67463926 -ve Lxn 1.348245648 7.14E-12 5.62E-10 protein_coding ENSMUSG00000090500 15 99819020 99834570 ve Gm17057 1.348657318 0.004924417 0.038664508 antisense ENSMUSG00000106209 5 121385522 121387101 ve Gm42918 1.349281045 0.005834255 0.043694795 antisense ENSMUSG00000053552 2 130295169 130370481 ve Ebf4 1.349345043 0.005837278 0.043700209 protein_coding ENSMUSG00000050721 9 65554386 65580040 -ve Plekho2 1.349817674 1.03E-11 7.87E-10 protein_coding ENSMUSG00000087203 2 117857291 118111202 -ve Gm13986 1.350225054 0.006673283 0.048468703 processed_transcript ENSMUSG00000037990 10 58813359 59138916 ve Sh3rf3 1.350263946 0.005160555 0.039841118 protein_coding ENSMUSG00000027890 3 108040408 108044894 -ve Gstm4 1.351718389 0.004464445 0.03576263 protein_coding ENSMUSG00000032179 9 75775364 75900310 ve Bmp5 1.352281265 0.002109881 NA protein_coding ENSMUSG00000025432 10 127000709 127020994 ve Avil 1.353379028 0.001031684 0.011560338 protein_coding ENSMUSG00000037664 7 143458339 143461050 -ve Cdkn1c 1.353680114 0.000121948 0.002014044 protein_coding ENSMUSG00000041608 9 120539818 120568318 ve Entpd3 1.354239399 0.00252334 0.023501242 protein_coding ENSMUSG00000047420 6 35312668 35326141 -ve Fam180a 1.354340616 0.001913729 0.018930969 protein_coding ENSMUSG00000046618 2 38931978 38963753 ve Olfml2a 1.354926241 0.002465909 0.023128399 protein_coding ENSMUSG00000006522 14 30908573 30923760 -ve Itih3 1.355265792 0.005438482 0.041423366 protein_coding ENSMUSG00000028005 3 82032006 82074689 -ve Gucy1b3 1.355730931 0.003060365 0.026984918 protein_coding ENSMUSG00000024459 17 36984061 36989537 -ve H2-M5 1.356503194 0.005023734 0.039202862 protein_coding ENSMUSG00000047414 12 95692226 95785215 ve Flrt2 1.356524918 2.32E-05 0.000483458 protein_coding ENSMUSG00000040264 3 142594847 142619179 ve Gbp2b 1.357182124 0.006318208 0.046494273 protein_coding ENSMUSG00000017446 11 118428203 118449963 ve C1qtnf1 1.357923014 1.52E-11 1.13E-09 protein_coding ENSMUSG00000025888 9 5298517 5307265 ve Casp1 1.358262939 0.002039988 NA protein_coding ENSMUSG00000102593 8 105633750 105634871 ve Gm38384 1.361241627 0.002725344 0.024790453 TEC ENSMUSG00000024339 17 34203527 34216321 ve Tap2 1.361414387 0.00022709 0.00340151 protein_coding ENSMUSG00000029161 5 30933143 30945591 -ve Cgref1 1.36207041 0.005883356 0.043923969 protein_coding ENSMUSG00000025348 10 128933813 128958277 ve Itga7 1.363030804 4.36E-22 9.30E-20 protein_coding ENSMUSG00000032657 3 89183143 89189295 ve Fam189b 1.364564986 0.000825075 0.009674938 protein_coding ENSMUSG00000023800 17 3326573 3519397 ve Tiam2 1.365294913 3.83E-08 1.56E-06 protein_coding ENSMUSG00000022321 15 18818947 19014236 ve Cdh10 1.366347697 0.0058584 0.043806531 protein_coding ENSMUSG00000043336 16 57353093 57573126 ve Filip1l 1.36957204 1.43E-09 7.59E-08 protein_coding ENSMUSG00000004035 3 107926334 107931817 -ve Gstm7 1.369654075 2.64E-06 7.36E-05 protein_coding ENSMUSG00000050288 11 102604396 102608058 ve Fzd2 1.371361968 2.98E-09 1.51E-07 protein_coding ENSMUSG00000047497 15 11064790 11346867 ve Adamts12 1.372572618 0.002795897 0.025238819 protein_coding ENSMUSG00000025321 12 119158022 119238802 -ve Itgb8 1.374130888 0.002972909 0.026397595 protein_coding ENSMUSG00000097222 18 11049087 11052567 -ve 1010001N08Rik 1.375000464 0.005180232 0.039930257 lincRNA ENSMUSG00000008398 10 93247414 93311135 -ve Elk3 1.375814056 1.53E-19 2.65E-17 protein_coding ENSMUSG00000017929 2 167298444 167349183 -ve B4galt5 1.376014158 1.54E-09 8.15E-08 protein_coding ENSMUSG00000021457 13 52583173 52648792 ve Syk 1.376651215 0.000370506 0.005102986 protein_coding ENSMUSG00000025491 7 140967221 140969825 ve Ifitm1 1.377074568 0.005493212 0.041683012 protein_coding ENSMUSG00000055271 12 103406822 103407820 -ve 9330161L09Rik 1.377639465 0.002500861 0.023363923 protein_coding ENSMUSG00000085957 5 134558146 134560171 -ve Syna 1.380117541 0.004759375 0.037617483 protein_coding ENSMUSG00000064366 MT 11671 11741 ve mt-Tl2 1.380487671 2.27E-06 6.44E-05 Mt_tRNA ENSMUSG00000024254 17 84676302 84700333 ve Abcg8 1.380697986 0.00173546 0.017476984 protein_coding ENSMUSG00000074364 7 15946977 15967567 -ve Ehd2 1.381105819 0.000223572 0.003359421 protein_coding ENSMUSG00000043099 11 75164565 75169519 -ve Hic1 1.381585394 0.005309867 0.040676766 protein_coding ENSMUSG00000037624 1 189207930 189402273 -ve Kcnk2 1.381748879 0.003072131 0.027050991 protein_coding ENSMUSG00000035237 8 105939551 105943382 -ve Lcat 1.384544943 0.001599062 0.016302197 protein_coding ENSMUSG00000033715 13 4049011 4090422 ve Akr1c14 1.384669649 0.000434587 0.005768073 protein_coding ENSMUSG00000053113 11 117966079 117970047 -ve Socs3 1.385101805 1.15E-10 7.55E-09 protein_coding ENSMUSG00000029847 6 34945278 34988404 -ve 2010107G12Rik 1.386445538 0.005194781 0.039993708 protein_coding ENSMUSG00000105112 5 110978665 110979217 ve Gm42778 1.387146516 0.001779388 NA TEC ENSMUSG00000086604 7 5046949 5057116 -ve Gm15510 1.387555436 0.005162375 0.039841118 antisense ENSMUSG00000020218 10 121033960 121100650 ve Wif1 1.387966482 0.004278649 0.034624787 protein_coding ENSMUSG00000041729 9 62419492 62537044 -ve Coro2b 1.388602425 0.003709675 0.031176045 protein_coding ENSMUSG00000034684 9 107681500 107710475 -ve Sema3f 1.389118309 5.72E-21 1.08E-18 protein_coding ENSMUSG00000051648 8 105382807 105413502 -ve Kctd19 1.390772161 0.004962925 0.038918591 protein_coding ENSMUSG00000058056 8 61513246 61902690 -ve Palld 1.392966074 1.54E-07 5.62E-06 protein_coding ENSMUSG00000037846 10 67979570 68059740 ve Rtkn2 1.394550336 3.24E-06 8.82E-05 protein_coding ENSMUSG00000085402 11 32903137 32926160 -ve Gm12111 1.396705723 0.001666688 NA lincRNA ENSMUSG00000028445 4 41638144 41640324 -ve Enho 1.400168195 0.003270344 0.028414291 protein_coding ENSMUSG00000040212 7 45918023 45921426 -ve Emp3 1.400620371 7.14E-05 0.001271347 protein_coding ENSMUSG00000059173 2 79834453 80129458 -ve Pde1a 1.401044128 0.000801621 0.009458107 protein_coding ENSMUSG00000030701 7 100642892 100662414 -ve Plekhb1 1.401643484 0.00438029 0.035252052 protein_coding ENSMUSG00000022296 15 38933142 38949405 ve Baalc 1.40180837 0.003609694 0.030595597 protein_coding ENSMUSG00000033960 18 4634929 4682868 ve 9430020K01Rik 1.402633188 2.96E-05 0.000598541 protein_coding ENSMUSG00000031780 8 94810453 94812035 ve Ccl17 1.404226923 0.003291575 0.028546521 protein_coding ENSMUSG00000005973 2 105386291 105399319 -ve Rcn1 1.405138679 4.26E-05 0.000818336 protein_coding ENSMUSG00000034394 11 4257557 4272514 ve Lif 1.405759538 8.00E-15 9.00E-13 protein_coding

30 ENSMUSG00000052125 12 33111711 33147597 -ve F730043M19Rik 1.405878383 0.000810906 0.00953655 processed_transcript ENSMUSG00000059493 X 161833296 162159730 -ve Nhs 1.406360465 0.002589493 0.023967958 protein_coding ENSMUSG00000028766 4 137741733 137796384 -ve Alpl 1.40737463 0.004392455 0.035311239 protein_coding ENSMUSG00000014782 8 105373274 105382862 ve Plekhg4 1.408285097 0.00149205 0.015451746 protein_coding ENSMUSG00000022220 14 55769058 55784042 -ve Adcy4 1.408310792 0.003665202 0.03090436 protein_coding ENSMUSG00000054263 15 7129559 7197489 ve Lifr 1.408450281 0.000576194 0.007300836 protein_coding ENSMUSG00000100775 1 23293729 23294075 ve Gm29107 1.408899294 0.002688265 0.024535423 lincRNA ENSMUSG00000108161 6 145999536 146001763 -ve Gm44269 1.409159564 0.002297907 0.02186581 lincRNA ENSMUSG00000086915 10 39558496 39613682 -ve Gm16365 1.409164761 0.00068309 0.008343357 antisense ENSMUSG00000031119 X 52053021 52165252 -ve Gpc4 1.411226791 0.000448305 0.005912958 protein_coding ENSMUSG00000008136 1 43123074 43196984 -ve Fhl2 1.411337041 2.41E-06 6.82E-05 protein_coding ENSMUSG00000027669 3 32580332 32616585 -ve Gnb4 1.413433247 8.67E-05 0.001507135 protein_coding ENSMUSG00000076441 2 31470207 31520672 ve Ass1 1.413872333 0.000206678 0.003152958 protein_coding ENSMUSG00000074604 3 51660360 51682677 ve Mgst2 1.414249965 2.09E-05 0.00043979 protein_coding ENSMUSG00000003411 4 108879063 108943324 ve Rab3b 1.415150787 0.00283423 0.025477939 protein_coding ENSMUSG00000049409 6 87578591 87590743 -ve Prokr1 1.415740795 0.0028762 0.0257921 protein_coding ENSMUSG00000040488 7 27305136 27337692 -ve Ltbp4 1.416320569 6.20E-05 0.001129538 protein_coding ENSMUSG00000040505 17 84658234 84683011 -ve Abcg5 1.418441463 0.001481049 NA protein_coding ENSMUSG00000024302 18 23415415 23659714 ve Dtna 1.420668563 0.000587402 0.007398233 protein_coding ENSMUSG00000052396 7 99219084 99238619 -ve Mogat2 1.420881791 0.003871005 0.032230473 protein_coding ENSMUSG00000086105 11 102614892 102616546 -ve Gm11636 1.421188098 0.004195245 0.03416252 lincRNA ENSMUSG00000041889 1 135371057 135375237 -ve Shisa4 1.423312655 9.95E-06 0.000235361 protein_coding ENSMUSG00000005397 13 13437602 13512275 ve Nid1 1.426685342 0.003767677 0.03153766 protein_coding ENSMUSG00000040254 5 12383385 12588948 ve Sema3d 1.426778447 0.001836739 0.018312435 protein_coding ENSMUSG00000022676 16 14705852 14709395 ve Snai2 1.426801646 0.002219435 0.021322072 protein_coding ENSMUSG00000004665 10 79988584 79996062 ve Cnn2 1.427633759 2.54E-07 8.72E-06 protein_coding ENSMUSG00000022032 14 65666403 65764826 ve Scara5 1.430042242 0.003997219 0.032950207 protein_coding ENSMUSG00000029223 5 66676091 66687234 ve Uchl1 1.430626022 0.003063297 0.026985714 protein_coding ENSMUSG00000023805 17 5941280 6044290 ve Synj2 1.432539317 4.07E-05 0.000790949 protein_coding ENSMUSG00000023979 17 47385393 47392967 ve Guca1b 1.433071006 0.003952581 0.03266245 protein_coding ENSMUSG00000037621 6 72206177 72235577 -ve Atoh8 1.435849785 1.08E-07 4.10E-06 protein_coding ENSMUSG00000026308 1 91351016 91362416 ve Klhl30 1.436874753 0.0013479 0.014222587 protein_coding ENSMUSG00000038370 1 171173262 171196268 -ve Pcp4l1 1.440378386 0.002998264 0.026524194 protein_coding ENSMUSG00000078816 7 3289179 3331099 ve Prkcg 1.440486172 0.000420877 0.00563863 protein_coding ENSMUSG00000039217 9 50575273 50581837 ve Il18 1.442746155 0.003659064 0.030892574 protein_coding ENSMUSG00000103749 18 37731009 37841873 ve Pcdhgb5 1.446343115 0.00335652 0.028964283 protein_coding ENSMUSG00000034220 1 92831645 92860779 ve Gpc1 1.446984657 1.69E-10 1.08E-08 protein_coding ENSMUSG00000089940 13 89739460 89887166 ve Gm4117 1.447587909 0.00082522 0.009674938 processed_transcript ENSMUSG00000002732 2 76663044 76673116 -ve Fkbp7 1.448239955 4.58E-10 2.68E-08 protein_coding ENSMUSG00000097875 15 38726869 39006185 -ve Gm26704 1.448252236 1.29E-05 0.000293131 lincRNA ENSMUSG00000000794 3 89520164 89675132 ve Kcnn3 1.450336396 0.00363779 0.030776187 protein_coding ENSMUSG00000033684 1 155776029 155812889 -ve Qsox1 1.450776504 2.43E-06 6.86E-05 protein_coding ENSMUSG00000095180 X 37804842 37808876 ve Rhox5 1.450938646 0.003539423 0.030172466 protein_coding ENSMUSG00000039238 11 121510978 121519333 -ve Zfp750 1.451569356 0.003585887 0.030459191 protein_coding ENSMUSG00000039911 4 149896283 149955043 -ve Spsb1 1.452091719 3.85E-14 4.02E-12 protein_coding ENSMUSG00000096960 16 25059639 25069058 ve A230028O05Rik 1.452542093 0.001587457 0.01620127 lincRNA ENSMUSG00000044933 15 78537015 78544345 -ve Sstr3 1.454258257 0.001570482 0.016123336 protein_coding ENSMUSG00000023809 17 7170115 7303313 ve Rps6ka2 1.454406263 3.99E-05 0.000777203 protein_coding ENSMUSG00000073591 18 37517871 37524479 ve Pcdhb22 1.454999038 8.60E-05 0.001497779 protein_coding ENSMUSG00000067795 1 16065979 16093325 -ve 4930444P10Rik 1.455029277 0.002901019 0.025953389 protein_coding ENSMUSG00000053475 2 52038009 52056686 ve Tnfaip6 1.456394008 0.002184423 0.021092399 protein_coding ENSMUSG00000048852 11 48904656 48992226 -ve Gm12185 1.456506142 0.003488065 0.029801541 protein_coding ENSMUSG00000033967 7 12927416 12931072 ve Rnf225 1.459237779 0.002253238 0.021531642 protein_coding ENSMUSG00000022018 14 79288756 79301645 -ve Rgcc 1.459918419 0.00082587 0.009676586 protein_coding ENSMUSG00000073679 4 155839492 155840178 -ve Mxra8os 1.466649244 0.002816095 0.025367192 antisense ENSMUSG00000061887 4 106910701 107049694 ve Ssbp3 1.467443162 6.17E-09 2.93E-07 protein_coding ENSMUSG00000108006 6 87277745 87279750 ve Gm44418 1.470967089 0.001648708 0.016736461 antisense ENSMUSG00000048126 1 90765923 90843971 -ve Col6a3 1.471297792 0.001202515 0.01302873 protein_coding ENSMUSG00000103585 18 37720369 37841870 ve Pcdhgb4 1.472437769 0.001773625 0.017767119 protein_coding ENSMUSG00000017144 2 51130438 51149111 -ve Rnd3 1.472980449 4.20E-09 2.08E-07 protein_coding ENSMUSG00000038210 6 52242106 52245810 -ve Hoxa11 1.474925775 0.000455837 0.005991499 protein_coding ENSMUSG00000033327 17 34670535 34719815 ve Tnxb 1.475450219 0.003082017 0.027125467 protein_coding ENSMUSG00000030214 6 136612070 136661928 -ve Plbd1 1.475785061 0.00211664 0.02056335 protein_coding ENSMUSG00000095105 13 12471209 12520450 -ve Edaradd 1.477504807 0.000415973 0.005595303 protein_coding ENSMUSG00000049134 19 56320035 56390037 -ve Nrap 1.478538487 0.002710527 0.024691149 protein_coding ENSMUSG00000024330 17 34039437 34066685 ve Col11a2 1.480988781 0.000350566 0.00488504 protein_coding ENSMUSG00000024402 17 35203165 35205351 -ve Lta 1.481520354 0.002088789 0.020365689 protein_coding ENSMUSG00000006457 19 4861223 4877909 -ve Actn3 1.48206382 0.001474174 0.015308359 protein_coding ENSMUSG00000029761 6 34598500 34775473 ve Cald1 1.48394562 4.18E-06 0.000111471 protein_coding ENSMUSG00000030774 7 97788541 97912381 ve Pak1 1.487978225 2.78E-11 2.00E-09 protein_coding ENSMUSG00000102440 18 37736936 37841870 ve Pcdhga9 1.489033067 0.002798074 0.02524647 protein_coding ENSMUSG00000038670 7 44501699 44524656 -ve Mybpc2 1.490867317 0.002623657 0.024173766 protein_coding ENSMUSG00000020599 11 109225355 109298129 -ve Rgs9 1.491285454 4.25E-05 0.000817587 protein_coding ENSMUSG00000063975 6 142234227 142322981 -ve Slco1a5 1.493006764 0.000968766 0.010978383 protein_coding ENSMUSG00000029784 6 30509849 30520254 ve Ssmem1 1.497673623 0.00230967 0.021955735 protein_coding ENSMUSG00000021250 12 85473890 85477273 ve Fos 1.500470406 8.09E-09 3.78E-07 protein_coding ENSMUSG00000085843 4 98793768 98798900 ve Kank4os 1.502817409 0.002480826 0.023217202 antisense ENSMUSG00000020601 12 15791727 15816877 -ve Trib2 1.504555694 0.000742081 0.008937447 protein_coding ENSMUSG00000028047 3 89215180 89226837 ve Thbs3 1.511180009 1.57E-05 0.000347159 protein_coding ENSMUSG00000039323 1 72824503 72852474 ve Igfbp2 1.513464102 0.000582108 0.007351051 protein_coding ENSMUSG00000028125 3 122044443 122180123 ve Abca4 1.514041115 2.05E-06 5.89E-05 protein_coding ENSMUSG00000036913 8 124793019 124834713 ve Trim67 1.514215102 0.001391291 0.014615478 protein_coding ENSMUSG00000028532 4 100776675 101029220 ve Cachd1 1.514324469 1.51E-07 5.49E-06 protein_coding ENSMUSG00000048706 4 80910646 80955628 ve Lurap1l 1.514436746 3.21E-10 1.96E-08 protein_coding

31 ENSMUSG00000021065 12 77238104 77476338 ve Fut8 1.516002838 5.83E-08 2.29E-06 protein_coding ENSMUSG00000100959 1 16662980 16663662 -ve Gm7654 1.516988106 0.00234548 0.022251603 processed_pseudogene ENSMUSG00000052087 13 55369732 55384687 ve Rgs14 1.517757007 0.002297809 0.02186581 protein_coding ENSMUSG00000032826 3 126921612 127499350 -ve Ank2 1.520192967 8.91E-19 1.42E-16 protein_coding ENSMUSG00000022512 16 26356642 26371841 -ve Cldn1 1.52117651 0.002107615 0.020507133 protein_coding ENSMUSG00000086040 6 54429603 54503768 ve Wipf3 1.52386533 0.001483529 0.015388672 protein_coding ENSMUSG00000017417 11 97923238 97986444 -ve Plxdc1 1.527161138 3.53E-05 0.000700814 protein_coding ENSMUSG00000034796 8 123117374 123135182 ve Cpne7 1.527192918 0.002057326 0.020157387 protein_coding ENSMUSG00000026398 1 136842571 136960448 -ve Nr5a2 1.52737738 0.002185549 0.021092545 protein_coding ENSMUSG00000023935 17 45448937 45474938 -ve Spats1 1.52800297 0.001485443 0.015400119 protein_coding ENSMUSG00000023019 15 99717515 99725005 ve Gpd1 1.528610569 1.99E-06 5.74E-05 protein_coding ENSMUSG00000034112 8 119700009 119757718 ve Atp2c2 1.52916141 0.001742425 0.017501822 protein_coding ENSMUSG00000022816 16 37776873 37836514 ve Fstl1 1.531136647 0.002057873 0.020157387 protein_coding ENSMUSG00000019359 X 100729873 100738895 ve Gdpd2 1.531514119 0.002117987 0.020563435 protein_coding ENSMUSG00000081223 11 58097104 58097773 -ve Gm12247 1.531924684 0.001588598 0.016204207 processed_pseudogene ENSMUSG00000024778 19 34290659 34327770 ve Fas 1.535879112 1.15E-05 0.000266802 protein_coding ENSMUSG00000029859 6 42358487 42373268 -ve Epha1 1.536184425 0.000271106 0.003933626 protein_coding ENSMUSG00000038253 6 52201754 52204587 -ve Hoxa5 1.536738188 8.02E-09 3.76E-07 protein_coding ENSMUSG00000032262 9 83778692 83806277 -ve Elovl4 1.538687753 7.19E-05 0.001279812 protein_coding ENSMUSG00000034460 12 73099609 73113456 -ve Six4 1.541748464 1.27E-12 1.09E-10 protein_coding ENSMUSG00000027533 3 10012548 10016607 ve Fabp5 1.545295419 1.39E-10 9.01E-09 protein_coding ENSMUSG00000044548 12 71309884 71320107 ve Dact1 1.54857343 3.72E-05 0.000734232 protein_coding ENSMUSG00000024610 18 60803848 60812646 ve Cd74 1.548600064 2.33E-05 0.000485838 protein_coding ENSMUSG00000046805 19 12460779 12465284 ve Mpeg1 1.550913156 0.001185901 0.01286461 protein_coding ENSMUSG00000048776 6 147252101 147264183 -ve Pthlh 1.551958678 0.001310419 0.013958936 protein_coding ENSMUSG00000038037 16 10783808 10785536 -ve Socs1 1.552468727 0.00014745 0.002370121 protein_coding ENSMUSG00000025932 1 14168954 14310235 -ve Eya1 1.553554664 8.21E-06 0.000198419 protein_coding ENSMUSG00000025610 16 87553330 87595336 ve Map3k7cl 1.554638771 1.74E-05 0.000377948 protein_coding ENSMUSG00000018907 11 70315610 70322628 -ve Alox12e 1.555885054 0.000619014 0.007714523 protein_coding ENSMUSG00000029134 5 32232708 32366520 ve Plb1 1.556413491 0.001503271 0.015542528 protein_coding ENSMUSG00000103677 18 37685210 37841873 ve Pcdhga4 1.557438833 0.000623643 0.007762025 protein_coding ENSMUSG00000063838 7 4151260 4164860 -ve Cdc42ep5 1.560088702 3.83E-07 1.27E-05 protein_coding ENSMUSG00000053004 6 114397936 114483296 ve Hrh1 1.568095892 0.000549884 0.007041297 protein_coding ENSMUSG00000030468 7 43408204 43418358 ve Siglecg 1.569238844 0.000806774 0.009505615 protein_coding ENSMUSG00000041633 X 153685154 153696391 -ve Kctd12b 1.571459795 4.60E-06 0.000120296 protein_coding ENSMUSG00000083483 2 130384883 130385329 -ve Gm14044 1.577989705 0.001558687 0.016020173 processed_pseudogene ENSMUSG00000037962 5 125003221 125012547 ve Fam101a 1.579140727 0.001514515 0.015624755 protein_coding ENSMUSG00000097134 10 66912489 66920258 -ve 1110002J07Rik 1.579502766 0.000789496 0.009348444 lincRNA ENSMUSG00000022623 15 89499623 89560261 ve Shank3 1.58040098 0.001065572 0.011842253 protein_coding ENSMUSG00000079330 1 132191431 132259227 ve Lemd1 1.582399669 0.00144397 0.015060416 protein_coding ENSMUSG00000019768 10 4611593 5005614 ve Esr1 1.582694243 0.001336951 0.014122752 protein_coding ENSMUSG00000010461 10 23104168 23349895 -ve Eya4 1.583248552 0.001248602 0.013420886 protein_coding ENSMUSG00000031596 8 40862396 40922308 ve Slc7a2 1.583479312 0.001497468 0.015499402 protein_coding ENSMUSG00000045903 19 4984355 4989971 -ve Npas4 1.58509543 0.000953021 0.010851755 protein_coding ENSMUSG00000017002 2 164354070 164389095 -ve Slpi 1.587545091 0.000370259 0.005102986 protein_coding ENSMUSG00000024784 19 6226380 6227768 ve Gpha2 1.587752592 0.000914933 0.010512602 protein_coding ENSMUSG00000031523 8 36567751 36953143 -ve Dlc1 1.588355111 1.95E-09 1.02E-07 protein_coding ENSMUSG00000047712 10 8204753 8518825 -ve Ust 1.589800415 8.63E-06 0.000206801 protein_coding ENSMUSG00000078144 8 92901407 92902407 ve Capns2 1.590815478 8.92E-05 0.001547352 protein_coding ENSMUSG00000026700 1 161395409 161418410 ve Tnfsf4 1.591615975 0.000959828 0.010909642 protein_coding ENSMUSG00000050953 10 56377300 56390419 ve Gja1 1.592482448 8.45E-06 0.000202669 protein_coding ENSMUSG00000035472 12 56712634 57197472 -ve Slc25a21 1.593786536 0.001149309 0.012545303 protein_coding ENSMUSG00000025355 10 128790953 128800824 ve Mmp19 1.594216917 0.000146311 0.002354983 protein_coding ENSMUSG00000074071 7 68273839 68363092 ve Fam169b 1.595479267 0.000881774 0.010212802 protein_coding ENSMUSG00000054074 2 18040676 18049051 -ve Skida1 1.595618496 5.98E-05 0.001095716 protein_coding ENSMUSG00000086283 11 102619796 102624416 -ve 2810433D01Rik 1.605000948 0.001290637 0.013781825 lincRNA ENSMUSG00000034786 17 34589806 34591754 ve Gpsm3 1.60748956 4.83E-05 0.000908643 protein_coding ENSMUSG00000034853 4 106744555 106804998 -ve Acot11 1.607790763 0.001047792 0.01171319 protein_coding ENSMUSG00000033538 9 5308828 5336783 ve Casp4 1.60859099 1.31E-21 2.59E-19 protein_coding ENSMUSG00000031952 8 111889135 111910199 -ve Chst5 1.608653932 0.000816734 0.009599157 protein_coding ENSMUSG00000021298 12 112850876 112860916 -ve Gpr132 1.611052033 0.000810512 0.00953655 protein_coding ENSMUSG00000024420 18 13687013 13972733 -ve Zfp521 1.611512359 0.000912616 0.010492323 protein_coding ENSMUSG00000103966 1 132102365 132108323 ve Gm37120 1.613352827 0.000940807 0.010751357 TEC ENSMUSG00000016918 1 12692277 12861192 ve Sulf1 1.614720048 0.000449755 0.00592385 protein_coding ENSMUSG00000085412 6 52102949 52113684 ve Halr1 1.617213859 0.000958223 0.01089792 lincRNA ENSMUSG00000039646 16 4639941 4650802 ve Vasn 1.617957025 7.70E-10 4.28E-08 protein_coding ENSMUSG00000048616 11 89300638 89302332 -ve Nog 1.618660319 0.001078536 0.011958341 protein_coding ENSMUSG00000026586 1 163245119 163313710 -ve Prrx1 1.621572239 0.000313141 0.004448388 protein_coding ENSMUSG00000029661 6 4504814 4541544 ve Col1a2 1.621890257 0.000425743 0.005686448 protein_coding ENSMUSG00000096965 17 5798657 5803240 ve 3300005D01Rik 1.622971969 0.000515235 0.006661584 lincRNA ENSMUSG00000073590 18 37655451 37661742 ve 3222401L13Rik 1.623001796 0.001017632 0.011423103 lincRNA ENSMUSG00000086522 10 120899157 120901888 ve Gm4473 1.627725616 0.001097246 0.012123319 antisense ENSMUSG00000017466 11 118301069 118355740 -ve Timp2 1.629910105 3.88E-07 1.28E-05 protein_coding ENSMUSG00000048482 2 109674700 109727007 ve Bdnf 1.6307259 2.66E-17 3.86E-15 protein_coding ENSMUSG00000032584 9 107906873 107920383 ve Mst1r 1.632017324 0.000350356 0.00488504 protein_coding ENSMUSG00000078921 11 49057194 49064206 -ve Tgtp2 1.63217445 0.000579442 0.007327761 protein_coding ENSMUSG00000045954 1 51289126 51302960 ve Sdpr 1.633310143 0.001050204 0.011726353 protein_coding ENSMUSG00000045326 3 108853678 108890008 -ve Fndc7 1.634066865 0.000964316 0.010941009 protein_coding ENSMUSG00000026365 1 140084708 140183764 -ve Cfh 1.634516194 0.000675433 0.008287139 protein_coding ENSMUSG00000042333 4 154922210 154928563 -ve Tnfrsf14 1.634939579 0.000629283 0.007821972 protein_coding ENSMUSG00000032322 9 56089962 56128888 ve Pstpip1 1.635681395 0.000807421 0.009507342 protein_coding ENSMUSG00000070509 7 73375509 73419899 ve Rgma 1.637817053 6.92E-06 0.000171372 protein_coding ENSMUSG00000001249 7 31098725 31115290 -ve Hpn 1.638440129 0.000901429 0.010376265 protein_coding ENSMUSG00000025608 6 31519488 31563981 -ve Podxl 1.638546128 4.46E-05 0.000847873 protein_coding

32 ENSMUSG00000042129 6 116633008 116673952 -ve Rassf4 1.640002217 0.001009399 0.011337386 protein_coding ENSMUSG00000031906 8 106252548 106337988 -ve Smpd3 1.640864314 1.37E-07 5.03E-06 protein_coding ENSMUSG00000048424 15 8968426 9066551 ve Ranbp3l 1.642117115 0.000954033 0.010856775 protein_coding ENSMUSG00000036585 18 38838673 38929404 -ve Fgf1 1.645185571 6.31E-06 0.000159631 protein_coding ENSMUSG00000021874 14 26356574 26400456 ve 4933413J09Rik 1.650947074 0.000330904 0.004669285 lincRNA ENSMUSG00000039519 3 18071950 18243338 -ve Cyp7b1 1.653852679 0.000893977 0.010321767 protein_coding ENSMUSG00000028487 4 84275095 84675275 -ve Bnc2 1.659879954 7.82E-07 2.42E-05 protein_coding ENSMUSG00000026068 1 40515362 40551705 ve Il18rap 1.660103729 0.000865669 0.010049904 protein_coding ENSMUSG00000004151 12 38779380 38868215 ve Etv1 1.663016802 0.00043091 0.005730783 protein_coding ENSMUSG00000054728 13 42680623 43138526 ve Phactr1 1.663459908 0.000721544 0.008734404 protein_coding ENSMUSG00000030255 6 145931641 145965223 ve Sspn 1.664022472 0.000848297 0.009884485 protein_coding ENSMUSG00000001300 8 8617434 8661242 -ve Efnb2 1.665816228 4.68E-14 4.86E-12 protein_coding ENSMUSG00000044250 15 97247107 97385689 ve Pced1b 1.668712156 1.26E-07 4.67E-06 protein_coding ENSMUSG00000029059 4 154895504 154899135 -ve Fam213b 1.67177057 0.000753831 0.009038834 protein_coding ENSMUSG00000026475 1 153740349 153745468 ve Rgs16 1.672577656 0.000567768 0.007237329 protein_coding ENSMUSG00000028599 4 145213463 145246870 -ve Tnfrsf1b 1.674132866 1.14E-08 5.14E-07 protein_coding ENSMUSG00000103144 18 37661793 37841873 ve Pcdhga1 1.675641575 0.000491088 0.00638415 protein_coding ENSMUSG00000030707 7 126699773 126707787 -ve Coro1a 1.67591747 0.000565277 0.007215254 protein_coding ENSMUSG00000052921 11 68943155 68957480 -ve Arhgef15 1.676074049 0.000761551 0.009125641 protein_coding ENSMUSG00000071573 19 33137747 33392295 -ve Rnls 1.686782336 0.000402685 0.005460074 protein_coding ENSMUSG00000071847 18 62922327 62953195 ve Apcdd1 1.690421575 1.99E-07 7.05E-06 protein_coding ENSMUSG00000071317 10 45335762 45369708 ve Bves 1.693376333 0.000214036 0.003236609 protein_coding ENSMUSG00000056895 11 58948920 58949533 ve Hist3h2ba 1.694033615 0.000598539 0.007503662 protein_coding ENSMUSG00000075318 2 65620771 65767447 ve Scn2a1 1.704780322 9.83E-05 0.001685441 protein_coding ENSMUSG00000036545 11 50602084 50807573 ve Adamts2 1.706024008 0.000312658 0.004444846 protein_coding ENSMUSG00000031453 8 13566950 13677603 -ve Rasa3 1.707970242 1.76E-07 6.28E-06 protein_coding ENSMUSG00000002007 X 73774405 73778925 ve Srpk3 1.711048142 0.000177332 0.002774359 protein_coding ENSMUSG00000000544 1 166130238 166166510 ve Gpa33 1.712035563 0.000575487 0.007300836 protein_coding ENSMUSG00000022679 16 13903161 13949619 ve Mpv17l 1.712620572 5.25E-09 2.54E-07 protein_coding ENSMUSG00000089991 1 139862957 139936477 -ve Gm16332 1.71323453 0.000382827 0.005246057 unprocessed_pseudogene ENSMUSG00000015766 6 137477245 137654876 -ve Eps8 1.714424832 5.94E-05 0.001090506 protein_coding ENSMUSG00000031538 8 22757744 22782847 ve Plat 1.719967825 5.68E-09 2.74E-07 protein_coding ENSMUSG00000041482 18 63010213 63387183 -ve Piezo2 1.720334666 0.000343138 0.004806208 protein_coding ENSMUSG00000032511 9 119483408 119579016 -ve Scn5a 1.723761508 0.000524166 0.006758645 protein_coding ENSMUSG00000037405 9 21015960 21028797 ve Icam1 1.727038071 5.77E-05 0.001065262 protein_coding ENSMUSG00000042182 1 33852052 33907816 -ve Bend6 1.72728719 0.000145086 0.002341227 protein_coding ENSMUSG00000051920 15 43020811 43170818 -ve Rspo2 1.72858519 0.000186791 0.002893735 protein_coding ENSMUSG00000086219 5 116438720 116465487 ve Srrm4os 1.731567864 0.000283655 0.004087607 antisense ENSMUSG00000044022 18 37513621 37518325 ve Pcdhb21 1.736930983 4.52E-05 0.000857854 protein_coding ENSMUSG00000022479 15 97854425 97910630 -ve Vdr 1.737141994 1.23E-05 0.000280301 protein_coding ENSMUSG00000027796 3 54755582 54801257 ve Smad9 1.737236632 4.11E-05 0.000796446 protein_coding ENSMUSG00000034117 19 10937160 10942511 ve Ptgdr2 1.737631143 0.000373675 0.005131755 protein_coding ENSMUSG00000073418 17 34728380 34743882 -ve C4b 1.739561629 0.000445454 0.005881812 protein_coding ENSMUSG00000023092 X 56731787 56793346 ve Fhl1 1.744643807 0.000137731 0.002236978 protein_coding ENSMUSG00000021763 13 113317084 113379711 ve BC067074 1.744743682 0.000415175 0.005595303 protein_coding ENSMUSG00000030834 7 45976380 46030286 -ve Abcc6 1.747416751 0.000437315 0.005796184 protein_coding ENSMUSG00000062866 10 13207717 13474396 -ve Phactr2 1.749374874 8.67E-05 0.001507135 protein_coding ENSMUSG00000047146 10 62804570 62899118 -ve Tet1 1.751595748 3.23E-05 0.000646615 protein_coding ENSMUSG00000052160 12 112760655 112768986 ve Pld4 1.751857075 0.000424969 0.005680109 protein_coding ENSMUSG00000026463 1 133699457 133801041 -ve Atp2b4 1.754877354 2.41E-05 0.000498832 protein_coding ENSMUSG00000022758 16 17561885 17577800 ve P2rx6 1.760146319 0.000203637 0.003121613 protein_coding ENSMUSG00000057337 10 60181532 60219260 -ve Chst3 1.765045026 4.16E-09 2.06E-07 protein_coding ENSMUSG00000033576 15 77044729 77057107 ve Apol6 1.769456275 0.000381231 0.005227964 protein_coding ENSMUSG00000022508 16 23965052 23988852 -ve Bcl6 1.77228321 1.19E-10 7.82E-09 protein_coding ENSMUSG00000019194 7 31116525 31126945 -ve Scn1b 1.776534526 0.000230572 0.003437406 protein_coding ENSMUSG00000027750 3 54361109 54391037 ve Postn 1.77722421 0.000181049 0.002820891 protein_coding ENSMUSG00000011658 7 44896079 44902631 ve Fuz 1.779370665 0.000355024 0.004937376 protein_coding ENSMUSG00000021846 14 48120869 48260883 ve Peli2 1.780209891 0.000358458 0.004962246 protein_coding ENSMUSG00000032122 9 37229149 37255738 -ve Slc37a2 1.780715909 8.05E-06 0.000194921 protein_coding ENSMUSG00000007872 4 136143497 136145755 ve Id3 1.788248645 5.42E-12 4.31E-10 protein_coding ENSMUSG00000068547 3 144952480 144975045 -ve Clca4a 1.800290171 0.000289083 0.004153212 protein_coding ENSMUSG00000029659 5 149411749 149431723 ve Medag 1.801254277 0.000162439 0.002573417 protein_coding ENSMUSG00000022440 15 78523346 78529625 -ve C1qtnf6 1.80297123 0.000233117 0.003469857 protein_coding ENSMUSG00000027460 2 151911210 151945337 ve Angpt4 1.806513085 0.000133515 0.002176692 protein_coding ENSMUSG00000042821 2 167538195 167542814 ve Snai1 1.808636214 1.75E-06 5.12E-05 protein_coding ENSMUSG00000042436 11 61485431 61488900 ve Mfap4 1.811012982 0.000168993 0.002661436 protein_coding ENSMUSG00000054934 10 116417861 116473878 -ve Kcnmb4 1.81217028 0.000179564 0.002802343 protein_coding ENSMUSG00000023022 15 99778470 99875428 -ve Lima1 1.812263583 1.91E-09 1.00E-07 protein_coding ENSMUSG00000040345 10 127323727 127329943 ve Arhgap9 1.81497884 0.000251582 0.003692659 protein_coding ENSMUSG00000103032 1 62809302 62811857 ve Gm37121 1.826138096 0.000222516 0.003346195 TEC ENSMUSG00000026204 1 75247027 75264502 -ve Ptprn 1.827138794 3.73E-05 0.000735344 protein_coding ENSMUSG00000024897 19 23758876 23949597 ve Apba1 1.829597466 8.10E-05 0.001420563 protein_coding ENSMUSG00000056752 11 65831282 66168551 -ve Dnah9 1.830323843 0.00015149 0.002426007 protein_coding ENSMUSG00000035305 4 100095791 100444765 ve Ror1 1.833088301 0.000233297 0.003469857 protein_coding ENSMUSG00000045165 7 127091359 127093986 ve AI467606 1.833191784 2.14E-05 0.000450071 protein_coding ENSMUSG00000044788 11 115279622 115297663 -ve Fads6 1.83395725 0.000115104 0.001914341 protein_coding ENSMUSG00000028019 3 81036416 81214040 ve Pdgfc 1.834455985 4.16E-09 2.06E-07 protein_coding ENSMUSG00000002289 17 33773750 33781575 -ve Angptl4 1.836556017 5.57E-08 2.20E-06 protein_coding ENSMUSG00000031129 9 94669909 95230445 ve Slc9a9 1.845042082 2.65E-05 0.000543597 protein_coding ENSMUSG00000020205 10 111506286 111508645 ve Phlda1 1.847187337 4.28E-09 2.11E-07 protein_coding ENSMUSG00000022864 16 78544012 78576657 -ve D16Ertd472e 1.847585253 2.09E-08 9.05E-07 protein_coding ENSMUSG00000058260 12 103994743 104013755 -ve Serpina9 1.847864139 0.00011795 0.001958234 protein_coding ENSMUSG00000071001 4 43727188 43728639 ve Hrct1 1.84877634 5.64E-08 2.23E-06 protein_coding ENSMUSG00000090891 6 87104746 87112997 ve D6Ertd527e 1.851515502 9.34E-05 0.001608258 protein_coding

33 ENSMUSG00000031762 8 94172618 94173567 ve Mt2 1.853254078 1.04E-11 7.92E-10 protein_coding ENSMUSG00000012428 5 7960457 7982213 ve Steap4 1.868744647 5.93E-05 0.001089901 protein_coding ENSMUSG00000059921 3 141465216 141834924 ve Unc5c 1.87045994 6.17E-05 0.001125672 protein_coding ENSMUSG00000046828 1 44204070 44218961 -ve Mettl21e 1.87225477 6.57E-05 0.0011868 protein_coding ENSMUSG00000020241 10 76595762 76623630 -ve Col6a2 1.872515105 0.000101762 0.00173032 protein_coding ENSMUSG00000022146 15 6813577 6874969 -ve Osmr 1.872905628 6.20E-13 5.58E-11 protein_coding ENSMUSG00000031070 7 145300828 145309557 ve Mrgprf 1.877193245 7.27E-05 0.001290331 protein_coding ENSMUSG00000085766 2 27882925 27887052 -ve 2810430I11Rik 1.877406966 0.00010226 0.001737002 processed_transcript ENSMUSG00000100980 1 91798528 91802937 -ve Gm29100 1.879543625 2.53E-06 7.10E-05 antisense ENSMUSG00000037855 10 67886103 67912662 -ve Zfp365 1.880858821 2.67E-05 0.000547324 protein_coding ENSMUSG00000033768 19 6418731 6544169 ve Nrxn2 1.885719416 6.90E-05 0.001235568 protein_coding ENSMUSG00000017400 11 98036623 98053462 -ve Stac2 1.888663208 0.000119272 0.001973416 protein_coding ENSMUSG00000036334 3 59316735 59344394 -ve Igsf10 1.89039658 0.000147776 0.00237254 protein_coding ENSMUSG00000037868 10 67535475 67542188 ve Egr2 1.890637705 1.65E-07 5.96E-06 protein_coding ENSMUSG00000028698 4 116221618 116303056 ve Pik3r3 1.893409838 6.02E-11 4.12E-09 protein_coding ENSMUSG00000030074 6 100704734 100810913 ve Gxylt2 1.896347289 1.02E-07 3.87E-06 protein_coding ENSMUSG00000029070 4 155839680 155844088 ve Mxra8 1.898048518 3.83E-10 2.30E-08 protein_coding ENSMUSG00000040428 7 45526330 45554229 ve Plekha4 1.905868739 4.20E-06 0.000111798 protein_coding ENSMUSG00000028581 4 130913125 130936141 ve Laptm5 1.906142067 0.000104393 0.00176715 protein_coding ENSMUSG00000023224 2 84765387 84775444 -ve Serping1 1.910703246 0.000100828 0.001722084 protein_coding ENSMUSG00000015468 17 34564268 34588503 ve Notch4 1.910809301 1.62E-06 4.79E-05 protein_coding ENSMUSG00000048218 15 97244074 97247287 -ve Amigo2 1.912674565 5.10E-07 1.65E-05 protein_coding ENSMUSG00000040260 17 49456022 49564337 -ve Daam2 1.913547468 3.12E-05 0.000626017 protein_coding ENSMUSG00000029718 5 137605103 137613784 -ve Pcolce 1.913891222 1.62E-11 1.20E-09 protein_coding ENSMUSG00000089769 17 12818793 12819537 ve Gm16574 1.916398649 0.000107187 0.001806818 processed_pseudogene ENSMUSG00000029126 5 38137192 38159907 -ve Nsg1 1.916883962 7.41E-05 0.001310876 protein_coding ENSMUSG00000094626 6 120488939 120493807 -ve Cecr6 1.918008464 0.000110637 0.001854667 protein_coding ENSMUSG00000001119 10 76708792 76726168 -ve Col6a1 1.924139197 0.000101676 0.00173032 protein_coding ENSMUSG00000025969 1 62703285 62818695 ve Nrp2 1.92506436 8.41E-13 7.47E-11 protein_coding ENSMUSG00000043460 15 78670022 78718113 -ve Elfn2 1.925517997 0.000112324 0.001877974 protein_coding ENSMUSG00000027858 3 102734529 102801513 ve Tspan2 1.928006767 1.02E-06 3.12E-05 protein_coding ENSMUSG00000078920 11 49076587 49096974 ve Ifi47 1.928119437 1.80E-05 0.00038857 protein_coding ENSMUSG00000108801 7 127691935 127700793 ve 1.92889248 2.01E-05 0.000425691 lincRNA ENSMUSG00000021835 14 46383520 46390669 -ve Bmp4 1.929945672 2.64E-13 2.55E-11 protein_coding ENSMUSG00000073650 1 74362108 74369321 ve Catip 1.930468725 2.62E-06 7.32E-05 protein_coding ENSMUSG00000020251 10 82650433 82690650 -ve Glt8d2 1.932659933 3.50E-08 1.43E-06 protein_coding ENSMUSG00000038068 13 47122720 47247991 ve Rnf144b 1.940065602 4.79E-07 1.57E-05 protein_coding ENSMUSG00000029096 5 35652023 35679782 -ve Htra3 1.940961872 8.99E-05 0.001556532 protein_coding ENSMUSG00000028024 3 129269175 129332720 -ve Enpep 1.941573174 9.74E-05 0.001672524 protein_coding ENSMUSG00000104346 18 37674307 37841873 ve Pcdhga3 1.944159394 4.63E-05 0.000876199 protein_coding ENSMUSG00000004791 12 85166639 85177296 -ve Pgf 1.944606049 2.40E-05 0.000497235 protein_coding ENSMUSG00000025429 18 77794545 77882007 ve Pstpip2 1.945260398 4.84E-07 1.58E-05 protein_coding ENSMUSG00000042485 14 30879257 30881608 ve Mustn1 1.94526233 6.56E-05 0.001186379 protein_coding ENSMUSG00000037447 1 36307733 36324029 ve Arid5a 1.94593267 2.22E-08 9.47E-07 protein_coding ENSMUSG00000078247 17 12741311 12860122 ve Airn 1.949120698 6.93E-05 0.001239634 antisense ENSMUSG00000041695 11 111066164 111076821 ve Kcnj2 1.958220171 3.99E-05 0.000777203 protein_coding ENSMUSG00000026471 1 155127277 155146814 -ve Mr1 1.961651679 1.69E-05 0.000370935 protein_coding ENSMUSG00000097926 18 5572824 5575055 -ve Gm26575 1.968696012 7.20E-05 0.00128017 sense_intronic ENSMUSG00000020057 10 88322804 88379080 -ve Dram1 1.968997127 1.05E-08 4.79E-07 protein_coding ENSMUSG00000033350 9 95399292 95406722 -ve Chst2 1.97212363 4.75E-05 0.000896335 protein_coding ENSMUSG00000028464 4 43514711 43523765 -ve Tpm2 1.97413448 1.08E-08 4.92E-07 protein_coding ENSMUSG00000028369 4 58042442 58206859 -ve Svep1 1.9753773 3.61E-05 0.000714614 protein_coding ENSMUSG00000066842 1 150562524 150993435 -ve Hmcn1 1.979445605 3.96E-05 0.000774996 protein_coding ENSMUSG00000040723 1 165646516 165709757 -ve Rcsd1 1.984770083 6.82E-05 0.001221602 protein_coding ENSMUSG00000052248 2 45111138 45114087 ve Zeb2os 1.991602771 5.39E-05 0.000999584 antisense ENSMUSG00000068227 15 78480553 78495066 -ve Il2rb 1.993954857 5.98E-05 0.001096069 protein_coding ENSMUSG00000027230 2 91982328 92024502 -ve Creb3l1 2.003176677 5.81E-07 1.85E-05 protein_coding ENSMUSG00000027470 2 152911352 152923068 ve Mylk2 2.010093935 1.40E-05 0.000314592 protein_coding ENSMUSG00000020577 12 36014557 36042500 -ve Tspan13 2.010431293 5.47E-06 0.000140109 protein_coding ENSMUSG00000067736 1 24612407 24612700 -ve Gm10222 2.01320637 1.59E-05 0.000351823 unprocessed_pseudogene ENSMUSG00000069892 11 49015874 49051242 -ve 9930111J21Rik2 2.013511184 4.72E-05 0.000891348 protein_coding ENSMUSG00000047428 17 46297421 46303271 ve Dlk2 2.015248444 5.58E-07 1.79E-05 protein_coding ENSMUSG00000049775 X 167207093 167209315 -ve Tmsb4x 2.016679553 5.29E-06 0.000136199 protein_coding ENSMUSG00000039126 19 16956118 17223932 ve Prune2 2.0205191 4.97E-05 0.0009295 protein_coding ENSMUSG00000029816 6 49036546 49070929 ve Gpnmb 2.021998904 2.49E-05 0.000513593 protein_coding ENSMUSG00000108601 7 73422250 73423902 ve 2.043588648 3.37E-05 0.000673871 TEC ENSMUSG00000020573 12 32173473 32208659 -ve Pik3cg 2.04904286 3.84E-05 0.000753546 protein_coding ENSMUSG00000027220 2 92915098 92956058 ve Syt13 2.050301503 2.25E-05 0.000470831 protein_coding ENSMUSG00000051457 7 127132232 127137823 -ve Spn 2.055903053 1.04E-05 0.000245851 protein_coding ENSMUSG00000031595 8 40926212 40990785 ve Pdgfrl 2.06305252 3.06E-05 0.000616322 protein_coding ENSMUSG00000061048 8 106510913 106556908 ve Cdh3 2.070188741 9.85E-07 3.01E-05 protein_coding ENSMUSG00000040133 2 118277110 118373419 -ve Gpr176 2.072081139 2.40E-12 1.98E-10 protein_coding ENSMUSG00000072235 15 98949841 98953551 -ve Tuba1a 2.077529243 5.37E-13 4.93E-11 protein_coding ENSMUSG00000039621 2 166566342 166713832 -ve Prex1 2.085517919 6.66E-06 0.000166374 protein_coding ENSMUSG00000034612 10 82985498 83195900 ve Chst11 2.088248645 8.06E-17 1.13E-14 protein_coding ENSMUSG00000021091 12 104406729 104414329 ve Serpina3n 2.088967322 1.45E-05 0.000325334 protein_coding ENSMUSG00000069893 11 48946150 48979398 -ve 9930111J21Rik1 2.095313299 2.18E-05 0.000457871 protein_coding ENSMUSG00000107865 6 87252250 87255608 -ve Gm44417 2.097099491 2.36E-05 0.000490292 TEC ENSMUSG00000011256 11 46055992 46147343 ve Adam19 2.09791405 1.16E-05 0.000267339 protein_coding ENSMUSG00000022090 14 70164218 70177681 -ve Pdlim2 2.103458369 1.24E-08 5.54E-07 protein_coding ENSMUSG00000022537 16 30511855 30550842 -ve Tmem44 2.105009578 3.00E-11 2.14E-09 protein_coding ENSMUSG00000013089 16 22381309 22439719 -ve Etv5 2.108472281 3.52E-07 1.18E-05 protein_coding ENSMUSG00000038319 5 24319589 24351604 -ve Kcnh2 2.110726341 6.45E-06 0.000162364 protein_coding ENSMUSG00000009614 2 27188393 27248337 -ve Sardh 2.115348036 5.10E-07 1.65E-05 protein_coding

34 ENSMUSG00000031565 8 25513654 25575714 ve Fgfr1 2.115961463 3.54E-07 1.19E-05 protein_coding ENSMUSG00000079685 10 7444873 7473477 -ve Ulbp1 2.117145503 1.25E-05 0.0002842 protein_coding ENSMUSG00000007805 1 91801461 91848028 ve Twist2 2.118942231 3.96E-21 7.52E-19 protein_coding ENSMUSG00000039239 1 186622792 186705989 -ve Tgfb2 2.120262651 4.88E-07 1.59E-05 protein_coding ENSMUSG00000025328 4 140785365 140810648 -ve Padi3 2.121113712 1.82E-05 0.000392201 protein_coding ENSMUSG00000023411 14 55824795 55833943 ve Nfatc4 2.122828687 1.14E-09 6.11E-08 protein_coding ENSMUSG00000056481 19 5068078 5070637 ve Cd248 2.124067617 1.94E-05 0.000414432 protein_coding ENSMUSG00000005124 15 66891320 66923201 ve Wisp1 2.130255506 6.70E-10 3.79E-08 protein_coding ENSMUSG00000033227 1 74771892 74785322 ve Wnt6 2.139858308 4.77E-06 0.000124514 protein_coding ENSMUSG00000006342 10 75636619 75644008 -ve Susd2 2.145902093 1.88E-06 5.43E-05 protein_coding ENSMUSG00000001240 11 101246028 101259546 ve Ramp2 2.146839143 1.04E-05 0.000244728 protein_coding ENSMUSG00000044337 1 90203980 90216751 ve Ackr3 2.147234694 1.07E-05 0.000250833 protein_coding ENSMUSG00000097993 1 135108497 135132594 -ve Ptprv 2.148836925 1.60E-05 0.000351881 processed_transcript ENSMUSG00000039943 2 135659011 136014593 ve Plcb4 2.151835893 1.17E-14 1.30E-12 protein_coding ENSMUSG00000045730 18 62177817 62179959 -ve Adrb2 2.157234423 6.89E-07 2.16E-05 protein_coding ENSMUSG00000042804 4 152274232 152285337 ve Gpr153 2.161551186 4.51E-06 0.000118609 protein_coding ENSMUSG00000036103 18 9707648 9877995 ve Colec12 2.165949258 6.53E-06 0.000163722 protein_coding ENSMUSG00000024663 19 10001669 10038380 ve Rab3il1 2.170687889 6.03E-11 4.12E-09 protein_coding ENSMUSG00000015619 2 9857078 9890034 -ve Gata3 2.175407337 1.97E-09 1.02E-07 protein_coding ENSMUSG00000071637 16 15887286 15888466 ve Cebpd 2.180262869 3.79E-10 2.29E-08 pseudogene ENSMUSG00000039058 3 152462815 152668360 -ve Ak5 2.18660888 2.75E-06 7.58E-05 protein_coding ENSMUSG00000038244 7 112225856 112355194 ve Mical2 2.188181525 1.30E-26 3.70E-24 protein_coding ENSMUSG00000086560 2 28025417 28030437 -ve Gm13372 2.188575107 1.99E-07 7.05E-06 processed_transcript ENSMUSG00000104621 3 152250029 152252803 -ve Gm43185 2.200630019 2.47E-06 6.95E-05 TEC ENSMUSG00000092035 6 4747306 4760517 ve Peg10 2.200849722 1.74E-07 6.24E-06 protein_coding ENSMUSG00000001020 3 90603771 90606045 ve S100a4 2.202503755 1.56E-12 1.32E-10 protein_coding ENSMUSG00000033644 14 70372480 70429094 -ve Piwil2 2.20324383 9.28E-06 0.000221355 protein_coding ENSMUSG00000070720 4 131921771 131923140 ve Tmem200b 2.204658392 9.59E-06 0.00022739 protein_coding ENSMUSG00000053469 15 66670753 66850721 ve Tg 2.205352692 2.66E-06 7.38E-05 protein_coding ENSMUSG00000044734 13 32842092 32851185 -ve Serpinb1a 2.214375602 7.11E-06 0.000175043 protein_coding ENSMUSG00000078922 11 48985327 48994172 -ve Tgtp1 2.219409178 3.83E-07 1.27E-05 protein_coding ENSMUSG00000041923 18 22693181 23041653 -ve Nol4 2.222902547 2.80E-10 1.74E-08 protein_coding ENSMUSG00000101111 1 24613189 24613971 -ve Gm28437 2.226820821 2.95E-06 8.09E-05 unprocessed_pseudogene ENSMUSG00000027253 2 91457511 91513779 ve Lrp4 2.230675738 2.37E-08 1.00E-06 protein_coding ENSMUSG00000019539 7 45082914 45092213 -ve Rcn3 2.234348169 6.51E-06 0.000163247 protein_coding ENSMUSG00000032380 9 66158223 66272242 ve Dapk2 2.237438717 5.09E-07 1.65E-05 protein_coding ENSMUSG00000022265 15 27466677 27594909 ve Ank 2.241277376 9.45E-18 1.40E-15 protein_coding ENSMUSG00000044217 15 99590849 99594829 ve Aqp5 2.246668143 6.59E-06 0.000164868 protein_coding ENSMUSG00000024451 18 37972624 37997574 -ve Arap3 2.253693462 5.42E-08 2.15E-06 protein_coding ENSMUSG00000026840 2 31887291 31946539 ve Lamc3 2.263569977 1.12E-07 4.22E-06 protein_coding ENSMUSG00000097252 3 70772379 70807291 -ve Gm6634 2.264298761 2.96E-08 1.23E-06 lincRNA ENSMUSG00000027208 2 126034658 126091185 ve Fgf7 2.265864221 3.41E-06 9.22E-05 protein_coding ENSMUSG00000100131 1 24611535 24612410 -ve Gm28439 2.270489797 2.02E-06 5.80E-05 unprocessed_pseudogene ENSMUSG00000022144 15 7811011 7837575 ve Gdnf 2.275064702 2.69E-10 1.68E-08 protein_coding ENSMUSG00000079014 12 104263122 104269372 ve Serpina3i 2.277116579 4.78E-07 1.57E-05 protein_coding ENSMUSG00000032085 9 45929628 45936058 -ve Tagln 2.285645067 1.84E-06 5.34E-05 protein_coding ENSMUSG00000052353 7 83932857 84086502 -ve Cemip 2.290880782 4.29E-06 0.000113836 protein_coding ENSMUSG00000026589 1 157506728 157568425 ve Sec16b 2.294248365 3.62E-06 9.77E-05 protein_coding ENSMUSG00000019987 10 24915208 24927470 -ve Arg1 2.295541239 2.29E-06 6.49E-05 protein_coding ENSMUSG00000027221 2 92599707 92615250 ve Chst1 2.312186999 2.65E-06 7.36E-05 protein_coding ENSMUSG00000027978 3 123446913 123506597 ve Prss12 2.32104484 6.56E-07 2.07E-05 protein_coding ENSMUSG00000022464 15 96994823 97055956 -ve Slc38a4 2.324472485 3.05E-06 8.33E-05 protein_coding ENSMUSG00000027611 2 155751117 155755471 ve Procr 2.325346024 5.90E-09 2.84E-07 protein_coding ENSMUSG00000033268 2 122315672 122347972 ve Duox1 2.32808799 2.67E-06 7.40E-05 protein_coding ENSMUSG00000108195 6 87138741 87140852 -ve Gm44415 2.339152437 1.68E-06 4.93E-05 TEC ENSMUSG00000025150 11 120729489 120732114 -ve Cbr2 2.355854346 3.02E-08 1.25E-06 protein_coding ENSMUSG00000091243 16 65815633 65863057 ve Vgll3 2.355956397 2.02E-06 5.80E-05 protein_coding ENSMUSG00000022367 15 56665627 56694539 -ve Has2 2.359669309 1.66E-06 4.88E-05 protein_coding ENSMUSG00000026872 2 44983632 45117395 -ve Zeb2 2.373644466 1.51E-14 1.63E-12 protein_coding ENSMUSG00000055435 8 115682942 115707794 -ve Maf 2.375780472 1.85E-08 8.16E-07 protein_coding ENSMUSG00000029581 5 142960343 142973185 ve Fscn1 2.375940313 1.67E-06 4.92E-05 protein_coding ENSMUSG00000020695 11 105292643 105351139 ve Mrc2 2.381635229 1.34E-07 4.94E-06 protein_coding ENSMUSG00000001995 8 125418063 125492710 -ve Sipa1l2 2.382497103 7.56E-27 2.28E-24 protein_coding ENSMUSG00000070576 5 111417362 111457033 ve Mn1 2.40468665 1.40E-06 4.20E-05 protein_coding ENSMUSG00000062713 16 94085260 94127032 ve Sim2 2.40488666 2.13E-08 9.21E-07 protein_coding ENSMUSG00000070469 7 82335694 82614450 ve Adamtsl3 2.412469098 1.01E-06 3.09E-05 protein_coding ENSMUSG00000006542 1 74738922 74749221 -ve Prkag3 2.428728743 8.21E-07 2.53E-05 protein_coding ENSMUSG00000005360 15 8634124 8710764 -ve Slc1a3 2.462639748 7.75E-07 2.40E-05 protein_coding ENSMUSG00000030088 6 90486427 90600203 ve Aldh1l1 2.463097447 1.15E-07 4.30E-06 protein_coding ENSMUSG00000029093 5 36017180 36398139 -ve Sorcs2 2.472630782 2.76E-22 6.09E-20 protein_coding ENSMUSG00000004540 7 18813937 18821607 -ve Psg17 2.492024986 4.78E-07 1.57E-05 protein_coding ENSMUSG00000023046 15 102144362 102149511 ve Igfbp6 2.500009489 6.18E-08 2.42E-06 protein_coding ENSMUSG00000032246 9 62858104 62875918 ve Calml4 2.508411967 1.13E-07 4.23E-06 protein_coding ENSMUSG00000039497 10 34151394 34207551 -ve Dse 2.508503582 2.14E-21 4.20E-19 protein_coding ENSMUSG00000059901 10 61197112 61273438 -ve Adamts14 2.517075187 1.07E-09 5.77E-08 protein_coding ENSMUSG00000101939 1 24612775 24613119 -ve Gm28438 2.525460242 2.29E-07 7.93E-06 unprocessed_pseudogene ENSMUSG00000037106 15 58510048 58665092 ve Fer1l6 2.528056067 9.30E-12 7.15E-10 protein_coding ENSMUSG00000056870 1 44551511 44796838 ve Gulp1 2.532093312 1.55E-30 6.38E-28 protein_coding ENSMUSG00000029334 5 98929773 99037351 -ve Prkg2 2.538936268 7.27E-08 2.81E-06 protein_coding ENSMUSG00000045761 17 71673261 71729669 ve Fam179a 2.539964615 1.75E-07 6.28E-06 protein_coding ENSMUSG00000026837 2 27886425 28039514 ve Col5a1 2.541635274 4.30E-26 1.17E-23 protein_coding ENSMUSG00000030170 6 119432531 119544347 -ve Wnt5b 2.541855877 1.02E-29 3.87E-27 protein_coding ENSMUSG00000000031 7 142575529 142578143 -ve H19 2.544411445 3.21E-07 1.09E-05 lincRNA ENSMUSG00000031659 8 88272403 88329962 ve Adcy7 2.565124253 2.90E-10 1.79E-08 protein_coding

35 ENSMUSG00000103793 18 37707039 37841873 ve Pcdhga6 2.56786448 2.15E-07 7.53E-06 protein_coding ENSMUSG00000100158 9 41581908 41582283 ve Gm28119 2.573624454 2.28E-07 7.90E-06 sense_intronic ENSMUSG00000030559 7 88430273 88491572 ve Rab38 2.582004705 2.89E-08 1.21E-06 protein_coding ENSMUSG00000031740 8 92827328 92853417 ve Mmp2 2.585266865 2.20E-08 9.40E-07 protein_coding ENSMUSG00000048387 12 9574442 9581499 ve Osr1 2.587880313 3.34E-08 1.37E-06 protein_coding ENSMUSG00000064272 1 74278550 74279624 ve Gpbar1 2.590017386 4.44E-15 5.27E-13 protein_coding ENSMUSG00000032401 9 64117147 64138118 ve Lctl 2.597390642 1.74E-07 6.24E-06 protein_coding ENSMUSG00000056888 10 111985448 112002631 -ve Glipr1 2.607086344 1.65E-07 5.97E-06 protein_coding ENSMUSG00000058297 10 60106219 60135198 ve Spock2 2.610144974 2.99E-08 1.24E-06 protein_coding ENSMUSG00000056174 4 126286793 126314330 ve Col8a2 2.615641638 4.17E-13 3.90E-11 protein_coding ENSMUSG00000103037 18 37680233 37841870 ve Pcdhgb1 2.626292341 1.30E-07 4.79E-06 protein_coding ENSMUSG00000039145 2 5293457 5714515 -ve Camk1d 2.629614952 6.28E-19 1.04E-16 protein_coding ENSMUSG00000038903 18 69925426 69969484 ve Ccdc68 2.640272334 1.08E-07 4.08E-06 protein_coding ENSMUSG00000015053 6 88193891 88207032 ve Gata2 2.642563399 2.23E-08 9.52E-07 protein_coding ENSMUSG00000036533 17 79334025 79355091 -ve Cdc42ep3 2.651460955 1.38E-13 1.38E-11 protein_coding ENSMUSG00000032332 9 79598991 79718831 -ve Col12a1 2.654685698 5.18E-13 4.78E-11 protein_coding ENSMUSG00000104610 3 137289639 137300708 ve Gm567 2.670582572 2.55E-09 1.30E-07 lincRNA ENSMUSG00000021904 14 31217860 31230350 ve Sema3g 2.670824973 3.24E-10 1.98E-08 protein_coding ENSMUSG00000039103 3 152236982 152266350 -ve Nexn 2.673184002 2.70E-17 3.88E-15 protein_coding ENSMUSG00000006586 4 13743436 13893649 ve Runx1t1 2.675877621 7.61E-08 2.94E-06 protein_coding ENSMUSG00000027204 2 125300594 125507993 -ve Fbn1 2.681023298 1.82E-08 8.05E-07 protein_coding ENSMUSG00000026817 2 32621758 32635058 ve Ak1 2.695930723 3.76E-18 5.85E-16 protein_coding ENSMUSG00000073821 4 63979854 64149924 ve 8030451A03Rik 2.709382865 2.14E-08 9.23E-07 processed_transcript ENSMUSG00000053030 5 77205107 77211471 -ve Spink2 2.711388748 2.32E-08 9.84E-07 protein_coding ENSMUSG00000026167 1 74791516 74804179 ve Wnt10a 2.721961819 4.64E-08 1.87E-06 protein_coding ENSMUSG00000052688 1 131688695 131715439 ve Rab7b 2.73486142 1.32E-11 9.88E-10 protein_coding ENSMUSG00000051323 X 133582860 133688987 -ve Pcdh19 2.737260221 8.87E-10 4.86E-08 protein_coding ENSMUSG00000032334 9 58287723 58313212 -ve Loxl1 2.750042112 2.70E-09 1.37E-07 protein_coding ENSMUSG00000050737 2 30889471 30929863 -ve Ptges 2.758274581 6.19E-09 2.94E-07 protein_coding ENSMUSG00000031486 8 27085583 27123436 ve Adgra2 2.759424625 7.27E-14 7.46E-12 protein_coding ENSMUSG00000017737 2 164940780 164955850 ve Mmp9 2.766436028 7.42E-12 5.82E-10 protein_coding ENSMUSG00000066363 12 104214544 104221129 ve Serpina3f 2.772480862 5.19E-09 2.52E-07 protein_coding ENSMUSG00000049404 3 67478972 67515523 -ve Rarres1 2.779528294 2.40E-08 1.02E-06 protein_coding ENSMUSG00000026251 1 87190607 87200070 ve Chrnd 2.781835913 2.17E-08 9.32E-07 protein_coding ENSMUSG00000050556 2 167095969 167190155 -ve Kcnb1 2.784102912 9.97E-10 5.40E-08 protein_coding ENSMUSG00000040624 10 3740364 3967303 ve Plekhg1 2.796113214 4.42E-10 2.61E-08 protein_coding ENSMUSG00000020181 10 109682660 110456204 -ve Nav3 2.802102112 8.99E-18 1.34E-15 protein_coding ENSMUSG00000054675 5 113793729 113800516 -ve Tmem119 2.80237454 1.87E-08 8.22E-07 protein_coding ENSMUSG00000029468 5 122643911 122691432 ve P2rx7 2.804765879 9.99E-09 4.60E-07 protein_coding ENSMUSG00000100862 1 24613974 24614651 -ve Gm10925 2.830391861 9.70E-09 4.47E-07 unprocessed_pseudogene ENSMUSG00000066720 17 23682584 23684018 -ve Cldn9 2.856353766 1.01E-08 4.64E-07 protein_coding ENSMUSG00000074272 7 25461707 25477603 -ve Ceacam1 2.86158985 8.07E-09 3.78E-07 protein_coding ENSMUSG00000018217 11 63128982 63159547 ve Pmp22 2.865867866 7.54E-09 3.55E-07 protein_coding ENSMUSG00000027800 3 57285611 57301988 -ve Tm4sf1 2.867287383 3.22E-26 8.98E-24 protein_coding ENSMUSG00000041449 12 104247905 104253669 ve Serpina3h 2.872478823 4.37E-10 2.58E-08ribed_unprocessed_pseudogene ENSMUSG00000067276 X 143802231 143827414 -ve Capn6 2.911548569 4.76E-09 2.32E-07 protein_coding ENSMUSG00000021253 12 86056744 86079041 -ve Tgfb3 2.924212346 6.20E-15 7.09E-13 protein_coding ENSMUSG00000028197 3 145292472 145552011 ve Col24a1 2.928720961 3.92E-09 1.95E-07 protein_coding ENSMUSG00000027339 2 131989415 132030258 -ve Rassf2 2.930671444 2.81E-21 5.45E-19 protein_coding ENSMUSG00000047747 8 82863356 83091271 ve Rnf150 2.945444051 2.24E-09 1.16E-07 protein_coding ENSMUSG00000001870 17 75005568 75392512 ve Ltbp1 2.962628509 4.37E-33 2.02E-30 protein_coding ENSMUSG00000056055 1 87803680 87845158 ve Sag 2.973854972 8.32E-11 5.58E-09 protein_coding ENSMUSG00000005958 16 21204755 21223305 ve Ephb3 2.987390293 5.92E-12 4.69E-10 protein_coding ENSMUSG00000038463 1 170644532 170682789 ve Olfml2b 2.995683023 6.33E-16 8.02E-14 protein_coding ENSMUSG00000031375 X 73483602 73495933 ve Bgn 3.030331687 7.70E-10 4.28E-08 protein_coding ENSMUSG00000035279 7 4925785 4944826 ve Ssc5d 3.035341479 7.36E-14 7.52E-12 protein_coding ENSMUSG00000061751 16 33974258 34573532 -ve Kalrn 3.036175284 5.12E-30 2.02E-27 protein_coding ENSMUSG00000039883 5 21543559 21575904 ve Lrrc17 3.045355895 7.27E-10 4.07E-08 protein_coding ENSMUSG00000044229 9 48362041 48400025 ve Nxpe4 3.066788557 2.20E-10 1.39E-08 protein_coding ENSMUSG00000002257 17 28207778 28228608 ve Def6 3.067644276 4.06E-10 2.42E-08 protein_coding ENSMUSG00000062380 8 123411424 123422015 ve Tubb3 3.076371334 3.09E-11 2.20E-09 protein_coding ENSMUSG00000028989 4 148495183 148500460 -ve Angptl7 3.103234264 6.55E-11 4.46E-09 protein_coding ENSMUSG00000021185 12 100779057 100896981 ve 9030617O03Rik 3.115457368 3.17E-15 3.81E-13 protein_coding ENSMUSG00000006403 1 171250421 171260637 ve Adamts4 3.123249332 5.15E-19 8.58E-17 protein_coding ENSMUSG00000026674 1 169972307 170110762 -ve Ddr2 3.15258821 1.40E-10 9.03E-09 protein_coding ENSMUSG00000037892 3 49743296 49757325 -ve Pcdh18 3.164689213 2.71E-18 4.26E-16 protein_coding ENSMUSG00000061603 12 52699383 53151015 ve Akap6 3.172315378 2.00E-11 1.47E-09 protein_coding ENSMUSG00000026207 1 75375297 75432320 ve Speg 3.178480048 5.78E-16 7.37E-14 protein_coding ENSMUSG00000025092 19 58795751 58860984 -ve Hspa12a 3.25559039 4.54E-18 7.01E-16 protein_coding ENSMUSG00000048096 1 135324807 135368065 ve Lmod1 3.296093044 2.18E-12 1.81E-10 protein_coding ENSMUSG00000090053 4 57434247 57712016 ve Palm2 3.297803126 1.31E-11 9.82E-10 protein_coding ENSMUSG00000032561 9 104288316 104337728 -ve Acpp 3.322825072 2.28E-11 1.66E-09 protein_coding ENSMUSG00000038248 10 43002500 43174530 -ve Sobp 3.332787559 1.95E-11 1.44E-09 protein_coding ENSMUSG00000022483 15 97975602 98004695 -ve Col2a1 3.348045537 1.59E-13 1.58E-11 protein_coding ENSMUSG00000032024 9 40685962 40785319 ve Clmp 3.385013595 9.17E-12 7.11E-10 protein_coding ENSMUSG00000019970 10 21882184 21999903 ve Sgk1 3.387377032 3.98E-49 3.60E-46 protein_coding ENSMUSG00000026494 1 178529125 178939200 ve Kif26b 3.394420572 8.13E-12 6.35E-10 protein_coding ENSMUSG00000032717 17 47815328 47834691 -ve Mdfi 3.411192573 1.14E-12 9.88E-11 protein_coding ENSMUSG00000063558 1 58029931 58106413 ve Aox1 3.412092301 2.80E-13 2.70E-11 protein_coding ENSMUSG00000030772 7 112116019 112159057 -ve Dkk3 3.474755708 2.52E-12 2.04E-10 protein_coding ENSMUSG00000017493 11 99041244 99054392 ve Igfbp4 3.484909468 1.37E-15 1.68E-13 protein_coding ENSMUSG00000021798 14 34526699 34588681 -ve Ldb3 3.486051507 1.36E-16 1.83E-14 protein_coding ENSMUSG00000024087 17 79706953 79715041 -ve Cyp1b1 3.488785108 2.51E-12 2.04E-10 protein_coding ENSMUSG00000000753 11 75409769 75422701 -ve Serpinf1 3.489522074 3.13E-16 4.05E-14 protein_coding

36 ENSMUSG00000044827 5 64924679 64933563 -ve Tlr1 3.506533219 9.56E-14 9.60E-12 protein_coding ENSMUSG00000046546 16 30599723 30602797 ve Fam43a 3.547984773 5.14E-20 9.40E-18 protein_coding ENSMUSG00000032572 9 105989454 106096783 -ve Col6a4 3.550221141 9.92E-13 8.72E-11 protein_coding ENSMUSG00000086181 3 38874570 38888259 -ve C230034O21Rik 3.554225265 6.11E-13 5.53E-11 antisense ENSMUSG00000021390 13 49608071 49624500 ve Ogn 3.567670907 2.10E-13 2.04E-11 protein_coding ENSMUSG00000028364 4 63959785 64047015 -ve Tnc 3.570949898 8.06E-20 1.43E-17 protein_coding ENSMUSG00000027848 3 103722222 103738001 -ve Olfml3 3.609227793 4.82E-15 5.61E-13 protein_coding ENSMUSG00000022665 16 45093402 45127924 ve Ccdc80 3.693924357 2.08E-15 2.53E-13 protein_coding ENSMUSG00000022562 15 76296597 76328015 -ve Oplah 3.716226646 1.71E-46 1.41E-43 protein_coding ENSMUSG00000057182 2 65457118 65567627 -ve Scn3a 3.734829768 1.30E-14 1.43E-12 protein_coding ENSMUSG00000022887 16 23451785 23520590 -ve Masp1 3.749579159 9.40E-16 1.17E-13 protein_coding ENSMUSG00000074415 9 41376397 41617772 ve 2610203C20Rik 3.786964107 6.70E-17 9.42E-15 processed_transcript ENSMUSG00000030220 6 136923655 136941899 -ve Arhgdib 3.812481065 1.18E-16 1.60E-14 protein_coding ENSMUSG00000022510 16 25683763 25892102 ve Trp63 3.825749135 4.80E-15 5.61E-13 protein_coding ENSMUSG00000022371 15 55307750 55520803 ve Col14a1 3.831969233 4.73E-15 5.58E-13 protein_coding ENSMUSG00000019929 10 97479500 97518162 ve Dcn 3.838116665 1.33E-14 1.45E-12 protein_coding ENSMUSG00000035373 11 82045712 82047525 ve Ccl7 3.925484805 9.16E-17 1.27E-14 protein_coding ENSMUSG00000026208 1 75360329 75368579 ve Des 3.931410554 1.40E-27 4.50E-25 protein_coding ENSMUSG00000040653 10 3366150 3464975 ve Ppp1r14c 3.956067008 1.24E-42 8.44E-40 protein_coding ENSMUSG00000055538 14 25711642 25769039 -ve Zcchc24 4.023877532 1.31E-28 4.60E-26 protein_coding ENSMUSG00000022309 15 42424727 42676977 -ve Angpt1 4.060411383 6.42E-18 9.83E-16 protein_coding ENSMUSG00000041481 12 104236245 104241939 ve Serpina3g 4.133815202 1.67E-33 7.93E-31 protein_coding ENSMUSG00000024501 18 43320979 43438286 -ve Dpysl3 4.148654309 2.06E-18 3.26E-16 protein_coding ENSMUSG00000049872 10 34091352 34096519 -ve Fam26e 4.220874969 1.21E-23 2.91E-21 protein_coding ENSMUSG00000045092 3 115710433 115715072 -ve S1pr1 4.248130469 6.45E-22 1.33E-19 protein_coding ENSMUSG00000051048 7 100285520 100319699 ve P4ha3 4.357269453 1.17E-27 3.83E-25 protein_coding ENSMUSG00000025887 9 5345430 5373032 ve Casp12 4.364982949 2.95E-22 6.44E-20 protein_coding ENSMUSG00000097789 7 84528954 84583531 ve Gm2115 4.377701194 1.17E-25 3.05E-23 lincRNA ENSMUSG00000020101 10 60346851 60372684 ve Vsir 4.414471987 1.16E-25 3.05E-23 protein_coding ENSMUSG00000002020 12 84783212 84876532 -ve Ltbp2 4.417436154 1.48E-22 3.30E-20 protein_coding ENSMUSG00000079018 15 75044018 75048830 -ve Ly6c1 4.436519895 6.77E-23 1.55E-20 protein_coding ENSMUSG00000037206 9 58156265 58159221 -ve Islr 4.69377504 5.07E-22 1.07E-19 protein_coding ENSMUSG00000033420 6 87133853 87335821 -ve Antxr1 4.704232296 1.79E-27 5.67E-25 protein_coding ENSMUSG00000004105 2 33216069 33247717 ve Angptl2 4.78828754 6.60E-34 3.21E-31 protein_coding ENSMUSG00000022206 15 11839896 11905674 -ve Npr3 4.80402746 5.46E-25 1.35E-22 protein_coding ENSMUSG00000067818 2 156775420 156781658 ve Myl9 4.859701079 8.04E-28 2.68E-25 protein_coding ENSMUSG00000024620 18 61045150 61085061 ve Pdgfrb 5.02270075 1.18E-26 3.39E-24 protein_coding ENSMUSG00000020614 11 109669749 109722279 -ve Fam20a 5.407237728 2.64E-51 2.79E-48 protein_coding ENSMUSG00000026564 1 166098148 166127922 -ve Dusp27 5.425170438 2.58E-36 1.36E-33 protein_coding ENSMUSG00000001506 11 94936224 94953042 ve Col1a1 5.526407684 1.45E-62 2.50E-59 protein_coding ENSMUSG00000026043 1 45311538 45349706 ve Col3a1 5.663053608 7.24E-31 3.12E-28 protein_coding ENSMUSG00000024529 18 52516069 52529867 -ve Lox 5.671780966 1.62E-40 1.02E-37 protein_coding ENSMUSG00000037254 2 10094593 10131396 -ve Itih2 5.735057382 8.83E-35 4.41E-32 protein_coding ENSMUSG00000027797 3 55242364 55539068 ve Dclk1 5.974501774 1.89E-56 2.40E-53 protein_coding ENSMUSG00000006800 2 166073089 166155663 -ve Sulf2 6.23605535 1.93E-82 9.19E-79 protein_coding ENSMUSG00000046743 3 38886940 39011985 ve Fat4 6.466647803 6.53E-70 1.55E-66 protein_coding ENSMUSG00000030218 6 136872435 136875823 -ve Mgp 6.602934405 4.15E-68 8.76E-65 protein_coding ENSMUSG00000039476 2 30834972 30881251 ve Prrx2 6.780725558 7.34E-56 8.71E-53 protein_coding

37 SIGNIFICANCE STATEMENT

Mutation of HNF1B, which encodes the transcription factor HNF-1b, is a cause of autosomal dominant tubulointerstitial kidney disease (ADTKD), but the mechanism whereby mutated HNF-1b leads to renal fibrosis is not known. The authors demonstrated that ablation of HNF-1b is sufficient to induce epithelial–mesenchymal transition (EMT) in vitro and in vivo through derepression of the HNF-1b–regulated gene Twist2 and its downstream target Snai2. Lineage tracing revealed that ablation of HNF-1b induces renal fibrosis via a cell-nonautonomous process involving epithelial/mesenchymal crosstalk. Further, they showed that epithelial cells with mutant HNF-1b secrete high levels of profibrotic TGF-b ligands that activate downstream Smad transcription factors in renal interstitial cells. Collectively, these findings reveal a novel Twist2-dependent EMT pathway that underlies renal fibrosis in HNF1B-related ADTKD.