1 Asia-Pacific Journal of Science and Technology: Volume: 24. Issue: 03. Article ID.: APST-24-03-03. Research Article Asia-Pacific Journal of Science and Technology https://www.tci-thaijo.org/index.php/APST/index Published by the Research and Technology Transfer Affairs Division, Khon Kaen University, Thailand A novel fungus, Mycodomus formicartus associated with black ant, Dolichoderus thoracicus (Smith) on bamboo Wuttiwat Jitjak1 and Niwat Sanoamuang2, 3, * 1International College, Khon Kaen University, Khon Kaen, Thailand. 2Division of Entomology and Plant Pathology, Faculty of Agriculture, Khon Kaen University, Khon Kaen, Thailand. 3Applied Taxonomic Research Center, Khon Kaen University, Khon Kaen, Thailand *Correspondent author: [email protected] Received 1 July 2018 Revised 7 June 2019 Accepted 10 June 2019 Abstract A fungus on a bamboo plant in Dan Sai district, Loei province, Thailand was collected for identification. Its appearance consisted of a grey-to-black matter with pores on the surface attached on a bamboo branch, and a population of black ants, Dolichoderus thoracicus (Smith) was associated with this fungus. Inside its fruiting body, there was a cavity functioning as a nest. With very dense hyphal mass, perithecia with periphyses were produced below the surface of the fruiting body. Asci contained 8 partascospores. The phylogenetic trees using three DNA regions, 18s rDNA, 28s rDNA and internal transcribed spacer suggested that it was in Dothideomycetes, Capnodiaceae but did not fit in any reported genus. Therefore, a new genus Mycodomus and species, Mycodomus formicartus were proposed and described. Keywords: Ant nest, Ant fungus, Black ant, Capnodiaceae, Perithecia 1. Introduction Fungal samples were observed to have gray-to-black lumps with pores on the surface on bamboo branches and collected for identification. Each sample was surrounded by a group of black ants, Dolichoderus thoracicus (Smith). Thus, it was assumed that the fungus was where the ants lived or a nursery for the ants. The body of the samples consisted of various shapes and the mycelium was very dense, which caused the hardness of the fruiting structure. There were also some pores on the surface which served as the means of the ants to travel in and out of the fungal body. The bamboo plant was unharmed by the fungus because it only clung to the branch in different heights, from less than one meter above ground to several meters on top of the bamboo tips. Inside the fruiting body, there was a cavity, which is expected to be where the ants resided in during their early stage. Perithecia were found beneath the surface of the fruiting body containing asci with 8 partascspores arranging themselves spirally. These features were the main unique characteristics of this bambosicolous fungus. Most of the fungal genera are in Sordariomycetes especially in Hypocreaceae, Xylariaceae, Lasiosphaeriaceae, and Clavicipitaceae [1]. There are also Dothideomycete fungi reported on bamboo e.g. Bambusicola massarinia Dai & Hyde, B. bambusae Dai & Hyde, B. irregulispora Dai & Hyde and B. splendid Dai & Hyde in northern Thailand which are Trematosphaeriaceae [2-3]. However, some publications have already reported this. Unspecified fungi from ant nests were found in various tropical regions [4]. The fungi were called Capnodiales spp. functioning as the nest of black ants, Crematogaster. In addition, another unidentified fungal isolate was derived from the nest wall of Dendrolasius and Chthonolasius ants and the fungus in Capnodiales displays mutualism with the ants [5]. However, in both reports, no perfect stage of the fungi was exhibited; only mycelial and conidia were available. A question arose whether the collected sample from Thailand was one of them. Therefore, molecular data of three ribosomal DNA regions, 18s rDNA, 28s rDNA and internal transcribe spacer were employed to perform phylogenetic inferences as well as identify its morphological features. 2 Due to its uniqueness relative to other fungi reported on bamboo and the insufficient number of reported ant- associating fungi, the fruiting bodies of the fungus were subjected to identification and characterization using morphology and molecular data, three rDNA sequences to construct phylogenetic trees. 2. Materials and methods 2.1 Collecting site Fugal samples were found on bamboo branches with different heights. It was found on the branch on top of the tree and only a meter from the ground. The location of the collected samples was in Dan Sai district, Loei Province in April 2015. Black ants were always around the fungal samples. The bamboo branches with the fungal samples including ants were collected for identification. 2.2 Fungal isolation and culture The fruiting bodies of the fungus was dissected in half and attached to the upper side of the Petri dishes containing Water Agar ( WA) and left overnight at room temperature to discharge ascospores. The obtained ascospores on WA surface were transferred onto a new Potato Dextrose Agar (PDA) and incubated for 7 days at 25 C̊ before being transferred into Potato Dextrose Broth (PDB) and incubated for 7 days at 25 C̊ without agitation. In addition, the morphological features of the fruiting bodies were examined and the fungal isolates were aerially cultured to investigate the morphological characters of its teleomorphs for 14-21 days in moist chambers at 25 C̊ . 2.3 DNA extraction Polymerase chain reaction (PCR) and DNA sequencing The fungal colonies on PDB were taken and washed in sterile distilled water for DNA isolation. The genomic DNA of was extracted using the standard method [6]. Of the collected colonies, 1 g were grounded in liquid nitrogen by using a sterile mortar and pestle in lysis buffer consisting of 200 mM Tris-HCl, pH 8.0, 250 mM NaCl, 25 mM EDTA, pH 8.0 and 2% sodium dodecyl sulfate for 700 µL with 2 µL ß-mercaptoethanol. Then, the mixture was transferred into tubes and incubated at 60 C̊ for 1 hr. After that the mixture of chloroform: isoamyl alcohol (24:1) for 700 µL were added and gently mixed before centrifuged at 12,000 rpm for 5 min at 4 C̊ . Only supernatant was transferred to new tubes. Isopropanol, 0.7 times of collected supernatant volume was added then the tubes were kept at -20 C̊ for 20 min. The centrifugation at 12,000 rpm for 5min was to obtain DNA pellets from the tubes then 70% ethanol for 500 µL was used to wash the pellets twice and left at room temperature to be air-dried. The dried DNA pellets were dissolved in 50-µL TE buffer made up of 10 mM Tris-HCl and 1 mM EDTA then followed by the addition of RNase A, 2 µL before being incubated for 20 min at 37 C̊ and 1 µl of Proteinase K was respectively added before 20 min incubation. Chloroform: isoamyl alcohol (24:1) was added, centrifuged 12,000 rpm for 4 min again to clean the DNA solution. The supernatant was transferred to new tubes and they were added with 3 µL of 3M sodium acetate and 150 µL of absolute ethanol and left at -20 C̊ for 30 min. The cleaned DNA pellets were obtained through centrifugation at 12,000 rpm for 10 min and the pellets were cleaned with 70% ethanol then dried at room temperature before re-suspended in TE buffer and kept at -20 C̊ for further experiments. The desired genomic DNA of fungal specific regions informative for fungal classification and identification e.g. 18s rDNA using primers NS1-GTAGTCATATGCTTGTCTC and NS4-CTTCCGTCAATTCCTTTAAG (White et al. 1990), 28s rDNA amplified with primers NL1-GCATATCAATAAGCGGAGGAAAAG and NL4- GGTCCGTGTTTCAAGACGG [7] and 5.8s rDNA using primers, ITS1-TCCGTAGGTGAACCTGCGG, ITS4- TCCTCCGCTTATTGATATGC and ITS5- GGAAGTAAAAGTCGTAACAAGG [6]. The total volume of a PCR mixture was 50 μL containing 100 ng of total DNA, 0.6 mM dNTPs, 2.5 mM MgSO4, 1 µM of each 20 pmol primer, 1x PCR buffer (Thermo Scientific), and 1.5 U of Taq polymerase (Thermo Scientific). The PCR conditions were used as follows. For NS1/NS4 primers, predenaturation was at 95 C̊ for 5 min and 30 cycles of then 95 C̊ for 1 min followed by annealing process at 54 C̊ at 1 min then extension at 72 C̊ for 1 min and final extension at 72 C̊ for 7 min (White et al. 1990). For NL1/NL4, the temperature used for predenaturation was at 94 C̊ for 5 min then followed by 30 cycles of 95 C̊ for 30 s, 55 C̊ for 30 s then 72 C̊ for 1 min and final extension at 72 C̊ for 7 min (O’Donnell 1993). To amplify the ITS regions, the predenaturation temperature was at 95 C̊ for 3 min followed by 35 cycles of 95 C̊ for 1 min, 55 C̊ (ITS1/ITS4), 57 C̊ (ITS4/ITS5) for 1 min then 72 C̊ for 2 min and 72 C̊ for 10 min [6]. Then, 1 µL of PCR products was loaded in 1% agarose gel through the electrophoresis in TBE buffer (1 M Tris, 0.9 M boric acid, and 0.01 M EDTA, pH 8.3) for 1 h then stained with ethidium bromide solution then visualized in gel documentation to determine whether the PCR yields were successful. The PCR products were in-gel purified and sequenced using a BigDye® Terminator v3.1 cycle sequencing kit by First BASE Laboratories, Seri Kembangan, Selangor, Malaysia. 3 2.4 Phylogenetic analysis Sequence Scanner Software v2.0 was used to check unclear chromatogram signals of the sequences which were removed before the alignment. The 18s, 28s and 5. 8s rDNA sequences were retrieved from GenBank (www.ncbi.nlm.nih.gov) as shown in Table 1. The accession numbers of DNA sequences of the fungus were as follows, 9 ITS sequences (KT454973, KT454974, KT454975, KT454976, KT454977, KT454978, KT454979, KT454980 and KT454981), 4 28s rDNA sequences (KT454982, KT454983, KT454984 and KT454985) and 4 18s rDNA sequences (KT454986, KT454987, KT454988 and KT454989).