ATR16 Syndrome: Mechanisms Linking Monosomy to Phenotype 2 3 4 Christian Babbs,*1 Jill Brown,1 Sharon W

bioRxiv preprint doi: https://doi.org/10.1101/768895; this version posted October 7, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

1 ATR16 Syndrome: Mechanisms Linking Monosomy to Phenotype 2 3 4 Christian Babbs,*1 Jill Brown,1 Sharon W. Horsley,1 Joanne Slater,1 Evie Maifoshie,1 5 Shiwangini Kumar,2 Paul Ooijevaar,3 Marjolein Kriek,3 Amanda Dixon-McIver,2 6 Cornelis L. Harteveld,3 Joanne Traeger-Synodinos,4 Douglas Higgs1 and Veronica 7 Buckle*1 8 9 10 11 12 1. MRC Molecular Haematology Unit, MRC Weatherall Institute of Molecular 13 Medicine, University of Oxford, Oxford, UK. 14 15 2. IGENZ Ltd, Auckland, New Zealand. 16 17 3. Department of Clinical Genetics, Leiden University Medical Center, Leiden, The 18 Netherlands. 19 20 4. Department of Medical Genetics, National and Kapodistrian University of Athens, 21 Greece. 22 23 24 25 *Authors for correspondence 26 [email protected] 27 [email protected] 28 29

1 bioRxiv preprint doi: https://doi.org/10.1101/768895; this version posted October 7, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

1 Abstract 2 3 Background: Sporadic deletions removing 100s-1000s kb of DNA, and 4 variable numbers of poorly characterised genes, are often found in patients 5 with a wide range of developmental abnormalities. In such cases, 6 understanding the contribution of the deletion to an individual’s clinical 7 phenotype is challenging. 8 Methods: Here, as an example of this common phenomenon, we analysed 9 34 patients with simple deletions of ~177 to ~2000 kb affecting one allele of 10 the well characterised, gene dense, distal region of chromosome 16 11 (16p13.3), referred to as ATR-16 syndrome. We characterised precise 12 deletion extent and screened for genetic background effects, telomere 13 position effect and compensatory up regulation of hemizygous genes. 14 Results: We find the risk of developmental and neurological abnormalities 15 arises from much smaller terminal chromosome 16 deletions (~400 kb) than 16 previously reported. Beyond this, the severity of ATR-16 syndrome increases 17 with deletion size, but there is no evidence that critical regions determine the 18 developmental abnormalities associated with this disorder. Surprisingly, we 19 find no evidence of telomere position effect or compensatory upregulation of 20 hemizygous genes, however, genetic background effects substantially modify 21 phenotypic abnormalities. 22 Conclusions: Using ATR-16 as a general model of disorders caused by 23 sporadic copy number variations, we show the degree to which individuals 24 with contiguous gene syndromes are affected is not simply related to the 25 number of genes deleted but also depends on their genetic background. We 26 also show there is no critical region defining the degree of phenotypic 27 abnormalities in ATR-16 syndrome and this has important implications for 28 genetic counselling. 29

2 bioRxiv preprint doi: https://doi.org/10.1101/768895; this version posted October 7, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

1 Introduction 2 3 Cytogenetic, molecular genetic, and more recently, next generation sequencing 4 (NGS) approaches have revealed copy number variations (CNVs) in the human 5 genome ranging from 1 to 1000s kb (Iafrate et al., 2004; MacDonald et al., 2014). 6 CNVs are common in normal individuals and have been identified in ~35% of the 7 human genome (Iafrate et al., 2004). When present as hemizygous events, in 8 phenotypically “normal” individuals, these imbalances are considered benign; 9 however, CNVs are also amongst the most common causes of human genetic 10 disease and they have been associated with a wide range of developmental 11 disabilities present in up to 14% of the population (Kaminsky et al., 2011). 12 CNVs have been shown to play an important role in neurodevelopmental 13 disorders including autism spectrum disorder, bipolar disorder, and schizophrenia as 14 well as influencing broader manifestations such as learning disabilities, abnormal 15 physical characteristics and seizures (reviewed in Merikangas et al., 2009). Some 16 CNVs occur recurrently in association with one particular phenotype: for example, 17 deletions within 16p11.2 and/or chromosome 22q are frequently associated with 18 autism, and deletions within 15q13.3 and 1q21.1 are found in schizophrenia. 19 However, the impact of most sporadic CNVs on phenotype is much less clear 20 (Merikangas et al., 2009). Difficulty in interpreting CNVs particularly occurs when 21 they result from complex rearrangements such as those associated with unbalanced 22 translocations, inversions, and imprinting effects. 23 To understand the principles and mechanisms by which CNVs lead to 24 developmental abnormalities we have simplified the issue by studying the 25 relationship between uncomplicated deletions within the region ~0.3 to ~2 Mb in the 26 sub-telomeric region of chromosome 16 and the resulting phenotypes. The 34 27 individuals studied here (comprising 11 new and 23 previously reported cases) 28 represent a cohort of patients with the α-thalassaemia mental retardation contiguous 29 gene syndrome, involving the chromosomal region 16p13.3, termed ATR-16 30 syndrome (MIM 141750) (Wilkie et al., 1990). 31 Individuals studied here have monosomy for various extents of the gene-rich 32 telomeric region at 16p13.3 and all have α-thalassemia resulting from loss of both 33 paralogous α-globin genes. Some patients also have mental retardation (MR), 34 developmental abnormalities and/or speech delay and facial dysmorphism. The most 35 severe cases also manifest abnormalities of the axial skeleton. By precisely defining 36 the endpoints of deletions within 16p13.3 we address whether the associated 37 neurological and developmental defects are simply related to the size of the deletions

3 bioRxiv preprint doi: https://doi.org/10.1101/768895; this version posted October 7, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

1 and the number of genes removed, whether there are critical haploinsufficient genes 2 within this region and whether similar sized deletions always lead to the same 3 phenotypes. Our findings suggest that while the loss of an increased number of 4 genes tends to underlie more severe phenotypic abnormalities, the genetic 5 background in which these deletions occur contributes to the occurrence of mental 6 retardation and developmental abnormalities. 7 Finally, this subgroup of ATR-16 patients also allowed us to address two 8 long-standing questions associated with large sub-cytogenetic deletions: those of 9 compensatory gene expression and telomere proximity effect (TPE) in cases of 10 telomere repaired chromosomal breakages. 11

4 bioRxiv preprint doi: https://doi.org/10.1101/768895; this version posted October 7, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

1 Methods 2 3 Patients 4 Ethical approval was obtained under the title “Establishing the molecular basis for 5 atypical forms of thalassaemia” (reference number MREC: 03/8/097) with written 6 consent from patients and/or parents. Here we focus on a cohort of patients with 7 pure monosomy within 16p13.3 to clarify the effect of the deletion. Number of familial 8 cases. 9 10 Fluorescence in situ Hybridisation (FISH) 11 FISH studies were carried out on fixed chromosome preparations as previously 12 described (Buckle and Rack, 1993) from seven patients (OY, TY, SH, MY, YA using 13 a series of cosmids covering the terminal 2 Mb of chromosome 16p (Supplementary 14 Table 1). FISH studies were also performed using probes specific for the sub- 15 telomeric regions of each chromosome in order to exclude any cryptic chromosomal 16 rearrangements. Subtelomeric rearrangements were detected as previously 17 described (Knight et al., 1997 and Horsley et al., 2001). 18 . 19 20 Southern Blotting 21 Single copy probes labelled with α32P-dCTP were synthesized and used to hybridize 22 Southern blots of DNA isolated from transformed lymphoblastoid cells. 23 24 PCR Detection of Chromosomal Deletions 25 DNA was extracted from mouse/human hybrid cell lines or transformed 26 lymphoblastoid lines. Based on FISH results with chromosome 16 cosmids, primer 27 pairs were designed located at regular intervals across the breakpoint clone. To 28 refine the 16p breakpoint, PCR amplification was performed using normal and 29 abnormal patient hybrid DNA obtained from mouse erythroleukemia (MEL cells) 30 fused to patient cells and selected to contain a single copy of human chromosome 16 31 generated as previously described (Zeitlin & Weatherall, 1983) as template. A 32 positive PCR indicated the sequence was present; a negative PCR indicated it was

33 deleted. All reactions were carried out in 1.5 mM MgCl2, 200 μM dNTPs, 2U of 34 FastStart Taq DNA polymerase (Roche), 1x FastStart PCR Reaction buffer (Roche)

35 (50mM Tris-HCl, 10 mM KCl, 5 mM (NH4)2SO4, pH 8.3). A list of the primer pairs is 36 shown in Supplementary Table 2. 37

5 bioRxiv preprint doi: https://doi.org/10.1101/768895; this version posted October 7, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

1 2 Telomere Anchored PCR Amplification 3 Telomere-anchored PCR was undertaken using a primer containing canonical 4 telomeric repeats in conjunction with a reverse primer specific for the normal 16p 5 sequence (primer sequences provided in Supplementary Table 2). As the telomere 6 repeat primer hybridises at any location in telomere repeats, heterogeneous 7 amplification products were produced. Amplification products were purified and 8 digested with restriction endonucleases BamHI or EcoRI and products ligated into 9 appropriately prepared pBluescript. Resulting colonies were screened for inserts and 10 DNA Sanger sequenced. 11 12 Quantification of gene expression 13 Total RNA was isolated from Epstein-Barr virus transformed lymphoblastoid cell lines 14 for 10 patients and 20 control individuals using TRI® reagent. cDNA synthesis was 15 performed with the AffinityScriptTM kit (Stratagene). Where gene expression was 16 measured by quantitative real-time PCR TaqMan® Gene Expression Assays Applied 17 Biosystems (ABI, www.appliedbiosystems.com) were used. Genes and assay 18 numbers were: POLR3K (Hs00363121_m1), C16orf33 (Hs00430677_m1), C16orf35 19 custom assay (Forward; CAACGCCCTCAGCTTTGG, Reverse; 20 GCTGGTGAGGGTCATGTCATC, Probe; CCCCAACCAGCAGC), LUC7L 21 (Hs00216077_m1), AXIN1 (Hs00394718_m1), MRPL28 (Hs00371771_m1), TMEM8 22 (Hs00430491_m1), NME4 (Hs00359037_m1), DECR2 (Hs00430406_m1), 23 Rab11FIP3 (Hs00608512_m1) ACTB (Hs99999903_m1). Two custom assays were 24 obtained from Eurogentec (www.uk.eurogentec.com): MPG (Forward; 5'- 25 GCATCTATTTCTCAAGCCCAAAG-3', Reverse; 5'- 26 GGAGTTCTGTGCCATTAGGAAGTC-3', Probe; 5'- 27 AGTTCTTCGACCAGCCGGCAGTCC-3') and C16orf9 (Forward; 5'- 28 GGCGGCCCGTTCAAG-3', Reverse; 5'-GAGCCCACAAGAAGCACA-3', Probe; 5'-

29 TCCCAGGGAACGCCGGTG-3'). Analysis was performed using the comparative CT

30 Method (ΔΔCT) (Livak et al., 2001). Data in Figure 3A were obtained by amplification 31 and Sanger sequencing of informative polymorphisms from genomic DNA and cDNA. 32 33 Array Comparative Genomic Hybridisation (aCGH) 34 DNA from patient LA was tested using an 8 x 60K SurePrint G3 custom CGH + SNP 35 microarray (Agilent) and analysed using Agilent Cytogenomics software 4.0. 36 Genomic DNA from patients NL and BAR was analysed using a custom fine tiling 37 array covering the alpha- and beta-globin gene clusters and surrounding areas was

6 bioRxiv preprint doi: https://doi.org/10.1101/768895; this version posted October 7, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

1 used (Roche NimbleGen, Madison, WI, USA). Array design was based on NCBI 2 Build 36.1 (hg18) and used as previously described (Phylipsen et al., 2012). 3 Genomic DNA from patients SH(Ju) and SH(Pa) were tested using CytoScan HD 4 arrays (Affymetrix) and analysed using Karyoview software. aCGH was performed 5 with genomic DNA from patients CJ, IM and YA using the Sentrix Human CNV370 6 BeadChip (Illumina) and analysed using GenomeStudio software. 7 8 Whole Genome Sequencing (WGS) 9 WGS was carried out at Edinburgh Genomics, The University of Edinburgh. The 10 pathogenicity of each variant was given a custom deleterious score based on a six- 11 point scale, (Fu et al., 2013) calculated using output from ANNOVAR (Wang et al., 12 2010). This was used to prioritise variants present in the hemizygous region of 13 chr16p13.3 in each patient and also genome wide.

7 bioRxiv preprint doi: https://doi.org/10.1101/768895; this version posted October 7, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

1 Results 2 3 Clinical Features of ATR-16 Syndrome 4 All individuals with ATR-16 syndrome have α-thalassemia because at two of the four 5 paralogous α-globin genes are deleted (--/αα) and this manifests as mild 6 hypochromic microcytic anaemia. In combination with a common small deletion 7 involving one α-gene on the non-paralogous allele (--/-α) patients may have a more 8 severe form of α-thlassaemia referred to as HbH disease (Harteveld & Higgs 2010). 9 In addition to α-thalassemia, which is always present, common features of ATR-16 10 syndrome include speech delay, developmental delay and a variable degree of facial 11 dysmorphism and, in severe cases, abnormalities of the axial skeleton. Newly cloned 12 breakpoint sequences are shown in Figure 1; deletions are shown in Figure 2. 13 Deletions larger than 2000 kb including the PKD1 and TSC2 genes lead to severe 14 MR with polycystic kidney disease and tuberous sclerosis respectively (European 15 Polycystic Kidney Disease Consortium, 1994). 16 Eleven patients from 9 families are reported here for the first time (OY, LA, 17 TY(MI), TY(Mi), YA, SH(P), SH(Ju), NL, CJ, MY and BAR) and we refine the 18 breakpoints in 4 previously reported families (BA, TN, IM, LIN). We define 19 breakpoints at the DNA sequence level in 7 of the 13 families studied (Figure 1), 6 of 20 which have been repaired by the addition of a telomere or subtelomere. In the 21 remaining family (SH) the deletion is interstitial and mediated by repeats termed 22 short interspersed nuclear elements (SINEs). 23 24 Identification of Co-Inherited Deleterious Loci 25 Three families (LA, YA and TN) have 16p13.3 deletions smaller than 1 Mb 26 and show relatively severe abnormalities. To test whether 16p13.3 deletions of <1 27 Mb may be unmasking deleterious mutations on the intact chromosome 16 allele in 28 severely affected patients, we performed whole genome sequencing (WGS) where 29 DNA was available (YA and the three affected members of the TN family) and 30 considered only coding variants in the hemizygous region of chromosome 16. 31 However, only common variants (allele frequency >5%) were present 32 (Supplementary Table 3) suggesting the cause(s) of the relatively severe phenotypes 33 in these patients reside elsewhere in the genome. To identity rare variants we 34 considered only those absent from the publicly available databases. This analysis 35 yielded 14 variants shared between the three affected individuals of family TN 36 (Supplementary Table 4). Of these, only one (chr15:64,782,684 G>A) affects a gene

8 bioRxiv preprint doi: https://doi.org/10.1101/768895; this version posted October 7, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

1 likely to be involved in the broader ATR16 phenotypic abnormalities. This change 2 leads to a R12X nonsense mutation in SMAD6, a negative regulator of bone 3 mophogenetic protein (BMP) signalling pathway. Heterozygous mutations in SMAD6 4 have been reported to underlie craniosynostosis, speech delay, global 5 developmental delay, fine motor impairment and aortic valve abnormalities with 6 variable penetrance (Timberlake et al., 2016; Luyckx et al., 2019). We checked 7 inheritance of the SMAD6 R12X variant in members of the TN family where samples 8 were available and found it most likely came from the unaffected grandmother 9 (Individual I,2 in Supplementary Figure 4). A phenotypically normal elder sister also 10 inherited this variant. These findings suggest that coinheritance of this SMAD6 loss 11 of function variant with the chromosome 16 deletion may lead to the increased 12 severity of the ATR-16 syndrome. 13 Further evidence the effect of ATR-16 deletions is modified by other loci 14 comes from patients SH(Ju) and SH(Pa) who harbour the same chromosome 16 15 deletion. Patient SH(Pa) has developmental delay and skeletal abnormalities, 16 however, his mother SH(Ju) does not have craniofacial nor skeletal abnormalities nor 17 developmental delay although she suffers from severe anxiety and depression (see 18 Figures 1,2 and Supplementary Information). Genome wide array comparative 19 genomic hybridisation (aCGH) analysis revealed that both SH(Ju) and SH(Pa) 20 harbour a ~133 kb deletion on the short arm of chromosome 2 including exons 5 to 21 13 of NRXN1 (Supplementary Figure 1). NRXN1 encodes a cell surface receptor 22 involved in the formation of synaptic contacts and has been implicated in autism 23 spectrum disorder, facial dysmorphism, anxiety and depression, developmental delay 24 and speech delay (e.g. The Autism Genome Project Consortium 2007; Kirov et al., 25 2008). This finding offers an explanation for the differences in the phenotypic severity 26 of the ATR-16 syndrome affecting these patients as autism differentially affects 27 males and females (see Discussion). 28 29 Chromatin Structure 30 Recent reports demonstrate chromosomal rearrangements, including 31 deletions, can result in aberrant DNA domain topology and illegitimate enhancer- 32 promoter contact causing gene misexpression (Lupianez et al., 2015). Chromatin 33 contact frequency is shown for the terminal 2 Mb of chromosome 16 in Figure 2A to 34 illustrate the effect of the deletions reported here on the chromatin structure. The 35 deletion in BA removes ~50% of the self-interacting domain in which CHTF18, 36 RPUSD1, GNG13, and LOC388199 reside thereby potentially removing cis-acting 37 regulatory elements of these genes, although the genes themselves remain intact. In

9 bioRxiv preprint doi: https://doi.org/10.1101/768895; this version posted October 7, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

1 the case of CJ, the deletion brings the powerful α-globin enhancer cluster (Hay et al., 2 2016) into proximity of CRAMP1L and may cause its aberrant expression in 3 developing erythroblasts. Although TADs have been reported to be stable structures 4 (e.g. Lupianez et al., 2015), many chromatin contacts are now known to vary in a 5 tissue-specific fashion (Szalaj & Plewczynski, 2018) and therefore it is not possible to 6 predict which genes may be aberrantly expressed in any given tissue as a result of 7 the ATR-16 deletions. 8 9 Compensatory Gene Expression 10 One explanation for the relatively mild abnormalities in many cases of ATR- 11 16 syndrome with deletions up to 900 kb may be compensatory transcriptional 12 upregulation of the homologues of deleted genes on the undamaged chromosome 13 16. This has been described as part of the mechanism of genetic compensation, also 14 termed genetic robustness (El-Brolosy and Stainer, 2017). To assay for 15 compensatory gene transcription we used qPCR to measure expression of 12 genes 16 within the terminal 500 kb of chromosome 16 in lymphoblastoid cells from 20 normal 17 individuals and from 10 patients with monosomy for the short-arm of chromosome 16 18 and found no evidence of compensatory upregulation: transcripts of all deleted genes 19 were present at ~50% of the normal levels in these cells (Figure 3B). It is possible 20 that other genes in downstream pathways affected by haploinsufficiency may be 21 transcriptionally upregulated, however, the mechanisms underlying this are complex 22 and beyond the scope of this study. 23 24 Telomere Position Effect 25 Previous work in human cells has shown that telomeres may affect chromatin 26 interactions at distances of up to 10 Mb away from the chromosome ends (Robin et 27 al, 2014) reducing expression of the intervening genes. This phenomenon, termed 28 telomere position effect (TPE) is thought to be mediated by the spreading of 29 telomeric heterochromatin to silence nearby genes. In budding yeast this effect can 30 extend a few kb towards the sub-telomeres, although in some cases yeast telomeres 31 can loop over longer distances (Bystricky et al., 2005) and repress genes up to 20 kb 32 away from the end of the chromosome. 33 To determine the effect of telomere proximity on genes adjacent to telomere- 34 healed breakpoints we measured their expression relative to the allele present in a 35 normal chromosomal context. To achieve this, we screened them for informative 36 single nucleotide polymorphisms (SNPs) in EBV transformed lymphoblastoid cells 37 generated from ATR-16 patients. The phase of polymorphisms was established

10 bioRxiv preprint doi: https://doi.org/10.1101/768895; this version posted October 7, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

1 using mouse erythroleukemia (MEL) cells fused to patient cells and selected to 2 contain a single copy of human chromosome 16, generated as previously described 3 (Zeitlin & Weatherall 1983). Expressed coding polymorphisms were present in genes 4 whose promoters are <60 kb away from breakpoints in 3 patients: TY, MY and BA. 5 For TY the nearest gene expressed in lymphoblastoid cells containing a 6 coding polymorphism is WDR90, the promoter of which is ~43.1 kb from the 7 abnormally appended telomere (Figure 3A). For BA, CHTF18 is the closest 8 expressed polymorphic gene with the promoter ~16.3 kb away from the breakpoint. 9 For MY, CLCN7 is the closest gene expressed in lymphoblastoid cells to contain a 10 polymorphism, the promoter of this gene is ~56.1 kb away from the telomere 11 stabilised lesion. To determine whether either allele of each of these 3 genes is 12 silenced we prepared genomic DNA and cDNA from each cell sample and Sanger 13 sequenced amplified fragments containing informative polymorphisms. We compared 14 peak heights of polymorphic bases in chromatograms derived from cDNA and 15 genomic DNA. None of the alleles assayed in the three patients tested showed any 16 evidence of a repressive effect (Figure 3A). 17

11 bioRxiv preprint doi: https://doi.org/10.1101/768895; this version posted October 7, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

1 Discussion 2 We characterised deletions leading to simple monosomy of the short arm of 3 chromosome 16 that cause ATR-16 syndrome. Many ATR-16 syndrome patients 4 suffer from neurodevelopmental abnormalities and one of the main questions in this 5 disease, and in the study of CNVs in general, is how deletion size relates to 6 phenotypic abnormalities. The monosomies analysed here show the likelihood and 7 severity of neurological and developmental abnormalities increases with deletion 8 size, however, there is no clear correlation. 9 The deletions in patients reported here range from ~0.177 Mb to ~2 Mb. 10 Previous studies suggest the critical region leading to abnormalities in addition to α- 11 thalassemia is an 800 kb region between ~0.9 and ~1.7 Mb from the telomere of 12 chromosome 16p (Harteveld et al., 2007) and SOX8 has been proposed as the 13 critical haploinsufficient gene (Pfeifer et al., 2000). However, a report of a family with 14 no developmental delay nor MR harbouring a 0.976 Mb deletion, suggests deletions 15 SOX8 may not lead to MR with complete penetrance and any “critical region” for MR 16 starts after this point (Bezerra et al., 2008; Family “F” in Figure 2). Supporting this we 17 report patients NL and BAR, who have deletions of ~1.14 Mb and ~1.44 Mb 18 respectively and show no abnormalities beyond α-thalassemia. 19 By contrast, we find LA (deletion ~408 kb) has speech delay and YA (deletion 20 ~748 kb), has speech and developmental delay and facial dysmorphism (Figure 2). 21 Family members of YA also have omphalocele, umbilical hernia and pyloric stenosis 22 suggesting there are other loci rendering YA susceptible to developmental 23 abnormalities. BA (deletion ~762 kb), who has a similarly sized deletion to YA, has 24 developmental delay but no other abnormalities. Four other patients with deletions <1 25 Mb (YA, TN(Pa), TN(Pe) and TN(Al)) have speech delay and facial dysmorphism. 26 This suggests the risk of developmental and neurological abnormalities arises from 27 much smaller terminal chromosome 16 deletions (~400 kb) than previously reported. 28 In SH(Pa) we have identified a strong candidate for the discordant 29 abnormalities: SH(Pa) also has a deletion of NRXN1, disruptions of which cause 30 autism and a range of neurological disorders. There is a higher incidence of autism in 31 males than in females, with a ratio of 3.5 or 4.0 to 1 (reviewed in Volkmar et al., 32 2004). This phenomenon is also specifically found in individuals with autism resulting 33 from rearrangements of NRXN1: Kirov and colleagues (2008) reported two affected 34 siblings who inherited a deletion of NRXN1 from their unaffected mother. It is 35 therefore possible Sh(Ju) is protected by her gender from the effects of NRXN1 36 disruption while the neurological and skeletal abnormalities in Sh(Pa) arise from the

12 bioRxiv preprint doi: https://doi.org/10.1101/768895; this version posted October 7, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

1 complex interaction of NRXN1 perturbation with his gender and coinheritance of the 2 16p13.3 deletion. Abnormalities in siblings of YA and BF (Heireman et al., 2019) also 3 suggest there may be other predisposing genes. Such loci compromise genetic 4 robustness proposed to minimise the effect of deletions and loss of function 5 mutations (El-Brolosy and Stainer, 2017). Another example of this is the SMAD6 6 R12X nonsense mutation present in all three affected members of family TN. Some 7 patients with loss of function mutations in SMAD6 have neurological abnormalities 8 (Timberlake et al., 2016) while others have not (Luyckx et al., 2019), suggesting 9 variable penetrance. Our analysis shows there are no likely pathogenic variants on 10 the hemizygous region of chromosome 16 in TN, suggesting modifying loci are 11 present elsewhere in the genome. These may be rare variants (such as those 12 identified in the TN and SH families) or common variation; a recent study that shows 13 that common genetic variants (allele frequency >5% in the general population) 14 contribute 7.7% of the variance of risk to neurodevelopmental disorders (Niemi et al., 15 2018), highlighting the complexity of this area. 16 Together these observations suggest that monosomy for 16p13.3 unmasks 17 the effects of other variants genome-wide. This is supported by findings in SCH who 18 has a very similar deletion to BAR and may be more severely affected owing to the 19 presence of other CNVs (Scheps et al., 2016). At the other end of the spectrum, 20 large ATR-16 deletions may be associated with relatively mild abnormalities. In LIN 21 (16p13.3 deletion ~2000 kb) there are no abnormalities of the axial skeleton and very 22 mild facial dysmorphism. Similarly, in the case of IM (deletion size ~2000 kb), facial 23 abnormalities are very mild and there is no evidence of language delay. Here we 24 propose chromosome 16p13.3 deletions larger than 400 kb predispose to MR and 25 associated developmental abnormalities, however, we find no evidence for critical 26 regions that incrementally worsen ATR-16 syndrome abnormalities. 27 We could not detect compensatory up-regulation of the homologues of 28 deleted genes. Recently, a case of ATR-16 was reported with a ~948 kb deletion and 29 who presented with a neuroblastoma in utero (Quadrifoglio et al., 2016). These 30 authors speculate that haploinsufficiency of the tumour suppressor AXIN1 may have 31 contributed to the neuroblastoma. Our finding that the remaining AXIN1 allele shows 32 no compensatory expression supports this hypothesis. 33 Terminal chromosome deletions are the most common subtelomeric 34 abnormalities (Ballif et al., 2007). The 16p deletions reported here are among the 35 most common terminal deletions along with 1p36 deletion syndrome, 4p terminal 36 deletion (causing Wolf-Hirschhorn syndrome), 5p terminal deletions (causing Cri-du- 37 chat syndrome), 9q34 deletion syndrome and 22q terminal deletion syndrome.

13 bioRxiv preprint doi: https://doi.org/10.1101/768895; this version posted October 7, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

1 Despite their impact on human health the mechanisms and timing underlying 2 telomeric breakage remain unknown. Findings of terminal deletions of 16p reported 3 and reviewed here and smaller deletions previously reported by our laboratory (Flint 4 et al., 1994) compared to more complex rearrangements at 1p, 22q and 9qter implies 5 different chromosomes are predisposed to different breakage and rescue 6 mechanisms. ATR-16 deletions are equally likely to have arisen on the maternal or 7 paternal chromosome. There is no evidence that the parental origin affects the 8 phenotypic severity of the ATR-16 syndrome, suggesting imprinting does not play a 9 role in ATR-16 pathogenesis. 10 The presence of high- and low-copy-number repeats at breakpoints may play 11 a role in stimulating the formation of non-recurrent breakpoints (Gu et al., 2008). Low 12 copy repeats (LCRs) are also mediators of nonallelic homologous recombination 13 (Stankiewicz and Lupski, 2002) and could be involved in chromosome instability 14 leading to terminal deletion. Following breakage, chromosomes can acquire a 15 telomere by capture or de novo telomere addition, which is thought to be mediated 16 by telomerase and this is stimulated by the presence of a telomeric repeat sequence 17 to which the RNA subunit of telomerase can bind (reviewed in Hannes et al., 2010). 18 We found 5 out of 6 telomere healed events share microhomology with appended 19 telomeric sequence. This is the same ratio (5 out of 6 breakpoints with 20 microhomology) described by Flint and colleagues and supported by Lamb and 21 colleagues (1 out of 1) giving a total 12 out of 13 reported telomere-healed breaks 22 characterised on 16p13.3 share microhomology with appended telomere sequences, 23 strongly suggesting a role for internal telomerase binding sites (Yang et al., 2011). It 24 may also be that telomerase binding to internal binding sites may inappropriately add 25 telomeres and thereby contribute to the generation of the breakpoints. 26 The lack of evidence for TPE in silencing gene expression is surprising and at 27 variance with previous findings (Stadler et al., 2013), which show that TPE can 28 influence gene expression at least 80 kb from the start of telomeric repeats. 29 However, TPE is likely to be context and cell type dependent. Additionally, because 30 of the lack of informative expressed polymorphisms in the patients studied here it 31 was not possible for us to assay expression of genes immediately adjacent to 32 telomeres and a more comprehensive screen may reveal TPE mediated gene 33 silencing closer to the telomere. Additionally, when the area of chromatin interaction 34 (visualised by HiC) is considered (Figure 2), contact domains for many genes 35 adjacent to chromosomal breaks are severely disrupted. This is likely to include the 36 loss of cis-acting regulatory elements and may bring the genes under the control of

14 bioRxiv preprint doi: https://doi.org/10.1101/768895; this version posted October 7, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

1 illegitimate regulatory elements (Franke et al., 2016). Therefore, it is likely that genes 2 adjacent to breakpoints would be incorrectly spatiotemporally expressed. 3 This work substantially increases the number of fully characterised cases of 4 ATR-16 syndrome reported and provides a uniquely well characterised model for 5 understanding how sporadic deletions giving rise to extended regions of monosomy 6 may affect phenotype. The findings show larger deletions have a greater impact but 7 importantly our analysis suggests there is no critical region defining the degree of 8 phenotypic abnormalities this has important implications for genetic counselling. 9 Analysis of patients with uncomplicated deletions also revealed unexpected 10 background genetic effects that alter phenotypic severity of CNVs. 11 12 13 Acknowledgements: 14 The authors thank Markissia Karagiorga-Lagana, MD, ex Director, Thalassaemia 15 Unit, "Aghia Sophia" Childrens Hosital Athens Greece for referring case BAR. This 16 work was supported by the Medical Research Council grant number: 17 (MC_uu_12009). 18 19 20 21 Authorship Statement: 22 23 24 DRH and VB conceived the project. CB, VB and DRH wrote the paper. CB, JS, CLH, 25 JB, EM, SWH, VB, SK and AD-M, performed experimental work. JTS, PO, MK, AD-M 26 assessed patients and clinical data. All authors commented on the manuscript. 27 28 29

15 bioRxiv preprint doi: https://doi.org/10.1101/768895; this version posted October 7, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

References

1. Autism Genome Project C, Szatmari P, Paterson AD, Zwaigenbaum L, Roberts W, Brian J, Liu XQ, Vincent JB, Skaug JL, Thompson AP, Senman L, Feuk L, Qian C, Bryson SE, Jones MB, Marshall CR, Scherer SW, Vieland VJ, Bartlett C, Mangin LV, Goedken R, Segre A, Pericak-Vance MA, Cuccaro ML, Gilbert JR, Wright HH, Abramson RK, Betancur C, Bourgeron T, Gillberg C, Leboyer M, Buxbaum JD, Davis KL, Hollander E, Silverman JM, Hallmayer J, Lotspeich L, Sutcliffe JS, Haines JL, Folstein SE, Piven J, Wassink TH, Sheffield V, Geschwind DH, Bucan M, Brown WT, Cantor RM, Constantino JN, Gilliam TC, Herbert M, Lajonchere C, Ledbetter DH, Lese-Martin C, Miller J, Nelson S, Samango-Sprouse CA, Spence S, State M, Tanzi RE, Coon H, Dawson G, Devlin B, Estes A, Flodman P, Klei L, McMahon WM, Minshew N, Munson J, Korvatska E, Rodier PM, Schellenberg GD, Smith M, Spence MA, Stodgell C, Tepper PG, Wijsman EM, Yu CE, Roge B, Mantoulan C, Wittemeyer K, Poustka A, Felder B, Klauck SM, Schuster C, Poustka F, Bolte S, Feineis-Matthews S, Herbrecht E, Schmotzer G, Tsiantis J, Papanikolaou K, Maestrini E, Bacchelli E, Blasi F, Carone S, Toma C, Van Engeland H, de Jonge M, Kemner C, Koop F, Langemeijer M, Hijmans C, Staal WG, Baird G, Bolton PF, Rutter ML, Weisblatt E, Green J, Aldred C, Wilkinson JA, Pickles A, Le Couteur A, Berney T, McConachie H, Bailey AJ, Francis K, Honeyman G, Hutchinson A, Parr JR, Wallace S, Monaco AP, Barnby G, Kobayashi K, Lamb JA, Sousa I, Sykes N, Cook EH, Guter SJ, Leventhal BL, Salt J, Lord C, Corsello C, Hus V, Weeks DE, Volkmar F, Tauber M, Fombonne E, Shih A, Meyer KJ. Mapping autism risk loci using genetic linkage and chromosomal rearrangements. Nat Genet 2007;39(3):319-28 2. Ballif BC, Sulpizio SG, Lloyd RM, Minier SL, Theisen A, Bejjani BA, Shaffer LG. The clinical utility of enhanced subtelomeric coverage in array CGH. Am J Med Genet A 2007;143A(16):1850-7 3. Bezerra MA, Araujo AS, Phylipsen M, Balak D, Kimura EM, Oliveira DM, Costa FF, Sonati MF, Harteveld CL. The deletion of SOX8 is not associated with ATR-16 in an HbH family from Brazil. Br J Haematol 2008;142(2):324-6 4. Buckle VJ, Rack K. Fluorescent in situ hybridisation. In: Davies KE, ed. Human genetic disease analysis: a practical approach. Oxford: Oxford University Press, 1993:59-80. 5. Bystricky K, Laroche T, van Houwe G, Blaszczyk M, Gasser SM. Chromosome looping in yeast: telomere pairing and coordinated movement reflect anchoring efficiency and territorial organization. Journal of Cell Biology 2005;168(3):375-87 6. Coelho A, Picanco I, Seuanes F, Seixas MT, Faustino P. Novel large deletions in the human alpha- globin gene cluster: Clarifying the HS-40 long-range regulatory role in the native chromosome environment. Blood Cells Mol Dis 2010;45(2):147-53 7. Daniels RJ, Peden JF, Lloyd C, Horsley SW, Clark K, Tufarelli C, Kearney L, Buckle VJ, Doggett NA, Flint J, Higgs DR. Sequence, structure and pathology of the fully annotated terminal 2 Mb of the short arm of human chromosome 16. Hum Mol Genet 2001;10(4):339-52 8. El-Brolosy MA, Stainier DYR. Genetic compensation: A phenomenon in search of mechanisms. PLoS Genet 2017;13(7):e1006780 9. European Polycystic Kidney Disease Consortium. The polycystic kidney disease 1 gene encodes a 14 kb transcript and lies within a duplicated region on chromosome 16. The European Polycystic Kidney Disease Consortium. Cell 1994;77(6):881-94 10. Fei YJ, Liu JC, Walker EL, 3rd, Huisman TH. A new gene deletion involving the alpha 2-, alpha 1-, and theta 1-globin genes in a black family with Hb H disease. Am J Hematol 1992;39(4):299-300 11. Felice AE, Cleek MP, McKie K, McKie V, Huisman TH. The rare alpha-thalassemia-1 of blacks is a zeta alpha-thalassemia-1 associated with deletion of all alpha- and zeta-globin genes. Blood 1984;63(5):1253-7 12. Flint J, Craddock CF, Villegas A, Bentley DP, Williams HJ, Galanello R, Cao A, Wood WG, Ayyub H, Higgs DR. Healing of broken human chromosomes by the addition of telomeric repeats. Am J Hum Genet 1994;55(3):505-12 13. Franke M, Ibrahim DM, Andrey G, Schwarzer W, Heinrich V, Schopflin R, Kraft K, Kempfer R, Jerkovic I, Chan WL, Spielmann M, Timmermann B, Wittler L, Kurth I, Cambiaso P, Zuffardi O, Houge G, Lambie L, Brancati F, Pombo A, Vingron M, Spitz F, Mundlos S. Formation of new

16 bioRxiv preprint doi: https://doi.org/10.1101/768895; this version posted October 7, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

chromatin domains determines pathogenicity of genomic duplications. Nature 2016;538(7624):265-69 14. Fu WQ, O'Connor TD, Jun G, Kang HM, Abecasis G, Leal SM, Gabriel S, Rieder MJ, Altshuler D, Shendure J, Nickerson DA, Bamshad MJ, Akey JM, Project NES. Analysis of 6,515 exomes reveals the recent origin of most human protein-coding variants (vol 493, pg 216, 2013). Nature 2013;495(7440):270-70 15. Gibson WT, Harvard C, Qiao Y, Somerville MJ, Lewis ME, Rajcan-Separovic E. Phenotype-genotype characterization of alpha-thalassemia mental retardation syndrome due to isolated monosomy of 16p13.3. Am J Med Genet A 2008;146A(2):225-32 16. Gu W, Zhang F, Lupski JR. Mechanisms for human genomic rearrangements. Pathogenetics 2008;1(1):4 17. Hannes F, Van Houdt J, Quarrell OW, Poot M, Hochstenbach R, Fryns JP, Vermeesch JR. Telomere healing following DNA polymerase arrest-induced breakages is likely the main mechanism generating chromosome 4p terminal deletions. Hum Mutat 2010;31(12):1343-51 18. Harteveld CL, Higgs DR. alpha-thalassaemia. Orphanet J Rare Dis 2010;5:13 19. Harteveld CL, Kriek M, Bijlsma EK, Erjavec Z, Balak D, Phylipsen M, Voskamp A, di Capua E, White SJ, Giordano PC. Refinement of the genetic cause of ATR-16. Hum Genet 2007;122(3-4):283-92 20. Harteveld CL, Voskamp A, Phylipsen M, Akkermans N, den Dunnen JT, White SJ, Giordano PC. Nine unknown rearrangements in 16p13.3 and 11p15.4 causing alpha- and beta-thalassaemia characterised by high resolution multiplex ligation-dependent probe amplification. J Med Genet 2005;42(12):922-31 21. Hay D, Hughes JR, Babbs C, Davies JOJ, Graham BJ, Hanssen L, Kassouf MT, Marieke Oudelaar AM, Sharpe JA, Suciu MC, Telenius J, Williams R, Rode C, Li PS, Pennacchio LA, Sloane-Stanley JA, Ayyub H, Butler S, Sauka-Spengler T, Gibbons RJ, Smith AJH, Wood WG, Higgs DR. Genetic dissection of the alpha-globin super-enhancer in vivo. Nat Genet 2016;48(8):895-903 22. Heireman L, Luyckx A, Schynkel K, Dheedene A, Delaunoy M, Adam AS, Gulbis B, Dierick J. Detection of a Large Novel alpha-Thalassemia Deletion in an Autochthonous Belgian Family. Hemoglobin 2019;43(2):112-15 23. Horsley SW, Daniels RJ, Anguita E, Raynham HA, Peden JF, Villegas A, Vickers MA, Green S, Waye JS, Chui DH, Ayyub H, MacCarthy AB, Buckle VJ, Gibbons RJ, Kearney L, Higgs DR. Monosomy for the most telomeric, gene-rich region of the short arm of human chromosome 16 causes minimal phenotypic effects. Eur J Hum Genet 2001;9(3):217-25 24. Iafrate AJ, Feuk L, Rivera MN, Listewnik ML, Donahoe PK, Qi Y, Scherer SW, Lee C. Detection of large-scale variation in the human genome. Nat Genet 2004;36(9):949-51 25. Kaminsky EB, Kaul V, Paschall J, Church DM, Bunke B, Kunig D, Moreno-De-Luca D, Moreno-De- Luca A, Mulle JG, Warren ST, Richard G, Compton JG, Fuller AE, Gliem TJ, Huang SW, Collinson MN, Beal SJ, Ackley T, Pickering DL, Golden DM, Aston E, Whitby H, Shetty S, Rossi MR, Rudd MK, South ST, Brothman AR, Sanger WG, Iyer RK, Crolla JA, Thorland EC, Aradhya S, Ledbetter DH, Martin CL. An evidence-based approach to establish the functional and clinical significance of copy number variants in intellectual and developmental disabilities. Genet Med 2011;13(9):777-84 26. Kirov G, Gumus D, Chen W, Norton N, Georgieva L, Sari M, O'Donovan MC, Erdogan F, Owen MJ, Ropers HH, Ullmann R. Comparative genome hybridization suggests a role for NRXN1 and APBA2 in schizophrenia. Hum Mol Genet 2008;17(3):458-65 27. Knight SJ, Horsley SW, Regan R, Lawrie NM, Maher EJ, Cardy DL, Flint J, Kearney L. Development and clinical application of an innovative fluorescence in situ hybridization technique which detects submicroscopic rearrangements involving telomeres. Eur J Hum Genet 1997;5(1):1-8 28. Lamb J, Harris PC, Wilkie AO, Wood WG, Dauwerse JG, Higgs DR. De novo truncation of chromosome 16p and healing with (TTAGGG)n in the alpha-thalassemia/mental retardation syndrome (ATR-16). Am J Hum Genet 1993;52(4):668-76 29. Lindor NM, Valdes MG, Wick M, Thibodeau SN, Jalal S. De novo 16p deletion: ATR-16 syndrome. Am J Med Genet 1997;72(4):451-4 30. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(T)(-Delta Delta C) method. Methods 2001;25(4):402-08

17 bioRxiv preprint doi: https://doi.org/10.1101/768895; this version posted October 7, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

31. Lupianez DG, Kraft K, Heinrich V, Krawitz P, Brancati F, Klopocki E, Horn D, Kayserili H, Opitz JM, Laxova R, Santos-Simarro F, Gilbert-Dussardier B, Wittler L, Borschiwer M, Haas SA, Osterwalder M, Franke M, Timmermann B, Hecht J, Spielmann M, Visel A, Mundlos S. Disruptions of topological chromatin domains cause pathogenic rewiring of gene-enhancer interactions. Cell 2015;161(5):1012-25 32. Luyckx I, MacCarrick G, Kempers M, Meester J, Geryl C, Rombouts O, Peeters N, Claes C, Boeckx N, Sakalihasan N, Jacquinet A, Hoischen A, Vandeweyer G, Van Lent S, Saenen J, Van Craenenbroeck E, Timmermans J, Duijnhouwer A, Dietz H, Van Laer L, Loeys B, Verstraeten A. Confirmation of the role of pathogenic SMAD6 variants in bicuspid aortic valve-related aortopathy. Eur J Hum Genet 2019 33. MacDonald JR, Ziman R, Yuen RK, Feuk L, Scherer SW. The Database of Genomic Variants: a curated collection of structural variation in the human genome. Nucleic Acids Res 2014;42(Database issue):D986-92 34. Merikangas AK, Corvin AP, Gallagher L. Copy-number variants in neurodevelopmental disorders: promises and challenges. Trends Genet 2009;25(12):536-44 35. Niemi MEK, Martin HC, Rice DL, Gallon G, Gordon S, Kelemen M, McAloney K, McRae J, Radford EJ, Yu S, Gecz J, Martin NG, Wright CF, Fitzpatrick DR, Firth HV, Hurles ME, Barrett JC. Common genetic variants contribute to risk of rare severe neurodevelopmental disorders. Nature 2018;562(7726):268-271 36. Pfeifer D, Poulat F, Holinski-Feder E, Kooy F, Scherer G. The SOX8 gene is located within 700 kb of the tip of chromosome 16p and is deleted in a patient with ATR-16 syndrome. Genomics 2000;63(1):108-16 37. Phylipsen M, Chaibunruang A, Vogelaar IP, Balak JRA, Schaap RAC, Ariyurek Y, Fucharoen S, den Dunnen JT, Giordano PC, Bakker E, Harteveld CL. Fine-Tiling Array CGH to Improve Diagnostics for alpha- and beta-Thalassemia Rearrangements. Human Mutation 2012;33(1):272-80 38. Quadrifoglio M, Faletra F, Bussani R, Pecile V, Zennaro F, Grasso A, Zandona L, Alberico S, Stampalija T. A Case of Prenatal Neurocytoma Associated With ATR-16 Syndrome. J Ultrasound Med 2016;35(6):1359-61 39. Rao SS, Huntley MH, Durand NC, Stamenova EK, Bochkov ID, Robinson JT, Sanborn AL, Machol I, Omer AD, Lander ES, Aiden EL. A 3D map of the human genome at kilobase resolution reveals principles of chromatin looping. Cell 2014;159(7):1665-80 40. Robin JD, Ludlow AT, Batten K, Magdinier F, Stadler G, Wagner KR, Shay JW, Wright WE. Telomere position effect: regulation of gene expression with progressive telomere shortening over long distances. Genes Dev 2014;28(22):2464-76 41. Scheps KG, Francipane L, Nevado J, Basack N, Attie M, Bergonzi MF, Cerrone GE, Lapunzina P, Varela V. Multiple copy number variants in a pediatric patient with Hb H disease and intellectual disability. American Journal of Medical Genetics Part A 2016;170(4):986-91 42. Stadler G, Rahimov F, King OD, Chen JC, Robin JD, Wagner KR, Shay JW, Emerson CP, Jr., Wright WE. Telomere position effect regulates DUX4 in human facioscapulohumeral muscular dystrophy. Nat Struct Mol Biol 2013;20(6):671-8 43. Stankiewicz P, Lupski JR. Genome architecture, rearrangements and genomic disorders. Trends Genet 2002;18(2):74-82 44. Szalaj P, Plewczynski D. Three-dimensional organization and dynamics of the genome. Cell Biol Toxicol 2018 45. Timberlake AT, Choi J, Zaidi S, Lu Q, Nelson-Williams C, Brooks ED, Bilguvar K, Tikhonova I, Mane S, Yang JF, Sawh-Martinez R, Persing S, Zellner EG, Loring E, Chuang C, Galm A, Hashim PW, Steinbacher DM, DiLuna ML, Duncan CC, Pelphrey KA, Zhao H, Persing JA, Lifton RP. Two locus inheritance of non-syndromic midline craniosynostosis via rare SMAD6 and common BMP2 alleles. Elife 2016;5 46. Volkmar FR, Lord C, Bailey A, Schultz RT, Klin A. Autism and pervasive developmental disorders. J Child Psychol Psychiatry 2004;45(1):135-70 47. Wang K, Li M, Hakonarson H. ANNOVAR: functional annotation of genetic variants from high- throughput sequencing data. Nucleic Acids Res 2010;38(16):e164

18 bioRxiv preprint doi: https://doi.org/10.1101/768895; this version posted October 7, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

48. Wilkie AO, Buckle VJ, Harris PC, Lamb J, Barton NJ, Reeders ST, Lindenbaum RH, Nicholls RD, Barrow M, Bethlenfalvay NC, Hutz MH, Tolmie JL, Weatherall DJ, Higgs DR. Clinical features and molecular analysis of the alpha thalassemia/mental retardation syndromes. I. Cases due to deletions involving chromosome band 16p13.3. Am J Hum Genet 1990;46(6):1112-26 49. Yang D, Xiong Y, Kim H, He Q, Li Y, Chen R, Songyang Z. Human telomeric proteins occupy selective interstitial sites. Cell Res 2011;21(7):1013-27 50. Zeitlin HC, Weatherall DJ. Selective expression within the human alpha globin gene complex following chromosome-dependent transfer into diploid mouse erythroleukaemia cells. Mol Biol Med 1983;1(5):489-50

19 bioRxiv preprint doi: https://doi.org/10.1101/768895; this version posted October 7, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

Figure 1 Chromosome 16 breakpoint sequences. DNA sequences at ATR-16 breakpoints. Patient codes are given in the upper left of each panel. For each case alignment of the two normal sequences is shown with sequence from the derivative chromosome (upper) with chromatogram traces traversing each breakpoint (lower). Areas of ambiguity are highlighted with grey boxes and the location of the last unambiguous base pair(s) are denoted by arrowheads and red boxes. Chr16, normal chromosome 16 sequence; Bpt, breakpoint sequence; Tel, telomere repeat sequence; SubTel, subtelomere repeat sequence; Prox, proximal chromosome 16 sequence; Dist, distal chromosome 16 sequence; AluY, AluY repetitive element. Asterisks indicate informative polymorphisms allowing sequence origins to be identified. For patients MY and OY a telomere primer with a mis-matched G nucleotide was used. bioRxiv preprint doi: https://doi.org/10.1101/768895; this version posted October 7, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

Figure 2 Summary of ATR-16 deletions. Upper: HiC interaction map showing interactions across the terminal 2 Mb of chromosome 16 at a 5 kb resolution in K562 cells (data from Rao et al., 2014). This shows how the ATR-16 deletions detailed in the lower section may impact the genome organisation. Middle: The positions of the alpha-globin cluster and other genes within this region are indicated. The alpha-globin genes and genes that, when mutated, are associated with tuberous sclerosis and adult polycystic kidney disease are shown in shaded boxes. Lower: The extent of each deletion is shown with the patient code (left). Deletions shown in green cause no other abnormalities apart from alpha-thalassemia and those in red cause at least one other abnormality present in ATR-16. Solid bars indicate regions known to be deleted and fine lines show regions of uncertainty. Asterisks indicate individuals whose deletion breakpoints have been cloned or refined in this work.

Figure 3 Effect of breakpoints and deletions on gene expression. A. 1 Schematic view of breakpoint positions in 3 patients with nearby expressed polymorphic genes. Genes are represented by black bars and transcription direction is indicated by an arrow. Polymorphic bases are shown by red letters indicating variant alleles and the distance of the promoter of each measured gene from the breakpoint is shown. On the right of each panel chromatograms show the quantity of the allele present in genomic DNA and cDNA from patient lymphoblastoid cells. B. Expression of 12 genes within 500 kb of the tip of the short arm of chromosome 16 in lymphoblastoid cells from 20 normal individuals, shown as reference (red column) and from 10 ATR-16 individuals hemizygous for each gene. Measurements in control cells are normalised to 1 (red column), relative expression in ATR-16 patient cells is shown in blue. Error bars show SD. Gene expression wasmeasured in triplicate and data combined.