Supp Data.Pdf
Total Page：16
File Type：pdf, Size：1020Kb
Supplementary Methods Verhaak sub-classification The Verhaak called tumor subtype was assigned as determined in the Verhaak et al. manuscript, for those TCGA tumors that were included at the time. TCGA data for expression (Affymetrix platform, level 1) and methylation (Infinium platform level 3) were downloaded from the TCGA portal on 09/29/2011. Affymetrix data were processed using R and Biocondutor with a RMA algorithm using quantile normalization and custom CDF. Level 3 methylation data has already been processed and converted to a beta-value. The genes that make up the signature for each of the 4 Verhaak groups (i.e. Proneural, Neural, Mesenchymal, and Classical) were downloaded. For each tumor, the averaged expression of the 4 genes signatures was calculated generating 4 ‘metagene’ scores, one for each subtype, (Colman et al.2010) for every tumor. Then each subtype metagene score was z-score corrected to allow comparison among the 4 metagenes. Finally, for each tumor the subtype with the highest metagene z-score among the four was used to assign subtype. Thus by this method, a tumor is assigned to the group to which it has the strongest expression signature. The shortcoming is that if a tumor has a ‘dual personality’ – for instance has strong expression of both classical and mesenchymal signature genes, there is some arbitrariness to the tumor’s assignment. Western Blot Analysis and cell fractionation Western blot analysis was performed using standard protocols. To determine protein expression we used the following antibodies: TAZ (Sigma and BD Biosciences), YAP (Santa Cruz Biotechnology), CD44 (Cell Signaling), FN1 (BD Biosciences), TEAD1, TEAD2, TEAD3, TEAD4 (Santa Cruz Biotechnology), MST1, p-MST1, MOB1, LATS1, LATS2, 14-3-3-, 1 ACTG2, (Cell Signaling), p-LATS1/2 (Abcam), Flag (Sigma Aldrich), Actin (Calbiochem), CAV2 (BD Biosciences), CTGF (Santa Cruz), RUNX2 (Sigma Aldrich), Cylin A, Cyclin E, Cyclin B1, p-cdk1, p-cdk4 (Cell Signaling Technologies). Protein extraction of GSCs was performed using 0.5% NP-40 lysis buffer containing 50 mM Tris-HCl (pH7.5), 150 mM NaCl, 50 mM NaF and supplemented with protease inhibitors (Roche) and PMSF just before use. For human glioma specimens, frozen tumors were dissected out and lysed with buffer containing 7M urea, 2M thiourea, 1% CHAPS, 50 mM Tris-HCl (pH 7.5). Protein concentrations were determined using the CB-X Protein Assay (G Biosciences). Nuclear and cytosolic fractionation was performed as previously described (Bhat et al.2004). IHC IHC analyses were performed on paraffin blocks, deparaffinized, and hydrated through an ethanol series. After microwave antigen retrieval, antibodies against TAZ (BD Biosciences or Novus), FN1 (BD Biosciences), CD44 (BD Biosciences) or J1-31 (Millipore) were incubated with the slides overnight at 4 °C. Staining was performed using the DAKO Envision kit according to the manufacturer’s instructions (DAKO, Carpinteria, CA). Methyl light assay DNA was extracted from cell lines using a DNA isolation kit (Epicenter) and the protocol was followed per manufacturer. DNA was then bisulfite converted using a kit from Zymo per manufacturer instructions. Methylation status of TAZ was detected using a fluorescence based Methyl Light PCR technique with COL2A1 as reference gene as previously described (Eads et al.1999, Eads et al.2000). Primers (F: TTATTACGTTTCGATTTCGGAAGTTCG and R: CGCCCAAATAATACCCGCTAAAAC) and probe (CGCGCTCATCCGACACCACTCCAA) 2 were designed against the 2nd CpG island in the TAZ promoter using Primer Express software (Applied Biosystems) against the amplicon; 5’- GGGTAAGAGGAGACGGGTGTTTTTTATTTATTTTTTTCGGTCGCGCGGATTTTTTTCG TTTAGATTTGTATTTGTATTTTTTTGAGTTTATTACGGATTTGGGGCGGGATT-3’. Bisulfite sequencing Genomic DNA was bisulfite converted as described above and the DNA was then inserted into a Topo vector using the TopoTA Cloning for Sequencing kit (Invitrogen). Ten colonies were picked and plasmid DNA was isolated using a miniprep kit (Qiagen). Sequencing was done at the MDACC core facility and compared to the promoter sequence available on the Transcriptional Regulatory Element Database website (http://rulai.cshl.edu/cgi- bin/TRED/tred.cgi?process=home) to identify methylated CpG’s. RT-PCR mRNA was obtained using the QIAshredder kit (Qiagen) and the RNeasy Plus Mini Kit (Qiagen) followed by a two-step RT-PCR method. Briefly, 0.3–0.5 μg total RNA was reverse transcribed to generate first strand DNA (Invitrogen). To amplify the cDNA, Taqman primer probes in conjunction with 1× Taqman Universal PCR Master Mix (Applied Biosystems) were used for the following genes: WWTR1, ACTB1,CTGF, CD44, FN1, ADAMTS1, and IL8. RNase inhibitor (0.4 units/μl; Roche) was included in every reaction. Reaction mixtures were incubated at 95 °C for 10 minutes for 1 cycle and then 15 s at 95 °C and 1 min at 60 °C for 40 cycles. The fluorescent signal was measured using the Applied Biosystems 7500, and the relative level of fold changes were calculated using the absolute Ct method. For the RCAS tumors, core punches representing more than 90% of tumor tissue was used from paraffin embedded tissues. 3 Total cellular RNA was isolated form the core punches using the Epicentre RNA isolation kit according to the manufacturers protocol (Epicentre Biotechnologies, Madison, WI) following de- paraffinization and proteinase K treatment. Real time PCR was performed as above using mouse specific Taqman probes for CD44, FN1, CTGF and RPS3. Small interfering RNA transfection Transient knockdown was performed using siRNA constructs from Dharmacon against: scrambled control, TAZ, STAT3, C/EBP-, and CTGF.. Cells were transfected with siRNAs using Lipofectamine 2000 (Invitrogen) according to manufacturer recommendations. The final siRNA concentration was 60 nM and cells were collected and analyzed 72 h later. Matrigel Invasion Assay Cells were plated on transwells (ISC Bioexpress) coated with Matrigel (BD Biosciences) and allowed to invade through the matrigel overnight. Hema 3 staining kit (Thermo Fisher) was used to stain the cells that invaded through the Matrigel. The dye was extracted using 5% Sodium Deoxycholate (Sigma) and an OD reading was done at 595 nm. EdU labeling and flow cytometric analysis Cells were chased with EdU for 2h followed by detection of S phase cells usingthe Click-iT EdU kit (Invitrogen A10202) per kit instructions. Neurosphere Assay Viability was calculated using the ViCell counter and 3 cells were plated per well in a 96-well flat bottom plate in triplicate. The number of wells containing neurospheres was counted three weeks after plating. 4 Immunoprecipitation Protein G dynabeads (Invitrogen) were cross linked with primary antibody for 1 hour. Then cell lysates were added to the beads and incubated overnight at +4°C. Beads were washed and western analyses were performed to confirm interacting proteins. Osteogenesis and chondrogenesis assays Cells were seeded at a density of 5x104 cells in a 6-well plate. After 24 hours, cell differentiation was induced with Osteogenesis Induction Medium (Lonza). Cells were fed every 3-4 days by completely replacing the medium with fresh Osteogenesis Induction Medium. After 3-4 weeks, cells were rinsed in PBS, fixed with 70% ethanol and stained with Alizarin Red. For chondrogenic assay, cell pellets were prepared by spinning down 3x105 cells in 15 ml polypropylene tubes and grown in Complete Chondrogenic Medium (Lonza). Cell pellets were fed every 2-3 days by completely replacing the medium with freshly prepared Complete Chondrogenic Medium. After 3-4 weeks, pellets were fixed in buffered 10% formalin and embedded in paraffin. 5m sections were slide-mounted and stained for glycosaminoglycans with Safranin O. NSC differentiation assays To induce the differentiation of NSCs, neurospheres were exposed to Accutase for 5–10 minutes and dissociated by triturating. Subsequently, the cells were plated in poly-d-lysine and laminin- coated 12mm glass coverslips, at approximately 15-20,000 cells per well in neurobasal medium supplemented with 5% FBS or without growth factors for 6 days at 5% CO2 and 37°C. At the end of the differentiation period, cells were fixated with 4% PFA washed with PBS and incubated in PBS containing 2% BSA and 10% NGS 1hr at room temperature to block 5 nonspecific antibody binding sites. Cells were then incubated with primary antibodies for 1 hr at room temperature, or at 4°C overnight. After the washing step, cells were incubated with appropriate secondary antibody for 1 hr at room temperature. To visualize nuclei, cells were counterstained with Hoechst 3342 (Sigma). Coverslips were than mounted and examined under a Zeiss fluorescent microscope. Supplementary Figure Legends Supplementary Figure S1. A. The MES subnetwork generated from the ARACNE analysis displaying network map (n=231 genes). The nodes were then color coded to show the membership of a given gene to a regulatory network. B. The expanded MES subnetwork showing first neighbors from the initial subnetwork (n=906 genes). C. Dot plot of TAZ mRNA expression versus MES metagene score in TCGA GBM dataset (Affymetrix platform). Points are color coded as red or blue based on if the given tumor has a more MES or PN signature using composite Phillips and Verhaak definitions. D. Cartoon depicting the HIPPO signaling pathway. Arrows indicate activation, blunt heads indicate repression. E. CpG sites in the TAZ promoter 1000 bp upstream of the transcription start site of TAZ is shown. Blue regions highlight CpG islands as identified using Methprimer software (http://www.urogene.org/methprimer/index1.html). F. Methylation status of HIPPO pathway gene promoters in 62 PN (blue) or 147 MES (red) GBMs from TCGA dataset (Illumina Infinium platform). Black bar is the mean of the methylation beta- score of either probe 1 (P1) or probe 2 (P2). Two-sample t-test between the groups was performed to assess statistical significance. G. Methylation status of TAZ and YAP1 across the four subtypes of GBM based on Verhaak called classification. Black bars in each column represent the mean of the group. H. Methylation status of TAZ and YAP1 across the four subtypes of GBM based on Verhaak calculated method.