Supp Data.Pdf
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
KPNA1 Antibody Cat
KPNA1 Antibody Cat. No.: 5981 Western blot analysis of KPNA1 in Hela cell lysate with KPNA1 antibody at 1μg/mL. Immunocytochemistry of KPNA1 in HeLa cells with KPNA1 antibody at 2.5 μg/mL. Immunofluorescence of KPNA1 in K562 cells with KPNA1 antibody at 20 μg/mL. Specifications HOST SPECIES: Rabbit SPECIES REACTIVITY: Human, Mouse, Rat HOMOLOGY: Predicted species reactivity based on immunogen sequence: Bovine: (100%) KPNA1 antibody was raised against a 15 amino acid synthetic peptide near the amino terminus of human KPNA1. IMMUNOGEN: The immunogen is located within amino acids 30 - 80 of KPNA1. TESTED APPLICATIONS: ELISA, ICC, IF, WB September 30, 2021 1 https://www.prosci-inc.com/kpna1-antibody-5981.html KPNA1 antibody can be used for detection of KPNA1 by Western blot at 1 μg/mL. Antibody can also be used for immunocytochemistry starting at 2.5 μg/mL. For immunofluorescence start at 20 μg/mL. APPLICATIONS: Antibody validated: Western Blot in human samples; Immunocytochemistry in human samples and Immunofluorescence in human samples. All other applications and species not yet tested. POSITIVE CONTROL: 1) Cat. No. 1201 - HeLa Cell Lysate 2) Cat. No. 17-001 - HeLa Cell Slide 3) Cat. No. 17-004 - K-562 Cell Slide Properties PURIFICATION: KPNA1 Antibody is affinity chromatography purified via peptide column. CLONALITY: Polyclonal ISOTYPE: IgG CONJUGATE: Unconjugated PHYSICAL STATE: Liquid BUFFER: KPNA1 Antibody is supplied in PBS containing 0.02% sodium azide. CONCENTRATION: 1 mg/mL KPNA1 antibody can be stored at 4˚C for three months and -20˚C, stable for up to one STORAGE CONDITIONS: year. -
TEAD3 (NM 003214) Human Tagged ORF Clone Product Data
OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RC210621 TEAD3 (NM_003214) Human Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: TEAD3 (NM_003214) Human Tagged ORF Clone Tag: Myc-DDK Symbol: TEAD3 Synonyms: DTEF-1; ETFR-1; TEAD-3; TEAD5; TEF-5; TEF5 Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin ORF Nucleotide >RC210621 ORF sequence Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATAGCGTCCAACAGCTGGAACGCCAGCAGCAGCCCCGGGGAGGCCCGGGAGGATGGGCCCGAGGGCCTGG ACAAGGGGCTGGACAACGATGCGGAGGGCGTGTGGAGCCCGGACATCGAGCAGAGCTTCCAGGAGGCCCT GGCCATCTACCCGCCCTGCGGCCGGCGGAAGATCATCCTGTCAGACGAGGGCAAGATGTACGGCCGAAAT GAGTTGATTGCACGCTATATTAAACTGAGGACGGGGAAGACTCGGACGAGAAAACAGGTGTCCAGCCACA TACAGGTTCTAGCTCGGAAGAAGGTGCGGGAGTACCAGGTTGGCATCAAGGCCATGAACCTGGACCAGGT CTCCAAGGACAAAGCCCTTCAGAGCATGGCGTCCATGTCCTCTGCCCAGATCGTCTCTGCCAGTGTCCTG CAGAACAAGTTCAGCCCACCTTCCCCTCTGCCCCAGGCCGTCTTCTCCACTTCCTCGCGGTTCTGGAGCA GCCCCCCTCTCCTGGGACAGCAGCCTGGACCCTCTCAGGACATCAAGCCCTTTGCACAGCCAGCCTACCC CATCCAGCCGCCCCTGCCGCCGACGCTCAGCAGTTATGAGCCCCTGGCCCCGCTCCCCTCAGCTGCTGCC TCTGTGCCTGTGTGGCAGGACCGTACCATTGCCTCCTCCCGGCTGCGGCTCCTGGAGTATTCAGCCTTCA TGGAGGTGCAGCGAGACCCTGACACGTACAGCAAACACCTGTTTGTGCACATCGGCCAGACGAACCCCGC CTTCTCAGACCCACCCCTGGAGGCAGTAGATGTGCGCCAGATCTATGACAAATTCCCCGAGAAAAAGGGA GGATTGAAGGAGCTCTATGAGAAGGGGCCCCCTAATGCCTTCTTCCTTGTCAAGTTCTGGGCCGACCTCA -
IN COLON CANCER a Dissertation by SATYA SREEHARI PATHI Su
MECHANISMS OF ACTION OF NON-STEROIDAL ANTI-INFLAMMATORY DRUGS (NSAIDs) IN COLON CANCER A Dissertation by SATYA SREEHARI PATHI Submitted to the Office of Graduate Studies of Texas A&M University in partial fulfillment of the requirements for the degree of DOCTOR OF PHILOSOPHY August 2012 Major Subject: Toxicology MECHANISMS OF ACTION OF NON-STEROIDAL ANTI-INFLAMMATORY DRUGS (NSAIDs) IN COLON CANCER A Dissertation by SATYA SREEHARI PATHI Submitted to the Office of Graduate Studies of Texas A&M University in partial fulfillment of the requirements for the degree of DOCTOR OF PHILOSOPHY Approved by: Chair of Committee, Stephen H. Safe Committee Members, Robert C. Burghardt Timothy Phillips Yanan Tian Interdisciplinary Faculty Chair of Toxicology, Weston Porter August 2012 Major Subject: Toxicology iii ABSTRACT Mechanisms of Action of Non-Steroidal Anti-Inflammatory Drugs (NSAIDs) in Colon Cancer. (August 2012) Satya Sreehari Pathi, B.V.M., Acharya N. G. Ranga Agricultural University, India; M.S., Texas A&M University, Kingsville Chair of Advisory Committee: Dr. Stephen H. Safe Non-steroidal anti-inflammatory drugs (NSAIDs) and their NO derivatives (NO- NSAIDs), and synthetic analogs are highly effective as anticancer agents that exhibit relatively low toxicity compared to most clinically used drugs. However, the mechanisms of action for NSAIDs and NO-NSAIDs are not well defined and this has restricted their clinical applications and applications for combined therapies. Earlier studies from our laboratory reported that specificity protein (Sp) transcription factors (Sp1, Sp3 and Sp4) are overexpressed in several types of human cancers including colon cancer and many Sp-regulated genes are pro-oncogenic and individual targets for cancer chemotherapy. -
Toxicogenomics Article
Toxicogenomics Article Discovery of Novel Biomarkers by Microarray Analysis of Peripheral Blood Mononuclear Cell Gene Expression in Benzene-Exposed Workers Matthew S. Forrest,1 Qing Lan,2 Alan E. Hubbard,1 Luoping Zhang,1 Roel Vermeulen,2 Xin Zhao,1 Guilan Li,3 Yen-Ying Wu,1 Min Shen,2 Songnian Yin,3 Stephen J. Chanock,2 Nathaniel Rothman,2 and Martyn T. Smith1 1School of Public Health, University of California, Berkeley, California, USA; 2Division of Cancer Epidemiology and Genetics, National Cancer Institute, Bethesda, Maryland, USA; 3National Institute of Occupational Health and Poison Control, Chinese Center for Disease Control and Prevention, Beijing, China were then ranked and selected for further exam- Benzene is an industrial chemical and component of gasoline that is an established cause of ination using several forms of statistical analysis. leukemia. To better understand the risk benzene poses, we examined the effect of benzene expo- We also specifically examined the expression sure on peripheral blood mononuclear cell (PBMC) gene expression in a population of shoe- of all cytokine genes on the array under the factory workers with well-characterized occupational exposures using microarrays and real-time a priori hypothesis that these key genes polymerase chain reaction (PCR). PBMC RNA was stabilized in the field and analyzed using a involved in immune function are likely to be comprehensive human array, the U133A/B Affymetrix GeneChip set. A matched analysis of six altered by benzene exposure (Aoyama 1986). exposed–control pairs was performed. A combination of robust multiarray analysis and ordering We then attempted to confirm the array find- of genes using paired t-statistics, along with bootstrapping to control for a 5% familywise error ings for the leading differentially expressed rate, was used to identify differentially expressed genes in a global analysis. -
The Title of the Article
Mechanism-Anchored Profiling Derived from Epigenetic Networks Predicts Outcome in Acute Lymphoblastic Leukemia Xinan Yang, PhD1, Yong Huang, MD1, James L Chen, MD1, Jianming Xie, MSc2, Xiao Sun, PhD2, Yves A Lussier, MD1,3,4§ 1Center for Biomedical Informatics and Section of Genetic Medicine, Department of Medicine, The University of Chicago, Chicago, IL 60637 USA 2State Key Laboratory of Bioelectronics, Southeast University, 210096 Nanjing, P.R.China 3The University of Chicago Cancer Research Center, and The Ludwig Center for Metastasis Research, The University of Chicago, Chicago, IL 60637 USA 4The Institute for Genomics and Systems Biology, and the Computational Institute, The University of Chicago, Chicago, IL 60637 USA §Corresponding author Email addresses: XY: [email protected] YH: [email protected] JC: [email protected] JX: [email protected] XS: [email protected] YL: [email protected] - 1 - Abstract Background Current outcome predictors based on “molecular profiling” rely on gene lists selected without consideration for their molecular mechanisms. This study was designed to demonstrate that we could learn about genes related to a specific mechanism and further use this knowledge to predict outcome in patients – a paradigm shift towards accurate “mechanism-anchored profiling”. We propose a novel algorithm, PGnet, which predicts a tripartite mechanism-anchored network associated to epigenetic regulation consisting of phenotypes, genes and mechanisms. Genes termed as GEMs in this network meet all of the following criteria: (i) they are co-expressed with genes known to be involved in the biological mechanism of interest, (ii) they are also differentially expressed between distinct phenotypes relevant to the study, and (iii) as a biomodule, genes correlate with both the mechanism and the phenotype. -
Replication of FTO Gene Associated with Lean Mass in a Meta
www.nature.com/scientificreports OPEN Replication of FTO Gene associated with lean mass in a Meta-Analysis of Genome-Wide Association Studies Shu Ran1, Zi-Xuan Jiang1, Xiao He1, Yu Liu1, Yu-Xue Zhang1, Lei Zhang2,3, Yu-Fang Pei3,4, Meng Zhang5, Rong Hai6, Gui-Shan Gu7, Bao-Lin Liu1, Qing Tian8, Yong-Hong Zhang3,4, Jing-Yu Wang7 & Hong-Wen Deng8* Sarcopenia is characterized by low skeletal muscle, a complex trait with high heritability. With the dramatically increasing prevalence of obesity, obesity and sarcopenia occur simultaneously, a condition known as sarcopenic obesity. Fat mass and obesity-associated (FTO) gene is a candidate gene of obesity. To identify associations between lean mass and FTO gene, we performed a genome-wide association study (GWAS) of lean mass index (LMI) in 2207 unrelated Caucasian subjects and replicated major fndings in two replication samples including 6,004 unrelated Caucasian and 38,292 unrelated Caucasian. We found 29 single nucleotide polymorphisms (SNPs) in FTO signifcantly associated with sarcopenia (combined p-values ranging from 5.92 × 10−12 to 1.69 × 10−9). Potential biological functions of SNPs were analyzed by HaploReg v4.1, RegulomeDB, GTEx, IMPC and STRING. Our results provide suggestive evidence that FTO gene is associated with lean mass. Sarcopenia is a complex disease described as the age-associated loss of skeletal muscle mass, strength and func- tion impairment1,2. Te low skeletal muscle mass will lead to many public health problems such as sarcopenia, osteoporosis and increased mortality3,4, especially in the elderly. Skeletal muscle is heritable with heritability esti- mates of 30–85% for muscle strength and 45–90% for muscle mass5. -
Nuclear Import Protein KPNA7 and Its Cargos Acta Universitatis Tamperensis 2346
ELISA VUORINEN Nuclear Import Protein KPNA7 and its Cargos ELISA Acta Universitatis Tamperensis 2346 ELISA VUORINEN Nuclear Import Protein KPNA7 and its Cargos Diverse roles in the regulation of cancer cell growth, mitosis and nuclear morphology AUT 2346 AUT ELISA VUORINEN Nuclear Import Protein KPNA7 and its Cargos Diverse roles in the regulation of cancer cell growth, mitosis and nuclear morphology ACADEMIC DISSERTATION To be presented, with the permission of the Faculty Council of the Faculty of Medicine and Life Sciences of the University of Tampere, for public discussion in the auditorium F114 of the Arvo building, Arvo Ylpön katu 34, Tampere, on 9 February 2018, at 12 o’clock. UNIVERSITY OF TAMPERE ELISA VUORINEN Nuclear Import Protein KPNA7 and its Cargos Diverse roles in the regulation of cancer cell growth, mitosis and nuclear morphology Acta Universitatis Tamperensis 2346 Tampere University Press Tampere 2018 ACADEMIC DISSERTATION University of Tampere, Faculty of Medicine and Life Sciences Finland Supervised by Reviewed by Professor Anne Kallioniemi Docent Pia Vahteristo University of Tampere University of Helsinki Finland Finland Docent Maria Vartiainen University of Helsinki Finland The originality of this thesis has been checked using the Turnitin OriginalityCheck service in accordance with the quality management system of the University of Tampere. Copyright ©2018 Tampere University Press and the author Cover design by Mikko Reinikka Acta Universitatis Tamperensis 2346 Acta Electronica Universitatis Tamperensis 1851 ISBN 978-952-03-0641-0 (print) ISBN 978-952-03-0642-7 (pdf) ISSN-L 1455-1616 ISSN 1456-954X ISSN 1455-1616 http://tampub.uta.fi Suomen Yliopistopaino Oy – Juvenes Print Tampere 2018 441 729 Painotuote CONTENTS List of original communications ................................................................................................ -
Molecular and Physiological Basis for Hair Loss in Near Naked Hairless and Oak Ridge Rhino-Like Mouse Models: Tracking the Role of the Hairless Gene
University of Tennessee, Knoxville TRACE: Tennessee Research and Creative Exchange Doctoral Dissertations Graduate School 5-2006 Molecular and Physiological Basis for Hair Loss in Near Naked Hairless and Oak Ridge Rhino-like Mouse Models: Tracking the Role of the Hairless Gene Yutao Liu University of Tennessee - Knoxville Follow this and additional works at: https://trace.tennessee.edu/utk_graddiss Part of the Life Sciences Commons Recommended Citation Liu, Yutao, "Molecular and Physiological Basis for Hair Loss in Near Naked Hairless and Oak Ridge Rhino- like Mouse Models: Tracking the Role of the Hairless Gene. " PhD diss., University of Tennessee, 2006. https://trace.tennessee.edu/utk_graddiss/1824 This Dissertation is brought to you for free and open access by the Graduate School at TRACE: Tennessee Research and Creative Exchange. It has been accepted for inclusion in Doctoral Dissertations by an authorized administrator of TRACE: Tennessee Research and Creative Exchange. For more information, please contact [email protected]. To the Graduate Council: I am submitting herewith a dissertation written by Yutao Liu entitled "Molecular and Physiological Basis for Hair Loss in Near Naked Hairless and Oak Ridge Rhino-like Mouse Models: Tracking the Role of the Hairless Gene." I have examined the final electronic copy of this dissertation for form and content and recommend that it be accepted in partial fulfillment of the requirements for the degree of Doctor of Philosophy, with a major in Life Sciences. Brynn H. Voy, Major Professor We have read this dissertation and recommend its acceptance: Naima Moustaid-Moussa, Yisong Wang, Rogert Hettich Accepted for the Council: Carolyn R. -
Identification of Novel Pathways That Promote Anoikis Through Genome-Wide Screens
University of Massachusetts Medical School eScholarship@UMMS GSBS Dissertations and Theses Graduate School of Biomedical Sciences 2016-10-14 Identification of Novel Pathways that Promote Anoikis through Genome-wide Screens Victoria E. Pedanou University of Massachusetts Medical School Let us know how access to this document benefits ou.y Follow this and additional works at: https://escholarship.umassmed.edu/gsbs_diss Part of the Biology Commons, and the Cancer Biology Commons Repository Citation Pedanou VE. (2016). Identification of Novel Pathways that Promote Anoikis through Genome-wide Screens. GSBS Dissertations and Theses. https://doi.org/10.13028/M27G6D. Retrieved from https://escholarship.umassmed.edu/gsbs_diss/889 This material is brought to you by eScholarship@UMMS. It has been accepted for inclusion in GSBS Dissertations and Theses by an authorized administrator of eScholarship@UMMS. For more information, please contact [email protected]. i TITLE PAGE IDENTIFICATION OF NOVEL PATHWAYS THAT PROMOTE ANOIKIS THROUGH GENOME-WIDE SCREENS A Dissertation Presented By VICTORIA ELIZABETH PEDANOU Submitted to the Faculty of the University of Massachusetts Graduate School of Biomedical Sciences, Worcester in partial fulfillment of the requirements for the degree of DOCTOR OF PHILOSOPHY OCTOBER 14TH, 2016 CANCER BIOLOGY ii SIGNATURE PAGE IDENTIFICATION OF NOVEL PATHWAYS THAT PROMOTE ANOIKIS THROUGH GENOME-WIDE SCREENS A Dissertation Presented By VICTORIA ELIZABETH PEDANOU This work was undertaken in the Graduate School of Biomedical Sciences Cancer Biology The signature of the Thesis Advisor signifies validation of Dissertation content ___________________________ Michael R. Green, Thesis Advisor The signatures of the Dissertation Defense Committee signify completion and approval as to style and content of the Dissertation __________________________________ Eric H. -
` Probing the Epigenome Andrea Huston1, Cheryl H Arrowsmith1,2
` Probing the Epigenome Andrea Huston1, Cheryl H Arrowsmith1,2, Stefan Knapp3,4,*, Matthieu Schapira1,5,* 1. Structural Genomics Consortium, University of Toronto, Toronto, ON M5G 1L7, Canada 2. Princess Margaret Cancer Centre and Department of Medical Biophysics, University of Toronto , Toronto, ON M5G 1L7, Canada 3. Nuffield Department of Clinical Medicine, Target Discovery Institute, and Structural Genomic Consortium, University of Oxford, Headington, Oxford OX3 7DQ, United Kingdom 4. Institute for Pharmaceutical Chemistry, Johann Wolfgang Goethe University, D-60438 Frankfurt am Main, Germany 5. Department of Pharmacology and Toxicology, University of Toronto, Toronto, ON M5S 1A8, Canada * Correspondence: [email protected], [email protected] Epigenetic chemical probes are having a strong impact on biological discovery and target validation. Systematic coverage of emerging epigenetic target classes with these potent, selective, cell-active chemical tools will profoundly influence our understanding of the human biology and pathology of chromatin-templated mechanisms. ` Chemical probes are research-enablers Advances in genomics and proteomics methodologies in recent years have made it possible to associate thousands of genes and proteins with specific diseases, biological processes, molecular networks and pathways. However, data from these large scale initiatives alone has not translated widely into new studies on these disease-associated proteins, and the biomedical research community still tends to focus on proteins that were already known before the sequencing of the human genome1. The human kinome for instance, a target class of direct relevance to cancer and other disease areas, is a telling example: based on the number of research articles indexed in pubmed in 2011, 75% of the research activity focused on only 10% of the 518 human kinases – largely the same kinases that were the focus of research before sequencing of the human genome - while 60% of the kinome, some 300 enzymes, was virtually ignored by the community2. -
Table S1 the Four Gene Sets Derived from Gene Expression Profiles of Escs and Differentiated Cells
Table S1 The four gene sets derived from gene expression profiles of ESCs and differentiated cells Uniform High Uniform Low ES Up ES Down EntrezID GeneSymbol EntrezID GeneSymbol EntrezID GeneSymbol EntrezID GeneSymbol 269261 Rpl12 11354 Abpa 68239 Krt42 15132 Hbb-bh1 67891 Rpl4 11537 Cfd 26380 Esrrb 15126 Hba-x 55949 Eef1b2 11698 Ambn 73703 Dppa2 15111 Hand2 18148 Npm1 11730 Ang3 67374 Jam2 65255 Asb4 67427 Rps20 11731 Ang2 22702 Zfp42 17292 Mesp1 15481 Hspa8 11807 Apoa2 58865 Tdh 19737 Rgs5 100041686 LOC100041686 11814 Apoc3 26388 Ifi202b 225518 Prdm6 11983 Atpif1 11945 Atp4b 11614 Nr0b1 20378 Frzb 19241 Tmsb4x 12007 Azgp1 76815 Calcoco2 12767 Cxcr4 20116 Rps8 12044 Bcl2a1a 219132 D14Ertd668e 103889 Hoxb2 20103 Rps5 12047 Bcl2a1d 381411 Gm1967 17701 Msx1 14694 Gnb2l1 12049 Bcl2l10 20899 Stra8 23796 Aplnr 19941 Rpl26 12096 Bglap1 78625 1700061G19Rik 12627 Cfc1 12070 Ngfrap1 12097 Bglap2 21816 Tgm1 12622 Cer1 19989 Rpl7 12267 C3ar1 67405 Nts 21385 Tbx2 19896 Rpl10a 12279 C9 435337 EG435337 56720 Tdo2 20044 Rps14 12391 Cav3 545913 Zscan4d 16869 Lhx1 19175 Psmb6 12409 Cbr2 244448 Triml1 22253 Unc5c 22627 Ywhae 12477 Ctla4 69134 2200001I15Rik 14174 Fgf3 19951 Rpl32 12523 Cd84 66065 Hsd17b14 16542 Kdr 66152 1110020P15Rik 12524 Cd86 81879 Tcfcp2l1 15122 Hba-a1 66489 Rpl35 12640 Cga 17907 Mylpf 15414 Hoxb6 15519 Hsp90aa1 12642 Ch25h 26424 Nr5a2 210530 Leprel1 66483 Rpl36al 12655 Chi3l3 83560 Tex14 12338 Capn6 27370 Rps26 12796 Camp 17450 Morc1 20671 Sox17 66576 Uqcrh 12869 Cox8b 79455 Pdcl2 20613 Snai1 22154 Tubb5 12959 Cryba4 231821 Centa1 17897 -
Table 2. Significant
Table 2. Significant (Q < 0.05 and |d | > 0.5) transcripts from the meta-analysis Gene Chr Mb Gene Name Affy ProbeSet cDNA_IDs d HAP/LAP d HAP/LAP d d IS Average d Ztest P values Q-value Symbol ID (study #5) 1 2 STS B2m 2 122 beta-2 microglobulin 1452428_a_at AI848245 1.75334941 4 3.2 4 3.2316485 1.07398E-09 5.69E-08 Man2b1 8 84.4 mannosidase 2, alpha B1 1416340_a_at H4049B01 3.75722111 3.87309653 2.1 1.6 2.84852656 5.32443E-07 1.58E-05 1110032A03Rik 9 50.9 RIKEN cDNA 1110032A03 gene 1417211_a_at H4035E05 4 1.66015788 4 1.7 2.82772795 2.94266E-05 0.000527 NA 9 48.5 --- 1456111_at 3.43701477 1.85785922 4 2 2.8237185 9.97969E-08 3.48E-06 Scn4b 9 45.3 Sodium channel, type IV, beta 1434008_at AI844796 3.79536664 1.63774235 3.3 2.3 2.75319499 1.48057E-08 6.21E-07 polypeptide Gadd45gip1 8 84.1 RIKEN cDNA 2310040G17 gene 1417619_at 4 3.38875643 1.4 2 2.69163229 8.84279E-06 0.0001904 BC056474 15 12.1 Mus musculus cDNA clone 1424117_at H3030A06 3.95752801 2.42838452 1.9 2.2 2.62132809 1.3344E-08 5.66E-07 MGC:67360 IMAGE:6823629, complete cds NA 4 153 guanine nucleotide binding protein, 1454696_at -3.46081884 -4 -1.3 -1.6 -2.6026947 8.58458E-05 0.0012617 beta 1 Gnb1 4 153 guanine nucleotide binding protein, 1417432_a_at H3094D02 -3.13334396 -4 -1.6 -1.7 -2.5946297 1.04542E-05 0.0002202 beta 1 Gadd45gip1 8 84.1 RAD23a homolog (S.