DOCSLIB.ORG

JJB 079 255 261.Pdf

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text

Load more

植物研究雑誌 J. J. Jpn. Bo t. 79:255-261 79:255-261 (2004) Phylogenetic Phylogenetic Analysis of the Tetrasporalean Genus Asterococcus Asterococcus (Chlorophyceae) sased on 18S 18S Ribosomal RNA Gene Sequences Atsushi Atsushi NAKAZA WA and Hisayoshi NOZAKI Department Department of Biological Sciences ，Graduate School of Science ，University of Tokyo ， Hongo Hongo 7-3-1 ，Bunkyo-ku ，Tokyo ，113 ・0033 JAPAN (Received (Received on October 30 ，2003) Nucleotide Nucleotide sequences (1642 bp) from 18S ribosomal RNA genes were analyzed for 100 100 strains of the clockwise (CW) group of Chlorophyceae to deduce the phylogenetic position position of the immotile colonial genus Asterococcus Scherffel ， which is classified in the Palmellopsidaceae Palmellopsidaceae of Tetrasporales. We found that the genus Asterococcus and two uni- cellular ， volvocalean genera ， Lobochlamys Proschold & al. and Oogamochlamys Proschold Proschold & al.， formed a robust monophyletic group ， which was separated from two te 位asporalean clades ， one composed of Tetraspora Link and Paulschulzia Sk 吋a and the other other containing the other palme l1 0psidacean genus Chlamydocaps αFot t. Therefore ， the Tetrasporales Tetrasporales in the CW group is clearly polyphyletic and taxonomic revision of the order order and the Palmellopsidaceae is needed. Key words: 18S rRNA gene ，Asterococcus ，Palmellopsidaceae ，phylogeny ，Tetraspor- ales. ales. Asterococcus Asterococcus Scherffel (1908) is a colo- Recently ， Ettl and Gartner (1 988) included nial nial green algal genus that is characterized Asterococcus in the family Palmello- by an asteroid chloroplast in the cell and psidaceae ， because cells of this genus have swollen swollen gelatinous layers surrounding the contractile vacuoles and lack pseudoflagella immotile immotile colony (e. g. ， Ettl and Gartner in the nor トattached vegetative colony. 1988). 1988). This genus is generally assigned to Patricia et al. (2000) revealed that the the Tetrasporales (e. g. ，Lemmermann 1915 ， Asterococcus belongs to the clockwise (CW) Tiffany Tiffany 1934 ，Smith 1950 ， Ettl 1964 ， Fott group of Chlorophyceae ， based on the CW 1971 ， Ettl and Gartner 1988). However ， the orientation of the flagellar apparatus in A. systematic systematic position of Asterococcus at the superbus (Cienkowski) Scherffe l. Nakazawa family family level varies according to the author. et al. (2004) carried out a taxonomic study of Lemmermann (1915) classified Asterococcus Asterococcus based on the comparative mor- in in the Palmellaceae. Korshikov (1 953) con- phology of many strains and molecular sidered sidered this genus a member of the dendroid phylogenetic analyses of the Rubisco 1紅 ge family family Chlorangiellaceae because his alga subunit (rbcL) gene sequences. However ， the produced dendroid ，gelatinous colonies. Fott phylogenetic position of this genus within (1 971) distinguished Asterococcus from the CW group was ambiguous ， possibly be- other other members of the Tetrasporales and es- cause of the limited numbers of operational tablished tablished a new far 凶ly ， the Asterococcaceae. taxonomic units (OTUs) analyzed (Naka- -255- 256 植物研究雑誌第79 巻第4号 平成16 年8月 zawa et al. 2004). Therefore ， sequence data quencing of 18S rRNA genes (Table 2). of of Asterococcus 紅 e needed for genes that Ninety five OTU s in the CW group exam- have have been determined in many taxa in the ined in this study were the same as those of CW group. Although Pr りschold et al. (2001) Proschold et al. (2001) ， and five additional studied studied the phylogeny of 95 strains of the CW OTU s are listed in Table 1. Seven OTU s CW group based on 18S ribosomal (r) RNA of the directly opposed (DO) group (Fig. 1) genes ，Asterococcus sequences were not ana- were selected from Proschold et al. (2001). lyzed. lyzed. Therefore we evaluated the phylo- The alignment of the 18S rRNA genes from genetic genetic position of the genus Asterococcus the 95 CW and seven DO OTUs was ex- based based on 18S rRNA sequences. Our results tracted from that of Proschold et al. (2001) suggest suggest that Asterococcus is separated from and the five additional OTU s (Table 1) were other other members of the Tetrasporales within realigned using Clustal X (Thompson et al. the the CW group. 1997). The alignment (1 642 bp; see Proschold Material Material and Methods et al. 2001) was subjected to unweighted Two. strains of Asterococcus were selected maximum p紅 simony (MP) analysis ，includ- as as representatives of the genus since they ing bootstrap analysis (Felsenstein 1985) have have different colonial forms and belong to with 100 replications of a full heuristic the the two subgroups constituting the mono 田 search based on the nearest-neighbor inter 司 phyletic phyletic Asterococcus group in the rbcL change (NNI) branch-swapping algorithm ， gene gene phylogeny (Nakazawa et al. 2004). using PAUP 4.0bl0 (Swofford 2002). They were A. superbus IAM C ・299 with a Following the guidelines for topology con- spherical spherical colony and A. korschikoffii Ettl struction with distance methods (N ei and ACOI 326 with a dendroid colony (Naka- Kumar 2000) ，we selected Jukes-Cantor dis- zawa et al. 2004) (Table 1). tances (Jukes and Cantor 1969) to construct The methods for DNA extraction and di 聞 (NJ) neighbor-joining trees. From the align- rect rect sequencing of polymerase chain reaction ment used for the MP analysis ，a Jukes- (PCR) products were the same as those of a Cantor distance matrix was calculated (J ukes previous previous study (Nakazawa et al. 2004) ，ex- and Cantor 1969) using PAUP 4.0bl0. With cept cept for the primers used for PCR and se- the NJ algorithm (Saitou and Nei 1987) ，a Table Table 1. Additional OTUs of CW group (Proschold et al. 2001) used for phylogenetic analysis using the18S rRNA genes genes Origin Origin of 18S DDBJAMB L/ GenBank Species Species Strain designation sequence sequence data accession number Asterococcus Asterococcus superbus IAM 1 C-299 The present study AB175836 2 Asterococcus Asterococcus korschikoffii ACOI 326 The present study AB175837 3 Characiochloris Characiochloris acuminata UTEX 2095 Buchheim et al. (2002) AF395435 4 Hafniomonas montana NIES -257 Nozaki et al. (2003) AB101517 Hφ uomonas mon ωna NIES-656 Nozaki et al. (2003) AB101518 lIAM Culture Collection at the University of Tokyo (Sugiyama et al. 1998). 2The 2The Culture Collection of Algae at the Department of Botany ，University of Coimbra (Santos and Mesquita 1986 ， Santos Santos 1988 ， Santos et al. 1993). 3Culture 3Culture Collection of Algae at the University of Texas at Austin (Starr and Zeikus 1993). 4Microbial 4Microbial Culture Collection at the National Institute for Environmental Studies (Watanabe et al. 2000). August August 2004 Journal of Japanese' Botany Vo l. 79 No. 4 257 Table Table 2. Primers used for amplifications and sequencing of the18S rRNA genes Designation Designation Positions 1 Sequence (5'-3') 18S-FA 18S-FA 1-21 AACCTGGTTGATCCTGCCAGT 18S-RD 57 0- 550 2 GCTGGCACCAGACTTGCCCTC 18S-FG 18S-FG 557-577 AGTCTGGTGCCAGCAGCCGCG 18S-FE 18S-FE 1112-1132 GGGAGTATGGTCGCAAGGCTG 18S-RF 18S-RF 1202-1182 2 CCCGTGTTGAGTCAAATTAAG 2 18S-RB 18S-RB 1799 ー1774 TGATCCTTCTGCAGGTTCACCTAC lCoordinate lCoordinate number from the Chlorella vulgaris Beijerink 18S rRNA gene (Huss et al. 1990). 2Reverse 2Reverse primer. phylogenetic 位ee was constructed ，also using lineages of other tetrasporalean algae ， one PAUP 4.0bl0. The robustness of the result- containing a palmellopsidacean species ing ing lineages was tested by bootstrap analysis [Chlamydoc αrps α maxima (Mainx) Ettl & with with 1000 replications using PAUP 4.0bl0. Gartner] and the other composed of two co 四 U sing the same alignment data ，a maximum lonial genera in the Tetrasporaceae likelihood likelihood (ML) analysis was carried out (Tetraspora Link and Paulschulzia Sk 吋a). using using PUZZLE in PAUP 4.0bl0 ， with the By contrast ， the genus Asterococc α us consti- HKY model (Hasegawa et al. 1985) to esti- tuted a robust monophyletic group with two mate mate qu 紅 tet puzzling support values ， which unicellular volvoca 叫lean genera Oog αル. have have the same practical meaning as bootstrap mηlochla α mηlyS Pr め.。凸 S印chold & al. (ο2001) and values values (Strimmer and von Haeseler 1996) for Loboch μα l， m. ηη ly y戸 internal internal branches of the phylogenetic tree high boot 臼st 住rap/QPS values (79-99 %) with with with 1000 puzzling steps (comp 訂 able to the the NJ ，MP ， and ML methods. Within this number of bootstrap replicates). In these group ， the MP and ML analyses suggested phylogenetic phylogenetic analyses ， the seven species in that Asterococcus and Oog αmochlamys the the DO group (Fig. 1) were designated the formed a clade with 71-75 % bootstrap/QPS outgroup outgroup since the DO group is sister to the values (not shown) ， whereas the NJ analysis CW group containing volvocalean and did not support this clade. biflagellate biflagellate te 住asporalean algae (Booton et et al. 1998). Discussion Tetrasporales Tetrasporales is traditionally characterized Results Results as having a gelatinous structure (gelatinous The NJ tree of the 18S rRNA sequences is matrix an d/ or pseudoflagella) in the vegeta- shown in Fig. 1， and branches with 50 % or tive phase in which cells can be converted greater greater bootstrap/QPS values in the NJ ，MP into reproductive cells without preceding cell an d/ or ML 紅 e shown. A robust mono 闘 divisions (e. g. ， Ettl and Gartner 1988). phyletic phyletic group consisting of the genus However ， the validity of this order has been Asterococcus Asterococcus (A. superbus and A. kor- doubted because no common characteristics schikoffii) schikoffii) was resolved with high boot- clearly distinguish the Tetrasporales from the strap/QPS strap/QPS values (92-100 %) using the NJ ， volvocalean an d/ or chlorococcalean green MP ， and ML methods. This genus was dis- algae (e. g. ， van den Hoek et al. 1995). Based tant tant from the ‘Reinhardtii' -Clade (Proschold on the 18S rRNA gene phylogeny ， Booton et et al. 2001) ， which included two separate et al.
Recommended publications
  • The Hawaiian Freshwater Algae Biodiversity Survey

    The Hawaiian Freshwater Algae Biodiversity Survey

    Sherwood et al. BMC Ecology 2014, 14:28 http://www.biomedcentral.com/1472-6785/14/28 RESEARCH ARTICLE Open Access The Hawaiian freshwater algae biodiversity survey (2009–2014): systematic and biogeographic trends with an emphasis on the macroalgae Alison R Sherwood1*, Amy L Carlile1,2, Jessica M Neumann1, J Patrick Kociolek3, Jeffrey R Johansen4, Rex L Lowe5, Kimberly Y Conklin1 and Gernot G Presting6 Abstract Background: A remarkable range of environmental conditions is present in the Hawaiian Islands due to their gradients of elevation, rainfall and island age. Despite being well known as a location for the study of evolutionary processes and island biogeography, little is known about the composition of the non-marine algal flora of the archipelago, its degree of endemism, or affinities with other floras. We conducted a biodiversity survey of the non-marine macroalgae of the six largest main Hawaiian Islands using molecular and microscopic assessment techniques. We aimed to evaluate whether endemism or cosmopolitanism better explain freshwater algal distribution patterns, and provide a baseline data set for monitoring future biodiversity changes in the Hawaiian Islands. Results: 1,786 aquatic and terrestrial habitats and 1,407 distinct collections of non-marine macroalgae were collected from the islands of Kauai, Oahu, Molokai, Maui, Lanai and Hawaii from the years 2009–2014. Targeted habitats included streams, wet walls, high elevation bogs, taro fields, ditches and flumes, lakes/reservoirs, cave walls and terrestrial areas. Sites that lacked freshwater macroalgae were typically terrestrial or wet wall habitats that were sampled for diatoms and other microalgae. Approximately 50% of the identifications were of green algae, with lesser proportions of diatoms, red algae, cyanobacteria, xanthophytes and euglenoids.
  • Lobo MTMPS (2019) First Record of Tetraspora Gelatinosa (Vaucher) Desvaux (Tetrasporales, Chlorophyceae) in the State of Goiás, Central-Western Brazil

    Lobo MTMPS (2019) First Record of Tetraspora Gelatinosa (Vaucher) Desvaux (Tetrasporales, Chlorophyceae) in the State of Goiás, Central-Western Brazil

    15 1 NOTES ON GEOGRAPHIC DISTRIBUTION Check List 15 (1): 143–147 https://doi.org/10.15560/15.1.143 First record of Tetraspora gelatinosa Link ex Desvaux (Tetrasporales, Chlorophyceae) in the state of Goiás, Central-Western Brazil Weliton José da Silva1, Ina de Souza Nogueira2, Maria Tereza Morais Pereira Souza Lobo3 1 Universidade Estadual de Londrina, Centro de Ciências Biológicas, Departamento de Biologia Animal e Vegetal, Laboratório de Microalgas Continentais, Rodovia Celso Garcia Cid, Pr 445 Km 380, CEP 86057-970, Londrina, PR, Brazil. 2 Universidade Federal de Goiás, Instituto de Ciências Biológicas, Departamento de Botânica, Laboratório de Análise de Gerenciamento Ambiental de Recursos Hídricos, Alameda Palmeiras Quadra I - Lote i2, CEP 74690-900, Goiânia, GO, Brazil. 3 Universidade Federal de Goiás, Programa de Pós-graduação em Ciências Ambientais, Laboratório de Análise de Gerenciamento Ambiental de Recursos Hídricos, Alameda Palmeiras Quadra I - Lote i2, CEP 74690-900, Goiânia, GO, Brazil. Corresponding author: Weliton José da Silva, [email protected] Abstract Tetraspora gelatinosa is rare and has been recorded only in 3 Brazilian states since the 2000s. The flora of the state of Goiás is incipiently known, but there is no record of Tetraspora thus far. We record the occurrence of T. gelatinosa in Goiás and characterize this species’ morphology and ecological preferences. Specimens were found in the Samambaia Reservoir, Goiânia, Goiás. Physical and chemical characteristics of the water were measured. Where T. gelatinosa was found, the water was shallow and characterized as ultraoligotrophic. These conditions agree with those reported for other environments in Brazil. Key words Algae, Meia Ponte river basin, new record, rare species, ultraoligotrophic.
  • Phylogenetic Placement of Botryococcus Braunii (Trebouxiophyceae) and Botryococcus Sudeticus Isolate Utex 2629 (Chlorophyceae)1

    Phylogenetic Placement of Botryococcus Braunii (Trebouxiophyceae) and Botryococcus Sudeticus Isolate Utex 2629 (Chlorophyceae)1

    J. Phycol. 40, 412–423 (2004) r 2004 Phycological Society of America DOI: 10.1046/j.1529-8817.2004.03173.x PHYLOGENETIC PLACEMENT OF BOTRYOCOCCUS BRAUNII (TREBOUXIOPHYCEAE) AND BOTRYOCOCCUS SUDETICUS ISOLATE UTEX 2629 (CHLOROPHYCEAE)1 Hoda H. Senousy, Gordon W. Beakes, and Ethan Hack2 School of Biology, University of Newcastle upon Tyne, Newcastle upon Tyne NE1 7RU, UK The phylogenetic placement of four isolates of a potential source of renewable energy in the form of Botryococcus braunii Ku¨tzing and of Botryococcus hydrocarbon fuels (Metzger et al. 1991, Metzger and sudeticus Lemmermann isolate UTEX 2629 was Largeau 1999, Banerjee et al. 2002). The best known investigated using sequences of the nuclear small species is Botryococcus braunii Ku¨tzing. This organism subunit (18S) rRNA gene. The B. braunii isolates has a worldwide distribution in fresh and brackish represent the A (two isolates), B, and L chemical water and is occasionally found in salt water. Although races. One isolate of B. braunii (CCAP 807/1; A race) it grows relatively slowly, it sometimes forms massive has a group I intron at Escherichia coli position 1046 blooms (Metzger et al. 1991, Tyson 1995). Botryococcus and isolate UTEX 2629 has group I introns at E. coli braunii strains differ in the hydrocarbons that they positions 516 and 1512. The rRNA sequences were accumulate, and they have been classified into three aligned with 53 previously reported rRNA se- chemical races, called A, B, and L. Strains in the A race quences from members of the Chlorophyta, includ- accumulate alkadienes; strains in the B race accumulate ing one reported for B.
  • Old Woman Creek National Estuarine Research Reserve Management Plan 2011-2016

    Old Woman Creek National Estuarine Research Reserve Management Plan 2011-2016

    Old Woman Creek National Estuarine Research Reserve Management Plan 2011-2016 April 1981 Revised, May 1982 2nd revision, April 1983 3rd revision, December 1999 4th revision, May 2011 Prepared for U.S. Department of Commerce Ohio Department of Natural Resources National Oceanic and Atmospheric Administration Division of Wildlife Office of Ocean and Coastal Resource Management 2045 Morse Road, Bldg. G Estuarine Reserves Division Columbus, Ohio 1305 East West Highway 43229-6693 Silver Spring, MD 20910 This management plan has been developed in accordance with NOAA regulations, including all provisions for public involvement. It is consistent with the congressional intent of Section 315 of the Coastal Zone Management Act of 1972, as amended, and the provisions of the Ohio Coastal Management Program. OWC NERR Management Plan, 2011 - 2016 Acknowledgements This management plan was prepared by the staff and Advisory Council of the Old Woman Creek National Estuarine Research Reserve (OWC NERR), in collaboration with the Ohio Department of Natural Resources-Division of Wildlife. Participants in the planning process included: Manager, Frank Lopez; Research Coordinator, Dr. David Klarer; Coastal Training Program Coordinator, Heather Elmer; Education Coordinator, Ann Keefe; Education Specialist Phoebe Van Zoest; and Office Assistant, Gloria Pasterak. Other Reserve staff including Dick Boyer and Marje Bernhardt contributed their expertise to numerous planning meetings. The Reserve is grateful for the input and recommendations provided by members of the Old Woman Creek NERR Advisory Council. The Reserve is appreciative of the review, guidance, and council of Division of Wildlife Executive Administrator Dave Scott and the mapping expertise of Keith Lott and the late Steve Barry.
  • Multigene Eukaryote Phylogeny Reveals the Likely Protozoan Ancestors of Opis- Thokonts (Animals, Fungi, Choanozoans) and Amoebozoa

    Multigene Eukaryote Phylogeny Reveals the Likely Protozoan Ancestors of Opis- Thokonts (Animals, Fungi, Choanozoans) and Amoebozoa

    Accepted Manuscript Multigene eukaryote phylogeny reveals the likely protozoan ancestors of opis- thokonts (animals, fungi, choanozoans) and Amoebozoa Thomas Cavalier-Smith, Ema E. Chao, Elizabeth A. Snell, Cédric Berney, Anna Maria Fiore-Donno, Rhodri Lewis PII: S1055-7903(14)00279-6 DOI: http://dx.doi.org/10.1016/j.ympev.2014.08.012 Reference: YMPEV 4996 To appear in: Molecular Phylogenetics and Evolution Received Date: 24 January 2014 Revised Date: 2 August 2014 Accepted Date: 11 August 2014 Please cite this article as: Cavalier-Smith, T., Chao, E.E., Snell, E.A., Berney, C., Fiore-Donno, A.M., Lewis, R., Multigene eukaryote phylogeny reveals the likely protozoan ancestors of opisthokonts (animals, fungi, choanozoans) and Amoebozoa, Molecular Phylogenetics and Evolution (2014), doi: http://dx.doi.org/10.1016/ j.ympev.2014.08.012 This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain. 1 1 Multigene eukaryote phylogeny reveals the likely protozoan ancestors of opisthokonts 2 (animals, fungi, choanozoans) and Amoebozoa 3 4 Thomas Cavalier-Smith1, Ema E. Chao1, Elizabeth A. Snell1, Cédric Berney1,2, Anna Maria 5 Fiore-Donno1,3, and Rhodri Lewis1 6 7 1Department of Zoology, University of Oxford, South Parks Road, Oxford OX1 3PS, UK.
  • Transcription of the Hydrogenase Gene During H2 Production in Scenedesmus Obliquus and Chlorella Vulgaris

    Transcription of the Hydrogenase Gene During H2 Production in Scenedesmus Obliquus and Chlorella Vulgaris

    Transcription of the Hydrogenase Gene during H2 Production in Scenedesmus Obliquus and Chlorella Vulgaris Yahaira de Jesus Tamayo Ordóñez Universidad Autónoma de Coahuila: Universidad Autonoma de Coahuila Benjamin Abraham Ayil Gutiérrez Instituto Politécnico Nacional: Instituto Politecnico Nacional Alejandro Ruiz Marin Universidad Autónoma del Carmen: Universidad Autonoma del Carmen Francisco Alberto Tamayo Ordóñez Universidad Autónoma del Carmen: Universidad Autonoma del Carmen Ileana Maria Mayela Moreno Davila Universidad Autónoma de Coahuila: Universidad Autonoma de Coahuila Leopoldo Ríos González Universidad Autónoma de Coahuila: Universidad Autonoma de Coahuila Jose Antonio Rodriguez de la Garza Universidad Autónoma de Coahuila: Universidad Autonoma de Coahuila Juan Carlos Robles Heredia Universidad Autónoma del Carmen: Universidad Autonoma del Carmen Maria Concepcion Tamayo Ordoñez ( [email protected] ) Universidad Autonoma de Coahuila https://orcid.org/0000-0003-0201-0184 Original article Keywords: microalgae, hydrogenase gene, molecular hydrogen, mutation Posted Date: March 24th, 2021 DOI: https://doi.org/10.21203/rs.3.rs-342043/v1 License: This work is licensed under a Creative Commons Attribution 4.0 International License. Read Full License Page 1/30 Abstract There is ongoing research related to the production of molecular hydrogen today and algae have proven to be good biological models for producing several compounds of interest. We analyzed how genetic variations in hydrogenase genes (hyd) can affect the production of
  • An Unrecognized Ancient Lineage of Green Plants Persists in Deep Marine Waters1

    An Unrecognized Ancient Lineage of Green Plants Persists in Deep Marine Waters1

    J. Phycol. 46, 1288–1295 (2010) Ó 2010 Phycological Society of America DOI: 10.1111/j.1529-8817.2010.00900.x AN UNRECOGNIZED ANCIENT LINEAGE OF GREEN PLANTS PERSISTS IN DEEP MARINE WATERS1 Frederick W. Zechman2,3 Department of Biology, California State University Fresno, 2555 East San Ramon Ave, Fresno, California 93740, USA Heroen Verbruggen,3 Frederik Leliaert Phycology Research Group, Ghent University, Krijgslaan 281 S8, 9000 Ghent, Belgium Matt Ashworth University Station MS A6700, 311 Biological Laboratories, University of Texas at Austin, Austin, Texas 78712, USA Mark A. Buchheim Department of Biological Science, University of Tulsa, Tulsa, Oklahoma 74104, USA Marvin W. Fawley School of Mathematical and Natural Sciences, University of Arkansas at Monticello, Monticello, Arkansas 71656, USA Department of Biological Sciences, North Dakota State University, Fargo, North Dakota 58105, USA Heather Spalding Botany Department, University of Hawaii at Manoa, Honolulu, Hawaii 96822, USA Curt M. Pueschel Department of Biological Sciences, State University of New York at Binghamton, Binghamton, New York 13901, USA Julie A. Buchheim, Bindhu Verghese Department of Biological Science, University of Tulsa, Tulsa, Oklahoma 74104, USA and M. Dennis Hanisak Harbor Branch Oceanographic Institution, Fort Pierce, Florida 34946, USA We provide molecular phylogenetic evidence that Key index words: Chlorophyta; green algae; molec- the obscure genera Palmophyllum Ku¨tz. and Verdigel- ular phylogenetics; Palmophyllaceae fam. nov.; las D. L. Ballant. et J. N. Norris form a distinct and Palmophyllales ord. nov.; Palmophyllum; Prasino- early diverging lineage of green algae. These pal- phyceae; Verdigellas; Viridiplantae melloid seaweeds generally persist in deep waters, Abbreviations: AU, approximately unbiased; BI, where grazing pressure and competition for space Bayesian inference; ML, maximum likelihood; are reduced.
  • A Taxonomic Reassessment of Chlamydomonas Meslinii (Volvocales, Chlorophyceae) with a Description of Paludistella Gen.Nov

    A Taxonomic Reassessment of Chlamydomonas Meslinii (Volvocales, Chlorophyceae) with a Description of Paludistella Gen.Nov

    Phytotaxa 432 (1): 065–080 ISSN 1179-3155 (print edition) https://www.mapress.com/j/pt/ PHYTOTAXA Copyright © 2020 Magnolia Press Article ISSN 1179-3163 (online edition) https://doi.org/10.11646/phytotaxa.432.1.6 A taxonomic reassessment of Chlamydomonas meslinii (Volvocales, Chlorophyceae) with a description of Paludistella gen.nov. HANI SUSANTI1,6, MASAKI YOSHIDA2, TAKESHI NAKAYAMA2, TAKASHI NAKADA3,4 & MAKOTO M. WATANABE5 1Life Science Innovation, School of Integrative and Global Major, University of Tsukuba, 1-1-1 Tennodai, Tsukuba, Ibaraki, 305-8577, Japan. 2Faculty of Life and Environmental Sciences, University of Tsukuba, 1-1-1 Tennodai, Tsukuba 305-8577, Japan. 3Institute for Advanced Biosciences, Keio University, Tsuruoka, Yamagata, 997-0052, Japan. 4Systems Biology Program, Graduate School of Media and Governance, Keio University, Fujisawa, Kanagawa, 252-8520, Japan. 5Algae Biomass Energy System Development and Research Center, University of Tsukuba. 6Research Center for Biotechnology, Indonesian Institute of Sciences, Jl. Raya Bogor KM 46 Cibinong West Java, Indonesia. Corresponding author: [email protected] Abstract Chlamydomonas (Volvocales, Chlorophyceae) is a large polyphyletic genus that includes numerous species that should be classified into independent genera. The present study aimed to examine the authentic strain of Chlamydomonas meslinii and related strains based on morphological and molecular data. All the strains possessed an asteroid chloroplast with a central pyrenoid and hemispherical papilla; however, they were different based on cell and stigmata shapes. Molecular phylogenetic analyses based on 18S rDNA, atpB, and psaB indicated that the strains represented a distinct subclade in the clade Chloromonadinia. The secondary structure of ITS-2 supported the separation of the strains into four species.
  • Acidophilic Green Algal Genome Provides Insights Into Adaptation to an Acidic Environment

    Acidophilic Green Algal Genome Provides Insights Into Adaptation to an Acidic Environment

    Acidophilic green algal genome provides insights into adaptation to an acidic environment Shunsuke Hirookaa,b,1, Yuu Hirosec, Yu Kanesakib,d, Sumio Higuchie, Takayuki Fujiwaraa,b,f, Ryo Onumaa, Atsuko Eraa,b, Ryudo Ohbayashia, Akihiro Uzukaa,f, Hisayoshi Nozakig, Hirofumi Yoshikawab,h, and Shin-ya Miyagishimaa,b,f,1 aDepartment of Cell Genetics, National Institute of Genetics, Shizuoka 411-8540, Japan; bCore Research for Evolutional Science and Technology, Japan Science and Technology Agency, Saitama 332-0012, Japan; cDepartment of Environmental and Life Sciences, Toyohashi University of Technology, Aichi 441-8580, Japan; dNODAI Genome Research Center, Tokyo University of Agriculture, Tokyo 156-8502, Japan; eResearch Group for Aquatic Plants Restoration in Lake Nojiri, Nojiriko Museum, Nagano 389-1303, Japan; fDepartment of Genetics, Graduate University for Advanced Studies, Shizuoka 411-8540, Japan; gDepartment of Biological Sciences, Graduate School of Science, University of Tokyo, Tokyo 113-0033, Japan; and hDepartment of Bioscience, Tokyo University of Agriculture, Tokyo 156-8502, Japan Edited by Krishna K. Niyogi, Howard Hughes Medical Institute, University of California, Berkeley, CA, and approved August 16, 2017 (received for review April 28, 2017) Some microalgae are adapted to extremely acidic environments in pumps that biotransform arsenic and archaeal ATPases, which which toxic metals are present at high levels. However, little is known probably contribute to the algal heat tolerance (8). In addition, the about how acidophilic algae evolved from their respective neutrophilic reduction in the number of genes encoding voltage-gated ion ancestors by adapting to particular acidic environments. To gain channels and the expansion of chloride channel and chloride car- insights into this issue, we determined the draft genome sequence rier/channel families in the genome has probably contributed to the of the acidophilic green alga Chlamydomonas eustigma and per- algal acid tolerance (8).
  • Chlorophyta, Chlorococcales, Oocystaceae) Outside East Asia

    Chlorophyta, Chlorococcales, Oocystaceae) Outside East Asia

    Fottea 10(1): 141–144, 2010 141 First report of Makinoella tosaensis OKADA (Chlorophyta, Chlorococcales, Oocystaceae) outside East Asia František HINDÁK & Alica HINDÁKOVÁ Institute of Botany, Slovak Academy of Sciences, Dúbravská cesta 9, SK–84523 Bratislava, Slovakia; e–mail: [email protected], [email protected] Abstract: The morphology of Makinoella tosaensis Okada 1949, a chlorococcalean coenobial alga described from Japan and since then observed only in Korea, has been studied under the LM from field material and in laboratory cultures. Its collection from a small fountain in the campus park of the Slovak Academy of Sciences in Bratislava, Slovakia, is the first record outside East Asia. The morphology of coenobia and cells in this material is in agreement with published data of the species. Key words: Chlorococcales, coenobial green algae, morphology, taxonomy, Slovakia Introduction & FOTT 1983). Outside of Japan (cf. http:// protist.i.hosei.ac.jp/PDB/Images/chlorophyta/ In the algal flora of Slovakia project, special Makinoella/index.html), it was observed only in attention was paid to small artificial water bodies Korea (he g e w a l d et al. 1999). The strain SAG such as urban fountains. The diversity of algae 28.97, isolated by Hegewald from Korea, is kept was investigated in several fountains within the at the Algal Collection in Göttingen, Germany. city limits of Bratislava (HINDÁK 1977, 1980 a, b, The ultrastructure of this culture was investigated 1984, 1988, 1990, 1996; HINDÁK & HINDÁKOVÁ in detail by sc h n e p f & he g e w a l d (2000). This 1994, 1998; HINDÁKOVÁ & HINDÁK 1998), strain was also used for molecular analyses and including a small basin located at the campus compared with some other representatives of the of the Slovak Academy of Sciences (SAS) at Oocystaceae (he p p e r l e et al.
  • The Symbiotic Green Algae, Oophila (Chlamydomonadales

    The Symbiotic Green Algae, Oophila (Chlamydomonadales

    University of Connecticut OpenCommons@UConn Master's Theses University of Connecticut Graduate School 12-16-2016 The yS mbiotic Green Algae, Oophila (Chlamydomonadales, Chlorophyceae): A Heterotrophic Growth Study and Taxonomic History Nikolaus Schultz University of Connecticut - Storrs, [email protected] Recommended Citation Schultz, Nikolaus, "The yS mbiotic Green Algae, Oophila (Chlamydomonadales, Chlorophyceae): A Heterotrophic Growth Study and Taxonomic History" (2016). Master's Theses. 1035. https://opencommons.uconn.edu/gs_theses/1035 This work is brought to you for free and open access by the University of Connecticut Graduate School at OpenCommons@UConn. It has been accepted for inclusion in Master's Theses by an authorized administrator of OpenCommons@UConn. For more information, please contact [email protected]. The Symbiotic Green Algae, Oophila (Chlamydomonadales, Chlorophyceae): A Heterotrophic Growth Study and Taxonomic History Nikolaus Eduard Schultz B.A., Trinity College, 2014 A Thesis Submitted in Partial Fulfillment of the Requirements for the Degree of Master of Science at the University of Connecticut 2016 Copyright by Nikolaus Eduard Schultz 2016 ii ACKNOWLEDGEMENTS This thesis was made possible through the guidance, teachings and support of numerous individuals in my life. First and foremost, Louise Lewis deserves recognition for her tremendous efforts in making this work possible. She has performed pioneering work on this algal system and is one of the preeminent phycologists of our time. She has spent hundreds of hours of her time mentoring and teaching me invaluable skills. For this and so much more, I am very appreciative and humbled to have worked with her. Thank you Louise! To my committee members, Kurt Schwenk and David Wagner, thank you for your mentorship and guidance.
  • Airborne Microalgae: Insights, Opportunities, and Challenges

    Airborne Microalgae: Insights, Opportunities, and Challenges

    crossmark MINIREVIEW Airborne Microalgae: Insights, Opportunities, and Challenges Sylvie V. M. Tesson,a,b Carsten Ambelas Skjøth,c Tina Šantl-Temkiv,d,e Jakob Löndahld Department of Marine Sciences, University of Gothenburg, Gothenburg, Swedena; Department of Biology, Lund University, Lund, Swedenb; National Pollen and Aerobiology Research Unit, Institute of Science and the Environment, University of Worcester, Worcester, United Kingdomc; Department of Design Sciences, Lund University, Lund, Swedend; Stellar Astrophysics Centre, Department of Physics and Astronomy, Aarhus University, Aarhus, Denmarke Airborne dispersal of microalgae has largely been a blind spot in environmental biological studies because of their low concen- tration in the atmosphere and the technical limitations in investigating microalgae from air samples. Recent studies show that airborne microalgae can survive air transportation and interact with the environment, possibly influencing their deposition rates. This minireview presents a summary of these studies and traces the possible route, step by step, from established ecosys- tems to new habitats through air transportation over a variety of geographic scales. Emission, transportation, deposition, and adaptation to atmospheric stress are discussed, as well as the consequences of their dispersal on health and the environment and Downloaded from state-of-the-art techniques to detect and model airborne microalga dispersal. More-detailed studies on the microalga atmo- spheric cycle, including, for instance, ice nucleation activity and transport simulations, are crucial for improving our under- standing of microalga ecology, identifying microalga interactions with the environment, and preventing unwanted contamina- tion events or invasions. he presence of microorganisms in the atmosphere has been phyta and Ochrophyta in the atmosphere (taxonomic classifica- Tdebated over centuries.