植物研究雑誌 J. J. Jpn. Bo t. 79:255-261 79:255-261 (2004) Phylogenetic Phylogenetic Analysis of the Tetrasporalean Genus Asterococcus Asterococcus (Chlorophyceae) sased on 18S 18S Ribosomal RNA Gene Sequences Atsushi Atsushi NAKAZA WA and Hisayoshi NOZAKI Department Department of Biological Sciences ，Graduate School of Science ，University of Tokyo ， Hongo Hongo 7-3-1 ，Bunkyo-ku ，Tokyo ，113 ・0033 JAPAN (Received (Received on October 30 ，2003) Nucleotide Nucleotide sequences (1642 bp) from 18S ribosomal RNA genes were analyzed for 100 100 strains of the clockwise (CW) group of Chlorophyceae to deduce the phylogenetic position position of the immotile colonial genus Asterococcus Scherffel ， which is classified in the Palmellopsidaceae Palmellopsidaceae of Tetrasporales. We found that the genus Asterococcus and two uni- cellular ， volvocalean genera ， Lobochlamys Proschold & al. and Oogamochlamys Proschold Proschold & al.， formed a robust monophyletic group ， which was separated from two te 位asporalean clades ， one composed of Tetraspora Link and Paulschulzia Sk 吋a and the other other containing the other palme l1 0psidacean genus Chlamydocaps αFot t. Therefore ， the Tetrasporales Tetrasporales in the CW group is clearly polyphyletic and taxonomic revision of the order order and the Palmellopsidaceae is needed. Key words: 18S rRNA gene ，Asterococcus ，Palmellopsidaceae ，phylogeny ，Tetraspor- ales. ales. Asterococcus Asterococcus Scherffel (1908) is a colo- Recently ， Ettl and Gartner (1 988) included nial nial green algal genus that is characterized Asterococcus in the family Palmello- by an asteroid chloroplast in the cell and psidaceae ， because cells of this genus have swollen swollen gelatinous layers surrounding the contractile vacuoles and lack pseudoflagella immotile immotile colony (e. g. ， Ettl and Gartner in the nor トattached vegetative colony. 1988). 1988). This genus is generally assigned to Patricia et al. (2000) revealed that the the Tetrasporales (e. g. ，Lemmermann 1915 ， Asterococcus belongs to the clockwise (CW) Tiffany Tiffany 1934 ，Smith 1950 ， Ettl 1964 ， Fott group of Chlorophyceae ， based on the CW 1971 ， Ettl and Gartner 1988). However ， the orientation of the flagellar apparatus in A. systematic systematic position of Asterococcus at the superbus (Cienkowski) Scherffe l. Nakazawa family family level varies according to the author. et al. (2004) carried out a taxonomic study of Lemmermann (1915) classified Asterococcus Asterococcus based on the comparative mor- in in the Palmellaceae. Korshikov (1 953) con- phology of many strains and molecular sidered sidered this genus a member of the dendroid phylogenetic analyses of the Rubisco 1紅 ge family family Chlorangiellaceae because his alga subunit (rbcL) gene sequences. However ， the produced dendroid ，gelatinous colonies. Fott phylogenetic position of this genus within (1 971) distinguished Asterococcus from the CW group was ambiguous ， possibly be- other other members of the Tetrasporales and es- cause of the limited numbers of operational tablished tablished a new far 凶ly ， the Asterococcaceae. taxonomic units (OTUs) analyzed (Naka- -255- 256 植物研究雑誌第79 巻第4号 平成16 年8月 zawa et al. 2004). Therefore ， sequence data quencing of 18S rRNA genes (Table 2). of of Asterococcus 紅 e needed for genes that Ninety five OTU s in the CW group exam- have have been determined in many taxa in the ined in this study were the same as those of CW group. Although Pr りschold et al. (2001) Proschold et al. (2001) ， and five additional studied studied the phylogeny of 95 strains of the CW OTU s are listed in Table 1. Seven OTU s CW group based on 18S ribosomal (r) RNA of the directly opposed (DO) group (Fig. 1) genes ，Asterococcus sequences were not ana- were selected from Proschold et al. (2001). lyzed. lyzed. Therefore we evaluated the phylo- The alignment of the 18S rRNA genes from genetic genetic position of the genus Asterococcus the 95 CW and seven DO OTUs was ex- based based on 18S rRNA sequences. Our results tracted from that of Proschold et al. (2001) suggest suggest that Asterococcus is separated from and the five additional OTU s (Table 1) were other other members of the Tetrasporales within realigned using Clustal X (Thompson et al. the the CW group. 1997). The alignment (1 642 bp; see Proschold Material Material and Methods et al. 2001) was subjected to unweighted Two. strains of Asterococcus were selected maximum p紅 simony (MP) analysis ，includ- as as representatives of the genus since they ing bootstrap analysis (Felsenstein 1985) have have different colonial forms and belong to with 100 replications of a full heuristic the the two subgroups constituting the mono 田 search based on the nearest-neighbor inter 司 phyletic phyletic Asterococcus group in the rbcL change (NNI) branch-swapping algorithm ， gene gene phylogeny (Nakazawa et al. 2004). using PAUP 4.0bl0 (Swofford 2002). They were A. superbus IAM C ・299 with a Following the guidelines for topology con- spherical spherical colony and A. korschikoffii Ettl struction with distance methods (N ei and ACOI 326 with a dendroid colony (Naka- Kumar 2000) ，we selected Jukes-Cantor dis- zawa et al. 2004) (Table 1). tances (Jukes and Cantor 1969) to construct The methods for DNA extraction and di 聞 (NJ) neighbor-joining trees. From the align- rect rect sequencing of polymerase chain reaction ment used for the MP analysis ，a Jukes- (PCR) products were the same as those of a Cantor distance matrix was calculated (J ukes previous previous study (Nakazawa et al. 2004) ，ex- and Cantor 1969) using PAUP 4.0bl0. With cept cept for the primers used for PCR and se- the NJ algorithm (Saitou and Nei 1987) ，a Table Table 1. Additional OTUs of CW group (Proschold et al. 2001) used for phylogenetic analysis using the18S rRNA genes genes Origin Origin of 18S DDBJAMB L/ GenBank Species Species Strain designation sequence sequence data accession number Asterococcus Asterococcus superbus IAM 1 C-299 The present study AB175836 2 Asterococcus Asterococcus korschikoffii ACOI 326 The present study AB175837 3 Characiochloris Characiochloris acuminata UTEX 2095 Buchheim et al. (2002) AF395435 4 Hafniomonas montana NIES -257 Nozaki et al. (2003) AB101517 Hφ uomonas mon ωna NIES-656 Nozaki et al. (2003) AB101518 lIAM Culture Collection at the University of Tokyo (Sugiyama et al. 1998). 2The 2The Culture Collection of Algae at the Department of Botany ，University of Coimbra (Santos and Mesquita 1986 ， Santos Santos 1988 ， Santos et al. 1993). 3Culture 3Culture Collection of Algae at the University of Texas at Austin (Starr and Zeikus 1993). 4Microbial 4Microbial Culture Collection at the National Institute for Environmental Studies (Watanabe et al. 2000). August August 2004 Journal of Japanese' Botany Vo l. 79 No. 4 257 Table Table 2. Primers used for amplifications and sequencing of the18S rRNA genes Designation Designation Positions 1 Sequence (5'-3') 18S-FA 18S-FA 1-21 AACCTGGTTGATCCTGCCAGT 18S-RD 57 0- 550 2 GCTGGCACCAGACTTGCCCTC 18S-FG 18S-FG 557-577 AGTCTGGTGCCAGCAGCCGCG 18S-FE 18S-FE 1112-1132 GGGAGTATGGTCGCAAGGCTG 18S-RF 18S-RF 1202-1182 2 CCCGTGTTGAGTCAAATTAAG 2 18S-RB 18S-RB 1799 ー1774 TGATCCTTCTGCAGGTTCACCTAC lCoordinate lCoordinate number from the Chlorella vulgaris Beijerink 18S rRNA gene (Huss et al. 1990). 2Reverse 2Reverse primer. phylogenetic 位ee was constructed ，also using lineages of other tetrasporalean algae ， one PAUP 4.0bl0. The robustness of the result- containing a palmellopsidacean species ing ing lineages was tested by bootstrap analysis [Chlamydoc αrps α maxima (Mainx) Ettl & with with 1000 replications using PAUP 4.0bl0. Gartner] and the other composed of two co 四 U sing the same alignment data ，a maximum lonial genera in the Tetrasporaceae likelihood likelihood (ML) analysis was carried out (Tetraspora Link and Paulschulzia Sk 吋a). using using PUZZLE in PAUP 4.0bl0 ， with the By contrast ， the genus Asterococc α us consti- HKY model (Hasegawa et al. 1985) to esti- tuted a robust monophyletic group with two mate mate qu 紅 tet puzzling support values ， which unicellular volvoca 叫lean genera Oog αル. have have the same practical meaning as bootstrap mηlochla α mηlyS Pr め.。凸 S印chold & al. (ο2001) and values values (Strimmer and von Haeseler 1996) for Loboch μα l， m. ηη ly y戸 internal internal branches of the phylogenetic tree high boot 臼st 住rap/QPS values (79-99 %) with with with 1000 puzzling steps (comp 訂 able to the the NJ ，MP ， and ML methods. Within this number of bootstrap replicates). In these group ， the MP and ML analyses suggested phylogenetic phylogenetic analyses ， the seven species in that Asterococcus and Oog αmochlamys the the DO group (Fig. 1) were designated the formed a clade with 71-75 % bootstrap/QPS outgroup outgroup since the DO group is sister to the values (not shown) ， whereas the NJ analysis CW group containing volvocalean and did not support this clade. biflagellate biflagellate te 住asporalean algae (Booton et et al. 1998). Discussion Tetrasporales Tetrasporales is traditionally characterized Results Results as having a gelatinous structure (gelatinous The NJ tree of the 18S rRNA sequences is matrix an d/ or pseudoflagella) in the vegeta- shown in Fig. 1， and branches with 50 % or tive phase in which cells can be converted greater greater bootstrap/QPS values in the NJ ，MP into reproductive cells without preceding cell an d/ or ML 紅 e shown. A robust mono 闘 divisions (e. g. ， Ettl and Gartner 1988). phyletic phyletic group consisting of the genus However ， the validity of this order has been Asterococcus Asterococcus (A. superbus and A. kor- doubted because no common characteristics schikoffii) schikoffii) was resolved with high boot- clearly distinguish the Tetrasporales from the strap/QPS strap/QPS values (92-100 %) using the NJ ， volvocalean an d/ or chlorococcalean green MP ， and ML methods. This genus was dis- algae (e. g. ， van den Hoek et al. 1995). Based tant tant from the ‘Reinhardtii' -Clade (Proschold on the 18S rRNA gene phylogeny ， Booton et et al. 2001) ， which included two separate et al.