Introduction to DNA Metabarcoding

Total Page:16

File Type:pdf, Size:1020Kb

Load more

Introduction to DNA metabarcoding Pierre Taberlet Laboratoire d'Ecologie Alpine, CNRS UMR 5553 Université Grenoble Alpes, Grenoble, France Porto, 1-5 May 2017 Introduction to DNA metabarcoding • Definitions • Technical context • Which marker for DNA metabarcoding? • The importance of bioinformatics • Key studies – For diet analysis – For current biodiversity surveys – For reconstructing past ecosystems • The future Introduction to DNA metabarcoding • Definitions • Technical context • Which marker for DNA metabarcoding? • The importance of bioinformatics • Key studies – For diet analysis – For current biodiversity surveys – For reconstructing past ecosystems • The future Environmental DNA • First reference in 1987 • Microbiology: from 2000 • Plants and animals: from 2003 • Environmental DNA: DNA that can be extracted from environmental samples (such as soil, water, or air), without first isolating any target organisms • Complex mixture of genomic DNA from many different organisms, possibly degraded • Contains intracellular and extracellular DNA Overview of the emergence of eDNA studies Taxonomic identification from environmental DNA: terminology metabarcoding Suggested terminology DNA DNA barcoding metabarcoding identification level DNA DNA eDNA barcoding metabarcoding metabarcoding (sensu lato) (sensu lato) species level type of markers standardized barcodes DNA DNA eDNA barcoding metabarcoding metabarcoding (sensu lato) (sensu lato) genus, family, or order level other markers complexity of DNA extract single multiple environmental specimen specimens sample (bulk sample) (air, water, soil, feces) Taberlet et al. (2012) Molecular Ecology, 21, 1789-1793. metabarcoding Web of Science, 28 April 2017 DNA metabarcoding The metabarcoding approach: bioinformatics, field, bench, bioinformatics • In silico analysis: design and test the most efficient metabarcodes for the target group • Sampling in the field to obtain a DNA extract representative of the local biodiversity • DNA amplification and sequencing • Sequence analysis and taxa identification – OBITools (metabarcoding.org/obitools) – Problem of amplification/sequencing errors DNA metabarcoding • Sampling in the field (soil, water, feces, etc.) • DNA extraction • DNA amplification with barcode primers • Sequencing of the PCR products on next generation sequencers • Identification of taxa using a reference database (or identification of MOTUs) DNA metabarcoding is not DNA barcoding • Same objective to identify taxa, but ... • Different methodology: metabarcoding relies on high throughput systems for high throughput taxon identification • Not the same constraints when working with environmental DNA -> different markers might be used The main steps of an eDNA study, showing the three possible approaches: single- species identification, metabarcoding, and metagenomics Introduction to DNA metabarcoding • Definitions • Technical context • Which marker for DNA metabarcoding? • The importance of bioinformatics • Key studies – For diet analysis – For current biodiversity surveys – For reconstructing past ecosystems • The future DNA sequencing • 2005: Capillary electrophoresis – 500-1000 bp per sequencing reaction – 12 x 96 reactions per day (≈ 1 Mb per day) • 2016: Next generation sequencers – Roche 454: ≈ 0.8 Gb per day – HiSeq 4000: ≈ 400 Gb per day = 400'000 times increase of sequencing capacity in 10 years Traditional versus next generation sequencing tradi3onal sequencing next generaon sequencing sampling and DNA extrac3on DNA amplificaon sequencing bioinformacs results ACGCTA ACGTTA ACGTTA ACGTTG ACATTA ACGCTA ACGTTA ACGTTA ACGTTG ACATTA 454 GS FLXTM • Company: Roche Diagnostic® • Website: www. 454.com • Fragment length: 700-800 bases • Number of reads per run: 1 106 • Total output per run: 0.7-0.8 Gb per run • Time per run: 23 hours Ion Torrent • Company: Life Technologies • Website: www.iontorrent.com • Fragment length: 100, 200, 400 bases • Number of reads per run: 0.1, 1, 8 106 • Time per run: 2 hours HiSeq 4000 • Company: Illumina® • Website: www.illumina.com • Fragment length: 150 bases (2x150 paired-ends) • Number of reads per run: 8.6-10 billions • Total output per run: 1.3-1.5 Tb • Time per run: 3.5 days An idea of the HiSeq 4000 production per run • 10 billions of reads of 150 bp • 6 lines per read • 55 lines per page (font 11) • 1 090 909 091 pages • 324 000 km long • 122.4 km high • more than 5,000 tons of paper MiSeq • Company: Illumina® • Website: www.illumina.com • Fragment length: 300 bases (2x300 paired-ends) • Number of reads per run: 2x25 106 • Total output per run: 14 Gb • Time per run: 27 hours MiniSeq • Company: Illumina® • Website: www.illumina.com • Fragment length: 150 bases (2x150 paired-ends) • Number of reads per run: 2x25 106 • Total output per run: 7.5 Gb • Time per run: 24 hours MinION • Company: Oxford Nanopore Technologies Ltd • Website: www.nanoporetech.com • Fragment length: ultra long reads (up to 300 kb) • Total output: 6 Gb per day Introduction to DNA metabarcoding • Definitions • Technical context • Which marker for DNA metabarcoding? • The importance of bioinformatics • Key studies – For diet analysis – For current biodiversity surveys – For reconstructing past ecosystems • The future Standard barcodes: COI, rbcL, matK • Advantages – Standard reference libraries can be used – High taxonomic resolution • Drawbacks – Primers from standard barcodes are designed on protein-coding genes, and cannot be highly conserved (the third nucleotide of each codon is variable) – Too long for using with degraded environmental DNA New barcodes for analyzing environmental DNA • Very short marker (usually less than 100 bp) • Highly conserved primers to equally amplify the different target sequences • Problem of the taxonomic resolution when using very short barcodes The mirage of standard "minibarcodes" • Hajibabaei M, Smith MA, Janzen DH, Rodriguez JJ, Whitfield JB, Hebert PDN (2006) A minimalist barcode can identify a specimen whose DNA is degraded. Molecular Ecology Notes, 6, 959-964. • Meusnier I, Singer GAC, Landry JF, Hickey DA, Hebert PDN, Hajibabaei M (2008) A universal DNA mini-barcode for biodiversity analysis. BMC Genomics, 9, 214. • Hajibabaei M, Shokralla S, Zhou X, Singer GAC, Baird DJ (2011) Environmental barcoding: a next-generation sequencing approach for biomonitoring applications using river benthos. PLoS ONE, 6, e17497. • Hajibabaei M, Spall JL, Shokralla S, van Konynenburg S (2012) Assessing biodiversity of a freshwater benthic macroinvertebrate community through non-destructive environmental barcoding of DNA from preservative ethanol. BMC Ecology, 12, 28. The mirage of standard "minibarcodes" COI Metazoameusnier 7 errors 8 6 4 Reverse errors Reverse 2 Reverse errors 0 0 2 4 6 8 ForwardForward errors errors Meusnier et al. (2008) BMC Genomics, 9, 214. The mirage of standard "minibarcodes" COI Metazoameusnier 7 errors 18S Eukaryota18s_hardy 5 errors 8 5 6 4 3 4 2 Reverse errors Reverse Reverse errors Reverse 2 1 Reverse errors Reverse errors 0 0 0 2 4 6 8 0 1 2 3 4 5 ForwardForward errors errors ForwardForward errors errors Meusnier et al. (2008) Hardy et al. (2010) Molecular BMC Genomics, 9, 214. Ecology, 19, 197-212. The mirage of standard "minibarcodes" COI Arthropodazbj 7 errors 16S Insectains 5 errors 8 5 6 4 3 4 2 Reverse errors Reverse Reverse errors Reverse 2 1 Reverse errors Reverseerrors 0 0 0 2 4 6 8 0 1 2 3 4 5 ForwardForward errors errors ForwardForward errors errors Zeale et al. (2011) Molecular Ecology Resources, 11, 236-244. Unpublished The chloroplast trnL(UAA) intron The g/h primers target highly conserved regions Spermatophytagh 3 errors 3.0 2.5 cpDNA trnL (UAA) intron 2.0 1.5 Reverse errors Reverse 1.0 Reverse errors 0.5 0.0 0.0 0.5 1.0 1.5 2.0 2.5 3.0 ForwardForward errors The ideal metabarcode • The primer targets must Target taxonomicgh 3 errors group be perfectly conserved (no mismatch at all) 3.0 • Must be short, but highly 2.5 informative • Must amplify all the 2.0 target taxonomic group, 1.5 but not the other groups errors Reverse 1.0 • The reference database Reverse errors must be comprehensive 0.5 • Unfortunately, such ideal 0.0 marker does not exist 0.0 0.5 1.0 1.5 2.0 2.5 3.0 ForwardForward errors Introduction to DNA metabarcoding • Definitions • Technical context • Which marker for DNA metabarcoding? • The importance of bioinformatics • Key studies – For diet analysis – For current biodiversity surveys – For reconstructing past ecosystems • The future Bioinformatic tools for designing new markers for DNA metabarcoding http://metabarcoding.org/obitools (NAR : RIAZ et al 2011) http://metabarcoding.org/obitools Look for conserved regions that flank variable regions many whole genome sequences [email protected] ecoPCR: fully integrated taxonomy http://metabarcoding.org/obitools ecoPCR -d ebpln96 -l50 -L150 -k -e3 GGGCAATCCTGAGCCAA CCATTGAGTCTCTGCACCTATC # # ecoPCR version 0.1 # direct strand oligo1 : GGGCAATCCTGAGCCAA ; oligo2c : GATAGGTGCAGAGACTCAATGG # reverse strand oligo2 : CCATTGAGTCTCTGCACCTATC ; oligo1c : TTGGCTCAGGATTGCCC # max error count by oligonucleotide : 3 # database : arctic_01_02_2008 # amplifiat length between [5,300] bp # output in kingdom mode # 0240g | 495 | 10000726 | subspecies | 282718 | Achillea alpina | 13328 | Achillea | 4210 | Asteraceae | 33090 | Viridiplantae | D | GGGCAATCCTGAGCCAA | 0 | CCATCGAGTCTCTGCACCTATC | 1 | 90 | ATCACGTTTTCCGAAAACAAACAAAGGTTCAGAAAGCGAAAAGAAAAAAAA | 1043o | 496 | 10000724 | subspecies | 282718 | Achillea alpina | 13328 | Achillea | 4210 | Asteraceae |
Recommended publications
  • DNA Metabarcoding of Microbial Communities for Healthcare I

    DNA Metabarcoding of Microbial Communities for Healthcare I

    Reviews ISSN 1993-6842 (on-line); ISSN 0233-7657 (print) Biopolymers and Cell. 2016. Vol. 32. N 1. P 3–8 doi: http://dx.doi.org/10.7124/bc.000906 UDC 577.25 + 579.61 DNA metabarcoding of microbial communities for healthcare I. Ye. Zaets1, O. V. Podolich1, O. N. Reva2, N. O. Kozyrovska1 1 Institute of Molecular Biology and Genetics, NAS of Ukraine, 150, Akademika Zabolotnoho Str., Kyiv, Ukraine, 03680 2 Department of Biochemistry, Bioinformatics and Computational Biology Unit, University of Pretoria Lynnwood road, Hillcrest, Pretoria, South Africa, 0002 [email protected], [email protected], [email protected] High-throughput sequencing allows obtaining DNA barcodes of multiple species of microorganisms from a single environmental sample. Next Generation Sequencing (NGS)-based profiling provides new opportunities to evaluate the human health effect of microbial community members affiliated to probiotics. DNA metabar- coding may serve as a quality control of microbial communities, comprising complex probiotics and other fermented foods. A detailed inventory of complex communities is a pre-requisite of understanding their func- tionality as whole entities that makes it possible to design more effective bio-products by precise replacement of one community member by others. The present paper illustrates how the NGS-based DNA metabarcoding allows profiling of both wild and hybrid multi-microbial communities with the example of a kombucha probi- otic beverage fermented by yeast-bacterial partners. Keywords: DNA metabarcoding, microbial communities, healthcare,
  • Metagenomics Approaches for the Detection and Surveillance of Emerging and Recurrent Plant Pathogens

    Metagenomics Approaches for the Detection and Surveillance of Emerging and Recurrent Plant Pathogens

    microorganisms Review Metagenomics Approaches for the Detection and Surveillance of Emerging and Recurrent Plant Pathogens Edoardo Piombo 1,2 , Ahmed Abdelfattah 3,4 , Samir Droby 5, Michael Wisniewski 6,7, Davide Spadaro 1,8,* and Leonardo Schena 9 1 Department of Agricultural, Forest and Food Sciences (DISAFA), University of Torino, 10095 Grugliasco, Italy; [email protected] 2 Department of Forest Mycology and Plant Pathology, Uppsala Biocenter, Swedish University of Agricultural Sciences, P.O. Box 7026, 75007 Uppsala, Sweden 3 Institute of Environmental Biotechnology, Graz University of Technology, Petersgasse 12, 8010 Graz, Austria; [email protected] 4 Department of Ecology, Environment and Plant Sciences, University of Stockholm, Svante Arrhenius väg 20A, 11418 Stockholm, Sweden 5 Department of Postharvest Science, Agricultural Research Organization (ARO), The Volcani Center, Rishon LeZion 7505101, Israel; [email protected] 6 U.S. Department of Agriculture—Agricultural Research Service (USDA-ARS), Kearneysville, WV 25430, USA; [email protected] 7 Department of Biological Sciences, Virginia Technical University, Blacksburg, VA 24061, USA 8 AGROINNOVA—Centre of Competence for the Innovation in the Agroenvironmental Sector, University of Torino, 10095 Grugliasco, Italy 9 Department of Agriculture, Università Mediterranea, 89122 Reggio Calabria, Italy; [email protected] * Correspondence: [email protected]; Tel.: +39-0116708942 Abstract: Globalization has a dramatic effect on the trade and movement of seeds, fruits and vegeta- bles, with a corresponding increase in economic losses caused by the introduction of transboundary Citation: Piombo, E.; Abdelfattah, A.; plant pathogens. Current diagnostic techniques provide a useful and precise tool to enact surveillance Droby, S.; Wisniewski, M.; Spadaro, protocols regarding specific organisms, but this approach is strictly targeted, while metabarcoding D.; Schena, L.
  • Cristescu TREE 2014.Pdf

    Cristescu TREE 2014.Pdf

    TREE-1853; No. of Pages 6 Opinion From barcoding single individuals to metabarcoding biological communities: towards an integrative approach to the study of global biodiversity Melania E. Cristescu Department of Biology, McGill University, Montreal, QC H3A 1B1, Canada DNA-based species identification, known as barcoding, introduced by Arnot et al. [6] and was firmly advanced transformed the traditional approach to the study of and standardized by Hebert et al. [7]. The simple idea of biodiversity science. The field is transitioning from bar- using a short DNA fragment as a barcode (see Glossary) for coding individuals to metabarcoding communities. This identifying species across the Metazoa has been both revolution involves new sequencing technologies, bio- strongly embraced and vigorously scrutinized over the past informatics pipelines, computational infrastructure, and decade [8,9]. Nevertheless, the efforts led by Paul Hebert, experimental designs. In this dynamic genomics land- and supported by the Consortium for the Barcode of Life scape, metabarcoding studies remain insular and biodi- (CBoL; http://www.barcodeoflife.org/) resulted in a global versity estimates depend on the particular methods enterprise that combined molecular tools with valuable but used. In this opinion article, I discuss the need for a scarce taxonomic expertise [10,11]. Today, DNA barcodes coordinated advancement of DNA-based species identi- are being used commonly to identify specimens and the fication that integrates taxonomic and barcoding infor- approach has wide applications in biodiversity conserva- mation. Such an approach would facilitate access to tion, environmental management, invasion biology, the almost 3 centuries of taxonomic knowledge and 1 de- study of trophic interactions, and food safety [12–14].
  • Edna in a Bottleneck: Obstacles to Fish Metabarcoding Studies in Megadiverse Freshwater 3 Systems 4 5 Authors: 6 Jake M

    Edna in a Bottleneck: Obstacles to Fish Metabarcoding Studies in Megadiverse Freshwater 3 Systems 4 5 Authors: 6 Jake M

    bioRxiv preprint doi: https://doi.org/10.1101/2021.01.05.425493; this version posted January 7, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license. 1 Title: 2 eDNA in a bottleneck: obstacles to fish metabarcoding studies in megadiverse freshwater 3 systems 4 5 Authors: 6 Jake M. Jackman1, Chiara Benvenuto1, Ilaria Coscia1, Cintia Oliveira Carvalho2, Jonathan S. 7 Ready2, Jean P. Boubli1, William E. Magnusson3, Allan D. McDevitt1* and Naiara Guimarães 8 Sales1,4* 9 10 Addresses: 11 1Environment and Ecosystem Research Centre, School of Science, Engineering and Environment, 12 University of Salford, Salford, M5 4WT, UK 13 2Centro de Estudos Avançados de Biodiversidade, Instituto de Ciências Biológicas, Universidade 14 Federal do Pará, Belém, Brazil 15 3Coordenação de Biodiversidade, Instituto Nacional de Pesquisas da Amazônia, Manaus, 16 Amazonas, Brazil 17 4CESAM - Centre for Environmental and Marine Studies, Departamento de Biologia Animal, 18 Faculdade de Ciências da Universidade de Lisboa, Lisbon, Portugal 19 20 *Corresponding authors: 21 Naiara Guimarães Sales, [email protected] 22 Allan McDevitt, [email protected] 23 24 Running title: Obstacles to eDNA surveys in megadiverse systems 25 26 Keywords: Amazon, barcoding gap, freshwater, MiFish, Neotropics, reference database, 27 taxonomic resolution 28 1 bioRxiv preprint doi: https://doi.org/10.1101/2021.01.05.425493; this version posted January 7, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity.
  • Metabarcoding in the Abyss: Uncovering Deep-Sea Biodiversity Through Environmental

    Metabarcoding in the Abyss: Uncovering Deep-Sea Biodiversity Through Environmental

    Metabarcoding in the abyss : uncovering deep-sea biodiversity through environmental DNA Miriam Isabelle Brandt To cite this version: Miriam Isabelle Brandt. Metabarcoding in the abyss : uncovering deep-sea biodiversity through environmental DNA. Agricultural sciences. Université Montpellier, 2020. English. NNT : 2020MONTG033. tel-03197842 HAL Id: tel-03197842 https://tel.archives-ouvertes.fr/tel-03197842 Submitted on 14 Apr 2021 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. THÈSE POUR OBTENIR LE GRADE DE DOCTEUR DE L’UNIVERSITÉ DE M ONTPELLIER En Sciences de l'Évolution et de la Biodiversité École doctorale GAIA Unité mixte de recherche MARBEC Pourquoi Pas les Abysses ? L’ADN environnemental pour l’étude de la biodiversité des grands fonds marins Metabarcoding in the abyss: uncovering deep - sea biodiversity through environmental DNA Présentée par Miriam Isabelle BRANDT Le 10 juillet 2020 Sous la direction de Sophie ARNAUD-HAOND et Daniela ZEPPILLI Devant le jury composé de Sofie DERYCKE, Senior researcher/Professeur rang A, ILVO, Belgique Rapporteur
  • Imprints of Independent Allopolyploid Formations On

    Imprints of Independent Allopolyploid Formations On

    Chen et al. BMC Genomics (2021) 22:264 https://doi.org/10.1186/s12864-021-07566-6 RESEARCH ARTICLE Open Access Imprints of independent allopolyploid formations on patterns of gene expression in two sibling yarrow species (Achillea, Asteraceae) Duo Chen1†, Peng-Cheng Yan2† and Yan-Ping Guo1* Abstract Background: Polyploid species often originate recurrently. While this is well known, there is little information on the extent to which distinct allotetraploid species formed from the same parent species differ in gene expression. The tetraploid yarrow species Achillea alpina and A. wilsoniana arose independently from allopolyploidization between diploid A. acuminata and A. asiatica. The genetics and geography of these origins are clear from previous studies, providing a solid basis for comparing gene expression patterns of sibling allopolyploid species that arose independently. Results: We conducted comparative RNA-sequencing analyses on the two Achillea tetraploid species and their diploid progenitors to evaluate: 1) species-specific gene expression and coexpression across the four species; 2) patterns of inheritance of parental gene expression; 3) parental contributions to gene expression in the allotetraploid species, and homeolog expression bias. Diploid A. asiatica showed a higher contribution than diploid A. acuminata to the transcriptomes of both tetraploids and also greater homeolog bias in these transcriptomes, possibly reflecting a maternal effect. Comparing expressed genes in the two allotetraploids, we found expression of ca. 30% genes were species-specific in each, which were most enriched for GO terms pertaining to “defense response”. Despite species-specific and differentially expressed genes between the two allotetraploids, they display similar transcriptome changes in comparison to their diploid progenitors.
  • In-Vitro Cardiovascular Protective Activity of a New Achillinoside from Achillea Alpina

    In-Vitro Cardiovascular Protective Activity of a New Achillinoside from Achillea Alpina

    Revista Brasileira de Farmacognosia 29 (2019) 445–448 ww w.elsevier.com/locate/bjp Original Article In-vitro cardiovascular protective activity of a new achillinoside from Achillea alpina ∗ Fei Zhou , Song Li , Jian Yang , Jiawang Ding , Chao He , Lin Teng Institute of Cardiovascular Diseases, The First College of Clinical Medical Sciences, China Three Gorges University, Yichang, Hubei, PR China a a b s t r a c t r t i c l e i n f o Article history: Achillinoside was isolated from methanol extract of Achillea alpina L., Asteraceae. The structure of the com- Received 28 August 2018 pound was characterized based on various spectrum data, including IR, HR-ESI-MS, 1D and 2D NMR. The Accepted 25 February 2019 cardiovascular protective effect of achillinoside was tested on H2O2-induced H9c2 cells. In our research, Available online 27 March 2019 achillinoside could increase the cell viability dose-dependently in H2O2-induced H9c2 cells. In addition, the levels of caspase-3/9 cells were significantly decreased in H2O2 and achillinoside incubated H9c2 Keywords: cells. Achillinoside © 2019 Sociedade Brasileira de Farmacognosia. Published by Elsevier Editora Ltda. This is an open Apoptosis inhibition access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/). Spectroscopic analysis H9c2 cells Introduction because H9c2 cell keeps the main characteristics of primary car- diomyocytes in vivo (Silva et al., 2010; Watkins et al., 2011). Herein The genus Achillea, Asteraceae, consists of 85 species around we describe the isolation and structure elucidation of the com- the world, and mainly distributed in eastern and southern Asia.
  • Experimental Quantification of Pollen with DNA Metabarcoding Using

    Experimental Quantification of Pollen with DNA Metabarcoding Using

    www.nature.com/scientificreports OPEN Experimental quantifcation of pollen with DNA metabarcoding using ITS1 and trnL Sandra Baksay 1*, André Pornon1, Monique Burrus1, Jérôme Mariette2, Christophe Andalo1 & Nathalie Escaravage1 Although the use of metabarcoding to identify taxa in DNA mixtures is widely approved, its reliability in quantifying taxon abundance is still the subject of debate. In this study we investigated the relationships between the amount of pollen grains in mock solutions and the abundance of high- throughput sequence reads and how the relationship was afected by the pollen counting methodology, the number of PCR cycles, the type of markers and plant species whose pollen grains have diferent characteristics. We found a signifcant positive relationship between the number of DNA sequences and the number of pollen grains in the mock solutions. However, better relationships were obtained with light microscopy as a pollen grain counting method compared with fow cytometry, with the chloroplastic trnL marker compared with ribosomal ITS1 and with 30 when compared with 25 or 35 PCR cycles. We provide a list of recommendations to improve pollen quantifcation. Environmental DNA metabarcoding is a molecular method that consists of investigating environmental DNA samples made of complex mixtures of genomes from numerous organisms1. Due to new sequencing technologies and bioinformatics tools, metabarcoding has been increasingly used to identify taxa in environmental samples1 to monitor biodiversity2–4, to investigate ecosystem functioning5 and interaction networks6–8, in both aquatic and terrestrial ecosystems. Nevertheless, its reliability in quantitative approaches, which depend on the match between counts of high-throughput sequence reads and the amount of sampled biological material2, is still the subject of debate9,10.
  • Characterization of Bacterial Communities Associated

    Characterization of Bacterial Communities Associated

    www.nature.com/scientificreports OPEN Characterization of bacterial communities associated with blood‑fed and starved tropical bed bugs, Cimex hemipterus (F.) (Hemiptera): a high throughput metabarcoding analysis Li Lim & Abdul Hafz Ab Majid* With the development of new metagenomic techniques, the microbial community structure of common bed bugs, Cimex lectularius, is well‑studied, while information regarding the constituents of the bacterial communities associated with tropical bed bugs, Cimex hemipterus, is lacking. In this study, the bacteria communities in the blood‑fed and starved tropical bed bugs were analysed and characterized by amplifying the v3‑v4 hypervariable region of the 16S rRNA gene region, followed by MiSeq Illumina sequencing. Across all samples, Proteobacteria made up more than 99% of the microbial community. An alpha‑proteobacterium Wolbachia and gamma‑proteobacterium, including Dickeya chrysanthemi and Pseudomonas, were the dominant OTUs at the genus level. Although the dominant OTUs of bacterial communities of blood‑fed and starved bed bugs were the same, bacterial genera present in lower numbers were varied. The bacteria load in starved bed bugs was also higher than blood‑fed bed bugs. Cimex hemipterus Fabricus (Hemiptera), also known as tropical bed bugs, is an obligate blood-feeding insect throughout their entire developmental cycle, has made a recent resurgence probably due to increased worldwide travel, climate change, and resistance to insecticides1–3. Distribution of tropical bed bugs is inclined to tropical regions, and infestation usually occurs in human dwellings such as dormitories and hotels 1,2. Bed bugs are a nuisance pest to humans as people that are bitten by this insect may experience allergic reactions, iron defciency, and secondary bacterial infection from bite sores4,5.
  • Introduction to Bioinformatics Analysis of Metabarcoding Data

    Introduction to Bioinformatics Analysis of Metabarcoding Data

    Introduction to Bioinformatics analysis of Metabarcoding data Theoretical part Alvaro Sebastián Yagüe www.sixthresearcher.com @SixthResearcher • Experimental design • Sampling • Sample processing • Sequencing • Sequence processing www.sixthresearcher.com @SixthResearcher • Experimental design • Sampling • Sample processing • Sequencing • Sequence processing www.sixthresearcher.com @SixthResearcher What do we want to sequence? Whole genome sequencing (WGS) ChIP-seq Amplicon sequencing (AS) Whole exome sequencing (WES) RNA-seq Mass spectrometry www.sixthresearcher.com @SixthResearcher How do we want to sequence? Green,E.D. (2001) Strategies for the systematic sequencing of complex www.sixthresearcher.com genomes. Nat. Rev. Genet., 2, 573–583. @SixthResearcher Metagenomics - Shotgun sequencing www.sixthresearcher.com @SixthResearcher Metagenomics - High-throughput sequencing DNA extraction DNA fragmentation and sequencing Read mapping to reference genome De novo assembly Chimeras! www.sixthresearcher.com @SixthResearcher Metabarcoding - Amplicon sequencing 1. PCR amplification and sample tagging Barcode 1 Barcode 2 Barcode 3 2. Sequencing of PCR products 3. De-multiplexing of reads Samples 1 2 3 4 5 6 Barcode 1 Barcode 2 Barcode 3 www.sixthresearcher.com @SixthResearcher Metabarcoding vs Metagenomics Kress, W. J., & Erickson, D. L. (2008). DNA barcodes: genes, genomics, and bioinformatics. Proceedings of the National Academy of Sciences of the United States of America, 105(8), 2761–2. www.sixthresearcher.com @SixthResearcher Metabarcoding vs Metagenomics http://luckylion.de/2015/10/11/dna-metabarcoding-vs-metagenomics/ www.sixthresearcher.com @SixthResearcher • Experimental design • Sampling • Sample processing • Sequencing • Sequence processing www.sixthresearcher.com @SixthResearcher ➢ Where? Variability in abundance within soil and plant. Consider vertical and horizontal distribution of fungi. ➢ When? Temporal dynamics over short and long term. For complete community census, sample across multiple seasons.
  • Environmental DNA Metabarcoding for Simultaneous Monitoring and Ecological Assessment of Many Harmful Algae

    Environmental DNA Metabarcoding for Simultaneous Monitoring and Ecological Assessment of Many Harmful Algae

    bioRxiv preprint doi: https://doi.org/10.1101/2020.10.01.322941; this version posted October 2, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Environmental DNA Metabarcoding for Simultaneous Monitoring and Ecological Assessment of Many Harmful Algae Emily Jacobs-Palmer1, Ramón Gallego1,2, Kelly Cribari1, Abigail Keller1, Ryan P. Kelly1 1University of Washington School of Marine and Environmental Affairs 2NRC Research Associateship Program, Northwest Fisheries Science Center, National Marine Fisheries Service, National Oceanic and Atmospheric Administration. Abstract Harmful algae can have profound economic, environmental, and social consequences. As the timing, frequency, and severity of harmful algal blooms (HABs) change alongside global climate, efficient tools to monitor and understand the current ecological context of these taxa are increasingly important. Here we employ environmental DNA metabarcoding to identify patterns in a wide variety of harmful algae and associated ecological communities in the Hood Canal of Puget Sound in Washington State, USA. We track trends of presence and abundance in a series of water samples across nearly two years. We find putative harmful algal sequences in a majority of samples, suggesting that these groups are routinely present in local waters. We report patterns in variants of the economically important genus Pseudo-nitzschia (family Bacillariaceae), as well as multiple harmful algal taxa previously unknown or poorly documented in the region, including a cold-water variant from the saxitoxin-producing genus Alexandrium (family Gonyaulacaceae), two variants from the karlotoxin-producing genus Karlodinium (family Kareniaceae), and one variant from the parasitic genus Hematodinium (family Syndiniaceae).
  • Demonstration of the Potential of Environmental DNA As A

    Demonstration of the Potential of Environmental DNA As A

    www.nature.com/scientificreports OPEN Demonstration of the potential of environmental DNA as a tool for the detection of avian species Received: 16 October 2017 Masayuki Ushio 1,2, Koichi Murata3,4, Tetsuya Sado5, Isao Nishiumi6, Masamichi Takeshita7, Accepted: 1 March 2018 Wataru Iwasaki 7 & Masaki Miya 5 Published: xx xx xxxx Birds play unique functional roles in the maintenance of ecosystems, such as pollination and seed dispersal, and thus monitoring bird species diversity is a frst step towards avoiding undesirable consequences of anthropogenic impacts on bird communities. In the present study, we hypothesized that birds, regardless of their main habitats, must have frequent contact with water and that tissues that contain their DNA that persists in the environment (environmental DNA; eDNA) could be used to detect the presence of avian species. To this end, we applied a set of universal PCR primers (MiBird, a modifed version of fsh/mammal universal primers) for metabarcoding avian eDNA. We confrmed the versatility of MiBird primers by performing in silico analyses and by amplifying DNAs extracted from bird tissues. Analyses of water samples from zoo cages of birds with known species composition suggested that the use of MiBird primers combined with Illumina MiSeq could successfully detect avian species from water samples. Additionally, analysis of water samples collected from a natural pond detected fve avian species common to the sampling areas. The present fndings suggest that avian eDNA metabarcoding would be a complementary detection/identifcation tool in cases where visual census of bird species is difcult. Environmental DNA (eDNA) is genetic material that persists in an environment and is derived from organ- isms living there, and researchers have recently been using eDNA to detect the presence of macro-organisms, particularly those living in aquatic/semiaquatic ecosystems1–5.