DOCSLIB.ORG

Characterization of a 23-Kda Protein Associated with CD40 TOMOHIRO MORIO, SILVA HANISSIAN, and RAIF S

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Characterization of a 23-Kda Protein Associated with CD40 TOMOHIRO MORIO, SILVA HANISSIAN, and RAIF S Proc. Natl. Acad. Sci. USA Vol. 92, pp. 11633-11636, December 1995 Immunology Characterization of a 23-kDa protein associated with CD40 TOMOHIRO MORIO, SILVA HANISSIAN, AND RAIF S. GEHA* Division of Immunology, Children's Hospital, and Department of Pediatrics, Harvard Medical School, Boston, MA 02115 Communicated by Mary Ellen Avery, Harvard Medical School, Boston, MA, August 30, 1995 (received for review May 1, 1995) ABSTRACT CD40 is a 45-kDa glycoprotein member ofthe MATERIALS AND METHODS tumor necrosis factor receptor (TNFR) family expressed on B cells, thymic epithelial cells, dendritic cells, and some carci- Cells. The human B-cell lines Raji, BJAB, and Ramos and the human bladder carcinoma cell line T24 were obtained from noma cells. The unique capacity of CD40 to trigger immuno- American Type Culture Collection. The human B-cell line globulin isotype switching is dependent on the activation of Jijoye which expresses TNFR p80 (CD120b) was a kind gift protein-tyrosine kinases, yet CD40 possesses no kinase do- from G. Mosialos and E. Kieff (Harvard Medical School). main and no known consensus sequences for binding to Human tonsil B cells were purified as described (13). protein-tyrosine kinases. Recently, an intracellular protein Monoclonal Antibodies (mAbs) and Reagents. Mouse anti- (CD40bp/LAP-1/CRAF-1) which belongs to the family of human CD40 mAb 626.1 (IgGl) was a gift from S. M. Fu TNFR-associated proteins was reported to associate with (University of Virginia, Richmond). Murine anti-major histo- CD40. We describe a 23-kDa cell surface protein (p23) which compatibility complex (MHC) class I mAb W6/32 (IgGl), and is specifically associated with CD40 on B cells and on urinary anti-HLA-DR mAb L243 (IgG2a) were obtained through bladder transitional carcinoma cells. Protein microsequenc- American Type Culture Collection. Anti-MHC class II mAb ing revealed that p23 shows no homology to any known 3B12 (IgGl) has been described (14). Anti-human Fas mAb protein. A rabbit antibody raised against a peptide derived ZB-4 (IgGl) was obtained from Kamiya Biomedical (Thou- from p23 recognized a 23-kDa protein in CD40 immunopre- sand Oaks, CA). Rat anti-human TNFR p80 mAb was pur- cipitates. In contrast to CD40bp/LAP-1/CRAF-1, p23 was chased from Genzyme. Anti-CD81 mAb 5A6 (IgGl) was not associated with TNFR p80 (CD120b). These findings kindly provided by S. Levy (Stanford University). Tunicamycin suggest that p23 is a novel member of the CD40 receptor was obtained from Boehringer Mannheim. Phosphatidylinos- complex. itol-specific phospholipase C (PI-PLC) was purchased from Calbiochem. Anti-p23 peptide polyclonal antibody was raised Interaction of the B-cell surface antigen CD40 with its ligand in rabbits against a 17-aa peptide derived from p23 and (CD40L) expressed on activated T cells plays a critical role in conjugated to keyhole limpet hemocyanin (KLH) and was T-B cell collaboration, particularly in immunoglobulin isotype absorbed with KLH as described (15). switching, in the induction of expression of B7 costimulatory Surface lodination and Immunoprecipitation. Surface io- survival and in dination and immunoprecipitation were carried out with Bolt- molecules, in B-cell the formation of germinal- on-Hunter reagent (16). In brief, 5 x 107 cells were washed center B cells (1-3). This is evidenced by the observations that with phosphate-buffered saline, and labeled with 2 mCi (74 mice with a disrupted CD40 gene fail to undergo isotype MBq) of 1251 in the presence of Bolton-Hunter reagent for 30 switching and to develop germinal centers in response to min on ice. The cells were washed with PBS and lysed on ice T-cell-dependent antigens (4, 5) and that B cells from CD40- for 30 min in 1% (vol/vol) Brij 96/150 mM NaCl/20 mM null mice fail to elicit an allogeneic response (G. Hollander, E. Hepes, pH 7.4/1 mM Na3VO4/50 mM NaF/1 mM phenyl- Castigli, and R.S.G., unpublished work). methanesulfonyl fluoride containing leupeptin at 5 ,ug/ml and The unique capacity of CD40 to trigger immunoglobulin antipain, chymostatin, and pepstatin each at 1 ,ug/ml. The cell class switching in B cells suggests that CD40 ligation activates lysates were precleared with protein G-Sepharose beads (Phar- a unique signaling pathway(s). Our studies and those of others macia) precoupled with normal mouse immunoglobulin and indicate that CD40 ligation activates protein-tyrosine kinases then were immunoprecipitated with protein G beads preab- (PTKs), including Lyn and Syk and results in tyrosine phos- sorbed with the indicated antibody. The immunoprecipitates phorylation of multiple substrates, including phosphatidylino- were resolved by SDS/12% PAGE and the bands were visu- sitol 3-kinase, phospholipase C-,y2, and a 28-kDa phospho- alized by autoradiography. protein (6, 7). More importantly, PTK inhibitors and crosslink- 355 Metabolic Labeling. BJAB cells were first washed in ing of CD45 to CD40 inhibit CD40-mediated isotype switching minimal essential medium deficient in Met/Cys (GIBCO/ (8, 9). However, CD40 has no kinase domain and no known BRL) and incubated for 1 hr in the same medium supple- consensus sequence for binding to PTK, suggesting that CD40 mented with 5% fetal bovine serum that had been dialyzed uses associated molecules for transducing intracellular signals. against 150 mM NaCl/20 mM Hepes, pH 7.4. The cells were Recently, a member of the tumor necrosis factor receptor then incubated with [35S]methionine/[35S]cysteine (Tran35S- (TNFR)-associated factor (TRAF) family of proteins was label; ICN) for 5 hr, washed, and lysed in 1% Brij 96 lysis found to bind to the cytoplasmic region of CD40 and to play buffer. Immunoprecipitation was carried out as described a role in CD40-mediated induction of CD23 expression (10- above. 12). We have identified and biochemically characterized a Two-Dimensional Electrophoresis. Two-dimensional gel 23-kDa cell surface protein (p23) associated with human electrophoresis was carried out with a Bio-Rad kit in accord CD40. p23 was not associated with CD95 (Fas) or with TNFR with the manufacturer's guidance. For first-dimension isoelec- p80 (CD120b), suggesting that it could be important in CD40- tric focusing, radiolabeled immunoprecipitates were solubi- specific signaling. Abbreviations: mAb, monoclonal antibody; MHC, major histocom- patibility complex; NMS, normal mouse serum; PI-PLC, phosphati- The publication costs of this article were defrayed in part by page charge dylinositol-specific phospholipase C; TNFR, tumor necrosis factor payment. This article must therefore be hereby marked "advertisement" in receptor; TRAF, TNFR-associated factor. accordance with 18 U.S.C. §1734 solely to indicate this fact. *To whom reprint requests should be addressed. 11633 Downloaded by guest on September 27, 2021 11634 Immunology: Morio et al. Proc. Natl. Acad. Sci. USA 92 (1995) lized in a 9 M urea/2% (vol/vol) Nonidet P-40/5% (vol/vol) Raji BJAB Tonsil B T24 2-mercaptoethanol and focused for 16 hr at 800 V in tube gels consisting of 9 M urea, 4% (wt/vol) acrylamide/N,N'- c_ CZ) C() -Z C0 0c methylenebisacrylamide (30:0.8 weight ratio), 2% (vol/vol) 0c .- ampholytes, and 2% Nonidet P-40. A 20 mM NaOH cathode kDa buffer and a 10 mM phosphoric acid anode buffer were used. Q- The second-dimension electrophoresis was carried out in an -46 SDS/12% polyacrylamide gel. The isoelectric point (pl) and 0 the molecular weight were calibrated with standard 2D marker (Bio-Rad). -30 Purification and Microsequencing of p23. The 1% Brij 96 lysate from 8 x 1010 BJAB B cells was passed through a column packed with protein G-Sepharose crosslinked to anti-CD40 mAb 626.1 by dimethyl pimelimidate dihydrochloride. The column was washed, and bound proteins were eluted with dimethylamine (pH 11.5) and then concentrated by ultrafil- -1 4 10 kDa). After SDS/12% tration with Centricon-10 (cutoff, FIG. 1. p23 is coprecipitated with CD40 in human B cells and in PAGE, proteins were electrotransferred to a poly(vinylidene urinary bladder transitional carcinoma cells. Raji and BJAB (Epstein- difluoride) (PVDF) membrane and visualized with Ponceau S Barr virus-negative) human B-lymphoma cells, normal human tonsil B stain. Two major bands were observed: a 46-kDa band that cells, and T24 human urinary bladder carcinoma cells were radiola- corresponded to CD40 and a 23-kDa band. The area of the beled with 1251 and immunoprecipitated with normal mouse serum PVDF membrane containing p23 was excised for in situ (NMS), L243 (anti-HLA-DR) (anti-human MHC class II), or 626.1 digestion with trypsin. The resultant peptide mixture was (anti-CD40). The immunoprecipitates (equivalent to 2 x 107 cells per separated by narrow-bore high-performance liquid chroma- lane) were resolved by SDS/12% PAGE under reducing conditions tography on a Vydac C18 reverse-phase column (2.1 mm x 150 and the gels were autoradiographed for 5 days, 2 days, 2 days, and 5 acetonitrile in 0.057% triflu- days for Raji cells, BJAB cells, tonsil B cells, and T24 cells, respectively. mm) with a gradient of 0-50% Arrows at left indicate the position of CD40 and p23. Molecular size oroacetic acid on a Hewlett-Packard 1090 chromatograph with markers are at right. a 1040 diode array detector. Optimal fractions from the chromatogram were chosen for sequencing on the basis of cholamidopropyl)dimethylammonio]- 1 -propanesulfonate different UV absorbance at 210, 277, and 292 nm, peak (CHAPS) or 1% Tween 20 lysates (data not shown). symmetry resolution, and molecular weight information from Members of the TNFR family, which includes CD40, display laser desorption mass spectrometry. Amino acid sequence was considerable homology in their extracellular regions (18). We obtained in the Harvard Protein Microsequencing Facility for therefore examined for the association of p23 with Fas (CD95) three different peptide peaks by automated Edman degrada- was detected in tion on an Applied Biosystems 477A protein sequencer using and TNFR p80 (CD120b).
Load more

Recommended publications
  • PAX5 Expression in Acute Leukemias: Higher B-Lineage Specificity Than Cd79a and Selective Association with T(8;21)-Acute Myelogenous Leukemia
    [CANCER RESEARCH 64, 7399–7404, October 15, 2004] PAX5 Expression in Acute Leukemias: Higher B-Lineage Specificity Than CD79a and Selective Association with t(8;21)-Acute Myelogenous Leukemia Enrico Tiacci,1 Stefano Pileri,2 Annette Orleth,1 Roberta Pacini,1 Alessia Tabarrini,1 Federica Frenguelli,1 Arcangelo Liso,3 Daniela Diverio,4 Francesco Lo-Coco,5 and Brunangelo Falini1 1Institutes of Hematology and Internal Medicine, University of Perugia, Perugia, Italy; 2Unit of Hematopathology, University of Bologne, Bologne, Italy; 3Section of Hematology, University of Foggia, Foggia, Italy; 4Department of Cellular Biotechnologies and Hematology, University La Sapienza of Rome, Rome, Italy; and 5Department of Biopathology, University Tor Vergata of Rome, Rome, Italy ABSTRACT (13, 16). PAX5 expression also occurs in the adult testis and in the mesencephalon and spinal cord during embryogenesis (17), suggesting an The transcription factor PAX5 plays a key role in the commitment of important role in the development of these tissues. hematopoietic precursors to the B-cell lineage, but its expression in acute Rearrangement of the PAX5 gene through reciprocal chromosomal leukemias has not been thoroughly investigated. Hereby, we analyzed routine biopsies from 360 acute leukemias of lymphoid (ALLs) and mye- translocations has been described in different types of B-cell malig- loid (AMLs) origin with a specific anti-PAX5 monoclonal antibody. Blasts nancies (18–23), and, more recently, PAX5 has also been shown to be from 150 B-cell ALLs showed strong PAX5 nuclear expression, paralleling targeted by aberrant hypermutation in Ͼ50% of diffuse large B-cell that of CD79a in the cytoplasm. Conversely, PAX5 was not detected in 50 lymphomas (24).
    [Show full text]
  • Human and Mouse CD Marker Handbook Human and Mouse CD Marker Key Markers - Human Key Markers - Mouse
    Welcome to More Choice CD Marker Handbook For more information, please visit: Human bdbiosciences.com/eu/go/humancdmarkers Mouse bdbiosciences.com/eu/go/mousecdmarkers Human and Mouse CD Marker Handbook Human and Mouse CD Marker Key Markers - Human Key Markers - Mouse CD3 CD3 CD (cluster of differentiation) molecules are cell surface markers T Cell CD4 CD4 useful for the identification and characterization of leukocytes. The CD CD8 CD8 nomenclature was developed and is maintained through the HLDA (Human Leukocyte Differentiation Antigens) workshop started in 1982. CD45R/B220 CD19 CD19 The goal is to provide standardization of monoclonal antibodies to B Cell CD20 CD22 (B cell activation marker) human antigens across laboratories. To characterize or “workshop” the antibodies, multiple laboratories carry out blind analyses of antibodies. These results independently validate antibody specificity. CD11c CD11c Dendritic Cell CD123 CD123 While the CD nomenclature has been developed for use with human antigens, it is applied to corresponding mouse antigens as well as antigens from other species. However, the mouse and other species NK Cell CD56 CD335 (NKp46) antibodies are not tested by HLDA. Human CD markers were reviewed by the HLDA. New CD markers Stem Cell/ CD34 CD34 were established at the HLDA9 meeting held in Barcelona in 2010. For Precursor hematopoetic stem cell only hematopoetic stem cell only additional information and CD markers please visit www.hcdm.org. Macrophage/ CD14 CD11b/ Mac-1 Monocyte CD33 Ly-71 (F4/80) CD66b Granulocyte CD66b Gr-1/Ly6G Ly6C CD41 CD41 CD61 (Integrin b3) CD61 Platelet CD9 CD62 CD62P (activated platelets) CD235a CD235a Erythrocyte Ter-119 CD146 MECA-32 CD106 CD146 Endothelial Cell CD31 CD62E (activated endothelial cells) Epithelial Cell CD236 CD326 (EPCAM1) For Research Use Only.
    [Show full text]
  • Bispecific CAR-T Cells Targeting Both CD19 and CD22 for Therapy Of
    Dai et al. Journal of Hematology & Oncology (2020) 13:30 https://doi.org/10.1186/s13045-020-00856-8 RAPID COMMUNICATION Open Access Bispecific CAR-T cells targeting both CD19 and CD22 for therapy of adults with relapsed or refractory B cell acute lymphoblastic leukemia Hanren Dai1,2,3†, Zhiqiang Wu1†, Hejin Jia2†, Chuan Tong1, Yelei Guo1, Dongdong Ti1, Xiao Han1, Yang Liu4, Wenying Zhang2, Chunmeng Wang2, Yajing Zhang2, Meixia Chen2, Qingming Yang2, Yao Wang1* and Weidong Han1,2* Abstract Background: Despite the impressive complete remission (CR) induced by CD19 CAR-T cell therapy in B-ALL, the high rate of complete responses is sometimes limited by the emergence of CD19-negative leukemia. Bispecific CAR-modified T cells targeting both CD19 and CD22 may overcome the limitation of CD19-negative relapse. Methods: We here report the design of a bispecific CAR simultaneous targeting of CD19 and CD22. We performed a phase 1 trial of bispecific CAR T cell therapy in patients with relapsed/refractory precursor B-ALL at a dose that ranged from 1.7 × 106 to 3 × 106 CAR T cells per kilogram of body weight. Results: We demonstrate bispecific CD19/CD22 CAR T cells could trigger robust cytolytic activity against target cells. MRD-negative CR was achieved in 6 out of 6 enrolled patients. Autologous CD19/CD22 CAR T cells proliferated in vivo and were detected in the blood, bone marrow, and cerebrospinal fluid. No neurotoxicity occurred in any of the 6 patients treated. Of note, one patient had a relapse with blast cells that no longer expressed CD19 and exhibited diminished CD22 site density approximately 5 months after treatment.
    [Show full text]
  • CD81 Is Required for CD19-Complex Formation and Terminal Human B
    Supplemental Table 1. Primer sequences for PCR amplification and sequencing of CD81 coding regions from genomic DNA. Exon Forward primer Forward primer sequence Reverse primer Reverse primer sequence 1 CD81exon1F GGGGCGGGGCCTATGGAG CD81exon1R GGACCTGCCCAACGTGGA 2 CD81exon2F TGTGGGGTGGGCGCACTC CD81exon2R CACGCCATGCCCGACTGT 3 CD81exon3F ATCCCTGGCAGTCAGCAACC CD81exon3R TCCGCCCTGAGCACCAGC 4 CD81exon4F GTCAGGTCGTGGGCTGGT CD81exon4R CTGGAGATCCTCCTGGCAAGT 5 CD81exon5F TCTGGGGTCTAGCCTCGAAGC CD81exon5R CTGGGCGTAGGCAGGATT 6 CD81exon6F GGCCCCTGGATGCATTCT CD81exon6R AGTGTGGTCGCTCCCTGTGG 7+8 CD81exon7+8F CTGCGTGACAACGGGAAG CD81exon7+8R TATACACAGGCGGTGATGG Supplemental Table 2. Primer sequences for PCR amplification and sequencing of CD81 and CD225 transcripts. Gene Forward primer Forward primer sequence Reverse primer Reverse primer sequence CD81 CD81_mRNA_F1 GACCCCACCGCGCATCCT CD81_mRNA_R1 GGATGGCCCCGTAGCAGC CD81_mRNA_F2 CGCCCAACACCTTCTATGTA CD81_mRNA_R2 TGCCCGAGGGACACAAAT CD81_mRNA_F3 TTCCACGAGACGCTTGACTGCT CD81_mRNA_R3 AGGCCCGTCTCCACTCAT IFITM1 IFITM1_mRNA_F1 TCATTGGTCCCTGGCTAATTCAC IFITM1_mRNA_R1 GGTCACGTCGCCAACCAT IFITM1_mRNA_F2 ACAGCGAGACCTCCGTGC IFITM1_mRNA_R2 TCTAGGGGCAGGACCAAG Supplemental Table 3. PCR primers and TaqMan probes for CD81 transcript level quantification. Target Forward primer Forward primer sequence Reverse primer Reverse primer sequence TaqMan probe TaqMan probe Sequence total CD81 CD81_RQ_F CGCCAAGGCTGTGGTGAA CD81_RQ_R AGAGGTTGCTGATGATGTTGCTG T-CD81 ACTGACTGCTTTGACCACCTCAGTGCTCA wild type CD81 CD81_RQ_F CGCCAAGGCTGTGGTGAA
    [Show full text]
  • CD19 Chimeric Antigen Receptor-Exosome Targets CD19 Positive B-Lineage Acute Lymphocytic Leukemia and Induces Cytotoxicity
    cancers Article CD19 Chimeric Antigen Receptor-Exosome Targets CD19 Positive B-lineage Acute Lymphocytic Leukemia and Induces Cytotoxicity Shabirul Haque 1,2,* and Sarah R. Vaiselbuh 1,2,3 1 Feinstein Institute for Medical Research, Northwell Health, 350 Community Drive, Manhasset, NY 11030, USA; [email protected] 2 Department of Pediatrics, Staten Island University Hospital, Northwell Health, 475 Seaview Ave, Staten Island, NY 10305, USA 3 Monsey Health Center, 40 Robert Pitt Drive, Monsey, NY 10952, USA * Correspondence: [email protected] Simple Summary: Our research describes our designer exosomes express CD19 Chimeric Antigen Receptor (Exo-CD19 CAR). This novel Exo-CD19 CAR is cytotoxic for CD19-positive leukemia B-cells without interfering with cytotoxicity in CD19-negative cells. This innovation can be translated into broader clinical applications as CD19 CAR exosome-based nano-immunotherapy for B-cell leukemia instead of whole CD19 CAR T-cell immunotherapy. Abstract: CAR-T cell therapy is not without some clinical adverse effects, namely cytokine storms, due to a massive release of cytokines when CAR-T cells multiply in the body. Our goal was to develop exosomes expressing CD19 CAR to treat CD19-positive B-cell malignancies, instead of using whole CD19 CAR-T cells, thereby reducing the clinical risk of uncontrolled cytokine storms. Exosomes are Citation: Haque, S.; Vaiselbuh, S.R. extracellular nanovesicles (30–150 nm), composed of lipids, proteins, and nucleic acids, that carry the CD19 Chimeric Antigen fingerprint of their parent cells. Exosomes are a preferred delivery system in nano-immunotherapy. Receptor-Exosome Targets CD19 Here, HEK293T parent cells were transduced with CD19 CAR plasmids and cellular CD19 CAR Positive B-lineage Acute Lymphocytic expression was confirmed.
    [Show full text]
  • Induction of Antitumor Immunity by Transduction of CD40 Ligand Gene
    D2001 Nature Publishing Group 0929-1903/01/$17.00/+0 www.nature.com/cgt Induction of antitumor immunity by transduction of CD40 ligand gene and interferon- gene into lung cancer Masahiro Noguchi,1 Kazuyoshi Imaizumi,1 Tsutomu Kawabe,1 Hisashi Wakayama,1 Yoshitsugu Horio,1 Yoshitaka Sekido,2 Toru Hara,1 Naozumi Hashimoto,1 Masahide Takahashi,3 Kaoru Shimokata,2 and Yoshinori Hasegawa1 1First Department of Internal Medicine, Nagoya University School of Medicine, Nagoya, Japan; Departments of 2Clinical Preventive Medicine and 3Pathology, Nagoya University School of Medicine, Nagoya, Japan. CD40±CD40 ligand (CD40L) interaction is an important costimulatory signaling pathway in the crosstalk between T cells and antigen-presenting cells. This receptor±ligand system is known to be essential in eliciting strong cellular immunity. Here we demonstrate that murine lung cancer cells (3LLSA) transduced with the CD40L gene (3LLSA-CD40L) were rejected in syngeneic C57BL/6 mice, but grew in CD40-deficient mice to the same extent as control tumor cells. Immunohistochemical study showed that inflammatory cells, including CD4+, CD8+ T cells and NK cells, infiltrated into the inoculated 3LLSA-CD40L tumor tissue. Inoculation of 3LLSA-CD40L cells into mice resulted in the induction of 3LLSA-specific cytotoxic T-cell immunity, and the growth of parental 3LLSA tumors was inhibited when 3LLSA cells were inoculated into C57BL/6 mice mixed with 3LLSA-CD40L cells or when they were rechallenged 4 weeks after 3LLSA-CD40L cells were rejected. Furthermore, co-inoculation of interferon (IFN)- ± transduced cells (3LLSA-IFN ) with 3LLSA-CD40L cells enhanced the antitumor immunity efficiently in vivo. These results indicate that the in vivo priming with CD40L- and IFN- gene±transduced lung cancer cells is a promising strategy for inducing antitumor immunity in the treatment of lung cancer.
    [Show full text]
  • ORIGINAL ARTICLE Flow Cytometric Protein Expression Profiling As a Systematic Approach for Developing Disease-Specific Assays
    Leukemia (2006) 20, 2102–2110 & 2006 Nature Publishing Group All rights reserved 0887-6924/06 $30.00 www.nature.com/leu ORIGINAL ARTICLE Flow cytometric protein expression profiling as a systematic approach for developing disease-specific assays: identification of a chronic lymphocytic leukaemia-specific assay for use in rituximab-containing regimens AC Rawstron, R de Tute, AS Jack and P Hillmen Haematological Malignancy Diagnostic Service (HMDS), Leeds Teaching Hospitals, Leeds, UK Depletion of disease below the levels detected by sensitive sustained remissions only occur in patients achieving an MRD- minimal residual disease (MRD) assays is associated with negative complete response.12 Therefore MRD is increasingly prolonged survival in chronic lymphocytic leukaemia (CLL). being used as an end point for therapeutic trials, and several Flow cytometric MRD assays are now sufficiently sensitive and rapid to guide the duration of therapy in CLL, but generally rely studies are now using the assessment of MRD to define the on assessment of CD20 expression, which cannot be accurately duration of therapy. measured during and after therapeutic approaches containing Approaches using allele-specific oligonucleotide polymerase rituximab. The aim of this study was to use analytical software chain reaction (ASO-PCR) to the immunoglobulin gene of the developed for microarray analysis to provide a systematic B-CLL cell are generally accepted to show the highest sensitivity approach for MRD flow assay development. Samples from CLL for MRD detection. However, more recent four-colour ap- patients (n ¼ 49), normal controls (n ¼ 21) and other B-lympho- proaches show sensitivities nearing that of ASO-PCR6,11,13 with proliferative disorders (n ¼ 12) were assessed with a panel of 66 antibodies.
    [Show full text]
  • Galectin-4 Interaction with CD14 Triggers the Differentiation of Monocytes Into Macrophage-Like Cells Via the MAPK Signaling Pathway
    Immune Netw. 2019 Jun;19(3):e17 https://doi.org/10.4110/in.2019.19.e17 pISSN 1598-2629·eISSN 2092-6685 Original Article Galectin-4 Interaction with CD14 Triggers the Differentiation of Monocytes into Macrophage-like Cells via the MAPK Signaling Pathway So-Hee Hong 1,2,3,4,5, Jun-Seop Shin 1,2,3,5, Hyunwoo Chung 1,2,4,5, Chung-Gyu Park 1,2,3,4,5,* 1Xenotransplantation Research Center, Seoul National University College of Medicine, Seoul 03080, Korea 2Institute of Endemic Diseases, Seoul National University College of Medicine, Seoul 03080, Korea 3Cancer Research Institute, Seoul National University College of Medicine, Seoul 03080, Korea 4Department of Biomedical Sciences, Seoul National University College of Medicine, Seoul 03080, Korea 5Department of Microbiology and Immunology, Seoul National University College of Medicine, Seoul 03080, Korea Received: Jan 28, 2019 ABSTRACT Revised: May 13, 2019 Accepted: May 19, 2019 Galectin-4 (Gal-4) is a β-galactoside-binding protein mostly expressed in the gastrointestinal *Correspondence to tract of animals. Although intensive functional studies have been done for other galectin Chung-Gyu Park isoforms, the immunoregulatory function of Gal-4 still remains ambiguous. Here, we Department of Microbiology and Immunology, Seoul National University College of Medicine, demonstrated that Gal-4 could bind to CD14 on monocytes and induce their differentiation 103 Daehak-ro, Jongno-gu, Seoul 03080, into macrophage-like cells through the MAPK signaling pathway. Gal-4 induced the phenotypic Korea. changes on monocytes by altering the expression of various surface molecules, and induced E-mail: [email protected] functional changes such as increased cytokine production and matrix metalloproteinase expression and reduced phagocytic capacity.
    [Show full text]
  • New Advances in Leukaemia Immunotherapy by the Use of Chimeric Artificial Antigen Receptors
    Biagi et al. Italian Journal of Pediatrics 2011, 37:46 http://www.ijponline.net/content/37/1/46 ITALIAN JOURNAL OF PEDIATRICS REVIEW Open Access New advances in leukaemia immunotherapy by the use of Chimeric Artificial Antigen Receptors (CARs): state of the art and perspectives for the near future Ettore Biagi*, Virna Marin, Greta Maria Paola Giordano Attianese, Irene Pizzitola, Sarah Tettamanti, Elisabetta Cribioli and Andrea Biondi Abstract Leukaemia immunotherapy represents a fascinating and promising field of translational research, particularly as an integrative approach of bone marrow transplantation. Adoptive immunotherapy by the use of donor-derived expanded leukaemia-specific T cells has showed some kind of clinical response, but the major advance is nowadays represented by gene manipulation of donor immune cells, so that they acquire strict specificity towards the tumour target and potent lytic activity, followed by significant proliferation, increased survival and possibly anti- tumour memory state. This is achieved by gene insertion of Chimeric T-cell Antigen Receptors (CARs), which are artificial molecules containing antibody-derived fragments (to bind the specific target), joined with potent signalling T-Cell Receptor (TCR)-derived domains that activate the manipulated cells. This review will discuss the main application of this approach particularly focusing on the paediatric setting, raising advantages and disadvantages and discussing relevant perspectives of use in the nearest future. Keywords: Leukaemia immunotherapy,
    [Show full text]
  • IL21R Expressing CD14+CD16+ Monocytes Expand in Multiple
    Plasma Cell Disorders SUPPLEMENTARY APPENDIX IL21R expressing CD14 +CD16 + monocytes expand in multiple myeloma patients leading to increased osteoclasts Marina Bolzoni, 1 Domenica Ronchetti, 2,3 Paola Storti, 1,4 Gaetano Donofrio, 5 Valentina Marchica, 1,4 Federica Costa, 1 Luca Agnelli, 2,3 Denise Toscani, 1 Rosanna Vescovini, 1 Katia Todoerti, 6 Sabrina Bonomini, 7 Gabriella Sammarelli, 1,7 Andrea Vecchi, 8 Daniela Guasco, 1 Fabrizio Accardi, 1,7 Benedetta Dalla Palma, 1,7 Barbara Gamberi, 9 Carlo Ferrari, 8 Antonino Neri, 2,3 Franco Aversa 1,4,7 and Nicola Giuliani 1,4,7 1Myeloma Unit, Dept. of Medicine and Surgery, University of Parma; 2Dept. of Oncology and Hemato-Oncology, University of Milan; 3Hematology Unit, “Fondazione IRCCS Ca’ Granda”, Ospedale Maggiore Policlinico, Milan; 4CoreLab, University Hospital of Parma; 5Dept. of Medical-Veterinary Science, University of Parma; 6Laboratory of Pre-clinical and Translational Research, IRCCS-CROB, Referral Cancer Center of Basilicata, Rionero in Vulture; 7Hematology and BMT Center, University Hospital of Parma; 8Infectious Disease Unit, University Hospital of Parma and 9“Dip. Oncologico e Tecnologie Avanzate”, IRCCS Arcispedale Santa Maria Nuova, Reggio Emilia, Italy ©2017 Ferrata Storti Foundation. This is an open-access paper. doi:10.3324/haematol. 2016.153841 Received: August 5, 2016. Accepted: December 23, 2016. Pre-published: January 5, 2017. Correspondence: [email protected] SUPPLEMENTAL METHODS Immunophenotype of BM CD14+ in patients with monoclonal gammopathies. Briefly, 100 μl of total BM aspirate was incubated in the dark with anti-human HLA-DR-PE (clone L243; BD), anti-human CD14-PerCP-Cy 5.5, anti-human CD16-PE-Cy7 (clone B73.1; BD) and anti-human CD45-APC-H 7 (clone 2D1; BD) for 20 min.
    [Show full text]
  • Identification of 18 Immune Cell Subsets Using 13-Color Panel
    Immunophenotyping Identification of 18 immune cell subsets in human blood using a 13-color panel Background Cell type Function Phenotype Flow cytometry has become the method of choice for Eosinophils Parasitic immunity CD45+, SSCmid/hi, CD14 –, CD16 –, CD19– immunophenotyping and identifying specific cellular + mid/hi subsets. Within seconds, it provides a thorough overview of Neutrophils Innate Immunity CD45 , SSC , CD14 –, CD16+, CD19– the major cell types that constitute a sample. Using multiple + mid markers simultaneously increases the number of parameters Classical Phagocytosis of CD45 , SSC , monocytes pathogens and CD14+, CD16– that can be analyzed per run and decreases the amount of antigen presentation starting material required to perform an assay. This can be Intermediate Phagocytosis of CD45+, SSCmid, critical for precious sample material and long-term immune- monocytes pathogens and CD14+, CD16mid monitoring studies. In this application note, we demonstrate antigen presentation 13-color immunophenotyping of human peripheral blood Non-classical Phagocytosis of CD45+, SSCmid, + + mononuclear cells (PBMCs) using the MACSQuant® Analyzer 16, monocytes pathogens and CD14 , CD16 antigen presentation a compact and reliable benchtop flow cytometer equipped + low + with three lasers. The markers selected allow for the Class-switched Adaptive immunity CD45 , SSC , CD19 , memory B cells CD27+, IgD–, CD14– simultaneous identification and analysis of 18 different cell Non-switched Adaptive immunity CD45+, SSClow, CD19+, populations, thus maximizing the amount of information that memory B cells CD27+, IgD+, CD14– can be retrieved from the sample material analyzed. This is Naive B cells Adaptive immunity – CD45+, SSClow, CD19+, critical when input material is limited, as is often the case for non-antigen CD27–, IgD+, CD14– pediatric or disease studies.
    [Show full text]
  • Immunohistochemical Expression of CD23 and CD40 May Identify Prognostically Favorable Subgroups of Diffuse Large B-Cell Lymphoma: a Nordic Lymphoma Group Study1
    722 Vol. 9, 722–728, February 2003 Clinical Cancer Research Immunohistochemical Expression of CD23 and CD40 May Identify Prognostically Favorable Subgroups of Diffuse Large B-cell Lymphoma: A Nordic Lymphoma Group Study1 Johan Linderoth,2 Mats Jerkeman, to a germinal center origin or attributable to increased Eva Cavallin-Ståhl, Stein Kvaløy, and apoptosis via induction of bax and/or enhanced T-cell inter- Emina Torlakovic action, resulting in improved autologous tumor response. Confirmatory studies are necessary. Department of Oncology, Lund University Hospital, 221 85 Lund, Sweden [J. L., M. J., E. C-S.]; Department of Oncology, the Norwegian Radium Hospital, Oslo, Norway [S. K.]; and Department INTRODUCTION of Pathology, The Norwegian Radium Hospital, Oslo, Norway [E. T.] DLBCL3 is the most frequent lymphoma subtype and en- compasses the majority, ϳ60–70%, of the aggressive lympho- mas. Biologically and clinically, it shows considerable hetero- ABSTRACT geneity. Eventually, 30–40% of the patients with advanced Purpose: In search for subgroups of diffuse large B-cell stage DLBCL who are treated with current therapies will be lymphoma (DLBCL) with different histogenetic origin and long-time survivors, whereas the rest will succumb to the dis- prognosis, as has been described by gene expression profil- ease. There is an obvious need for prognostic information to ing, we examined tumor specimens from 125 patients with design a more risk-adapted primary therapy. The IPI is one DLBCL, uniformly treated by either cyclophosphamide- available, validated tool, based on clinical features (age, stage, Adriamycin-vincristine-prednisone or methotrexate, doxo- level of lactate dehydrogenase, performance status, and number rubicin, cyclophosphamide, vincristine, prednisone, and of extranodal sites; Ref.
    [Show full text]