UC Merced UC Merced Electronic Theses and Dissertations

Title REGULATION OF STEM CELL FUNCTION IN THE ADULT BODY

Permalink https://escholarship.org/uc/item/44r5x132

Author Peiris, Tanuja Harshani

Publication Date 2014

Peer reviewed|Thesis/dissertation

eScholarship.org Powered by the California Digital Library University of California REGULATION OF STEM CELL FUNCTION IN THE ADULT BODY By: Tanuja Harshani Peiris

DISSERTATION Submitted in satisfaction of the requirements for the degree of DOCTORATE OF PHILOSOPHY in Quantitative Systems Biology With an emphasis in Stem cell biology, Tissue repair and Regeneration in the OFFICE OF GRADUATE STUDIES of the UNIVERSITY OF CALIFORNIA, MERCED

Committee Advised: Dr. Nestor Oviedo Dr. Jennifer Manilay Dr. David Ojcius Dr. Ricardo Zayas

2014 Copyright

Tanuja Harshani Peiris, 2014.

Signature page

The dissertation of Tanuja Harshani Peiris is approved by, and is accepted in the quality and form for publication on microfilm and electronically:

______

Dr. Jennifer Manilay (Chair)

______

Dr. Nestor Oviedo (Advisor)

______

Dr. David Ojcius

______

Dr, Ricardo Zayas

iii

Dedication

In dedication to my mother for her love and support and for always been therefore me. A special feeling of gratitude also to my father and sister for all the help and encouragement.

Table of Contents

Figure and Tables ...... xii Acknowledgements ...... xv Curriculum vitae ...... xvii Abstract ...... xxix Chapter 1 ...... 1 Stem Cells and their implications towards, cancer initiation, tissue repair and regeneration 1 1.1 – Introduction ...... 1 Stem cells and history ...... 1 1.2 - Stem Cell characterization ...... 2 1.3 - Stem cell division theory ...... 3 1.4 - Stem cells and cancer ...... 4 1.5 - How do stem cells maintain wound repair and regeneration? ...... 5 1.6 - Stem Cells and maintenance of tissue homeostasis ...... 6 Chapter 2 ...... 8 Planaria as a model organism to study in vivo stem cell regulation ...... 8 2.1 – Planaria as a model organism ...... 8 2.2 - Planaria Classification and physiology ...... 10 Chapter 3 ...... 13 Materials and Methods ...... 13 Identification of homologs and Phylogenetic analysis ...... 13 Planarian Culture ...... 13 Cloning ...... 13 dsRNA synthesis ...... 14 Riboprobe synthesis ...... 14 Microinjections ...... 15 In vitro dsRNA synthesis ...... 15 RNAi by feeding ...... 15

Whole mount Immunofluoresence ...... 15 Brdu Staining ...... 16 Planaria Dissociation and cell collection ...... 16 Fixation of dissociated cells ...... 16 Protein extraction ...... 17 Western Blot ...... 17 Flow Cytometry analysis ...... 17 TUNEL Assay ...... 18 Measurements of planaria and image processing ...... 18 RNA Extraction ...... 19 cDNA synthesis ...... 19 Quantitative RT-PCR ...... 19 In situ hybridization (ISH) ...... 19 Comet Assay ...... 19 Karyotyping Assay ...... 20 Oligonucleotides ...... 20 Oligos Used for cloning ...... 20 Oligos used for qpcr ...... 21 Chapter 4 ...... 22 TOR signaling regulates planarian stem cells and controls localized and organismal growth ...... 22 4.1 - Introduction ...... 22 4.1.1 - Target of Rapamycin Structure ...... 22 4.1.2 - Target of Rapamycin functions ...... 25 4.1.3 – PTEN in smed ...... 26 4.2 Results ...... 27 4.2.1 - Identification of smed-TOR and TOR pathway homologs ...... 27 4.2.2 - TOR is ubiquitously expressed in planaria ...... 29 4.2.3 - Planarian TOR is down regulated upon RNAi ...... 30 4.2.4 - TOR is important for cell proliferation and growth ...... 32 4.2.5 - TOR (RNAi) inhibits systemic neoblast and successive progeny populations ...... 34

4.2.6 - TOR(RNAi) increases cell death ...... 36 4.2.7 - TOR is essential for organismal growth and long term tissue maintenance ...... 37 4.2.8 - TOR signaling is required for blastema formation and cell proliferation post amputation ...... 41 4.2.9 - TOR signaling is required for proper tissue patterning post amputation ...... 43 4.2.10 - TOR requirement for organismal growth and long-term tissue maintenance, and its functions are mediated through RAPTOR, a component of the TOR Complex-1 ...... 45 Chapter 5 ...... 50 AKT regulates stem cell behavior during tissue renewal and regeneration in planarians ... 50 5.1 – Introduction ...... 50 5.1.1 - AKT Structure ...... 50 5.1.2 - AKT Regulation and function ...... 50 5.2 Results ...... 52 5.2.1 - Planaria possess a single AKT homolog that is evolutionarily conserved ...... 52 5.2.2 - Planarian AKT is important for stem cell proliferation and progression through the cell cycle ...... 54 5.2.3 - Planarian AKT affects neoblast markers and their function ...... 58 5.2.4 - Planarian AKT down regulation increases cell death ...... 60 5.2.5 - AKT regulates cell proliferation probably via the TORC1 pathway ...... 61 5.3 - Conclusion ...... 62 Chapter 6 ...... 63 Bioinformatics Analysis of the DNA Damage Reparative Mechanisms in Schmidtea mediterranea ...... 63 6.1 - Introduction ...... 63 6.1.1 – DNA damage is induced by various extrinsic and intrinsic factors ...... 63 6.1.2 – DNA damage: Repair ...... 64 6.1.3 - Homologous Recombination Pathway ...... 66 6.1.4 Non homologous end joining ...... 67 6.2 Results ...... 69 6.2.1 – DNA damage pathway sensors ...... 69 6.2.2 – DNA damage mediators ...... 74 6.2.3 – DNA repair and Cell cycle control ...... 77

vii

6.2.4 – DNA repair through homologous recombination ...... 79 6.2.5 – DNA repair through non-homologous recombination ...... 82 Damage recognition ...... 82 Endo-Exo nuclease activity and DNA end processing ...... 83 Ligation ...... 83 6.2.6 – DNA damage induced cell death ...... 86 6.3 – Conclusion ...... 87 Chapter 7 ...... 89 Rad51 is important for DNA Repair, tissue homeostasis and tissue repair and regeneration ...... 89 7.1 – Introduction ...... 89 7.1.1 – Rad Related Proteins ...... 89 7.1.2 - Rad51 family of proteins and Rad51/RecA structure and function ...... 90 7.1.3 - Rad51 is controlled by tumor suppressors and is activated during Cell cycle progression...... 91 7.1.4 - Rad51 repairs DNA damage and is involved with cell death ...... 92 7.1.5 - Rad51 paralogs ...... 94 7.2 - Results ...... 94 7.2.1 - Schmidtea mediterranea Rad51 homolog maintains remarkable conservation in structure ...... 94 7.2.2 - Schmidtea mediterranea Rad51 is expressed in proliferative cells and is down regulated upon Rad51(RNAi) ...... 97 7.2.3 - Schmidtea mediterranea Rad51 maintains functional conservation ...... 98 7.2.4 - Rad51 down regulation disrupts cell proliferation during normal homeostasis ...... 100 7.2.5 – Rad51 down regulation impacts neoblast and progeny markers ...... 109 7.2.6 – Rad51(RNAi) increases cell death and promotes regional differences in cell death ...... 112 ...... 112 7.2.7 – Rad51(RNAi) increases DNA damage equally in the anterior and posterior regions ...... 116 7.2.8 – Animals with disrupted polarity provides antero-posterior differences in cell proliferation and death ...... 118

viii

7.2.9 – Rad51(RNAi) animals responds to feeding ...... 121 7.2.10 – Rad51(RNAi) animals do not regenerate ...... 123 7.3 - Conclusions...... 123 Chapter 8 ...... 126 BRCA2 and RPA are important to maintains Planarian tissue homeostasis ...... 126 8.1 – Introduction ...... 126 8.1.1 - BRCA1, BRCA2 and RPA proteins ...... 126 8.1.2 - BRCA1, Breast cancer type 1 susceptibility protein ...... 127 8.1.3 - BRCA2, Breast cancer type 2 susceptibility protein ...... 127 8.1.4 - RPA (Replication Protein A) ...... 130 8.2 - Results ...... 130 8.2.1- BRCA2 homolog is found in Planaria ...... 130 8.2.2 - Schmidtea mediterranea BRCA2 is expressed in proliferative cells and is down regulated upon RNAi ...... 132 8.2.3 - Schmidtea mediterranea BRCA2 impacts cell proliferation similar to Rad51(RNAi) down regulation ...... 133 8.2.4 - BRCA2(RNAi) down regulates neoblasts and successive progeny similar to Rad51(RNAi) ...... 137 8.2.5 - Schmidtea mediterranea BRCA2 maintains regional differences in cell death similar to Rad51(RNAi) ...... 138 8.2.6 - RPA homolog is found in Planaria ...... 140 8.2.7 - Schmidtea mediterranea RPA impacts cell proliferation ...... 141 ...... 143 8.2.8 - Schmidtea mediterranea down regulates neoblasts and successive progeny but does not impose regional differences ...... 144 8.3 - Conclusions...... 144 Chapter 9 ...... 146 Rad51 interplay with tumor suppressors contribute towards the observed regional differences ...... 146 9.1 - Introduction ...... 146 9.1.1 - p53 and DNA damage responses ...... 146 9.1.2 - Rb and DNA damage responses ...... 147

9.2 - Results ...... 149 9.2.1 – p53 and Rad51 interplay ...... 149 9.2.2 – Rb and Rad51 interplay ...... 154 9.2.3 – Rb and p53 decisions are governed by systemic positional cues ...... 156 9.3 - Conclusion ...... 156 Chapter 10 ...... 158 Ku70 and Ku80 heterodimer may play a role in mediating DNA repair in the planaria. .. 158 10.1 – Introduction ...... 158 10.1.1 - NHEJ pathway ...... 158 10.1.2 - Ku70-80 structure ...... 159 10.2 Results ...... 161 10.2.1 - Ku70 and Ku80 homologs in the Planaria ...... 161 10.2.2 Schmidtea mediterranea Ku70 down regulation does not impact DNA repair or cellular proliferation ...... 164 10.2.3 - Schmidtea mediterranea Ku70 down regulation does not impact Cell death ...... 167 10.2.5 - Schmidtea mediterranea Ku70 down regulation does not impact regeneration ... 170 10.2.6 - Schmidtea mediterranea MRE11 down regulation does not impact cell proliferation...... 170 10.3 Conclusions ...... 171 Chapter 11 ...... 173 DNA damage sensors are important for proper DSB repair in Schmidtea mediterranea .. 173 11.1 - Introduction ...... 173 11.1.1 ATM is an important DNA damage sensor ...... 173 11.1.2 - ATR is important for HR mediated DNA damage repair ...... 176 11.2 - Results ...... 176 11.2.1 - Identification of smed-ATM and ATR ...... 176 11.2.2 - ATM is expressed primarily in the neoblasts ...... 177 11.2.3 - Planarian ATM down regulation does not impact cell proliferation ...... 178 11.2.4 - ATM vs NHEJ and HR ...... 180 12.2.5 - ATM and cell death ...... 180 12.2.6 - ATM does not impact wound repair and Regeneration ...... 182

11.2.7 - ATM and DNA Repair ...... 184 11.3 – Conclusion ...... 184 Chapter 12 ...... 186 An In vivo analysis of stem cell regulation ...... 186 12.1 – Introduction ...... 186 12.1- Planaria as a model organism ...... 186 12.2 - Neoblasts are an abundant heterogeneous population ...... 187 12.3 - Genes are required to maintain specific stem cell populations and cellular functions ...... 188 References ...... 191

Published Papers prior to the defense...... 238 1. TOR signaling regulates planarian stem cells and controls localized and organismal growth ...... 238 2. Gap junction proteins: Master regulators of the planarian stem cell response to tissue maintenance and injury ...... 255 3. Innate immune system and tissue regeneration in planarians: An area ripe for exploration ...... 264

xi Figure and Tables

Figure 1. 1 - – Stem Cells can divide and differentiate into various types of cells...... 1 Figure 1. 2 – Stem Cell Division theory...... 3

Figure 4. 1 – Target of Rapamycin Structure ...... 22 Figure 4. 2 – Mammalian TORC1 and TORC2 complexes...... 23 Figure 4.3 - Molecular Phylogenetic analysis by Maximum Likelihood method ...... 28 Figure 4.4 – smed-TOR is expressed ubiquitously ...... 30 Figure 4.5 – Smed-TOR is down regulated by TOR specific RNA-interference ...... 31 Figure 4.6– Smed-TOR RNA-interference reduces mitotic activity ...... 33 Figure 4.7 - RNA-interference reduces expression of neoblast markers ...... 35 Figure 4. 8 – smed-TOR(RNAi) increases cell death ...... 36 Figure 4.9 - TOR is required for long-term tissue maintenance ...... 37 Figure 4.10 - TOR is required for organismal growth ...... 39 Figure 4.11 - TOR systemic expression is modulated by the metabolic status and Remaining neoblasts after TOR(RNAi) respond to systemic nutrient levels ...... 40 Figure 4.12 - TOR signaling drives early response of neoblast to amputation but regeneration occurs in the absence of blastema formation ...... 41 Figure 4.13 – TOR signaling is required for proper tissue patterning post amputation ...... 44 Figure 4. 14 - Functional disruption of TOR Complex-1 affects neoblast proliferation ...... 45 Figure 4.15 - Functional disruption of TOR Complex-1 affects neoblast gene expression ...... 46 Figure 4.16 - Functional disruption of TOR Complex-1 affects neoblast gene expression and proliferation ...... 47 Figure 4.17 - Working model ...... 48

Figure 5.1 – Domain structure of AKT ...... 50 Figure 5.2 – AKT function ...... 51 Figure 5.3 - AKT is down regulated upon AKT (RNAi)...... 53 Figure 5. 4 - AKT down regulation reduces body size...... 54 Figure 5.5 - AKT(RNAi) down regulates proliferative cells...... 55 Figure 5.6 - AKT(RNAi) decreases Brdu in cooperation ...... 56 Figure 5.7 - AKT down regulates impairs cell cycle progression...... 57 Figure 5.8 - Neoblast markers are down regulated upon AKT(RNAi)...... 58 Figure 5.9 – Neoblast progeny markers are down regulated upon AKT(RNAi) ...... 59 Figure 5.10 – Neoblast progeny markers are down regulated upon AKT(RNAi) ...... 60

Figure 6. 1 – DNA damage and Repair pathways ...... 63 Figure 6. 2 – DNA damage response mediation ...... 65 Figure 6.3 – Planarian homologs for MRE11 and Rad50 ...... 70 Figure 6.4 – Planarian homologs for DNA-PKc ...... 72 Figure 6.5 – Planarian homolog for PARP-1 ...... 73 Figure 6. 6 – Planarian homologs for H2Ax and MDC-1 ...... 75 Figure 6. 7 – Planarian homologs for Claspin and TOPBP1 ...... 76 Figure 6. 8 – Planarian homologs for Wee1 and Myt1 ...... 78 Figure 6. 9 – Planarian homolog for Rad54 ...... 80

xii

Figure 6. 10 - Planarian homolog for Fen1 ...... 81 Figure 6. 11 – Planarian homolog for DNA Ligase IV ...... 84 Figure 6. 12 – Planarian homolog for Caspase 2 and Cathepsin B ...... 85 Figure 6.13 - DNA damage repair pathways are conserved in the planaria ...... 87

Figure 7. 1 - Human Rad51A structure ...... 90 Figure 7. 2 - Schmidtea mediterranea Rad51 homolog is structurally conserved ...... 95 Figure 7. 3 – Schmidtea mediterranea Rad51 is expressed in neoblasts ...... 96 Figure 7. 4 – Rad51 is down regulated upon Rad51 RNAI microinjections ...... 97 Figure 7. 5 - Schmidtea mediterranea Rad51 maintains functional conservation ...... 99 Figure 7. 6 – Rad51(RNAi) down regulates mitosis ...... 102 Figure 7. 7 – Rad51(RNAi) maintains regional differences in proliferation – ...... 104 Figure 7. 8 – Rad51(RNAi) induced cell cycle arrest ...... 105 Figure 7.9 – Cell cycle genes are down regulated in the Rad51(RNAi)...... 106 Figure 7. 10 - Neoblast markers confer regional differences upon Rad51(RNAi)...... 107 Figure 7. 11 – Neoblasts and successive progeny are down regulated upon Rad51(RNAi) 108 Figure 7. 12 - Sigma, Zeta and Gamma neoblast populations are down regulated in the Rad51(RNAi)...... 110 Figure 7. 13 – Rad51(RNAi) cell death promoting regional differences in cell death levels...... 112 Figure 7. 14 – Apoptosis is up regulated in the Rad51(RNAi)...... 113 Figure 7. 15 – Planarian Rad51 localizes to the nucleus upon sub lethal IR...... 115 Figure 7. 16 – DNA is damaged upon Rad51 down regulation...... 116 Figure 7. 17– Post DNA damage X1 population is severely compromised in the planaria equally along the anterior posterior axis...... 117 Figure 7. 18 – Rad51 Mediated HR Pathway Regulates Cell Proliferation Along the AP Axis in Planaria...... 119 Figure 7. 19 – Mitotic cells are concentrates to the anterior region probably by proliferation...... 120 Figure 7. 20 – Metabolic cues are impacted by Rad51 down regulation...... 121 Figure 7. 21 – Rad51 down regulation impairs regeneration in planaria...... 122 Figure 7. 22 - Working model...... 124

Figure 8. 1 – Structures of Human BRCA2 and RPA structures ...... 129 Figure 8. 2 – Genomic analysis of the Schmidtea mediterranea BRCA2 homolog...... 131 Figure 8. 3 - BRCA2 is down regulated by BRCA2(RNAi)...... 132 Figure 8. 4 – BRCA2(RNAi) are sensitive to Radiation ...... 133 Figure 8. 5 – BRCA2(RNAi) down regulates mitosis maintaining regional differences similar to Rad51(RNAi)...... 135 Figure 8. 6 – BRCA2 and Rad51 expression levels ...... 136 Figure 8. 7 – BRCA2(RNAi) down regulates neoblast marker expression...... 137 Figure 8. 8 – BRCA2(RNAi) increases Cell death similar to Rad51(RNAi) ...... 139 Figure 8. 9 – Identification of RPA70 homolog in the planaria...... 140 Figure 8. 10 - RPA(RNAi) impairs neoblast proliferation...... 141 Figure 8. 11 – RPA and Rad51 expression levels ...... 142 Figure 8. 12 - RPA(RNAi) down regulates neoblast marker expression ...... 143

xiii

Figure 9. 1 – DNA damage and Tumor suppressor responses ...... 148 Figure 9.2 – P53 interplays with Rad51 to maintain cell proliferation along the anterior posterior axis...... 150 Figure 9.3 – P53 interplays with Rad51 to maintain cell death ...... 152 Figure 9.4 – Rb interplays with Rad51 to maintain cell proliferation ...... 153 Figure 9.5 – Tumor suppressors mediate different functions along the anterior posterior fragment in the absence of Rad51...... 154 Figure 9.6 – Tumor suppressors mediate cell proliferation based on systemic positional cues ... 155 Figure 9.7 - Working model ...... 157

Chapter 10. 1 - Genomic analysis of the Planarian Ku70 Homolog...... 160 Chapter 10. 2 - Genomic analysis of the Planarian Ku80 Homolog...... 161 Chapter 10. 3 - Ku70 is expressed in anterior and posterior regions of the planaria...... 162 Chapter 10. 4 - Ku70 is down regulated upon RNAi...... 163 Chapter 10. 5 – Ku70(RNAi) is not responsible for mitotic down regulation...... 164 Chapter 10. 6 - Ku70 down regulation does not impact proliferation post induced DNA damage...... 165 Chapter 10. 7 – Flow cytometry analysis of the X1, X2, Xins populations in the planaria. 166 Chapter 10. 8 – Ku70 down regulation does not impact cell death in planaria...... 168 Chapter 10. 9 – MRE11 down regulation does not impact cell proliferation...... 169

Figure 11.1 - Genomic analysis of the Planarian ATM Homolog...... 174 Figure 11. 2 - Genomic analysis of the Planarian ATR Homolog...... 175 Figure 11.3 – ATM expression in planaria...... 177 Figure 11.4 – ATM(RNAi) does not impact cell proliferation in planaria...... 179 Figure 11. 5 – ATM(RNAi) does not impact cell death ...... 181 Figure 11. 6 – ATM(RNAi) does not impact regeneration...... 182 Figure 11.7 – ATM(RNAi) does not impact neoblast recovery post irradiation...... 183

Figure 12. 1 - Stem cells utilize local and systemic signals...... 186 Figure 12.2– Neoblasts are a heterogeneous population ...... 187 Figure 12. 3 – Specific genes are required for the regulation of specific cellular functions...... 189

xiv

Acknowledgements

Foremost I would like to express gratitude and love for my mother who always believed in me and encouraged me to be the woman I am today. My life has had many ups and downs, and one mother’s love has carried me through the special ups, but mostly during my downs. This thesis would not have been a possibility without the love, trust and the help she has given me through the years. My father and my sister has been rocks by my side and my whole family has aided me through this journey. Therefore special gratitude and appreciation goes to my family.

I would like to express my appreciation and thanks to my advisor, Dr. Nestor Oviedo who has molded me into the scientist I am today. I fondly remember the days I started working at the Oviedo lab and the tremendous attempt to publish a paper within a short time. With the correct guidance, hard work and dedication this task was accomplished with great success. I will always look back to those days not only as one of the greatest triumphs in my life, but also some of the happiest times in my life. I learnt that happiness comes in all forms and shapes, and sometimes it can come as a beautiful image that shows positive data. This experience will guide me through the rest of my career and I have realized the power of team work, hard work and dedication. Thank you Dr. Oviedo for the excellent guidance and making me realize my potential and capabilities which I did not know I had.

My journey at UC Merced had some rough points, but certain people made me believe in myself and helped through the rough patches. The first time I came to Merced I had a detour stay in Atwater. Without a car and very limited cat tracks service, I was stranded on a 100 degree weather in Atwater with no way of coming to and forth. Two special ladies, Katie Unruh and Barbara Escobar came to my help. They helped me find a new place and moved all my belongings within a matter of days. Words cannot express my special appreciation and thanks and I would like to acknowledge them both fondly. Also a special thanks and deep appreciation goes to Carrie King and Dee Acker who played a special part during my thesis career. At a time when everything was at an end, these two ladies stood by me and helped me to obtain the best possible situation. I would also like to remember and thank Dr. Juan Meza and Paul Roberts for their help and support on numerous occasions.

Special thanks also goes to Daniel Ramirez, Paul Barghouth and Udoka Ofoha with whom I have shared projects, laughter and tears. I also would like to fondly remember some special undergraduate students Adam Meng, Michael Chow, Katie Wang, Tatsiana Verstak, Salvador Rojas, Camille Hassel, Kristianne Amurao and Carlos Gomez, who at special times has helped me tremendously. I would also like to thank Edelweiss Pfister

Oviedo, Marcela Bolanos and Natasha Flores for the support, friendship and comfort. Thank you all for bringing some joy and comfort during my never ending experiments and frustrations.

A special thanks goes to my best friend Patricia Primakov, who has been with me through thick and thin. I never expected to find another sister in the midst of my life and I did. I would also like to express my special appreciation to a special friend, Mapi Asta, who has been my partner in crime at UC Merced. Your help, words of comfort and friendship means a lot to me.

A very special thanks also goes to the Gordon Science Tissue repair and regeneration conference and the chairs during the years 2011-2015. I would like to extend my gratitude to Dr. Sabine Eming, Dr. Enrique Amaya and Dr. Dunja Knapp for the numerous opportunities they have given me. Thank you for the faith and guidance you have provided, and for bringing some extra joy into my life and my career.

I would also like to thank my committee members, Dr. Jennifer Manilay, Dr. Ojcius and Dr, Ricardo Zayas for serving as my committee members even at hardship. Thank you for letting my defense be an enjoyable moment, and for your brilliant comments and suggestions.

Thank you to the collaborators who has provided technical advice and numerous reagents: Dr. Ricardo Zayas, Dr. Manel Camps, Dr Julien Sage, Dr. Peter Reddien, Dr. Christian Peterson. Also thanks to the grants that funded the research in the Oviedo Lab: NIH-National Cancer Institute and National Institute of General Medical Sciences, CA176114 and GM109372, Jane Villas scholarship and UC Merced graduate funding.

xvi

Curriculum vitae

EDUCATION

University of California, Merced 2008- present PhD candidate, Quantitative Systems Biology Emphases: Stem Cell Biology, Cancer, Tissue Repair and Regeneration, Aging Thesis advisor: Dr. Nestor Oviedo Dissertation – expected date of completion October 15th 2014

University of Pennsylvania, Philadelphia, PA 2005-2007 Post-Baccalaureate Program

Ramapo College of New Jersey, New Jersey 1999-2003 B.S. in Biology, B.S. in Bioinformatics Minor Theater and Drama

PUBLICATIONS & WORKS IN PROGRESS

Peiris TH, Ramirez DJ, Ofoha RU, Barghouth P, Weckerle F, Davidian D, Nestor Oviedo. “Molecular regulation of cell proliferation and tissue repair along the anteroposterior axis in the adult body”. Manuscript in preparation.

Peiris TH, Ramirez DJ, Weckerle F, Oviedo NJ. “AKT regulates stem cell behavior during tissue renewal and regeneration in planarians”. Manuscript in preparation.

Peiris TH, Hoyer K, Oviedo NJ. “Inflammatory responses during planarian regeneration.” Seminars in Immunology. YSMIM1020, DOI information: 10.1016/j.smim.2014.06.005

Peiris TH, Oviedo NJ. “Gap junction proteins: Master regulators of the planarian stem cell response to tissue maintenance and injury”. Biochim Biophys Acta. Jan 2013 :1828(1):109-17. PMID:22450236

Peiris TH, Weckerle F, Ozamoto E, Ramirez D, Davidian D, García-Ojeda ME, Oviedo NJ. “TOR Signaling Regulates Planarian Stem Cells and Controls Localized and Organismal Growth.” Journal of Cell Science. April 1 2012 :125(Pt 7):1657-65. PMID:22427692

Wang H*, Peiris TH*, A. Mowery, John Le Lay, Yan Gao and Linda E. Greenbaum. “CCAAT/enhancer binding protein-beta is a transcriptional regulator of peroxisome- proliferator-activated receptor-gamma coactivator-1alpha in the regenerating liver.”

xvii

Molecular Endocrinology. July 2008:22(7):1596-605. PMID: 18467525 (*first author equal contribution to the paper)

Wang H*, Larris B*, Peiris TH*, Liping Zhang, John Le Lay, Yan Gao, Linda Greenbaum. “C/EBP beta activates E2F regulated genes in vivo via recruitment of the coactivator CBP/P300 Journal of Biological Chemistry. August 24 2007: 282(34):24679- 88. PMID: 17599912 (*first author equal contribution to the paper)

Friedman JR, Larris B, Le PP, Peiris TH, Arsenlis A, Schug J, Tobias JW, Kaestner KH, Greenbaum LE. “Orthogonal analysis of C/EBPbeta targets in vivo during liver proliferation”. Proc Natl Acad Sci U S A. August 31 2004: 101(35):12986-91. PMID: 15317935

PROFESSIONAL EXPERIENCE

University of California, Merced, Natural Sciences Department Nov 2010-2014 Thesis Advisor, Dr. Nestor Oviedo Title: Ph.D. Candidate In my doctoral work, I investigated stem cell regulation in their natural environment using the model organism Schmidtea mediterranea. Downregulation of DNA repair pathways using gene specific RNAi caused genomic instability and disruption of homeostasis along the antero-posterior axis. Further I showed that the TOR/AKT pathway is important for maintenance of stem cells and down regulation of these genes disrupts the systemic homeostasis, tissue repair and regeneration. By integrating RNAi and in vivo functional studies we reveal novel mechanisms and roles for these key regulatory pathways during in vivo cellular turnover, tissue repair/regeneration, cancer and aging.  Planaria (Schmidtea mediterranea) as a model  Bioinformatic analysis identify novel genes  Cloning techniques to clone genes  RNAi techniques to down regulate genes  Flow Cytometry and cell sorting  Proliferation assays (Brdu, H3p)  Cell death assays (TUNEL, Caspase, Annexin V)  Immunohistochemistry  In situ hybridization  Protein extraction and Western blot  RNA extraction and Quantative Real-time pcr  COMET assay and karyotyping  Grant and manuscript preparation

xviii

University of California, Merced, Natural Sciences Department Aug 2008-Oct 2010 Advisor, Dr. Marcos Garcia-Ojeda Title: Ph.D. Candidate In my doctoral work, I researched age-related dynamics of Committed T cell progenitors (CTP), and HSC derived bone marrow population that is capable of generating functional T cells via both thymic and extrathymic pathways. I showed that CTP frequency in the bone marrow increases in aged C57BL/6 mice compared to young mice. To understand the capability of young and aged CTPs to generate T cells in vitro, I adapted cell culture techniques to analyze and sort different cell populations using flow cytometry. This work has revealed a unique bone marrow derived progenitor population that could be utilized to generate functional T cells and could pave the way to studies related with aging and towards developing various therapeutical approaches.  Mouse models (C57BL/6)  Dissection and isolation of the mouse thymus, bone marrow, spleen, liver.  T cell proliferation assays  Cell culture techniques (includes Co-culture)  Proliferation assays (Hoechst)  Cell death assays (Annexin V)  RNA extraction and Quantative Real-time pcr  Grant and manuscript preparation

University of Pennsylvania, Philadelphia, PA. School of Medicine Jul 2003-Aug 2007 University of Pennsylvania, Philadelphia, PA Advisor, Dr. Linda Greenbaum Title: Research Specialist I investigated factors contributing towards cell cycle progression in vivo using mouse liver regeneration model. Partial hepatectomy in mice trigger a rhythmic and synchronized proliferative response that can be utilized to study cell cycle progression. I have performed chromatin immunoprecipitation assay, Quantative Real-time pcr and mouse promoter microarray to identify C/EBPβ targets in vivo after partial hepatectomy. Utilizing C/EBPβ knockout mice and chromatin immunoprecipitation assay, I have shown C/EBPβ occupancy on E2F regulated genes and its capability to activate E2F target genes. Further C/EBPβ was found to be essential for PGC-1α activation which is a co-activator involved with metabolic homeostasis during liver regeneration.  Mouse models, C57BL/6/SV129 background  Breeding, weaning, genotyping and maintenance of mouse colonies  Chromatin preparation and Chromatin Immunoprecipitation assay  Experience with radioactive materials and protocols related  Electrophoretic mobility shift assay  Cloning techniques to clone genes  Protein extraction and Western blot

xix

 RNA extraction, Quantative Real-time pcr and Northern Blot  Glucose and Insulin Tolerance tests  Cell culture techniques  BiFC Assay  Luciferase Assay  Transfection Assay

Ramapo College of New Jersey, NJ Jan 2000-May 2003 Advisor, Dr. Paramjeet Bagga Title: Undergraduate student Researcher As an undergraduate researcher, I investigated Quadruplex-forming G-Rich Sequences (QGRS) in the eukaryotic pre mRNA sequences. Utilizing NCBI newly mapped human and mouse genome I manually investigated the exon-intron boundaries to predict Quadruplex-forming G-Rich sequences. This analysis further helped to formulate theories about alternative spliced regions where we predict that the alternative splicing of genes might be dependent on G-rich sequences and their interactions with specific proteins.  NCBI, SWISS-PROT  C++ programming language  Oracle/MYSQL database programming language  Perl language  Unix Programming language  Database Search and Sequence Analysis  Database design (ORACLE and MYSQL)

 Other Computer Skills  Microsoft Word, Excel, PowerPoint, Access, Photoshop

AWARDS, HONORS & GRANTS RECEIVED

FELLOWSHIP AND GRANTS

Graduate and Research Council Summer Fellowship, University of California Merced 2014. One of twenty competitive fellowships provided campus wide out of 125 fellowship applications submitted by each graduate group to provide summer support. Project entitled, “Molecular regulation of cell proliferation and tissue repair along the antero-posterior axis in the adult body”

Dean’s Discretionary Award, University of California, Merced, 2013. This award recognizes a UC Merced student for academic merit. Project entitled “Molecular regulation of cell proliferation and tissue repair along the antero-posterior axis in the adult body”.

Graduate and Research Council Summer Fellowship, University of California Merced 2013. One of fifty competitive fellowships provided campus wide out of 125 fellowship applications submitted by each graduate group to provide summer support. Project entitled, “AKT regulates stem cell behavior during tissue renewal and regeneration in planarians”.

Quantitative and Systems Biology Travel Grant, University of California, Merced, 2012.

Quantitative systems Biology summer funding, University of California Merced, 2012. One award given due to academic merit.

Graduate and Research Council Summer Fellowship, University of California Merced 2011. One of fifty competitive fellowships provided campus wide out of 125 fellowship applications submitted by each graduate group to provide summer support. Project entitled, “TOR Signaling Regulates Planarian Stem Cells and Controls Localized and Organismal Growth”.

Villas Scholarship, University of California Merced 2011. One scholarship provided on academic merit and sponsorship by a faculty advisor. Project entitled, “TOR Signaling Regulates Planarian Stem Cells and Controls Localized and Organismal Growth”.

Graduate and Research Council Summer Fellowship, University of California Merced 2010. One of fifty competitive fellowships provided campus wide out of 125 fellowship applications submitted by each graduate group to provide summer support. Project entitled, “Age related dynamics of committed T cell progenitors in mice”.

Presidential Scholarship, Ramapo College of New Jersey 1999-2003. I received full tuition fees, room, individual meals and books through the offered Presidential scholarship ~ $20000/year for 4 years.

AWARDS AND HONORS Developmental Biology Meeting, Santa Cruz, Poster competition 2012. One of three winners in the poster competition out of 110 posters in the same category. Poster title, “TOR signaling regulates planarian stem cells during tissue maintenance and regeneration”.

The Faculty-Student Research award, Ramapo College of NJ, 2003. One award in recognition of outstanding research contribution in collaboration with a faculty member.

Metropolitan Association of College and University Biologists conference, New York 2002. First place in Poster presentation. Poster title, “‘G’ rich Element Conserved in Human Pre-mRNA’s May be Involved in RNA Processing Site Selection.”

xxi

Metropolitan Association of College and University Biologists conference, New York 2002. First place in Poster presentation. Poster title, “Bioinformatics analysis of a conserved sequence found in 5' Cap and poly(A) regions of human pre-mRNAs”.

The Book Award, Ramapo College of NJ, 2002. One award in recognition of academic excellence.

POSTERS, PRESENTATIONS & CONFERENCE CHAIR POSITIONS

ORAL PRESENTATIONS

Discussion leader in Signals in growth control and metabolism - Gordon Science Conferences in Tissue Repair and Regeneration, New London, NH USA, June 16th – 21st 2013.

Discussion leader for panel discussion on career development - Gordon Science Seminars in Tissue Repair and Regeneration, New London, NH USA, June 15 – 16th 2013.

Stem Cells and Aging Symposium, Santa Cruz, CA, USA 2013. “Molecular regulation of cell proliferation and tissue repair along the anteropostior axis in the adult body”. Selected for oral presentation from submitted abstracts.

Gordon Science Conferences in Tissue Repair and Regeneration, New London, NH USA, 2011. “TOR signaling distinguishes regenerative from homeostatic stem cells in planaria.” Selected for oral presentation from submitted abstracts.

Fall Seminar Series, University of California Merced, CA USA, 2011. “TOR signaling distinguishes regenerative from homeostatic stem cells in planaria.” Invited talk.

Quantitative Systems Biology Spring Retreat, University of California Merced, CA USA, 2011. “Identification of Systemic Signals Regulating Stem Cells.” Selected for oral presentation from submitted abstracts.

Quantitative Systems Biology Spring Retreat, University of California Merced, CA USA, 2010. “Age related dynamics of committed T cell progenitors in mice.” Selected for oral presentation from submitted abstracts.

10th Annual UC System-wide Bioengineering Symposium, University of California, 2009. “Age related dynamics of committed T cell progenitors in mice.” Selected for oral presentation from submitted abstracts.

xxii

Quantitative Systems Biology Spring Retreat, University of California Merced, CA USA, 2009. “Age related dynamics of committed T cell progenitors in mice.” Selected for oral presentation.

POSTER PRESENTATIONS

T. Harshani Peiris, Udoka Ofoha, Paul Barghouth, Daniel Ramirez, Katie Wang, Emma Tkachuk, Manish Thiruvalluvan, Alexander Wilson-Fallon, Frank Weckerle, Elyse Ozamoto, and Néstor J. Oviedo. “Molecular regulation of cell proliferation and tissue repair along the anteropostior axis in the adult body”. Gordon Science Conferences in Tissue Repair and Regeneration, New London, NH USA, 2013.

T. Harshani Peiris, Udoka Ofoha, Paul Barghouth, Daniel Ramirez, Katie Wang, Emma Tkachuk, Manish Thiruvalluvan, Alexander Wilson-Fallon, Frank Weckerle, Elyse Ozamoto, and Néstor J. Oviedo. “Molecular regulation of cell proliferation and tissue repair along the anteropostior axis in the adult body”. Stem Cells and Aging Symposium, Santa Cruz, CA, USA, 2013.

Daniel Ramirez, T. Harshani Peiris, Emma Tkachuk, Paul Barghouth, Manish Thiruvalluvan, Frank Weckerle, Elyse Ozamoto, and Néstor J. Oviedo. “AKT regulates stem cell behavior during tissue renewal and regeneration in planarians”. Stem Cells and Aging Symposium, Santa Cruz, CA, USA, 2013.

T. Harshani Peiris, Frank Weckerle, Elyse Ozamoto, Daniel Ramirez, Devon Davidian, Marcos Garcia-Ojeda and Néstor J. Oviedo. “TOR signaling regulates planarian stem cells during tissue maintenance and regeneration”. Developmental Biology meeting, UC Santa Cruz, CA, USA, 2012. (Judged Winning poster Presentation).

Tatsiana Verstak, T. Harshani Peiris, Elyse Ozamoto, Frank Weckerke, Néstor J. Oviedo, PhD."The protein kinase AKT regulates stem cell behavior and cellular turnover in adult tissues". Undergraduate symposium, University of California Merced, CA, USA 2012.

Daniel Ramirez, T. Harshani Peiris, Elyse Ozamoto, Frank Weckerke, Néstor J. Oviedo, PhD. “Regional differences in stem cell proliferation are associated with repair of double- stranded DNA breaks by Rad51”. Undergraduate symposium, University of California Merced, CA, USA 2012.

T. Harshani Peiris, Frank Weckerle, Elyse Ozamoto, Daniel Ramirez, Devon Davidian, Marcos Garcia-Ojeda, and Nestor J. Oviedo. “TOR signaling distinguishes regenerative from homeostatic stem cells in planaria.” Gordon Science Conferences in Tissue Repair and Regeneration, New London, NH USA (2011).

xxiii

T. Harshani Peiris, Frank Weckerle, Elyse Ozamoto, Daniel Ramirez, Devon Davidian, Nestor J. Oviedo. “Identification of systemic signals regulating stem cells during tissue maintenance and regeneration”. Research week, University of California, Merced, 2011.

Tanuja Peiris, Jesús Ciriza, Mufadhal Al-Kuhlani, Ashley Graham, and Marcos García- Ojeda. "Age related dynamics of committed T cell progenitors in mice". The American Association of Immunologists, Inc. Journal of Immunology. April 2010.

Dancik, G., Peiris, T. H., Bandaranayake, R. and Bagga, P.S. “Prediction of Potential ‘G’-Rich elements near Processing Sites in Human pre-mRNAs”. RNA Processing Meeting of the RNA Society, Vienna, Austria, (2003)

Peiris, T. H., Weise-Riccardi, S., Bandaranayake, R. and Bagga, P.S. A. “‘G’ rich Element Conserved in Human Pre-mRNA’s May be Involved in RNA Processing Site Selection.” Presentation at annual MACUB conference, NY, USA. (2002) (Judged First Prize Winning Presentation).

Peiris, T. H., Moharita, A., Mimaryan, G., Johnson, M., Touleughian, M., and Bagga, P. “A ‘G’-rich sequence is conserved near RNA processing sites in human pre-mRNAs”. Presentation at annual Beyond Genome: Bioinformatics and Genome Research, San Diego, CA, USA. (2002)

Peiris, T. H., Weise-Riccardi, S., Bandaranayake, R. and Bagga, P.S. “Genomic Distribution of a Conserved ‘G’-Rich Element That May Be Involved In RNA- Processing Site Selection”. Presentation at annual Chemical and Biological Sciences Research Symposium, University of Maryland, Baltimore County, MD, USA. (2002)

Peiris, T. H., Moharita, A., Mimaryan, G., Johnson, M., Touleughian, M., and Bagga, P. “Distribution of A Conserved Sequence near RNA Processing Sites of Human Pre- mRNAs.” Annual Meeting of "American Association for Advancement of Science" (AAAS), Boston, MA, USA. (2002)

Mimaryan, G., Moharita, A., Peiris, T. H., Touleughian, M. and Bagga, P.S. “Bioinformatics analysis of a conserved sequence found in 5' Cap and poly(A) regions of human pre-mRNAs”. Annual MACUB conference. New Jersey, USA. (2001) (Judged First Prize Winning Presentation).

Barnes, K., Peiris, T. H., Yalamanchilli, R., Walter, J. and Bagga, P. S. A strategy for Site-specific mutagenesis of a human recombinant protein, DSEF-1, an auxiliary cleavage-polyadenylation factor. Annual MACUB conference. New York, USA. (2000)

xxiv

SYMPOSIUMS AND CHAIRING DUTIES Chair - Gordon Science Seminars in Tissue Repair and Regeneration, New London, NH USA, to be held in 2015.

Associate Chair - Gordon Science Seminars in Tissue Repair and Regeneration, New London, NH USA, June 15 – 16th 2013.

Discussion leader in Signals in growth control and metabolism - Gordon Science Conferences in Tissue Repair and Regeneration, New London, NH USA, June 16th – 21st 2013.

Discussion leader for panel discussion on career development - Gordon Science Seminars in Tissue Repair and Regeneration, New London, NH USA, June 15 – 16th 2013.

TEACHING & MENTORSHIP

STUDENT SUPERVISION IN RESEARCH I have trained students at masters and undergraduate level.

Daniel Ramirez, Masters student Fall 2012 - present, Undergraduate student Spring 2011-2012, University of California Merced. Udoka Ofoha, Masters student, Fall 2012 - present, University of California Merced. Paul Bargouth, Masters student Summer 2013 till present, Undergraduate student, Spring 2011-2013, University of California Merced. Emma Tkachuk, undergraduate student, Spring 2011 - present, University of California Merced. Carlos Gomez, Undergraduate student, Spring 2013 - present, University of California Merced. Salvador Rojas, Undergraduate student, Spring 2013 - present, University of California Merced. Camille Hassell, Undergraduate student, Fall 2013 - present. University of California Merced. Kristianne Amurao, Undergraduate student, Fall 2013 - present. University of California Merced. Manish Thiruvalluvan, Undergraduate student, Spring 2011-2013, University of California Merced. Michael Chow, undergraduate student, Spring 2011 - Spring 2013, University of California Merced. Katie Wang, Undergraduate student, Summer 2012-Spring 2013, University of California Merced. Alexander Wilson-Fallon, Undergraduate student, Fall 2012-Spring 2013, University of California Merced.

xxv

Tatsiana Verstak, Undergraduate student, Fall 2012-Spring 2012, University of California Merced. Ashley E Graham, Undergraduate student, Fall 2009-Spring 2010, University of California Merced.

TEACHING EXPERIENCES Classes taken towards proper conduct of teaching, University of California Merced QSB 201 – Teaching and Learning QSB 399 – University Teaching

University of California, Merced, Natural Sciences Department Course: Cancer Genetics and Tumor Biology Title: Teaching Fellow Semesters: Spring 2014, Spring 2013, Spring 2012 My main responsibility was to organize and run 3 discussions to emphasize lecture topics. I also undertook ~2 main lectures each semester. Duties included exam grading, developing a weekly quiz, holding office hours, and assisting students with presentations.

University of California, Merced, Natural Sciences Department Course: Cells Tissues and Organs Title: Teaching Fellow Semesters: Fall 2012 I undertook 4 Discussions per week and 2 main lectures through the semester. Other duties included exam grading, developing a weekly quiz, holding office hours, and assisting students with presentations.

University of California, Merced, Natural Sciences Department Establishing Laboratory Course Resources for “Introduction to Molecular Biology Lab” 2010. Title: Teaching Fellow My main responsibility was to establish protocols and set the ground work for this course. After establishing 14 protocols, I tested them individually and then wrote the protocols and arranged them into a booklet. This includes pre lab questions, protocols for the students to follow and a rubric to write a full lab report. This has since been established as course work material at University of California Merced.

University of California, Merced, Natural Sciences Department Course: Molecular Machinery of Life Title: Graduate Student Teaching Assistant Semesters: Summer 2010 My main responsibility was to organize and run two discussion and 2 laboratory sections per week. Other duties included grading, developing a weekly quiz, holding office hours, and assisting students with hands-on laboratory experience.

xxvi

University of California, Merced, Natural Sciences Department Course: Introduction to Molecular Biology Lab Title: Graduate Student Teaching Assistant Semesters: Spring 2010, Fall 2009, Summer 2009 My main responsibility was to organize and run two 2 laboratory sections per week. Other duties included grading, holding office hours, and assisting students with hands-on laboratory experience.

University of California, Merced, Natural Sciences Department Course: Contemporary Biology and Lab Title: Graduate Student Teaching Assistant Semesters: Spring 2009, Fall 2008 My main responsibility was to organize and run two discussion and 2 laboratory sections per week. Other duties included grading, developing a weekly quiz, holding office hours, and assisting students with hands-on laboratory experience.

Ramapo College of New Jersey, NJ, School of Theoretical and Applied Science Chemistry and Biology Title: Tutor Semesters: 1999 - 2003 My main responsibility was to assist students with related chemistry and Biology questions.

Upward Bound Program, New Jersey Chemistry and Biology Title: Instructor and Tutor Semesters: 2000 - 2003 Upward bound program targets highschool students from low-income families and provides support to prepare them for college level education. My main responsibility was to conduct Chemistry lectures for students during the weekends twice a month and assist students with related chemistry and Biology questions.

EMPLOYMENT HISTORY

University of California, Merced, Natural Sciences Department Teaching Fellow 2010 - present Graduate student Teaching Assistant 2008 - 2009

University of Pennsylvania, PA, School of Medicine Research Specialist, Gastroenterology division 2003-2007

xxvii

Ramapo College of New Jersey, School of Theoretical and Applied Science Research Assistant, Bioinformatics 2000-2003 Ramapo College of New Jersey, School of Theoretical and Applied Science Laboratory Assistant, Chemistry 2000-2002

Ramapo College of New Jersey, School of Theoretical and Applied Science Chemistry and Biology Tutor 1999-2003

PROFESSIONAL ORGANIZATIONS & MEMBERSHIPS 1. Member of American Association of Immunologists (2009 – 2010). 2. Member of the Sigma Xi scientific Research society, Ramapo College of NJ. (2001 – 2003) 3. Member of the Metropolitan College and University Biologies (MACUB) 4. Member of the Pre Med and Biology Clubs, Ramapo College of NJ. (1999 – 2003). 5. Member of the International student organization, Ramapo College of NJ. (1999 – 2003).

xxviii

Abstract

Stem cells (SCs) distributed along the body have the capability to divide upon physiological demand and further differentiate into specialized cells that repair injured tissues. Thus, understanding regulatory mechanisms that control SC behavior during tissue repair and physiological demand is crucial for biomedical applications. Here we perform analysis of SCs in vivo, during tissue regeneration and physiological cellular turnover by using the planarian flatworm, Schmidtea mediterranea. Planarians provide an excellent model to explore fundamental aspects of cell regulation in their natural environment during adult tissue maintenance, regeneration and repair. In particular, I analyze components of (1) the TOR (Target of Rapamycin) and AKT pathway: an evolutionary conserved signaling system that has been implicated in cell cycle progression, metabolism, protein synthesis and cell growth. (2) DNA repair mechanisms. I have identified homologs for members of these pathways and designed a strategies to study their function with RNA interference (RNAi). Obtained results indicate that the TOR and AKT signaling is involved with controlling systemic SC behavior and can participate in physiological cell turnover but are unable to form regenerative blastema upon damage. Uniquely, TOR-independent SCs are capable of repairing damage by remodeling pre-existing tissue, which does not require active cell proliferation. Regional differences in cellular proliferation, migration and tissue repair exist along the anteroposterior (AP) axis in vertebrate and invertebrate animals. Despite years of research, the basic mechanisms controlling cell division and tissue repair along the body remain poorly understood. Loss-of-function genetic approaches allowed to identify mechanisms controlling regional differences in cell proliferation along the planarian AP axis. These results suggest interplay between DNA repair mechanisms and tumor suppressor genes as capable of regulating cell behavior in specific areas of the adult body. Here I explored the possibility of controlling tissue regeneration and repair by exploring interactions between DNA double-strand break repair mechanisms through Rad51, and the tumor suppressors p53 and the retinoblastoma pathways. We hope to expand these results to understand stem cell-directed regeneration of particular tissues to enable the implementation of effective biomedical approaches.

xxix

Chapter 1

Stem Cells and their implications towards, cancer initiation, tissue repair and regeneration

1.1 – Introduction

Stem cells and history

Stem cells are unspecialized cells that have the capability to proliferate and differentiate into different types of cells that form various tissues. There has been much debate over who discovered stem cells. Though stem cell research gained its momentum around the 1990s, several dated articles from the 1800s imply that scientists probably knew the existence of a cell population that can divide and form new tissue. For example, Abraham Trembly in 1744 described hydra and their remarkable regenerative potential. He discovered that post amputation, the hydra are capable of fully regenerating the missing

Totipotent BLASTOCYST Pluripotent Stem Cell Stem Cell

Stem Cells that Stem Cells that forms Somatic Cells forms Germ Cells

Ectoderm Mesoderm Endoderm

Skin Immune system Liver Hair Muscle Intestine Bone

Figure1. 1 - – Stem Cells can divide and differentiate into various types of cells. Resulting fertilized eggs maintain totipotency. These totipotent stem cells divide and differentiate to form pluripotent stem cells that can derive somatic or germ stem cells. The Somatic stem cell population gives rise to the ectoderm, mesoderm and the endoderm that forms various tissue and organs.

1 tissue which is possibly attributed to the intrinsic cellular populations in hydra (Trembley 1744). Although he did not mention “stem cells” in his articles, the implications have earned him credits as the first to study stem cells. Pappenheim’s work published early as 1917 mentions lymphoidocytes which has now been recognized as the modern “stem cells”. Currently research in stem cells has peaked, due to the development of new technology and techniques, and the discovery of model organisms that can be utilized to study their intrinsic nature. These techniques and model organisms can be utilized to understand stem cell function and regulation. This knowledge can then be implemented towards advancing various biological concepts and therapeutical approaches.

1.2 - Stem Cell characterization

Stem cells are specific cells that are unspecialized and has the capability to proliferate and differentiate into various tissues. Stem cells can be characterized based on their potency, which is their ability to differentiate into other cell types. Based on this characterization stem cells could be totipotent, pluripotent and multipotent. Totipotent stem cells can divide ad differentiate to produce all the different cells in a living organism. Pluripotent stem cells will differentiate into cells that form the three germ layers: ectoderm, mesoderm, endoderm (Figure 1.1). Cells that are multipotent could differentiate into several types of cells, but not all types of cells in an organism, e.g, hematopoietic stem cells that divides and differentiates to form all immune cells.

Laboratories studying stem cells focuses on two types of stem cells: Embryonic stem cells (ESC) and somatic or adult stem cells (ASC). Embryonic stem cells are derived and isolated from the blastocyst of an organism. For example, human ESCs are derived from the inner cell mass of a 5-7 day old blastocyst [3]. These cells have the capability to generate the three germ cell layers, and hence are termed pluripotent stem cells. In laboratory settings ESC can be grown in vitro and addition of certain regulatory factors can induce them to differentiate into different types of adult cells including germ cells [4]. Theoretically, the isolated stem cells grown in vitro in labs are expected to maintain, extensive proliferative capabilities, a normal karyotype, derive into all three germ layers and contain telomerase activity[5]. However, maintaining all of the above functions in vitro has been challenging, foreshadowing progress in in vitro based stem cell research.

Adult stem cells are cells derived from adult organisms and could be either pluripotent or multipotent. Mostly these cells are tissue based, for example: hematopoietic stem cells which maintains all the cells in the immune system [6], liver oval cells that help the liver regenerate and form missing liver tissue [7]. However the quantity and turnover rate of most adult stem cells in mammalian systems are low, example: Mouse liver oval cells are low in numbers and a liver cell has a cell turnover rate of 200+ days [8]. Therefore, model organism with large stem cell pools and higher cellular turnover is gaining much interest and demand in stem cell research fields. Several model organisms such as planarians have garnered attention due to the large pool of stem cells termed neoblasts

2 spread across the system. Unlike most other species these neoblasts divide rapidly during systemic homeostasis and contribute to the planarian remarkable tissue repair and regeneration capabilities [9].

1.3 - Stem cell division theory

Stem cell division is proposed to occur symmetrically or asymmetrically [10]. Asymmetric cell proliferation results in two cells that are phenotypically different from each other, whether based on genetic makeup or their functionality. One daughter cell will differentiate to maintain the target tissue population and while the other cell will preserve the mother stem cell properties to maintain the self-renewing population. Recent studies have provided two hypothesis regarding the types of division: cytoplasmic asymmetric division and extrinsic asymmetric division. During cytoplasmic asymmetric division, the cell could divide with different cytoplasmic compartments rendering the two daughter cells phenotypically and functionally different. Extrinsic asymmetric division initially results in two identical daughter cells and could acquire the same structure, but due to the microenvironment and specific signals generated, the cells could result in performing two different functions [11]. This theory applies well for adult stem cell divisions, however

Figure 1. 2 – Stem Cell Division theory. Cells can divide using symmetric or asymmetric cell division. Depending on the environment from the niche or the system, asymmetric division could impose cytoplasmic asymmetric cell division or extrinsic asymmetric cell division.

3 cannot be used to explain embryonic stem cell divisions. This could suggest that adult stem cells might recapitulate asymmetric stem cell division, while the embryonic stem cells the symmetric cell division [12]. Further, embryos could also use a type of asymmetric cell division which results in cells that maintain proliferative ability while maintaining a differentiated population.

Symmetric division can provide the divided cells the plasticity to divide again or differentiate. This process will aid cell development, promote regeneration. Thus a stem cell can divide to form two stem cells or two cells that will differentiate. However emerging evidence provides that symmetrically divided stem cells have the capacity to form tumors and an enhanced capability for tumorigenesis. Thus the suggestion or the possibility that symmetric cell division is the precondition for tumor transformation has gained some attention [11]. Stem cells grown in vitro can recapitulate embryonic and adult tissue development. This renders them a good method to be used for tissue repair and regeneration based therapies. However, before we utilize stem cells towards therapeutic approaches, we need to thoroughly explore and understand stem cell structure and function in vivo. The studies should be expanded to involve stem cell regulation during maintenance of homeostasis, repair and regeneration, aging and development. In order to understand how stem cells are regulated we require better and advanced techniques and model organisms.

1.4 - Stem cells and cancer

Stem cells that have mutated to create an oncogenic environment are described as cancer stem cells. It is believed that these cancer stem cells have the capability to create and maintain tumors. Analysis have demonstrated that tumors contain a heterogeneous cell population. Cancer stem cell theory illustrate that once a stem cell has mutated, it could divide and differentiate into different cellular populations that will promote the maintenance and growth of the tumor. Apart from the cancer stem cells, normal cells can also migrate towards the tumor to help the maintenance and growth. Thus these cells within the tumors can contain different phenotypes and functions, creating a heterogeneous environment within the tumor (park et al 1971). Two tumor models were suggested to explain the heterogeneity: stochastic model and the hierarchy model. Stochastic model based tumor cells will be biologically similar, however they can be influenced by various cell intrinsic and extrinsic factors that can convey variability. This implicates the tumor environment as a combination of cells with differential phenotypes. Hierarchy model in contrast implies that there are specific sub sets of cell populations that have different biological structures and functions within the tumor. Only a few cells within this tumor has the true cancer causing potential, while the other cells will aid the tumor cell growth.

Adults stem cells usually are slow cycling group of cells (ex. Hematopoietic stem cells). The low cycling rate will reduce the accumulation of mutations. However if the stem cells mutates due to various extrinsic and intrinsic insults to the DNA, capable DNA repair mechanisms could be activated to repair the damage. If the cell cannot be repaired, cell

4 death pathways could be activated to eliminate the mutated cells from the population. However cells could still mutate and accumulate (even at a lower frequency rate) damaged cells over time and these mutated stem cells could develop into cancer stem cells.

Stem cells are more prone to develop malignancies due to several reasons. Stem cells are long lived and can accumulate genotoxic effects faster than the differentiated shorter living cells. Once stem cells have been mutated they have the higher probability to cause cancer/tumors due to the fact they are longer lived, undifferentiated and has the capability to divide more.

1.5 - How do stem cells maintain wound repair and regeneration?

Wound healing and tissue repair requires damaged cells or tissue to be replaced and restored by new cells. Evidence based on human and mouse studies have not revealed encouraging outcomes in this field due to the lack of regenerative potential in these animals. However mammals are born with regenerative potential as seen by fetal wound healing capabilities.

Wound healing studies initially involved the addition of growth factors to the wound site [13]. However unlike model organisms and the laboratory derived mild wounds, chronic human wounds could not be repaired by exposure to growth factors [14]. Tissue engineering fields have provided novel therapeutic approaches to mediate wound repair and regeneration. These bioengineered grafts were constructed under the assumption that the grafted tissue could integrate and adapt to the host organism. For this purpose the microenvironment of the wound should accept the graft and connect with a myriad of signals that should be generated between the grafted donor tissue and the host tissue. However these approaches encountered several problems: (1) The immune system responds in response to damage and creates inflammatory responses which slows the repair process (2) Rejection of the grafted tissue (3) Grafted tissue could be involved with signals generated from the microenvironment or the whole system. These issues created many errors that marred our understanding regarding tissue repair and regeneration and possible therapeutic approaches. However some progress have been made where certain bioengineering therapies [15, 16]

Rejuvenation in this field was garnered after the implications of stem cells providing new hope. Studies in model organisms such as the planaria reveal the potential of stem cells to heal and repair and regenerate wounds. Since then implication and usage of stem cells as a potential therapy to heal, repair damaged tissue garnered much attention in the past few years. With gathering knowledge generated from model organisms with remarkable regenerative potential, the field of wound healing, tissue repair and regeneration has moved forward into the 21st century. The most attractive stem cell population towards repair and regeneration were embryonic stem cells which created some controversies based on ethical issues. However generation of induced pluripotent stem cells

(iPS) by Takahashi et al in 2007 has revitalized this field providing new hope. Whether these iPS cells contains true embryonic structure and potential is still under investigation. On one line of investigation, researchers discovered that iPS cells could cause teratomas even more efficiently than ESCs in vivo [17] implying that there are differences between iPS cells and ESCs. However these cells have garnered much attention as an attractive model for wound repair, tissue repair and regeneration.

Though iPS cells and the current advances in stem cell studies are providing attractive models and applications for tissue repair, regeneration and several other disease status, how these stem cells will be regulated in vivo, in the complexity of a live organism has not been elucidated yet. This is a fundamental aspect to study and understand before designing and therapeutic approaches. Knowledge in this area will help us to understand and create better iPS cells that functions to repair and regenerate without forming teratomas.

1.6 - Stem Cells and maintenance of tissue homeostasis

Homeostasis can be defined as the capability or attempt to maintain stability within multi-cellular beings. During tissue homeostasis, the cells will either divide or go through programmed cell death in order to maintain stability within the organ/tissue. Due to growth, various physiological activities and stress, cells will divide as an attempt to replace missing tissue. Further older differentiated cells or damaged cells will be eliminated via apoptosis. This process of cell division and death can be termed cellular turnover. It is estimated that an average adult will eliminate about 50 billion cells and these cells will be replaced by the underlying stem cell populations belonging to each organ/tissue [18]. The rate of cellular turnover is different in various tissue. In an average adult the intestinal epithelium renews within about 5 days while the lung epithelium renews completely within about 6 months [19]. This differences in cell turnover could be based on stress, physiological conditions and age. How mammalian systems maintain homeostasis and differential turnover during normal, stressed, physiologically challenged, aged systems remains to be elucidated and is a big debate in the field.

In order for cellular turnover to occur stem cells needs to divide, and properly differentiate to replace the particular missing cell. Based on the asymmetric stem cell division theory, one of the two daughter cells will maintain stem like structure and function, while one stem cell will divide completely. The decision for a cell to maintain stemness or differentiate is based on several regulatory pathways. This requires the activation and repression of specific pathways that maintain decisions to divide or differentiate [20]. Thus once a stem cell divides there are 3 distinct cell fate switches observed. Switch 1 maintains one stem like cell while the other cell is programmed for differentiation. The second switch is maintained to transiently amplify the division of the cells while the third switch decides to terminally differentiate the cell to maintain cell turnover. Proper regulatory pathways that activate set of genes that help to differentiate into a particular cell type A, and not cell

6 type B and C. The differentiation potentiality towards B and C is stopped by the recruitment of repressors that will mediate this particular step (Fig 2) [20]. Thus in order to understand tissue homeostasis it is necessary to understand the activators and the suppressors. This will also change depending on the microenvironment or the niche that the stem cells reside and other environmental and intrinsic factors.

In this particular study I attempt to understand cellular turnover in vivo in the complexity of the whole organism. Mammalian systems poses a distraction due to the fact that there are complex organs and tissue with different cellular turnover. Moreover each tissue type contains few stem cells that are harder to isolate and manipulate. Thus by using the model organism planaria that contains a pool of stem cells and high cellular turnover, I will attempt to understand and deduce in vivo regulation of stem cells and cell turnover.

My studies will revolve around two main pathways (1) TOR/AKT pathway (2) DNA repair mechanisms. Disruption of both these pathways have been implicated with cancer initiation, aging and defects in normal homeostasis. Embryonic lethality has minimized our understanding regarding this pathways in most mammalian models, and therefore I will try to decipher molecules in each pathway and how they are involved with maintaining in vivo homeostasis, tissue repair and regeneration utilizing planaria as a model organism.

Chapter 2

Planaria as a model organism to study in vivo stem cell regulation

2.1 – Planaria as a model organism

In all living organisms cellular function is coordinated through signaling pathways. These cellular signaling pathways are then responsible for integrating local and systemic signals critical for embryonic development, adult tissue maintenance, and repair. Moreover, the origin of many diseases ranging from cancer to degenerative malignancies is associated with deregulation of diverse signaling pathways. However, how signaling pathways coordinate systemic cell behavior is poorly understood. One of the main limitations is the lack of model systems in which systemic modulation by cellular signaling pathways can be explored in vivo. Another limiting factor is the lack of techniques and methods to access stem cells and their behavior at a systemic level. In particular, stem cells (SCs) are a group of cells found within multi-cellular organisms that have the capability to divide and support physiological needs of all tissues, as well as to generate cellular progeny able to repair tissue damage [21, 22]. Indeed, one of the most puzzling problems of modern biology and medicine is to understand systemic regulation of SCs in health and disease. Dissecting the molecular basis of SC regulation in vivo will provide new targets for developing novel treatments for degenerative diseases, cancer and other ailments. Furthermore, it will open new therapeutic approaches to correct developmental malformations and to induce regeneration of lost, damaged and aging parts.

A caveat for the progression of studies is the lack of research conducted in vivo in the complexity of the whole organism. This is mainly due to the lack of good model organism. Studies in mice and rats are favored mainly due to the fact that their genome shares 95% similarities with human. Further the anatomy and the physiology has much resemblance to human, but with a shorter lifespan. Due to these reasons rodents are powerful tools to model various pathological conditions and cellular and physiological phenomenon while facilitating efficient and accelerated results applicable to human conditions. Compared to the studies conducted using primates, mouse and rat research can be relatively cost effective and requires less time and space. However, with the increasing costs for particular techniques and the charges incurred for housing rodents in research facilities, studies in mice and rats can be costly. Further each research requires IACUC approval before a study can be performed and this procedure can be lengthy in certain situations. Although rodents possess many similarities to human conditions, studying physiological conditions or pathologies in vivo in the complexity of the whole organism can pose some problems. For example, certain genes are embryonically lethal and conditional knockdown still does not provide a natural pathology free environment to understand the behavior of signaling pathways and disease progression.

Fruit flies (Drosophila melanogaster) provide an attractive model system to study developmental and behavioral aspects that’s comparable to humans. These animals

8 maintain conserved signaling pathways that provides substantial information regarding fundamental biological processes. The advanced genetic and technical tools provide much efficient methods to understand intrinsic mechanisms which has contributed extensively to the molecular, cell and developmental biology. Fruit flies maintain an extensive stem cell population during development and several adult stem cell populations during adulthood gaining some attention from stem cell fields [23]. Germ line and somatic stem cell niches have provided valuable information regarding the intrinsic nature of these cells in vivo. However the stem cell population in adulthood is limited and thus provides a barrier during stem cell research.

In vitro stem cell research has contributed greatly to understand intrinsic factors that contribute towards stem cell maintenance and differentiation. However, how these cells behave in the complexity of the whole organism based on extrinsic and intrinsic factors such as DNA damage, aging, and metabolism provides a barrier to our understanding and cannot be directly used to invent therapeutic approaches. Thus in vivo model organisms are crucial to provide applicable insights. However in vivo results using current model organisms and targets can also sometimes be misleading when applied to humans. For example, flies and rodents have a relatively shorter life span than humans, and studies on how a therapeutic approach or a drug could affect a system long term can sometimes be misleading.

Caenorhabditis elegans (C. elgans) is a worm model that provides an excellent model to study development, physiology and aging. Therefore tools and techniques are been developed to thoroughly understand mechanisms and relate them to human conditions. C. elegans contain a self-renewing germ stem cells which has provided valuable insights into germ cell niche and cell renewal [24]. However the lack of a large pool of somatic stem cells limits some of their use. Zebrafish (Dano rerio) is a vertebrate freshwater fish that has provided valuable insights into development, genetics and disease. Genetic screens have portrayed their implications towards human diseases and targeted therapies [25]. Zebrafish has regenerative capacity and therefore stem cell research using this model organism has garnered much attention

Recent advances in research have brought freshwater planaria to the forefront of research focusing on tissue repair and regeneration. Large pools of Neoblasts or the planarian stem cells and their plasticity render these animals remarkable regenerative capabilities. Further there has been a recent boom in publications characterizing a plethora of planarian stem cell characteristics and tissue repair and regeneration. Abraham Trembley sometimes referred to as the father of Biology or the first scientist to study stem cells, first studied the hydra remarkable regenerative ability. The work published in 1744 characterized Hydra regenerative capacity. Within the same publication, Trembley also briefly characterized planarian regeneration. In 1814 J.G. Dalyell published “Observations on some interesting phaenomena in animal physiology exhibited by several species of planariae” which described the first planarian regeneration phenomena. He described planarian as “immortal under the edge of the knife”. Nobelaureate Thomas Hunt Morgan in 1901 published extensively on embryogenesis and regeneration and used planaria to

9 describe the regeneration phenomenon. But the concepts of development and regeneration requires more advancement in molecular and cellular biology concepts and associated techniques. Therefore planarian stem cells and their regeneration studies lay dormant for quite some time. Pubmed records classifies ~480 publications from 1925 – 1999 in the planaria field. The significance of the studies were enhanced with the finding of neoblasts and down regulation of genes using RNAi by A. Sanchez Alvarado and P. Newmark and later publications that was provided new technical methods such as whole worm labeling using various proliferative markers has gained this field much momentum. Therefore in a short time as 15 years there have been ~700 publications characterizing stem cell structure, function, tissue repair and regeneration and planarian physiology.

This chapter focuses on the uses of planaria as a model organism and what we can learn from the model organism towards understanding stem cell regulation, aging, systemic maintenance, tissue repair and regeneration. In my thesis I focus on the planaria to understand stem cell regulation during systemic homeostasis, DNA damage, and cancer. I also focus on systemic homeostasis based on cell proliferation and cell death. Using RNAi I have been able to down regulate genes and investigate the function of specific genes and how signaling pathways are regulated. Further I characterize several phenotypes that systemically developed by the compromisation of various pathways that regulates stem cells. These pathways control cancer, aging, metabolic functions, tissue repair and regeneration, and therefore my work might provide valuable insights into stem cell regulation and how different pathways impact stem cells in vivo in the complexity of the whole organism.

2.2 - Planaria Classification and physiology

Planarians are bilaterally symmetrical triploblasts and contain the 3 germ layers: ectoderm, mesoderm, endoderm. They are further characterized as protostomes, however their physiology does not agree with the normal characterization of the coelomates belonging to the protostome classification. Planarians are acoelomate since they lack a body cavity. The only cavity within the animals is the gut and therefore the planaria have a flat body, and hence the name flatworms and belong to the phylum Platyhelminthes. Under the phylum Platyhelminthes planaria are further classified into the class turbellaria which comprises the free living non parasitic flatworms. Planarian digestive system contains three branches and therefore these animals are further classified into the order triclads. Further they are classified into the family planariidae and the genus planaria. Hundreds of species have been discovered, however main focus has been given to the two species Schmidtea mediterranea and Dugesia Japonica due to their remarkable regenerative potential. Specifically in this thesis I focus on the species Schmidtea mediterranea. Hence any of the following terms “planaria” “flatworm” “worm” from now on will pertain to the species Schmidtea meditteranea.

Planaria are free-living, living mostly in fresh water or marine and like to live in dark shaded regions (nocturnal). They are usually predators or scavengers that feed on live or dead animals using the pharynx located at the ventral surface around the middle of their body. This same opening is used to excrete waste. The excretory system of the planaria contains flame cells connected by ciliated ducts involved with osmoregulation and removal of waste. Thus these cells function similar to a kidney. Because planarian have a high ratio of surface area to volume, their diffusion distances are short and allows them the usage of diffusion for respiration purposes. Thus they do not contain The Central nervous system (CNS) is a bio lobed ganglia in the anterior region of the animal and this divides into two long nerve cords that run towards the posterior region. This is located underneath the ventral body wall musculature [9]. The main sensory receptors in the planaria are the photoreceptors and chemoreceptors which are located anteriorly. They are projections of the cephalic ganglia and therefore the behavioral patterns are connected to the CNS [9]. Planarian photoreceptors contain rhabodometric photoreceptor neurons, pigment cells and an optic cup [26]. These photoreceptors sense light so that the animals can move away from it towards a darker region in a body of water. Due to the formation and location of the photoreceptors in the anterior region, the animals have a “cross eyed” look providing a unique cute cartoonish look. Sub epithelial glands produce mucus secretion. This is important for locomotion, protection, adhesion to substrates and capture prey [9]. The ventral surface of the animal contains cilia which has a 9+2 axoneme, and are crucial for the planaria locomotion. Planarian can either crawl or glide and uses the beating cilia and mucus to gain the gliding movement [27]. Recent bioinformatics analysis further provides evidence for an innate immune system in the planaria [28].

Freshwater planarians can reproduce sexually or asexually. Usually one species will contain only one mode of reproduction, though some species have known to be capable of switching from asexual to sexual under experimental conditions. Asexual reproduction compromise of transverse fission. During this process the worm will attach its tail to a substrate and then pull the anterior region away from the posterior region. During this process the worm will stretch until the fission occurs. Schmidtea mediterranea species which is the primary focus in the Oviedo lab in UC Merced contains a sexual and an asexual strain. All experiments in this thesis utilizes the asexual strain. The asexual strain reproduce using transverse fission and do not maintain any reproductive organs. Transverse fission occurs with the planarian stretching and becoming thinner and producing two fragments. These two fragments then regenerate the missing tissue. The sexual strain are hermaphrodites containing male and female gonads. However during sexual reproduction, cross fertilization between two worms occur.

2.3 - Planaria and regeneration and as an Emerging model systems to study stem cells

Planarians contains characteristic pools of stem cells termed neoblasts distributed throughout the body, except in the pharynx and the area in front of the photoreceptors [29]. These cells are small about 5-10µm in diameter with a large nucleus and a small cytoplasm

11 that contains few organelles and ribosomes [30, 31]. The current understanding describes neoblasts as the only cells that are capable of dividing [32]. This has been further proved due to the accumulation of neoblasts around the wounded or amputated region. Neoblasts are a heterogeneous population containing cells that were characterized based on their sensitivity to radiation and proliferative status: neoblasts (X1), early division progeny (X2), late division progeny (Xins) [33]. Recent studies have further characterized the neoblast population into sigma, zeta and gamma based on function and gene expression level [34]. Sigma neoblasts are wound responsive and is essential to maintain various tissue while the zeta neoblast population maintains epidermal tissue. Gamma neoblasts are a sub population of Sigma.

Neoblasts, the only proliferative cells in the planaria are abundant and are spread through the animal. The heterogeneity and the plasticity of the stem cells renders the remarkable capability to repair and regenerate. Amputation performed on any part of the body except the most anterior region of the animal will result in a fully regenerated animals within 7-14 days. Post amputation, two proliferative peaks are required to maintain proper regeneration and two cell death peaks at 4hour and 52 hour to maintain proper patterning of the tissue. With this knowledge at hand, and the development of RNA interference (RNAi) technique, has developed the planaria into a remarkable tool to identify how different pathways are involved with tissue repair and regeneration, cancer initiation, maintenance of homeostasis [28, 33, 35, 36]. Even though planarian stem cell studies are relatively novel, many techniques have been developed to promote the study of stem cell function and regulation. Some of these techniques are described in Chapter 3. The accessibility of a sequenced genome has revealed structural conservation and various studies have confirmed functional conservation. Furthermore, classical experiments have demonstrated that mammalian chemically-induced diseases such as cancer and degenerative pathologies can be modeled in these animals [37, 38]. This further highlights planaria as an attractive model organism to study not only stem cell function and regulation, but as a possible translational model organism for various pathologies.

Thus utilizing all the positive aspects of this model organism I delve into understanding how stem cells are regulated when (1) TOR/AKT pathway is impaired (2) when DNA damage repair pathways are impaired. TOR/AKT pathway mediates a signaling network that mediate cell proliferation, cell growth/differentiation, metabolic functions, tissue remodeling. Compromisation of DNA damage repair results in many pathological conditions such as cancer, aging and tissue degeneration. I will focus to understand how these pathways maintain tissue homeostasis, tissue repair and regeneration in vivo in the complexity of the whole organism utilizing various techniques described in chapter 3.

Chapter 3

Materials and Methods

Identification of homologs and Phylogenetic analysis Conserved homologs for the TOR pathway, DNA repair pathways and other signaling pathways were identified using the S. mediterranea database SmedDb (Sánchez Alvarado et al., 2002). Identified sequences was initiated a six frame translation using pfam and subsequently analyzed using HMMER search to confirm conservation. The sequences were further confirmed by Blastn, blastx, blastp and alignment tools (http://blast.ncbi.nlm.nih.gov/Blast.cgi). The identified sequences was aligned by CLUSTALW or T-Coffee software with sequences obtained using HomoloGene (http://www.ncbi.nlm.nih.gov/homologene). A predictive evolutionary model and phylogenetic tree was built using MEGA software (www.megasoftware.net).

Planarian Culture Planarian culture was maintained as previously described (Oviedo et al., 2008).

Cloning Cloning primers were synthesized to amplify a 400 – 650bp region of each identified gene. Extracted total RNA from asexual Schmidtea mediterranea was used to synthesize cDNA using Thermo Scientific verso cDNA kit (Cat#AB-1453/A). The amplified region was cloned using two methods. (1) Amplified cDNA fragment was TA cloned into pDrive vector (Qiagen pcr cloning kit Cat. # 231124) was subsequently transformed using Invitrogen TOP10 competent bacteria (Cat # C4040-06) and plasmid extracted (Qiagen Spin miniprep kit Cat # 27104) using ampicillin antibiotic selection (100 µg/ml). Restriction enzyme (RE) digestion by BamHI, XhoI or PstI resulted in a gel extracted (Qiagen Gel extraction kit Cat# 28704) fragment which was T4 ligated (Invitrogen Cat # 15224-017) between the T3 and T7 promoter region of the pBluescriptII SK(+) plasmid. Post transformation of the ligated substrate and selection through ampicillin antibiotic (100 µg/ml) and plasmid isolation, (2) Amplified cDNA fragment was TA cloned into pCR™2.1-TOPO® TA Vector (TOPO TA cloning kit Cat # 45-0030) and subsequently transformed and plasmids isolated with ampicillin antibiotic selection (100 µg/ml). T3 and T7 primers were used to amplify a secondary pcr product (Roche Cat# 04738225001) containing the cloned gene fragment using the following pcr conditions. This secondary pcr product was used to synthesize dsRNA or ISH probes.

Step Process Temperature Time Cycles 1 Denaturation 94°C 5 min Repeat step 1 - 1X 2 Denaturation 94°C 1 min Repeat step 2 – 30X Annealing 56.6°C 30 seconds Extension 72°C 30 seconds 3 Extension 72°C 10 minutes Repeat step 3 - 1X

dsRNA synthesis dsRNA was synthesized as previously described (Oviedo et al., 2008). Amplified T3 and T7 fragment (T3/T7 DNA) of the cloned gene was used to synthesize single stranded T3 and T7 separately using the following mixture: 4ul of the pcr product, 1X synthesis buffer (Promega Cat # P118B), 20mM DTT (Promega Cat # P117B), 4µl of equal micture of rNTPs (Promega P114A, P113A, P115A, P116A), 1µl T3 polymerase (Promega Cat # P208C) or 1µl of T7 polymerase (Promega Cat # P207B), 4µl of Rnase Dnase free water, 1µl of Recombinant RNasin® Ribonuclease Inhibitor (Promega Cat # N251A) were mixed and incubated at 37°C for 2 hours. 1µl of RQ1 RNase-Free DNase (cat # M610A) was added and incubated for 15 minutes at 37°C. 1 µl of the synthesized T3 and T7 mixtures were separately stored in -20°C. Rest of the T3 and T7 mixtures were combined and 380 µl of STOP solution (1M ammonium acetate, 10mM EDTA, 0.2% SDS) added and incubated at RT for 10 minutes. Post adding 200µl of Phenol chloroform, samples were vortexed 15 seconds each and centrifuged 2 minutes at 14000rpm. The top visible layer was extracted to a new tube and 200 µl of chloroform was added. Samples were vortexed for 15 seconds and centrifuged for 2 minutes at 14000rpm. Incubation at 68°C for 10 minutes was followed by a 30 minute incubation at 37°C. Samples were ethanol purified as follows: 1ml of 100% ethanol was added and centrifuged 10 minutes at 14000rpm, 4°C. The ethanol was carefully decanted and 1ml of 80% ethanol was added and centrifuged 10 minutes at 14000rpm, 4°C. All traces of ethanol was removed and samples were mixed with 10 µl of Rnase Dnase free water. The previously stored single stranded T3 and T7 sample and the synthesized double stranded samples were run on a 1% agarose gel.

Riboprobe synthesis dsRNA was synthesized as previously described (Oviedo et al., 2008). Amplified T3 and T7 fragment (T3/T7 DNA) of the cloned gene was used to synthesize single stranded T3 and T7 separately using the following mixture: 4ul of the pcr product, 1X synthesis buffer (Promega Cat # P118B), 20mM DTT (Promega Cat # P117B), 4µl of equal micture of rNTPs (Promega P114A, P113A, P115A, P116A), 1µl T3 polymerase (Promega Cat # P208C) or 1µl of T7 polymerase (Promega Cat # P207B), 4µl of Rnase Dnase free water, 1µl of Recombinant RNasin® Ribonuclease Inhibitor (Promega Cat # N251A) were mixed and incubated at 37°C for 2 hours. 1µl of RQ1 RNase-Free DNase (cat # M610A) was added and incubated for 15 minutes at 37°C. For ethanol precipitation 0.17M Lithium Chloride and 54 µl of ice cold 100% ethanol was added and the samples were places in the

-80°C for 15 minutes and centrifuged for 20 minutes at 14000rpm, 4°C. Post removal of the supernatant the pellet was re-suspended in 50 µl of deionized formamide.

Microinjections Microinjections were carried out as previously described (Oviedo et al., 2008). A protocol for each gene downregulation was optimized for each gene.

In vitro dsRNA synthesis In vitro dsRNA was synthesized as previously described (Rouhana et al, 2013). 1µg of the Rad51 specific dsRNA was mixed with 30µl of planaria food and was fed 3X times per week for 30 days.

RNAi by feeding RNAi by feeding was performed as previously described (Reddien et al., 2005). Genes cloned into pPR244 plasmids (kanamycin resistant) were transformed into HT115 bacteria (tetracyclin resistant) and grown overnight in 2xYT media with kanamycin (50µg/ml) and tetracyclin (10µg/ml). Aliquotes from the overnight cultures were freshly grown at a 1:10 dilution in 2xYT media with bacteria resistance until OD 0.4-0.6 at a 37°C shaker at 225rpm was reached. Bacteria were incubated with 1mM IPTG for an additional 2 hours at 37°C and 225rpm. Samples were spun down at 5000rpm for 5 minutes and the bacteria pellet was mixed with 50µl of planaria food (calf liver) and fed to the planaria. Prior to amputation, APC was fed 7X over a 2 week period to obtain double tailed animals. β-catenin was fed 3-4 times over a 8 day period and amputated to obtain double headed animals. β-catenin plasmid was a kind gift from Christian Petersen at Northwestern University, APC plasmid was a kind gift from Peter Reddien at MIT.

Whole mount Immunofluoresence Planarians were fixed and immunostaining performed as previously described (Oviedo et al., 2008). Planarians were fixed using the carnoy fixation method. 5 minute incubation in ice with 2.7ml HCl (Fisher Cat # A144-500) in 47.3ml of miliq-water was used to kill and remove the mucous layer of the planaria. Carnoy solution containing 60% denatured ethanol (Fisher Cat# 407-4), 30% chloroform (Sigma Cat# 366927), 10% glacial acetic acid(Fisher Cat# A38-500) was added and samples were incubated in ice for 2 hours. Post removal of Carnoy solution, ice cold 100% methanol was added and the samples were incubated in the -20°C for a minimum of 1 hour. Animals were bleached overnight with a mixture of 1ml H2O2 and 4ml of 100% methanol. The samples were rinsed in 100% methanol and stored at -20°C. During staining, the samples were rehydrated in the following order: 5 minutes 75% methanol in PBSTx (1X PBS with 0.3% Triton X-100), 5 minutes 50% methanol, 5 minutes 25% methanol, 5 minutes 100% PBSTx. Subsequently samples were blocked in PBSTB (0.25% BSA in PBSTx) for 4-6 hours RT. Primary antibody was added in PBSTB, RT overnight. Primary antibodies: α-H3p 1:250 (Millipore Cat# 05-817R), α-synapsin, 1:100 (Developmental Studies Hybridoma Bank): acetylated tubulin, 1:1000 (Sigma T7451): activated caspase-3, 1:1000 (Abcam ab13847): and α-

15 arrestin, 1:10,000 (kind gift from K. Watanabe, University of Hyogo, Japan). The animals were washed 6 X 60 minutes in PBSTB and secondary antibody was added in PBSTB, RT overnight. Secondary antibodies: Goat anti-mouse Alexa488, 1:400 (Invitrogen Cat# 673781) for α-synapsin, α-arrestin, acetylated tubulin, Goat anti-rabbit Alexa568, 1:800 (Invitrogen Cat# 11036) for H3P, HRP-conjugated Goat anti-rabbit antibody (Millipore Cat# 12-348) with TSA-Alexa568 anti-HRP for Caspase-3. The animals were washed 6 X 60 minutes in PBSTB and mounted using VECTASHIELD® Mounting Medium (Vector laboratories Cat# H-1000). All images were visualized and the mitotic cells (H3P positive) and apoptotic cells (Caspase positive) were counted and normalized to the area (mm2) using NIS element software (Nikon). Statistical analyses were performed using Microsoft Excel.

Brdu Staining Brdu staining was performed as previously described (Cowles et al, 2012). Mucous was removed by a 5 minute incubation with 0.0625% NAC (N-acetyl cysteine) and then the worms were incubated for 1 hour in the dark at RT in 25mg/ml Brdu (Sigma cat# B5002) dissolved in water and 3% DMSO. Worms were rinsed three times with planarian salt water and Brdu pulse chase performed for 12 – 16 hours. Animals were fixed using Carnoy fixation method described elsewhere and rehydrated as described elsewhere. Animals were incubated in 2N HCl for 45 minutes and later incubated in 0.1M Borax for 2 minutes. Post 2X PBSTx washes and 4 hour block in PBSTB Primary antibody was added: α-Brdu 1:100 (BD Biosciences #347580) in PBSTB was added fresh overnight at RT and next day washed 6 X 60 minutes with PBSTx. Samples were blocked for 1 hour RT in PBSTB and incubated in 1:250 HRP-conjugated Goat anti-mouse antibody (Invitrogen Cat# G21040) overnight. Samples were washed 6 X 60 minutes in PBSTB and incubated in 10mM imidazole in PBSTx (PBSTI) for 30 minutes RT and later in 1:1000 FITC-Tyramide in PBSTI for 30 minutes RT. Animals were developed with FITC- ® Tyramide in PBSTI+0.015% H2O2 and mounted using VECTASHIELD Mounting Medium.

Planaria Dissociation and cell collection Planarians were dissociated as previously described with slight modifications (Reddien et al., 2005). Planarians were amputated into small pieces in cold calcium, magnesium-free medium (CMF plus BSA) and then placed in a rocker for 30 minutes to 1 hour hours at 4°C. (CMF plus BSA: 15mM Hepes, 400mg/L NaH2PO4, 800mg/L NaCl, 1200mg/L KCl, 800mg/L NaHCO3, 240mg/L glucose, 1% BSA, pH7.3). Cells were filtered using a 20 micron filter and centrifuged at 1500 rpm and the collected cell pellet was suspended in 1ml of CMF media before cell counting.

Fixation of dissociated cells Dissociated cells were counted and all traces of CMF media were removed by two 1X PBS washes. Cells were fixed on to cover slips using 100% methanol for 1 hour at - 20°C. Samples were rehydrated using mixtures of 75%, 50% and 25% Methanol in PBSTx. Post final rehydration with 100% PBSTx, the cells were blocked in PBSTB for 4 hours RT

16 and primary antibody added overnight: α-Rad51 1:500 (Abcam ab109107). Wash 6 X 10mins in PBSTB and replace with secondary antibody overnight: 1:500 HRP-conjugated Goat anti-rabbit antibody (Millipore Cat# 12-348). Wash 6 X 10mins in PBSTB. Add TSA- Alexa488 in PBSTI 1:1000 for 20 minutes. Wash 6 X 10mins in PBSTB. Add DAPI (0.1ug/1mL) for 15mins and mounted using VECTASHIELD® Mounting Medium.

Protein extraction Animals were quickly dissociated with no buffer present until no tissue fragments were visible and incubated in 1X RIPA buffer (Cell signaling Cat# 9806) with protease inhibitors (Roche cocktail Cat# 04693124001, 1mM PMSF, 1mM DTT) for 30 minutes in ice. Volume to mass ratio for this was as follows: 10 large dissociated planaria were incubated in 300µl of 1X RIPA and protease cocktail mixture. Samples were spun at 14000 rpm for 15 minutes at 4°C. Transfer the supernatant to a new tube and immediately place on ice. 25µl of the supernatant was aliquoted into a tube for protein concentration readings. Rest was immediately mixed with equal volumes of 2X laemmli buffer (4% SDS, 10% 2- mercaptoethanol, 20% glycerol,0.004% bromophenol blue, 0.125 M Tris-HCl) and incubated at 95°C for 5 minutes (or boiled at 100°C) to denature and reduce. Protein lysates were stored at -20°C. Bio rad protein assay was used to determine protein concentration.

Western Blot 40ug of protein lysates were heated at 80°C for 5 minutes and run on 12.5 – 15% SDS-PAGE gel along with a molecular weight marker (Bio Rad Cat # 1610375). The gel was run 1 to 2 hours at 100V with 1X Running buffer. 30 second methanol activated PVDF transfer membrane (Bio Rad Cat # 162-0175) was used to transfer the gel extracts overnight in 1X transfer buffer at 40V in a cold room. The membrane was blocked with 5% milk 1 hour and incubated in the primary antibodies overnight at 4°C on a rocker. Primary antibody: α-tubulin 1:500 (Sigma 081M4861), α-Rad51 1:5000 (Abcam ab109107) and caspase 1:5000 (Abcam ab13847). The membrane was washed 3X 30 minutes prior to the addition of the secondary antibody: 1:2000 HRP-conjugated Goat anti-rabbit antibody (Millipore Cat# 12-348) for α-Rad51and Caspase, 1:2000 HRP-conjugated Goat anti- mouse antibody (Invitrogen Cat# G21040). The membrane was washed 3X 30 minutes each and developed using Luminata Forte Western HRP substrate (Millipore Cat # WBLUF0100).

Flow Cytometry analysis 1X106 cells from dissociated planaria was stained with DNA marker Draq5 (eBioscience Cat # 65-0880-96) at a 1:500 dilution in CMF media for 30 minutes at RT in the dark. Incubation with calcein (Invitrogen Cat # C3100MP) 1:500 diluted in CMF media for 10 minutes at RT was sufficient to stain live cells. BD FACSDiva™ software was used for initial gating and samples were either analyzed using LSRII flow cytometer (BD Biosciences) or sorted using ARIAII flow cytometer (BD Biosciences). Lethally irradiated planaria were used to approximate the gates for X1 and X2 populations and/or gated as previously described (Eissenhoffer et al 2008). Final gating of populations were performed

17 using flow jo software. Cell populations were sorted into FBS media and centrifuged to pellet the cells. Post FBS removal cells were either used fixed on slides using 4% paraformaldehyde for 20 minutes RT or immersed in trizol to extract RNA. Cell cycle analysis was performed using either Draq5 (1:500 diluted in CMF media ) or DAPI (0.1ug/ml). Draq5 stained populations were gated for cell cycle using live Draq5 positive populations and Flowjo software. During DAPI staining, 70% ethanol fixed cells (as previously described) was stained with DAPI 0.1ug/ml for 30 minutes at RT in the dark and analyzed immediately using LSRII. Flow cytometry analyses were performed with FlowJo software, Version 8 (www.flowjo.com). Staining of apoptotic cells were performed using 1X105 cells from dissociated planaria immersed in 100ul of binding buffer (Bio Legend Cat# 422201) and stained with 5ul of Annexin V (Pacific Blue) (Bio Legend Cat# 640918) and 5ul of 7-AAD Viability staining solution (PECy5) (Bio Legend Cat#420404) and incubated at RT for 15 minutes. The samples were immediately analyzed using LSRII flow cytometer (BD Biosciences).

TUNEL Assay TUNEL assay was performed as previously described (Pellettieri et al., 2010). 5 minute incubation at RT with 10% NAC diluted in 1X PBS was used to kill and remove the mucous layer of the planaria. Fixation with 4% formaldehyde in PBSTx (1X PBS with 0.3% Triton X-100) for 20 minutes at RT was followed by incubation with 1% SDS diluted in 1X PBS for 20 minutes RT. Animals were bleached overnight with a mixture of 1ml H2O2 and 4ml of PBSTx and rinsed and stored at 4C in PBSTx the next day. The animals were not stored in the 4°C for more than a week. Staining was performed using The ApopTag Red In Situ Apoptosis Detection Kit (Millipore Cat# S7165), where animals were inserted into a 96 well plate with only 2 animals per well. 20µl of the mixture containing 70% of the reaction buffer and 30% of the terminal transferase enzyme was added to each well and incubated at 37°C for 4 hours. The animals were rinsed in stop/wash buffer (1ml stop wash buffer mixed with 34ml MiliQ water) and rinsed 1X with PBSTB (0.25% BSA in PBSTx). 20µl of the mixture containing 47% anti-digoxigenin-rhodamine antibody and 53% blocking solution was added to each well and incubated in the dark at RT for 4 hours or at 4°C overnight. The animals were washed 4 X 10 minutes in PBSTB and mounted using VECTASHIELD® Mounting Medium.

Measurements of planaria and image processing Measurements and image processing was performed as previously described (Peiris et al., 2012). Animal behavior was recorded using a Nikon AZ-100 multizoom microscope and NIS Elements AR 3.2 software. Automated area measurements were calculated with NIS Elements at day 0, day 20 and day 40 after injection. Standard deviations were obtained by normalizing the area measurements for each set time point to the average on day 0 to obtain percentage standard deviation and this value was divided by the data point to calculate the standard error represented on the graph. Digital pictures were collected using a Nikon AZ-100 multizoom microscope and NIS Elements AR 3.2 software. Brightness and contrast were adjusted with Adobe Photoshop.

RNA Extraction FACS sorted cells or whole planaria were immersed in 750ul of TriZol and homogenized for 1 minute and incubated at RT for 5 minutes. 200ul of chloroform (per 750µl of TriZol added) was added and vortexed for 15 seconds and incubated at RT for 3 minutes. Samples were spun at 11000rpm at 4°C for 15 minutes and the clear upper layer was transferred to a new tube. 500µl of isopropanol was added to the tube and incubated at RT for 10 minutes and centrifuged 11000rpm at 4°C for 15 minutes. The pellet was then washed with 1ml of 75% ice cold ethanol and centrifuged 7500rpm at 4C for 5 minutes. All traces of ethanol was removed and depending on the pellet size,10-50µl of Dnase Rnase free water was used to mix the pellet. Samples were incubated at -80°C freezer long term. cDNA synthesis 1µg of the extracted RNA (from section) was incubated with the following reagents from cDNA synthesis kit (cat# ): 1X cDNA synthesis buffer, 2µl dnTP mix, 1ul of RNA primer, 1µl of RT enhancer, 1µl of Verso enzyme mix and Rnase Dnase free water up to 20µul total volume. The samples were incubated 42°C for 30 minutes and 95°C for 2 minutes.

Quantitative RT-PCR Quantitative RT-PCR (qPCR) was performed as previously described (Peiris et al., 2012). qPCR reactions were performed using the SYBR Green Master Mix (cat #) in a 7500 Fast Real Time PCR cycler (Applied Biosystems). All reactions were performed in triplicates using the median cycle threshold value for analysis. Gene expressions are relative to the ubiquitously expressed clone H.55.12e (Reddien et al., 2005). Each cDNA sample was amplified with clone H.55.12e and a standard curve was obtained. The expression of each sample was now obtained based on the relative expression of the clone H.55.12e.

In situ hybridization (ISH) ISH on isolated cells and quantification were performed as previously described (Oviedo et al., 2008). Whole-mount ISH (WISH) was performed as previously described (Pearson et al., 2009). For ISH on dissociated cells, isolated cells from FACS were spotted onto slides and fixed using 4% paraformaldehyde. ISH was performed as previously described (Oviedo et al., 2008). Propidium iodide (PI) or DAPI were used to stain nuclei. Cells that were double labeled with the nuclei marker and the riboprobe were counted in relationship with the total number of nuclei. Fluorescent in situ hybridization was performed as previously described (Pearson et al., 2009). In all cases, ten different fields were counted per slide.

Comet Assay Frosted microscope slides were coated with 1% Normal Melting Point Agarose (NMPA) in 10XPBS and dried overnight. Add 10mL of CMF onto the dissociated cell pellet and incubate cells in 37°C water bath for two hours. Count cells and centrifuge tube at 2500rpm for 2 minutes and add 100µL of 0.5% Low Melting Point Agarose (0.5%

LMPA) made in 10XPBS per 50,000 cells. Quickly pipette mixture onto coated 1%NMPA dried slides, cover with a cover slip (24x50mm) and let dry at 4°C until agarose solidifies. Gently remove the cover slip and place slides overnight in a coplin jar at 4°C with 89% Lysing solution (2.5M Nacl, 100mM EDTA, 10mM Trizma base, 8g pelletized NaOH in dH2O, filter and pH 10.0), 10% DMSO and 1% Triton x-100. Replace the coplin jar with neutralization buffer (0.4M Tris base in dH2O and adjust pH to 7.5) for 5mins and keep solutions and samples at 4°C. Remove the neutralization buffer and place slides into electrophoresis chamber at 4°C. Fill chamber with 1X electrophoresis buffer (10N NaOH and 200mM EDTA in dH2O and adjust pH to 13) and let sample sit for 15 minutes without electrical current. Run the electrophoresis machine at 12V for 30 minutes at 4°C. Place slides back into the coplin jar and equilibrate samples for 5 minutes in neutralization buffer. Remove buffer and fix samples with cold 100% ethanol for 5 minutes. Once slides are dry, stain samples with 1:10 ratio of SYBR gold into 1X TE buffer (10mM Tris-HCl and 1mM EDTA and adjust pH to 7.5) by placing 150-200µL of solution onto sample and covering with a cover slip (24x50mm). Scoring scheme is based off of a rank from 0-2, where a score of 0 showed little DNA damage and 2 is a disbursed tail indicating extensive DNA damage.

Karyotyping Assay Soak animals in 0.05% Colchicine (diluted in planarian salt water) overnight but no greater than 16 hours. Place one animal per 1.5mL tubes and remove colchicine solution. Add ethanol and acetic Acid Solution (3:1 respectively) to each tube and rotate for 15 minutes at RT. Remove the Ethanol/Acetic acid solution and place 1N HCl solution (in dH2O) and incubate for 2 minutes at RT and then incubate at 60°C in a Thermomixer for 6 minutes. Remove the HCl solution and add orcein solution to each tube for 15 minutes. Carefully remove orcein solution and replace with 60% acetic acid solution (in dH2O) and incubate for 5 minutes. Place animals on small 22x22mm cover slips and add a drop of Lactic acid-acetic acid-dH2O (1:1:1) on top of each worm and let it sit for 5 minutes. Remove excess liquid and add 1µL of orcein to each animal. Place a long cover slip (24x60) quickly and carefully on the small cover slip with the treated animal on it. Chromosomes were viewed under a 100X objective.

Oligonucleotides All oligonucleotides were synthesized and desalted by Fisher Scientific eurofins: All primers were diluted to a 40 picomole concentration prior to use. 0.625ul from each primer was utilized per each pcr reaction.

Oligos Used for cloning Gene Cloned Forward Primer Reverse Primer size Rad51 436 TTTGCAAGGTGGTGTTGAAA ATCAGCCAACCGTAACAAGG Ku70 410 AGGCATGAAATTGGACGAAG CGACTAGGAGGAGGTGATCG MRE11 428 GCATGCAGCGAAGAATTACA ATCGGATCAATGGCAAAGTC ATM 481 GGTTTTGCTTCACGATCCAT ATCGCAGAAACCAGAGCAGT Rb 531 ATGGCGGAGTCAATTTCAAC GCAATTCGAGAACCTCAAGC

P53 516 CCTGCTTTTAAATCCGACGA AAGTGTTTTCCGACCACCTG BRCA2 570 ACGATTTACCACCCGAATCA CGTGAACGTGTCAACAAACC RPA 545 GAATCGGACGTCCATGAGAT GCGGCTGAAATGGAGAAATA ndk 652 GAAATTAACGAAGCCCGTCA TCCCTTTTCACTTTCCATCG

Oligos used for qpcr Gene Size Forward Primer Reverse Primer Rad51 141 ATGTCAGAATCCCGATACGC ATCAGCCAACCGTAACAAGG Ku70 125 TAGTTGGCATTGGGATCCAT CAGATTTGTGCTGCCTTCAA MRE11 133 GCTGGCAACGACTAAGGAAC CCCGATATATTCCTGGCTGA ATM 128 CTGATTGGTCGGCTTTCATT AGCTAACCAATCCCCCAAAG Rb 142 CCACGAGATCCTCCAAATGT CGTGTGAACATTGGTTTTGC BRCA2 143 CAAAGAGACCCTGCTTGAGG AGCCGGAACACAGTACCATC RPA 114 TCCGACGAGATAGGGTTGTC CAGCCTTTTCCGTTTCACAT ATR 141 AAACTTTGGAGTGGCCAGAA GTTCGATTTCATTGCGGAGT UDP 152 TTCCTACAGCCACTTGAGCGAC GTCGGTGGTTATTTTGCG Smedwi-1 174 TTTATCGTGACGGTGTTGGA TTGGATTAGCCCCATCTTTG Smedwi-2 142 ATCCTATGGCACCGAATGAG CCCTTATGCACCTTTCCAAC NB.21.11e 148 GCAGATGACGTGAAACAAGG TACTTGATTTGGCGGGAGAC Agat-1 131 ACCGATTCCAGTTTCGCTTA TCAATCGCTCCAAAATCTCA Cyclin B 162 TCGGGAAATAGTTCGAATGC CCAAGGACATCGCAGAAAAT Soxp-1 114 TGGTTGGACGTCGCCTTCTT ACCCATTACCTCCTGAATGGCT

Fgfr-1 101 CGGCATCCAATAAGTGCGCT TGTCAGTTTCAGTGGGAACTCC A Soxp-2 104 CTTCCCAAGAAGTTTGCTTATT GGCCATTGAATAGTTTCATGAT TCTGA ATTTTCCA Inx13 113 AAACGGAATCCATTGGTAATA GCTGGGTTGAAGGCACTGTT ATTCATTCT Nkx2.2 112 TCGCCAAATTATGCTCAGATTG CGATTTCTTGTTCACTGGAATT ATCC CGGA Zfp-1 115 CCCGTGCCTGAACAATTTGACA CCTCAGCGCATGCCTCTGTA

P53 117 TGGTTGCATTGCATCGGAACA GGCCCAGCAATATATTACTTCG GC Soxp-3 114 TGTGGTTGGAATTTTTCACTGA ACCTGTGCAGACAATTCGAAG TTTCT A

Chapter 4

TOR signaling regulates planarian stem cells and controls localized and organismal growth

4.1 - Introduction

4.1.1 - Target of Rapamycin Structure

Soil sample analysis from Easter Island (Rapa Nui) identified a bacteria (Streptomyces hygroscopicus) that was able to produce a potent antifungal molecule. Purification and structural analysis of this molecule revealed a macrolide lactone. Thus this molecule was named “Rapamycin” based on the name of the island where it was discovered. Characterization of this molecule discovered potent anti-bacterial and fungal properties and immunosuppressive roles [39, 40]. However Rapamycin gained more attention after Dr. Suren Sehgal in Canada discovered its tumor suppressive roles [41, 42]. Studies performed to identify the antifungal effects of this macrolide rapamycin illustrate the possible G1 phase cell cycle arrest in Saccharomyces cerevisea [43]. This lead to the discovery of a protein targeted by rapamycin, and this protein was termed target of rapamycin (TOR) due to its sensitivity to rapamycin. Evolutionary studies have confirmed that TOR is a conserved kinase found across fungi, animals and plants [44-46]. TOR kinase complexes with other proteins and form TORC1 and TORC2 in the mammalian systems and these complexes retain different and specific functions within a cell [47].

Figure 4. 1 – Target of Rapamycin Structure mTOR is a large protein kinase with an N terminus that contains HEAT repeats (tandem repeats of Huntington, elongation factor 3, regulatory A subunit of protein phosphatase 2A, and TOR1). FAT (FRAP, ATM and TRRAP) domain mediates its protein interactions and the C-terminal FATC domain (FAT C terminal) is known to be involved with mediating protein interactions and mTOR degradation. Rapamycin- FKBP12 complex binds to the FRB domain (FKBP12-rapamycin-binding) to mediate inhibitory effects on mTOR. The kinase domain of mTOR is found at the C-terminal region and mediates catalytic activities.

mTOR (mechanistic target of rapamycin) is a large protein and contains a molecular weight of 289kDa. Preliminary analysis showed that TOR proteins across species contain ~ 40-60% identities (Fig 4.1) [48]. TOR belongs to the members of the phosphoinositide- 3-kinase-related serine threonine protein kinase (PIKK) family of proteins. This family is primarily involved with DNA damage repair and nutrient sensing [49]. TOR structure consists of HEAT (Huntington elongation factor 3, alpha-regulatory subunit of protein phosphatase 2A and TOR1) repeats, a FAT domain ( belonging to FRAP-ATM-TRAAP family) domain, a FRB domain (FKBP12-rapamycin binding), a kinase domain and a FATC domain [50] (Figure 4.1). These domains confer specific functions necessary for its regulatory and functional properties. mTOR contains several HEAT repeats which is found in several members of the PIKK family of proteins. These repeats have been linked with cytoplasmic transport and vesicle trafficking [51]. Human mTOR is predicted to contain 40-45 heat repeats. Also present in the PIKK family of proteins is a FAT domain known to be important for protein-protein interactions [52]. At the further most C terminal region is a FATC domain usually found in proteins containing a FAT domain. This region has been connected to regulatory functions involving protein interactions and degradation of mTOR [53, 54]. The kinase domain of mTOR protein resembles the kinase domain of PI3K (phosphatidylinositol 3-kinase) and is confers catalytical functions to the protein. The FRB domain is the rapamycin binding domain of TOR. Rapamycin complexes with FKBP12

Figure 4. 2 – Mammalian TORC1 and TORC2 complexes. Mammalian TORC1 and TORC2 complexes retain different functions but can be activated by nutrients and growth factors. TORC1 and TORC2 complexes both share mlST8. TORC1 complex specifically binds Raptor and Pras40 and is sensitive to Rapamycin. TORC2 complex binds Rictor and Sin1.

23 and binds to the FRB domain of mTOR via FKBP. The binding of FKBP–rapamycin complex is 2000 fold stronger than rapamycin binding to FRB domain alone [55]. The FKBP-Rapamycin complex binding to TOR prevents the binding of Raptor to TOR, thereby inhibiting the formation of the TORC1 complex. However this binding does not prevent Rictor binding to mTOR. Thus Rictor is known as the Rapamycin insensitive partner of mTOR and Raptor the Rapamycin sensitive partner of mTOR.

TOR has the capability to complex with different molecules in vivo. In mammalian systems TOR forms two complexes: TORC1 and TORC2 (Figure 4.2). These two complexes differ in their composition, sensitivity to rapamycin, downstream targets and function. Both the TORC1 and TORC2 complexes share mLST8 (Gβl) protein. mLST8 is a 38kDa protein crucial for the function of TOR and is known to stimulate TOR catalytic activities [56]. Thus this molecule is important for TORC1 and TORC2 complexes and is highly conserved [48]. Components specific to TORC1 and TORC2 complexes has been characterized by several groups. Work performed by Michael Hall and colleagues have been instrumental to characterize yeast and mammalian TORC1 and TORC2 components [48]. Further studies performed in plant, worm, fly and mammalian systems have identified homologous counterparts to the yeast TORC complexes, but not all [48]. For example, Yeast contains two TOR genes, while higher eukaryotes contain only one TOR homolog [57]. The absence of certain TORC1 and TORC2 complex molecules in different model organisms could be due to evolutionary consequences or partial characterization of the complexes.

TORC1 complex contains Raptor (regulatory associated protein of TOR) which is crucial for the functions mediated by the TORC1 pathway. Raptor, also a highly conserved, large protein (~150 kDa) binds directly to mTOR, possibly at multiple sites [48, 58]. TORC1 differs from TORC2 complex due to its sensitivity to rapamycin. This is associated with rapamycin binding to the FRB domain of TOR which inhibits the binding of Raptor to form the TORC1 complex. However the exact mechanism associated with FKBP12- rapamycin inhibition of TORC1 is controversial and has not been clearly elucidated yet. Studies have shown that addition of Rapamycin does not down regulate TOR or Raptor expression, but down regulates mTOR and Raptor downstream targets such as S6K1. In vitro studies suggest that FKBP12-rapamycin could dissociate the Raptor-mTOR and bind to the FRB domain and thereby cause the TORC1 sensitivity to rapamycin [58]. However emerging in vivo studies have also suggested that FKBP12-rapamycin could be involved with inhibiting TORC1 auto-phosphorylation and catalytic activity to inhibit TORC1 mediated functions [59]. Raptor main function can be designated to the TORC1 complex functions which involves nutrition sensing coupled with enhanced transcription, translation, ribosomal biogenesis, cell growth and proliferation [48]. TORC2 complex contains Rictor (rapamycin independent companion of TOR or AVO3) which is not sensitive to Rapamycin. This is also a large protein (~200 kDa) involved with TORC2 mediated actin polymerization and cell migration [59, 60].

Thus mTOR is shared by the two complexes. Whether mTOR prioritizes one complex over another or if there is a preferential binding affinity to form either complex

24 has not been elucidated yet. However it could be suggested that when Raptor is not present, the available mTOR molecules might complex with Rictor and associated molecules to form more TORC2 complex or vice versa. Either way, both these complexes have different functions and how these complexes react and interplay in vivo, systemically, in the complexity of the whole organism has not been elucidated.

4.1.2 - Target of Rapamycin functions

Cells in a multicellular organism are regulated not only by local signals. Systemic signals (example, endocrine signals) could also affect the cellular growth, proliferation, senescence and death. Thus, a multicellular organism can only function with the correct coordinated connections that integrate local and systemic signals. Thereby cells can incorporate these local and systemic signals to grow and proliferate. Cells utilize a complex system to grow and proliferate only when there are suitable environmental conditions. In order to sense these signals, cells utilize endogenous molecular sensors. These molecular sensors will sense these local and systemic cues such as nutrients and stress and transmit the signal to mediate a specific cellular function. A sensory molecular that is central component of this signaling system is TOR. TOR is a crucial intracellular convergence point for many signaling pathways.

mTOR pathway can be stimulated by growth factors and nutrients. Insulin and insulin like growth factors (IFGs) activate the PI3k pathway and subsequently AKT. Activated AKT can inhibit the mTOR negative regulators TSC1 and TSC2, thereby stabilizing the mTOR mediated functions. Activated mTOR can bind directly to Rheb which further stimulates mTOR functions. PI3K-AKT-TOR pathway is suppressed by the tumor suppressor PTEN. With the availability of nutrients, mTOR once again recruits its positive regulator Rheb. Nutrients such as amino acids can further initiate activity of mTOR signaling by inhibiting TSC1 and TSC2. Studies have further shown that amino acid sensing is probably done directly by mTOR rather than via a specific pathway.

The intrinsic availability of energy in a cell can also regulate mTOR via several pathways. TORC1 mainly senses the available cellular energy via AMP activated protein (AMPK) which is activated in response to decreased energy. LKB1 a tumor suppressor activates AMPK which in turn phosphorylates and activates the TOR inhibitor TSC2. Thus high energy availability in a cell down regulates TORC1 activity. During nutrient availability, AKT activity enhances cellular ATP levels thereby decreasing AMPK and subsequent activation of TSC2. This process stabilizes TOR mediated pathways. These kinases mediate cellular responses to stresses such as DNA damage. Thus Stress and hypoxic conditions mediate mTOR down regulation via REDD proteins and TSC1 and TSC2 activation. Further DNA damage responses up regulates p53 which has shown to down regulate mTOR through AMPK and TSC2 activation.

TORC1 pathway regulates translation through activation of S6K1 and 4EBP which initiates the translational machinery. TORC1 associates with these molecules via the Raptor protein. This activation leads to general increase in translation, specifically of

5’TOP mRNA which are important to synthesize ribosomal proteins and proteins important for elongation. Thus the general translation machinery and its activities will be enhanced in the presence of mTOR.

mTOR is a Critical controller of aging (1-3) [61] and this has been proven with studies performed using Rapamycin, where Rapamycin treatment prolongs life. This highlights the importance of the TORC1 complex towards longevity. These functions are probably mediated in conjunction with sirtuins which are up regulated upon inhibition of mTOR expression and function. Further, autophagy which is up regulated upon mTOR down regulation likely plays a role towards enhancing lifespan.

Autophagy is a catabolic function that promotes the breakdown of cells by the mediation of lysosomes. The broken down components can be utilized as energy during nutrient stress. Apart from supplying energy, autophagy can be utilized as a survival mechanism by the system where it cleans damaged organelles and mis-folded proteins. It also performs immune functions by getting rid of intracellular pathogens. Autophagy therefore could also protect against genomic instability since it has the capability to degrade damaged components [62, 63]. Further it has been implicated with the promotion of cellular senescence [64] and prevention of necrosis. Eukaryotic cells maintain autophagy tightly coupled with the nutrition level and metabolic functions. mTOR is a well-known regulator of the autophagy pathway which is activated under nutrition rich conditions. Under starvation, or inhibition of TORC1 pathway by rapamycin, the Atg complex assembles to promote and activate the autophagy pathway. Under nutrition rich conditions, TORC1 complex destabilizes the Atg complex and releases Atg13 and Atg1 inhibiting the activation of the autophagy pathway. Thus mTOR plays a crucial role during the activation of autophagy. Planarians have the remarkable capability to remodel their body during periods of starvation. Studies have indicated that autophagy might play crucial role during the starvation period to maintain systemic homeostasis and tissue remodeling [65, 66]. With the links of autophagy to senescence and the function of autophagy towards promotion of metabolically stressed hypoxic regions of tumors, understanding autophagy and the crucial role TORC1 plays in vivo in the complexity of the whole organism is important. Thus by using planaria as a model organism we might be able to understand the importance of autophagy during starvation.

4.1.3 – PTEN in smed

Previous studies performed in Schmidtea mediterranea have shown the presence of PTEN (phosphatase and tensin homolog deleted on chromosome 10) [35]. Down regulation of smed-PTEN 1 and smed-PTEN 2 homologs created lesions and abnormal growth in less than 14 days and the animals eventually died by lysis. Smed-PTEN(RNAi) further increased the number of proliferative cells, leading to conclude that the PTEN tumor suppressor function is conserved in planaria. Treatment of rapamycin which inhibits the function of TORC1, down regulated proliferative cells in the smed-PTEN(RNAi). This indicates that the TOR-PTEN pathway could be conserved in planaria and the pathway that mostly mediates the proliferation in the absence of PTEN could be TORC1. Based on the

26 above study, I hypothesized that TOR could be conserved in planaria and progressed to identify a TOR homolog and to prove that structure and function is conserved. Furthermore planaria is an attractive model system to study stem cell function and regeneration. In this chapter I describe how the identified Schmidtea mediterranea TOR (smed-TOR) is involved with stem cell regulation, tissue repair and regeneration.

4.2 Results

4.2.1 - Identification of smed-TOR and TOR pathway homologs

Using Schmidtea mediterranea sequenced genome database [67] we identified a single TOR homolog which contains unique domains present in other species. The discovered sequence contains 6 heat repeats, an FAT domain, FRB domain, a kinase domain and an FATC domain which is consistent with the molecular organization observed in other vertebrate and invertebrate TOR homologs [48]. Alignment of these domains with other family members of PIKK such as ATM and ATR, did not show similar identities. This suggests that the homolog we found is indeed the planarian TOR. ClustalW multiple sequence alignment of the TOR FAT domain of S. mediterranea, Homo sapiens,Canis familiaris, Rattus norvegicus, Danio rerio, Gallus gallus, Anopheles gambiae, Drosophila melanogaster shows conservation of the planarian FAT domain (Fig 4.3B). The homologous residues across species are shaded in dark blue and positive substitutions based on vertebrate alignment are shaded in light blue. The homologous and positive substitutions common only to invertebrates are shaded in green (Fig 4.3A).

I further performed phylogenetic analysis to decipher Phylogenetic relationship among Primates and invertebrates based on the protein sequences of TOR (Gen Bank accession # ACT98286.1). Alignment of the 9 sequences was done in Clustal X with maximum likelihood method which is based on the JTT matrix-based model. The percentage of trees in which the associated taxa clustered together is shown next to the branches. Initial tree(s) for the heuristic search were obtained automatically as follows. When the number of common sites was<100 or less than one fourth of the total number of sites, the maximum parsimony method was used: otherwise BIONJ method with MCL distance matrix was used. A discrete Gamma distribution was used to model evolutionary rate differences among sites (5 categories (+G, parameter=4.1754). The tree is drawn to scale, with branch lengths measured in the number of substitutions per site. The analysis involved 9 amino acid sequences. All positions containing gaps and missing data were eliminated. There were a total of 279 positions in the final dataset. Branch support is under 5000 Bootstrap replicas. Evolutionary analyses were conducted in MEGA5. These data proves that the identified molecule is indeed TOR, which will be termed smed-TOR for the rest of the analysis.

of 279 positions in the final dataset. Branch support is under 5000 Bootstrap

Figure 4.3 - Molecular Phylogenetic analysis by Maximum Likelihood method (A) Phylogenetic relationship among Primates and invertebrates based on the protein sequences of TOR (Gen Bank accession # ACT98286.1). Alignment of the 9 amino acid sequences with 279 total positions was done in Clustal X. Maximum Likelihood method was based on the JTT matrix-based model. The percentage of trees in which the associated taxa clustered together is shown next to the branches. The tree is drawn to scale, with branch lengths measured in the number of substitutions per site. Evolutionary analyses were conducted in MEGA5 with a branch support under 5000 Bootstrap replicas. (B) CLUSTALW multiple alignment of the TOR FAT domain of S. mediterranea, Homo sapiens, Canis familiaris, Rattus norvegicus, Danio rerio, Gallus gallus, Anopheles gambiae, Drosophila melanogaster shows multiple homologous regions within the FAT domain. The homologous residues across species are shaded in dark blue and positive substitutions based on vertebrate alignment are shaded in light blue. The homologous and positive substitutions common only to invertebrates are shaded in green.

We further investigated other members of the TOR pathway and successfully retrieved Raptor and LST8. Other labs have found Rictor and Sin 1 [68, 69]. The existence of several members belonging to the TORC1 and TORC2 complexes further validates the existence and conservation of the TOR pathway in Schmidtea mediterranea. Another important member of the TOR pathway is the master regulator and kinase AKT which has also been discovered in Schmidtea mediterranea [35]. Particular data concerning this molecule has been explained in chapter 5.

4.2.2 - TOR is ubiquitously expressed in planaria

Several modifications from previously described cloning procedure [70] (chapter 3) was made and a ~400bp smed-TOR fragment was cloned into pBluescript plasmid containing a T3 and T7 promoter. This was confirmed by sequencing and pcr amplification using T3 and T7 primers. The amplified secondary pcr product was used to synthesize riboprobes and perform whole mount in situ hybridization (ISH. ISH showed that smed- TOR is ubiquitously expressed in the planaria when stained with the anti-sense probe and not the sense probe (Fig 4.4 A and B).

Three populations have been characterized in planaria: X1 (neoblasts), X2 (early division progeny), Xins (late division progeny). These populations were sorted by flow cytometry as shown in figure 4.4 C and as described in materials and methods. These sorted cells were used for two purposes 1) extract RNA 2) Fix the sorted cells with paraformaldehyde to perform ISH. Fluorescent ISH was performed using smed-TOR probe and X1, X2, Xins population markers: Smedwi-1, NB.21.11e, Agat-1 respectively. The sorted X1 population was stained with smed-TOR and smedwi-1 probes and DAPI to identify cells. All sorted X1 cells stained with Smedwi-1 probe, but not smed-TOR probe (Fig 4.4 F). Quantification of the double stain (Smedwi-1and TOR) indicated that 82.7±11.7% of the X1 population expressed smed-TOR. This implies that not all proliferative cells in the intact planaria express smed-TOR gene. Double stain and quantification using the smed-TOR probe with NB.21.11e to mark X2 population and or the AGAT-1 probe to mark the Xins population showed that 58% of X2 and 72% of Xins cells expressed smed-TOR (Fig 4.4 D). Since the above cell populations were sorted from animals that were starved only for 7 days, we can assume that in a normal intact animal, at a given time smed-TOR is ubiquitously expressed, but not equally distributed in all populations and cells.

Figure 4.4 – smed-TOR is expressed ubiquitously (A) Whole mount ISH shows widespread distribution of TOR expression and (B) lack of signal in the sense probe demonstrates signal specificity. (C) FACS plot shows gates used to isolate irradiation sensitive (X1 and X2) and insensitive (Xins) populations based on viability and the DNA content. (D) Bar graph shows TOR expressing cells are present among neoblasts and differentiated tissues (X1, n: 287: X2, n: 169 and Xins, n: 380). (E) Proliferative neoblast expressing TOR (green signal, blue is DAPI). (F) Double staining with smedwi-1 and TOR fluorescent probes on proliferative cells. The majority of cells co-express both genes, arrows indicate positive signal for each probe.

4.2.3 - Planarian TOR is down regulated upon RNAi

To assess the role of TOR during normal homeostasis, a double stranded RNA (dsRNA) microinjection protocol for TOR was designed and optimized (Fig 3A). The 400bp TOR fragment cloned into pBluescript plasmid was used to synthesize dsRNA as previously described [70]. The RNAi (RNA interference) protocol was optimized until it achieved reproducible maximum abrogation in order to reduce the possibility of a TOR partial down regulation (Fig 4.5 A). This is demonstrated by ISH performed on control and TOR(RNAi) animals (Fig 4.5 B) and quantitative PCR (qpcr) analysis (Fig 4.5 C). Following TOR(RNAi), animals displayed slower photo tactic responses but no lethality 30 days after the first injection. These data suggest that TOR is not required for short-term tissue turnover. Under these conditions, strong down regulation of TOR gene expression could be achieved in less than a week, but stable effects on neoblasts were detectable ~3 weeks after the first dsRNA injection, demonstrated by qpcr (Fig 4.5 C). Quantification of

TOR expression post 20 days of RNAi indicated a ~15 fold down regulation in TOR expression. This down regulation stayed consistent at 30 days post first injection and no lethality was detected, suggesting that abnormalities in neoblasts were probably associated with lack of functional TOR protein, and it takes ~20 days under this RNAi strategy to abolish TOR function in the whole adult worm. Although additional experiments are needed to test for TOR protein activity, the timeline reported here are consistent with the turnover rate reported for other planarian proteins [71, 72]. We further injected animals up to 45 days and observed no lethality or significant visible phenotypes. However animals decreased in size significantly and this will be discussed later in the chapter. Please note that the injected RNAi animals were starved.

Figure 4.5 – Smed-TOR is down regulated by TOR specific RNA-interference (A) Intact animals received microinjections with water (control) or TOR/RAPTOR-dsRNA as illustrated. Animals that were kept beyond day 30 were subjected to a 5th injection and fixed on day 40 after first injection. (B) Whole mount ISH shows widespread distribution of TOR expression in control and lack of signal in the TOR(RNAi) (C) 30 days post first injection. (D) The RNAi strategy applied to down regulate TOR maintains its expression significantly low compared to control even 30 days after first injection. Qpcr analyses are from triplicated experiments: values represent average and error bars s.d. Gene expressions are relative to the ubiquitously expressed clone H.55.12e [1].

With the results obtained in Fig 4.5 we are able to conclude that the TOR gene expression is down regulated with the optimized RNAi injection regime. Down regulation of TOR signaling has known to cause growth arrest and down regulation in translation and transcription activity protein synthesis [73]. Therefore silencing TOR expression in planaria could also impact the gene and protein levels. A study performed in yeast to monitor the global mRNA levels with the impairment of TOR signaling pathways through rapamycin showed an increase in global mRNA degradation [74]. This was comparable to starvation induced mRNA degradation implying that TOR is important for global mRNA stabilization. The same study also showed That TOR is important for ribosomal protein mRNAs and down regulation could impair ribosomal biogenesis. TOR at the functional level also signals S6K and 4eBP for protein synthesis and therefore this protein might have dual function in promoting and stabilizing protein levels within the cell. Thus with the down regulation of TOR, we can expect global mRNA decay and a down regulation of global protein synthesis.

4.2.4 - TOR is important for cell proliferation and growth

Abnormal expression of mTOR has been implicated with cancer and aggressive tumor growth [75, 76]. Studies connect TOR function to cell proliferation, cell migration, cell growth and cell death. Abrogating TOR signaling causes growth arrest and down regulation of global mRNA expression and protein synthesis [74]. Planaria provides an excellent system to understand stem cells and regulation of proliferative cells in vivo in the complexity of the whole organism. To understand smed-TOR involvement with stem cell regulation, animals were fixed using the Carnoy fixation method as described previously with some modifications [77]. Whole mount immunostaining was performed using an antibody against Histone 3 phosphorylated (α-H3p). Histone 3 protein gets phosphorylated during the mitosis phase of the cell cycle and therefore positive signals emanating will indicate cells at the mitosis phase of the cell cycle. H3p staining 30 days post first TOR(RNAi) injection and the H3p positive cells were counted per mm2 area. As depicted in Fig 4.6, H3p positive cells were down regulated by 2.6 fold: Control 166.2933 ± 35, smed-TOR(RNAi) 63.2251 ± 29.4. However TOR(RNAi) did not even up to 40 days of RNAi, did not completely eliminate neoblasts. This implies that certain stem cells are capable of dividing in the absence of TOR. Whether the cells would completely abrogate proliferation over long periods of smed-TOR(RNAi) remains to be observed.

Studies have shown that TOR impairment affects the G1 phase of the cell cycle [78]. Therefore we performed cell cycle analysis by flow cytometry using DAPI or Draq5 as the DNA content marker. Compared to the control (75.6±0.3) there was an arrest at the G1 phase of the cell cycle in the TOR(RNAi) (83.1±0.3). However the cells that passed G1 phase and were capable of entering the S phase was down regulated ~50% in the TOR (RNAi). From the cells that entered S phase only 62% of the cells were capable entering the G2/M phase. The down regulation of H3p positive cell content in the smed- TOR(RNAi) might therefore be correlated with the incapability of TOR depleted stem cells

32 to transition through the cell cycle. Down regulation of global mRNA and protein expression due to impairment in its synthesis post TOR depletion could play a role towards TOR(RNAi) mediated cell cycle arrest.

E G 1 phase S phase G2/M phase Control 75.6 ± 0.3 14.1 ± 0.7 13.7 ± 0.3 Smed-TOR(RNAi) 83.1 ± 0.3 7.58 ± 0.1 8.5 ± 0.3

Figure 4.6– Smed-TOR RNA-interference reduces mitotic activity (A-C) whole-mount immunostaining with anti-H3P antibody, and quantification of mitoses demonstrates reduction in mitotic activity in TOR(RNAi) animals (Student’s t-test p<0.01): three independent experiments, n>12 animals. (D) Cell cycle analysis with DAPI indicates neoblasts progression to cell cycle is impaired after TOR(RNAi), Student’s t-test G1 phase (p<0.01), G2/M phase (p<0.05), S phase (p<0.05). One representative experiment (mean  s.d.) of three separate experiment is shown in figure. Scale bar = 200µm. (E) A table summary of three independent experiments for figure D.

4.2.5 - TOR (RNAi) inhibits systemic neoblast and successive progeny populations

Planarian literature describes the existence of 3 cell populations: proliferative neoblasts, early division progeny, late division progeny [33]. Neoblasts (X1 population) are a heterogeneous stem cell population that is known to proliferate constantly to maintain tissue homeostasis, repair and regeneration. Studies characterizing neoblasts have used specific gene expression patterns as markers to reveal their existence. The most characterized marker used for neoblasts is Smedwi-1 [33, 79]. The early division progeny is usually marked by NB.21.11e (X2 population) and the late division progeny by Agat-1 (Xins population). Using these markers we performed ISH on control and 30 day smed- TOR(RNAi) animals. These experiments showed that the X1, X2, Xins progeny still exist within the TOR(RNAi), however the expression levels are substantially reduced: Compared to control animal expression set at 100% the TOR (RNAi) expressed the proliferative neoblast marker Smedwi-1 82.12%, the early division progeny marker NB.21.11e 87.09% and the late division progeny marker AGAT-146.60% (Fig 4.7 A-F). To better understand the levels of neoblast and their successive progeny we performed quantitative pcr using Smedwi-1, NB.21.11e and AGAT-1 primers, which further proved that these populations are down regulated marked by the decreased levels of gene expression (Fig 4.7 G-I).

Flow cytometry methods have been utilized to identify and quantify X1, X2, Xins populations in the planaria [33]. The X1 population marked by the proliferative stem cells contains 4N DNA content, while X2 and Xins will contain 2N DNA content. We used Draq5 DNA marker to identify and sort cells with 4N and 2N DNA content. Further upon irradiation X1 and X2 populations are depleted, but not Xins. Using these strategies live cells (stained with Calcein) were gated based on their DNA content and radiation sensitivity and appropriately sorted or analyzed. The flow cytometry analysis thus provided a lower X1 population frequency (control 12.9%±0.7 and smed-TOR RNAi 9.3%±1.2) compared to the control animals (Fig 4.7 J), once again showing that the neoblast population frequency is compromised post smed-TOR(RNAi). Thus I have demonstrated using ISH, immunostaining and FACS that TOR is important for cell proliferation and maintenance of specific cell populations within the planaria. TOR down regulation impairs cell proliferation creating an imbalance in homeostasis within the system.

These analyses indicate that TOR regulates neoblast proliferation during systemic cell turnover. The reasons for the reduction in proliferative neoblasts and their progeny after TOR(RNAi) is not entirely clear, but two possible scenarios could be suggested: (1) TOR inhibition produces a uniform effect on all neoblasts that leads to a gradual decline in their proliferative capacity, and (2) TOR has distinct roles in stem cells along the planarian body, implying that a subset of neoblasts requires this signaling pathway for proliferation whereas some other neoblasts divide independently of TOR. The complexity of the neoblast population is not well understood, but recent evidence supports the notion that intrinsic differences exist among neoblasts [79]. TOR inhibition does not produce a uniform cellular response along the mammalian body [80], indicating that additional analyses of this phenotype in planarians might shed some light on the systemic regulation

34 of TOR in adult tissues. Further based on TOR expression, function and TOR requirement, the planarian neoblast population can now be divided into two main groups:3 smed-TOR dependent neoblasts, smed-TOR independent neoblasts.

Figure 4.7 - RNA-interference reduces expression of neoblast markers TOR(RNAi) reduces the expression of neoblast-associate genes detected by ISH (A-F) and qpcr (G-I) : smed-piwi (~ 5.5 fold), NB.21.11 (~ 6.5 fold), and smed-Agat1 (~1.8 fold). Three independent experiments with n>9 animals for ISH and n>6 animals for qpcr. Bars 200µm. (J) FACS analysis on control vs TOR(RNAi) shows a decrease in the X1 population frequency compared to the control. Three independent experiments with >20 animals. (Student’s t-test p<0.01).

4.2.6 - TOR(RNAi) increases cell death

Figure 4. 8 – smed-TOR(RNAi) increases cell death (A) Cell death is elevated in intact TOR(RNAi) animals (Student’s t-test p<0.005, three independent experiments, n>5).

Studies performed in various model systems show that TOR is essential for cell cycle progression and cell survivability [81]. mTOR also has known to inhibit apoptosis increasing cell survivability [82]. However emerging studies have demonstrated that TOR has a crucial role towards cell death. Down regulation of TOR and AKT reduced oxidative stress and thereby reduce neuronal necrosis [83]. But the most evidence is produced by activation of autophagy and subsequent cell death upon TOR down regulation [84, 85]. To understand systemic regulation of cell death by smed-TOR, we assessed control and smed- TOR(RNAi) post TUNEL staining. The results provided a ~2.6 fold increase in cell death in the TOR(RNAi): control 687.04 ± 115, smed-TOR(RNAi) 1786.5 ± 492 (Fig 4.8 A). TUNEL staining has the capability to stain fragmented DNA which could be due to different cell death pathways: apoptosis, necrosis, autophagy. Whether the TUNEL positive cells observed were due to apoptosis or autophagy remains to be clarified. For this purpose using apoptosis markers Annexin V and/or caspase will help to quantify the amounts of cellular death mediated by apoptosis.

LC3 is a well-known marker for autophagy characterized in several model systems [86, 87]. However LC3 can also be expressed in lysosomes under conditions other than autophagy. This might devalue LC3 as a portable marker for autophagy. Gtdap-1 is an ortholog of human DAP-1 protein which is a crucial TOR regulated autophagy suppressor

[65, 66]. Therefore observing the Gtdap-1 expression in control and TOR(RNAi) might provide important insights into autophagy mediated cell death.

Figure 4.9 - TOR is required for long-term tissue maintenance Long-term tissue maintenance is not effectively supported after TOR(RNAi). About 7% of tissue is loss in front of the photoreceptors (arrows) in TOR(RNAi), Smed-PC2 labels CNS. A reduction in the expression of the allometric marker cintillo (chemoreceptors) (Student’s t-test p <0.0001) and excretory system after TOR(RNAi) (Student’s t-test p <0.0001). Numbers represent chemoreceptors/mm or smedinx-10 associated-signal  SD of three experiments 40 days starvation n>8 animals. Bar is 100µm.

4.2.7 - TOR is essential for organismal growth and long term tissue maintenance

Continuous neoblast division in uninjured planarians supports tissue turnover [70]. However, if there is an imbalance between neoblast division and cell death, it might affect long-term tissue maintenance. To test this assumption, the integrity of differentiated tissues was evaluated using organ-specific markers (Fig. 4.9). We found that tissue integrity in TOR(RNAi) planarians was compromised in at least two ways. First, there was mild loss of tissue (8.7%61.6 decrease) at the most anterior part, a condition that is known as head regression and is commonly associated with the inability of neoblasts to support tissue turnover [1]. Second, the low number of cells expressing the excretory system marker

37 smedinx-10, and the allometric indicator cintillo suggests that neoblasts in TOR(RNAi) animals cannot support long-term systemic tissue turnover (Fig. 4.9). We propose that these results, together with high apoptotic levels (Fig. 4.8), might lead to the generalized tissue degeneration observed in TOR(RNAi) planarians.

mTOR has been implicated with cell growth, energy maintenance and metabolism. It is known to respond to environmental signals such as nutritional cues and stress. When nutrition is plenty, TOR is capable of mediating a number of function such as cellular proliferation, translation initiation, ribosome biogenesis and down regulation of autophagy [48, 80, 88]. Planarians can increase or decrease their body size according to metabolic and environmental conditions [89]. However the molecular bases of this remarkable tissue plasticity are unknown. This developmental plasticity in the adult has been associated with addition of new cells during growth, and elimination of specific cells during size reduction, which in both cases help to remodel and adjust body proportions accordingly [90].

The mTOR pathway is a sensor that responds to signals, such as nutrient and energy availability, by modulating cell growth and division [48, 80, 88]. To test whether TOR plays a role in planarian growth and de-growth, we exposed TOR(RNAi) animals to high or low nutrient levels (i.e. continuous feeding or starvation, respectively) and recorded changes in organismal size for 40 days. When maintained under low nutrient levels, control and TOR(RNAi) worms decreased in size at the same rate (Fig. 4.10). This indicates that tissue remodeling could occur in the absence of functional TOR, which is consistent with TOR inhibition under low nutrient conditions observed in other organisms [88]. Indeed, we found that TOR expression is down regulated during starvation (Fig 4.12A-B). Conversely, control animals fed once a week displayed sustained increase in size, whereas fed TOR(RNAi) animals failed to grow and kept their overall size with minimal change for 40 days. Independently of the metabolic status (i.e. starving or feeding) the overall cellular size in TOR(RNAi) animals was always smaller than in controls (Fig 4.10 B), suggesting that, as in other species, the planarian TOR is a key regulator of cell size [91, 92]. Altogether, these results indicate that TOR signaling is a key molecular component of organismal growth in planarians. This molecular function of TOR could be important for understanding metabolic plasticity during tissue maintenance and regeneration as has been long sought after in the planarian literature (Bardeen, 1901: Morgan, 1901).

The fact that fed TOR(RNAi) animals kept their size relatively stable over time is consistent with the notion that the remaining neoblasts to some extent sense nutrients and are capable of supporting tissue turnover (Fig 4.10A). Therefore, the lack of organismal growth in the presence of nutrients, together with the inability of neoblasts to contribute to localized growth after amputation, suggests that in the absence of functional TOR, the neoblast response to satisfy body demand is restricted, confirming the role of this pathway as a systemic regulator. Additional experiments are needed to determine whether these effects are the result of a delayed cell cycle transition and/or an altered migratory and differentiation response.

Figure 4.10 - TOR is required for organismal growth (A) In TOR(RNAi) starvation does not affect “degrowth” but feeding once a week prevents organismal growth. Average  SD of 25 animals per time point. (B) TUNEL-positive nuclei is elevated in intact TOR(RNAi) animals (Student’s t-test p <0.005). Two independent experiments n>5 animals. (B) Flow cytometry analysis using forward scatter (FCS) indicates a decrease in cellular size in animals subjected to TOR(RNAi) in comparison to the controls. Data is representative of three individual experiments, 40 days starvation and/or TOR (RNAi).

To understand the levels of smed-TOR during starvation, animals starved for 7 and 30 days were used for ISH and qpcr. ISH analysis indicate a clear down regulation in smed- TOR expression (Fig 4.11 A & B), while qpcr analysis indicates a ~50% down regulation in smed-TOR gene expression (Fig 4.11 D). Post feeding, planarians increases neoblast proliferation post 6 hours and maintains increased proliferation for up to 72 hours [93]. TOR(RNAi) animals however was incapable of maintaining equal number of proliferative cells compared to the controls at 6 hours, and peaks at 12 hour and then down regulates the

proliferative capacity compared to controls (Fig 4.11 C). Thus the incapability to maintain proliferative cells post feeding. which could play a major role during cell growth. might explain the decrease in body size in the fed TOR(RNAi). To understand whether X1, X2, Xins populations were affected post TOR(RNAi) and feeding, ISH was performed using Smedwi-1, NB.21.11e and Agat-1 probes. The obtained data indicates a clear down regulation in neoblast markers in the TOR(RNAi) even post feeding (data not shown). This further validates that without smed-TOR, planaria cannot respond to nutritional cues to maintain stem cells and their successive progeny.

Figure 4.11 - TOR systemic expression is modulated by the metabolic status and Remaining neoblasts after TOR(RNAi) respond to systemic nutrient levels (A-B) After feeding the intensity of the TOR expression seems to increase whereas animals starved for over a month the intensity of the signal by ISH is about 50% lower. Note both experiments were performed side by side and signal development was stopped at the same time. Total of five animals per condition and scale bar is 200µm. (C) Intact TOR(RNAi) animals are able to eat and neoblasts along the body increase their division rate upon feeding. Increase in mitoses is observed by 6 hours post feeding and gradually decrease towards pre-feeding levels after 72 hours. Each data point represents average  s.d. of n: 5 to 7 animals. (D) In starving animals TOR expression is down regulated by 50.8% (Student’s t-test p <0.001).

4.2.8 - TOR signaling is required for blastema formation and cell proliferation post amputation

Figure 4.12 - TOR signaling drives early response of neoblast to amputation but regeneration occurs in the absence of blastema formation (A-B) TOR(RNAi) prevents blastema formation after two rounds of amputation or in cuts 20 days after first injection. Cephalic regeneration is shown (five independent experiments, n: >180, bars 500µm). (C) TOR(RNAi) restricts local growth -blastema (n:>32 animals). (D) Nervous tissue (arrows) that is normally regenerated within the blastema appears in pre-existing tissue after TOR(RNAi). Central nervous system (CNS, smed-pc2) and (E) visual neurons (anti-arresting antibody), 10 days after decapitation. Although the mechanism by which brain and visual neurons are regenerated after TOR(RNAi) is not necessarily clear, animals sense external stimuli, see text for details (n:>15, the animal outline is depicted). (F) In control animals two burst of mitoses (6 and >30 hours) are triggered after amputation but in TOR(RNAi) only one is observed at 20 hours post-amputation. The difference in the mitotic response in both groups is statistically significant p=1.43e-09 by Two-Way-Anova. Each data point represents mean  s.e. of two independent experiments with n>10 animals. Red dotted line represents plane of amputation.

To investigate the roles of TOR in planarian regeneration, the response to amputation was evaluated in worms subjected to TOR(RNAi). Upon amputation, neoblasts proliferate to form a specialized structure called the regenerating blastema, which is the new tissue from which missing structures are regenerated [29, 94]. After two rounds of amputation, controls (water injected, n>40) regenerated both head and tail within a week, whereas TOR(RNAi)-treated fragments failed to form recognizable blastemas (Fig 4.12 A). A similar response was also observed after single longitudinal cuts, indicating that this phenotype was not restricted to the number or the type of amputation (Fig 4.12 B). Quantification of the size of blastema formed indicated that 100% of the animals did not form blastema (Fig 4.12 C).

Although neoblasts continue to proliferate after TOR(RNAi), they were unable to form blastema, indicating that TOR signaling is required for blastema formation. Nonetheless, TOR(RNAi) fragments without blastemas survived for >40 days after the first injection. Surprisingly, these fragments became sensitive to light and responded to other external stimuli, suggesting that the sensory system was somewhat functional. Over time, TOR(RNAi) fragments without blastema developed characteristic photoreceptor pigmentation close to the anterior wound (Fig 4.12 E). A closer evaluation with nervous system markers revealed an unexpected result: nervous system structures (e.g. brain, visual neurons) removed during amputation was to some extent regenerated in TOR(RNAi) animals, but within pre-existing tissue (Fig. 4.12 D). These observations indicate that, despite the absence of blastema formation, regeneration in TOR(RNAi) fragments is not completely suppressed, revealing an intriguing process of regeneration in which nervous tissue is regenerated within pre-existing tissue.

Our data suggest that down regulation of TOR signaling provides an excellent model for identifying mechanisms of injury-induced stem cell response as it specifically prevents blastema formation but does not completely abrogate regeneration. Therefore, we sought to better understand the cellular response to amputation after TOR(RNAi). The initial response of neoblasts to amputation involves two waves of mitoses that are required for blastema formation [72, 95]. Although the molecular signals driving these mitotic waves are unknown, it has recently been shown that the first mitotic peak is a system-wide neoblast response triggered by mechanical injury. This initial wave peaks as early as 6 hours after wounding. The second mitotic peak, however, is an amputation-induced neoblast response, localized near the wounded area, and is evident ~48 hours after injury [72].

Time course regeneration experiments confirmed the post-amputation bimodal mitotic waves that lead to blastema formation in control fragments (Fig 4.12 F). However, neoblasts in TOR(RNAi) worms failed to mount the early systemic mitotic response after amputation. Nonetheless, their widespread proliferative response gradually increased to peak 20 hours after amputation, which typically corresponds to the stage of neoblast recruitment and the onset of the local response to loss of tissue [72]. These results indicate that neoblasts in TOR(RNAi) planarians can sense and divide following injury but are unable to reach the proliferative levels required after amputation on time. Whether a second

42 mitotic peak in TOR(RNAi) animals occurs 48 hours post-amputation needs to be investigated, but it is unlikely that it affects the process of blastema formation because the initial decisions are made within the first 12–24 hours after injury [96]. Additional experiments are also needed to rule out the mechanism by which neoblasts regenerate missing parts within pre-existing tissues, and whether the lack of blastema is associated with an impaired migratory response to injury within the neoblast progeny. However, we propose that TOR is a crucial component for the signals driving the early widespread neoblast response after amputation (i.e. the first mitotic peak). We speculate that the lack of blastema formation in the absence of TOR signaling could be associated with multiple factors (intrinsic and non-intrinsic) that combine slow proliferative responses in neoblasts upon injury with an impaired migratory property in their progeny.

4.2.9 - TOR signaling is required for proper tissue patterning post amputation

Spatiotemporal synchronization between cell division and cell death is a requirement for animal regeneration [97-100]. In planarians, two waves of apoptosis remove differentiated cells after amputation [100]. Significantly, the time period between the apoptotic peaks overlaps with the neoblast mitotic response. The first apoptotic wave precedes neoblast response to injury and is localized near the wound site. By contrast, the second peak is a systemic cell death response detectable 48 hours post-injury [100, 101]. Apoptosis was evaluated in regenerating fragments by the whole-mount TUNEL method [100]. Control fragments regenerated and displayed a characteristic apoptotic response pattern similar to that of an uncut animal (i.e. randomly distributed through the body) 7 days post-amputation (Fig 4.13A). By contrast, TOR(RNAi) fragments consistently displayed an increased and localized cell death response closely associated with the wound surface, even one week post-injury (Fig 4.13 A). This apoptotic response resembled the distribution pattern of the first wave of apoptosis seen early during regeneration [100] Furthermore, amputated TOR(RNAi) worms displayed an unexpected six-fold increase in TUNEL-positive nuclei after a week post-amputation (4.13 B). These results suggest that cell death induced by regeneration, at least in late stages, takes place independently of TOR signaling. However, the effects of prolonged apoptosis near the wound are unknown.

Cell death post amputation is required for proper tissue patterning. Time course analysis of cell death in planaria control and TOR(RNAi) contains differences. During the first two days control animals maintain higher levels of cell death compared to TOR(RNAi), and post the 5th day TOR(RNAi) animals have elevated levels of cell death with control animals containing down regulated apoptosis. The changes in cell death might further explain the lack of proper regeneration patterns in TOR(RNAi). The elevated levels of cell death post Day 6 could be involved with some level of tissue patterning resulting in the rearrangement of the existing tissue to form CNS and photoreceptors.

Figure 4.13 – TOR signaling is required for proper tissue patterning post amputation (A,B) Apoptosis takes place in absence of functional TOR signaling. The pattern of apoptotic cells remains close to the wounded area and is abnormally increased. TUNEL-positive nuclei: green signal. In controls, signal is randomly distributed whereas in TOR(RNAi) apoptotic cells is increased (6-fold) and accumulated near the cut surfaces (arrows). Bar 200µm, Student’s t-test p <0.0005. One of two independent experiments (n=5 animals) is shown. (C) TOR(RNAi) animals do not show the same patterns of cell death post amputation. Post day 5 control animals decrease cell death while TOR(RNAi) maintains high levels of cell death. One experiment performed with at least n=4 animals per time point.

In 1901, Thomas Hunt Morgan classified animal regeneration into two broad categories: (1) epimorphosis, which requires cell proliferation, and (2) morphallaxis, which proceeds through remodeling of pre-existing tissues and does not entail cellular proliferation (Morgan, 1901). However, after more than a century, the mechanisms regulating each type of tissue repair remain largely unknown [102-104]. Our results show that TOR forms part of the endogenous signals essential for blastema formation during

44 epimorphic regeneration. However, in the absence of functional TOR signaling, part of the nervous system regenerates within pre-existing tissues by a process that is not entirely clear. We speculate that it might involve both epimorphosis and morphallaxis. Nevertheless, it reveals TOR signaling to be a key molecular regulator of animal regeneration.

4.2.10 - TOR requirement for organismal growth and long-term tissue maintenance, and its functions are mediated through RAPTOR, a component of the TOR Complex-1

Raptor is a crucial component that maintains structure and function mediated by the TORC1 complex. A search through the genome database discovered a homolog for Raptor while Rictor has been previously identified [68]. In order to understand whether the

Figure 4. 14 - Functional disruption of TOR Complex-1 affects neoblast proliferation (A) Whole mount ISH shows widespread distribution of RAPTOR expression similar to TOR. (B) A planarian RAPTOR homolog (RAPTOR) restricts neoblast division (Student’s t-test p <0.001):

imbalance in cell proliferation and cell death is due to TORC1 mediated signaling, Raptor was cloned similar to the cloning method performed for TOR. Post cloning ribo probes against Raptor was synthesized and ISH was performed on control animals to assess the Raptor expression in the planaria. Raptor thus is ubiquitously expressed in the planaria (Fig 4.14 A).

Raptor was down regulated using an injection regime similar to TOR(RNAi) and mitosis and the neoblast marker expression was assessed. Similar to TOR (RNAi), H3p+ cells were down regulated in the Raptor(RNAi) (Fig 4.14B). H3p+ cells in Rictor(RNAi) did not show the same down regulation levels [68]. Further analysis using neoblast markers (Fig 4.15 A-B) were down regulation in the Raptor(RNAi) similar to TOR(RNAi). Thus the neoblast restriction is possibly associated with the TORC1 complex in the planaria.

TOR(RNAi) restricts blastema formation, but however is capable of patterning the existing tissue to form a CNS and photoreceptors. To investigate whether this process requires the TORC1 complex, Raptor was down regulated and 30 days later was amputated. Similar to TOR(RNAi), amputated Raptor(RNAi) animals were not capable of forming a

Figure 4.15 - Functional disruption of TOR Complex-1 affects neoblast gene expression (A) RNA-interference of the planarian RAPTOR homolog (RAPTOR) restricts the expression of neoblast markers associated with proliferation and early and late division post-mitotic division progeny. Whole mount ISH performed 40 days after first injection with smedwi-1 , NB.21.11 and smed-Agat1 respectively. Data is representative of two independent experiments with ~ 6 animals per condition. Scale bar 200µm. (B) The expression of smedwi-1 (proliferative, 5 fold), NB.21.11 (early progeny, 3.2 fold) and Smed-Agat-1 (late progeny, 1.9 fold) Student’s t-test p <0.001. (C) RAPTOR(RNAi) prevents blastema formation but induces regeneration of nervous structures within pre-existing tissue. In each case two or more experiments with n>6 animals, bar = 200µm.

46 blastema (Fig 4.15 C) (n=12). Moreover, RAPTOR(RNAi) amputated worms responded to light stimuli and regenerated visual neurons within pre-existing tissue, resembling the TOR(RNAi) phenotype. Rictor(RNAi) animals were capable of forming a blastema and did not show similar regenerative responses as TOR(RNAi) and Raptor(RNAi) (data not shown and [68]. This data implies that the neoblast restriction and regenerative deficiencies observed with TOR(RNAi) is possibly mediated through the TORC1 complex in the planaria.

Figure 4.16 - Functional disruption of TOR Complex-1 affects neoblast gene expression and proliferation (A) Daily injections with rapamycin (60-80 nM solution) mediate significant reduction in mitosis (Student’s t-test p <0.0002). The experiment was performed for 30 days and represent average  s.d. of n: 5 to 7 animals. (B) Rapamycin treatment down regulates expression of smedwi-1 (proliferative, 5 fold), NB.21.11 (early progeny, 3 fold), and Smed-AGAT-1 (late progeny, 8 fold), (Student’s t-test p <0.001). qRT-PCR analyses are from triplicated experiments: values represent average and error bars s.d. Gene expressions are relative to the ubiquitously expressed clone H.55.12e.

The macrolide rapamycin inhibits TOR function through TORC1 [48, 88]. We found that continuous treatment with rapamycin at .60 nM considerably reduced neoblast division (Fig 4.16 A) and the expression of neoblast associated genes (smedwi-1, NB.21.11e and Smed-Agat-1) in a similar fashion to TOR and RAPTOR(RNAi) (Fig 4.16 B). This result suggests that TOR signaling inhibition can be partially recapitulated by targeting TORC1 complex. Furthermore, RAPTOR(RNAi) consistently prevented regeneration in a way that is consistent with both the proposed TOR-protein turnover and the TOR(RNAi) phenotype.

Altogether, aspects of the TOR(RNAi) phenotype in planarians can be recapitulated by targeting RAPTOR with either RNAi or treatment with rapamycin, suggesting that the TOR deficient phenotype described here is likely to be mediated through TORC1. Additional characterization of up- or downstream targets, including AKT, 4E-BP and S6K, present in Schmidtea mediterranea will provide insights into TOR regulation in adult tissues. Furthermore, analysis using novel TOR inhibitors targeting members of the TORC1 and TORC2 complexes [105-108] has the potential to identify new drug targets to control the behavior of stem cells and to induce tissue-specific regeneration.

Figure 4.17 - Working model Working model illustrating the possibility of following a population of neoblasts that remain proliferating after TOR(RNAi) during tissue maintenance and regeneration. TOR is an essential component for maintaining homeostasis and regeneration.

4.3 - Conclusion

Taken together, our results reveal that it is possible to perform analysis of TOR function at the systemic level in adult organisms. Furthermore, by applying this paradigm we revealed roles for TOR in controlling adult stem cells during tissue turnover and regeneration that are consistent with effects observed in mammals [80, 88]. TOR has been a well characterized serine threonine kinase in connection with cell growth and metabolism. It is capable of sensing its environment depending on nutritional cues and helps to maintain proliferation or initiate autophagy. Therefore whether TOR is expressed in all proliferative neoblasts or its successive progeny post feeding remains to be clarified.

Mammalian cells do not display a uniform response to TOR inhibition but studies on planarians could provide additional opportunities for dissecting complex cell regulation by this pathway in adult tissues. The phenotype described here provides simplified grounds by which the systemic effect resulting from manipulation of ubiquitous signaling pathways could be translated to the complexity of the whole organism. Our results reveal that TOR signaling components are conserved in planarians and that TORC1 probably mediates TOR function during early regenerative response and organismal growth. These findings could enable studies to further characterize epimorphic regeneration without blastema formation. This is of particular interest given that not all regenerative processes involve blastema formation and in some organisms (including humans), tissue repair can take place without the formation of this specialized structure. Our model provides the opportunity to investigate TOR signaling in the whole organism. As the TOR signaling pathway has been the focus of current anticancer therapy, inhibition of TOR function in planarians could also provide unique insights into the consequences of long-term inhibition of this pathway.

Chapter 5

AKT regulates stem cell behavior during tissue renewal and regeneration in planarians

5.1 – Introduction

5.1.1 - AKT Structure

AKT (PKB or RAC-alpha serine/threonine-protein kinase or v-akt murine thymoma viral oncogene homolog 1) is a serine threonine protein kinase in the PI3K/PTEN/AKT pathway that is known to control and regulate multitude of functions such as cell proliferation, metabolism, cell growth, cell death in adult tissue. Recent studies have implicated AKT as a regulator during stem cell proliferation, cellular differentiation, dedifferentiation and embryo development. Factors such as insulin, IGF, EGF binding to receptors activate PI3k which in turn activates AKT. Once AKT has been activated it will activate a myriad of pathways. AKT has been established as a promoter of tumor survival, and hence development of therapies towards controlling the function of AKT has been a focus in cancer research.

AKT protein contains 3 conserved domains: pH domain, catalytic domain, AGC- kinase C terminal extension. The catalytic domain contains the highest conservation (90%) while the PH domain also contains ~80% homology across species (Fig 5.1A). The C terminal extension maintains 60-70% identities across species. Suggestions regarding the 3D structure of AKT has been documented which will provide us in the future about their capability to be active and promote signaling [109]. This classification can also help us to discover AKT activators and inhibitors and discover targeted drugs Figure 5.1 – Domain structure of AKT towards therapeutic AKT contains 3 domains PH domain, kinase domain and a regulatory domain. approaches.

5.1.2 - AKT Regulation and function

Three homologous AKT isoforms have been identified in mammals and these are expressed in different types of tissue in human: AKT1(PKBα) is the most ubiquitous form but is not expressed in kidney liver or spleen, AKT2 (PKBβ) mostly expressed in skeletal

50 muscle, digestive and reproductive organs, AKT3 (PKBɤ) is mostly expressed in brain and testis. While single isoform down regulation only carries defects during mammalian embryonic development, double mutants are embryonically lethal or will die post natal.

AKT is a protein (kinase) that has the capability to activate several key molecules in living cells and could act as a master regulator and a convergence node for several signaling pathways such as TORC1 pathway, Wnt/β catenin pathway (Figure 5.2). AKT pathway is triggered by the activation of phosphoinositide 3-kinase (PI3K) and by the decreased expression of phosphatase and tensin homolog (PTEN), which is a molecule highly

Figure 5.2 – AKT function

AKT is activated by PI3K and this pathway is inhibited by PTEN tumor suppressor. Activated AKT will regulate myriad of signaling pathways. Therefore AKT is a master regulator and an intracellular convergence point for many signaling pathways.

associated with cancer [110]. Thus AKT function is suppressed by the tumor suppressor PTEN. Activated PI3K triggers a protein cascade that aids the activation of AKT, which in turn will alter the function of several proteins and will mediate specific cellular functions as indicated in figure 5.1 [111]. Thus AKT is essential for activation of several important proteins that regulate cell cycle progression, survival, metabolism, protein synthesis, and

51 cell growth. Defects in the AKT pathway have known to induce and enhance cancer progression, tissue degeneration (cell death), metabolic and neurological diseases [111, 112]. Although AKT has been studied in various animal models, it is unknown how AKT systemically regulates SCs. As part of my PhD thesis in Dr. Oviedo’s lab I am interested in studying how the AKT pathway regulates stem cells. The planarian model system contains abundant and accessible adult SCs, known as neoblasts. These flatworms are well known for their extraordinaire regenerative capacities and for their molecular and functional conservation of the AKT signaling pathway [35, 113]. Furthermore, classical experiments have demonstrated that mammalian chemically-induced diseases such as cancer and degenerative pathologies can be modeled in these animals [37, 38].

Maintenance of tissue homeostasis, tissue repair and regeneration require proper coordination of signaling networks that mediate stem cell proliferation, differentiation and death. PI3K/AKT/TOR signaling networks mediate cell proliferation, cell growth and differentiation, metabolic functions and tissue remodeling [113]. In order to understand this tightly knit signaling cascades and how they coordinate and interact with each other, we need to understand how molecules affect the system as a whole. But how this occurs has been poorly understood. Previous studies have characterized TOR and PTEN in the PI3K-AKT pathway in the planaria [35, 114]. These studies have validated the importance of this pathway towards stem cell proliferation, regeneration, repair and maintenance of systemic homeostasis. AKT activates TOR and its role in regulating stem cells has also been documented in several model organisms. TOR has an important role in regulating protein expression and therefore the maintenance of cell proliferation might be linked with this requirement. Further this pathway has been implicated in several disease status such as cancer, Parkinson’s and diabetes. Understanding AKT function within the planarian system will provide insights into the PI3K-AKT pathway and how it regulates cells in vivo and this approach might aid to enhance and create better therapeutic approaches.

5.2 Results

5.2.1 - Planaria possess a single AKT homolog that is evolutionarily conserved

Protein kinases perform multitude of regulatory functions by phosphorylating target proteins. These functions ranging from cell proliferation, metabolism cell growth, cell death are highly conserved across yeast, invertebrate and vertebrate kinomes. The eukaryotic protein kinases (ePK) are thought to have evolved from ePK like Kinases (ELKs) in bacteria [115, 116]. Thus these proteins have evolutionarily conserved their structure and function specially in their catalytic domains. Human AKT contains a plecstrin homology domain (PH), a protein kinase domain and an AGC kinase C terminal region (Fig 5.1). I compared the previously identified and cloned full length S. mediterranea AKT homolog [35] to the human AKT2 and the analysis revealed 72% identities between the two sequences. The identified AKT planarian sequence contains the AKT catalytic domain.

Previous studies have described PTEN and TOR protein function in the planaria, which is conserved with mammalian and other species [35, 113]. PTEN down regulation increases AKT expression which is responsible for abnormal proliferative responses. Down regulation of AKT by RNAi has shown to decrease the proliferative capacity, however AKT and PTEN simultaneous downregulation by RNAi did not result in a massive down regulation of mitotic cells, indicating that there are other key players initiating cell proliferation in the absence of PTEN [35]. Previous studies have also shown that AKT is expressed in the three characterized planarian stem cell and progenitor populations: neoblasts (X1), early division progeny (X2), late division progeny (Xins). With these preliminary data at hand I sought to further characterize the role AKT plays during maintenance of tissue homeostasis, repair and regeneration.

Figure 5.3 - AKT is down regulated upon AKT (RNAi). (A) AKT RNAi micro injection schedule. (B) ISH shows that AKT is expressed ubiquitously (C) Upon AKT(RNAi) AKT is down regulated (D) Quantitative PCR indicates that 30 days post first injection, AKT expression is down regulated.

AKT is expressed ubiquitously in neoblasts, early division progeny and the late division progeny [35]. In order to understand the importance of AKT for planarian tissue maintenance, repair and regeneration, I down regulated AKT using RNAi by injection (Fig 5.3 A-D) and or RNAi by feeding as described before [35, 117]. RNAi is a well-established mode of eliminating S. mediterranea mRNA expression and protein over time. We were successfully able to down regulate AKT utilizing AKT(RNAi) injection schedule and AKT(RNAi) by feeding (Data not shown). Qpcr and ISH performed confirmed successful abrogation of AKT expression in the planaria (Figure 5.3 B-D).

10 days post first injection the AKT(RNAi) animals showed elongation of the whole body and deformed movement. These phenotypes persevered over 50 days post first injection coupled with a reduction in size. Starved AKT(RNAi) animals measured 0.23mm2 (±0.08) compared to the control 0.72mm2 (±0.07) 30 days

Figure 5. 4 - AKT down regulation reduces body size. post first injection which represents a Area measurement of the body size over 40 days shows that ~3 fold reduction in size (Fig 5.4). the starved AKT(RNAi) reduces body size faster than the We attempted to feed these animals starved controls. after AKT(RNAi), however the animals 21 days post first injection or 28 days post first feeding failed to respond to food or ingest food (data not shown). Reduction in size coupled with the incapability to ingest food implies the importance of AKT for systemic tissue homeostasis and function.

5.2.2 - Planarian AKT is important for stem cell proliferation and progression through the cell cycle

Systemic tissue homeostasis requires correct regulation and maintenance of cellular proliferation and cell death. The down regulation of AKT in planaria resulted in reduction in size, tissue degradation, movement impairment and incapability to respond to food stimulus in intact animals. Further PI3K-AKT pathway has been implicated to perform a pro survival and pro proliferative roles in other model organisms. Recent studies have implicated PI3K-AKT-mTOR coupled with the wnt pathway to be important for G1-S phase transition [118, 119]. Studies have also shown that AKT/mTOR inhibition arrests HepG2 cells at S phase in vitro [120]. Further PI3K/AKT pathway down regulation affects the G2/M transition [121].

Figure 5.5 - AKT(RNAi) down regulates proliferative cells. (A) AKT(RNAi) down regulates mitosis AKT(RNAi) (54 cells/mm2, ±33.7), compared to the control (240 cells/mm2, ±14.5) (P=0.000016). (3 separate experiments, n=16). (B) AKT(RNAi) down regulates mitosis early as day 20 and maintains equal down regulation 30-40 days. (C) AKT(RNAi) by feeding shows down regulation of proliferation compared to fed controls.

Therefore to first understand the effects of AKT on stem cell function and proliferation, we down regulated AKT using AKT(RNAi) by injection and feeding and fixed the animals using Carnoy fixationmethod. To measure cells that have proliferated and are in the mitotic phase, we performed immunostaining using histone 3 phosphorylated on serine 3 (H3p) antibody on intact whole animals. Quantification of H3p positive cells 30 days post first AKT(RNAi) injection indicated a ~4.4 fold significant (P=0.000016) reduction in mitotic cells in the AKT(RNAi) (54 cells/mm2, ±33.7), compared to the control (240 cells/mm2, ±14.5) (Fig 5.5A). To further assess changes in cell proliferation, we quantified mitosis 20, 30, and 40 post first AKT(RNAi) injection. This time course RNAi down regulation over 40 days shows gradual mitotic down regulation in starved animals. We see a ~2 fold down regulation of mitotic cells 20 days post first injection compared to the ~4.4 fold down regulation observed by day 30 and 5 fold down regulation by day 40. (Figure 5.5B). Further AKT down regulation by feeding RNAi also significantly down regulated mitosis by ~3 fold (Fig 5.5C). This down regulation was observed across a 40 day span. Comparing the mitotic cell numbers across an area between the starved and AKT(RNAi) injected and AKT(RNAi) fed animals indicate an increase in cell proliferation in the fed animals compared to starved animals. This implies that upon AKT down regulation, the animals are still responding to food, and the stem cells are responding to metabolic cues.

Figure 5.6 - AKT(RNAi) decreases Brdu in cooperation (A) 12 hour Brdu In cooperated control worm (B) 12 hour Brdu in cooperated AKT(RNAI) animal. Error bar = 200um (C) Brdu is in cooperated into controls and not AKT (RNAi). Controls 321.019mm2 and AKT(RNAi) 9.55mm2 Brdu+ cells. (Two separate experiments, n = 14) (p= 0.001 by Student T test). Double staining with H3p and Brdu shows an overlap of H3p+Brdu+ cells in the control, but no overlaps were found in the AKT(RNAi). (One experiment analyzed, therefore no error bars are shown)

Brdu is a thymidine analog that can be incorporated into DNA as a substitution for thymidine during S phase of the cell cycle and is commonly used to assess cell proliferation. Brdu pulse chase analysis will detect cells that are in the S phase or was able to successfully complete cell cycle. Duration of the mammalian normal cell, cell cycle is implicated to be between 16 – 24 hours. However long Brdu pulse chases by the soaking method was toxic for the AKT(RNAi) animals, and therefore the pulse chase was performed for 12 hours. 30 days post first AKT(RNAi) injection we performed immunostaining for 12 hour pulsed Brdu labeled intact whole worms. 12 hours post Brdu in cooperation, control animals contained 321.019mm2 Brdu positive cells while AKT(RNAi) animals had 9.55mm2 Brdu+ cells (Fig 5.6 A-C)). This implies that AKT(RNAi) animals maintains slow and down regulated proliferation levels.

An attempt to double stain Brdu with H3p mitotic marker provided the number of cells that entered or completed S phase and G2/M phases of the cell cycle during the 12 hours of Brdu pulse chase. Control animals double stained for Brdu and H3p at a rate of 18.38mm2 post 12 hour Brdu pulse chase while AKT(RNAi) animals did not have any cells with Brdu and H3p over lapped stain (Fig 5.6 C). Since AKT function has been implicated in all phases of the cell cycle I hypothesize that the inhibition of AKT might increase the duration of the different phases of the cell cycle and thereby will contain lower Brdu in cooperation and less mitotic cells.

C G 1 phase S phase G2/M phase Control 62.7 ± 0.4 7.46 ± 0.7 30.47 ± 0.6 Smed-TOR(RNAi) 70.3 ± 0.5 0 ± 0.4 29.7 ± 0.8

Figure 5.7 - AKT down regulates impairs cell cycle progression. Compared to control, AKT(RNAi) arrests cells at G1. Frequency percentages indicate that there is an overall impairment in cell cycle progression. (C) Table representing data obtained by two independent representati shown.

Fluorescence-activated cell sorting (FACS) methods can be utilized to assess the abundant stem cells present in planaria. We used DAPI or Draq5 DNA markers to assess cells at different phases of the cell cycle. 30 days post RNAi injection AKT(RNAi) exhibited a slight up regulation of cells at G1 phase and 0% cells at S phase compared to the controls (Fig 5.7). This data together with the H3p and Brdu data reveals the possibility of cell cycle impairment in the absence of AKT. Since neoblasts are the only proliferative cells present in the planaria, we can hypothesize that AKT is important for stem cell proliferation.

5.2.3 - Planarian AKT affects neoblast markers and their function

Neoblasts are the only proliferative cells in the planaria. An array of published data has confirms the existence and conservation of cell cycle genes and these can be utilized to understand the levels of cell proliferation. Further stem cell markers characterizing planarian neoblast populations have also been characterized: Smedwi-1, Bruli-1, nanos. In order to understand stem cells and their function in the absence of AKT, we performed

Figure 5.8 - Neoblast markers are down regulated upon AKT(RNAi). (A) Control Smedwi-1 shows ubiquitous expression (B) AKT(RNAi) animals do not show any smedwi-1 expression (C) Smedwi-1 expression (D) Cyclin B expression (E) Bruli expression (F) Nanos expression is down regulated upon AKT RNAi. Error bars = 200um. Each experiment have been performed at least 2 times.

58 gene expression analysis on several neoblast, early division progeny and late division progeny markers.

ISH (in situ hybridization) analysis of Smedwi-1, a neoblast marker showed near complete elimination of its mRNA expression upon AKT down regulation (Fig 5.8 A-B) (3 separate experiments, n=12). Quantification analysis by quantitative pcr showed a 5.5 fold down regulation of the Smedwi-1 gene expression 40 days post first AKT(RNAi) Injection (Fig 5.8 C) (3 separate experiments). Since Smedwi-1 is only implicated as a neoblast marker we assessed Cyclin B which is also a neoblast marker, a cell cycle regulator and is known to be up regulated in response to AKT activation [122]. Cyclin B maintained a ~9.6 fold down regulation in its gene expression with the perturbation of AKT (Fig 5.8 D). Down regulation of bruli in planaria has shown to eradicate all mitotic cells implying that it is required for stem cell proliferation and maintenance in the S. mediterranea [71]. Quantitative analysis of bruli in AKT(RNAi) indicated a 6 fold down regulation compared to the control and this was comparable with the Smedwi-1 gene expression down regulation (Fig 5.8 E). Smed-nanos a nanos like gene expressed primarily in planarian germ cells however was not compromised by AKT(RNAi) [123] (Fig Fig 5.8

Figure 5.9 – Neoblast progeny markers are down regulated upon AKT(RNAi) (A) Control NB.21.11e shows ubiquitous expression (B) Control AGAT-1shows ubiquitous expression (C) AKT(RNAi) NB.21.11e expression is completely down regulated (D) (C) AKT(RNAi) AGAT-1 expression is completely down regulated Cyclin B expression (E) NB.21.11e and (F) Agat-1 expression measured by quantitative pcr is down regulated upon AKT RNAi. Error bars = 200um.

F). This data with the H3p , Brdu and DAPI stains indicates that AKT down regulation impacts the gene expression and thereby the progression of the cell cycle in planaria.

Planarian cell populations post the proliferative stem cell stage can be characterized based on the radiation sensitivity: early division progeny and late division progeny. The early division progeny marker NB.21.11e was decreased in the AKT(RNAi) completely as seen by ISH staining (Figure 5.9 A & C) and quantitative pcr (Figure 5.9 E). Further the late division progeny marker AGAT-1 was completely eliminated by AKT suppression. ISH staining and qpcr both portray complete elimination of the Agat-1 expression (Figure 5.9 B, D, F). Whether this suppression in stem cell and progeny markers is due to a down regulation in neoblast proliferation and differentiation or whether AKT is involved with regulating the expression of these specific genes needs further investigation. AKT is also known as a pro survival gene and is involved with suppressing cell death. Thus we could also assume that AKT down regulation might be increasing cell death and eliminating neoblasts and their successive progeny.

5.2.4 - Planarian AKT down regulation increases cell death

AKT plays a pro survival role, and down regulation of AKT activates various death pathways in vivo and in vitro. Apart from programmed cell death, AKT could initiate necrosis, mitotic catastrophe and anoikis. Thus in order to understand the level of survivability of the planaria in the absence of AKT(RNAi), 30 day injected animals were

Figure 5.10 – Neoblast progeny markers are down regulated upon AKT(RNAi) (A) Control NB.21.11e shows ubiquitous expression (B) Control AGAT-1shows ubiquitous expression (C) AKT(RNAi) NB.21.11e expression is completely down regulated (D) (C) AKT(RNAi) AGAT-1 expression is completely down regulated Cyclin B expression (E) NB.21.11e and (F) Agat-1 expression measured by quantitative pcr is down regulated upon AKT RNAi. Error bars = 200um.

Figure 5.11 – AKT regulates cell proliferation via the TORC1 pathway. Down regulation of AKT with and without the TORC1 complex (TOR and Raptor) down regulates cell proliferation. Rictor down regulation increases cell proliferation. Each experiment has been performed at least two times with n>10 animals. Significance measured by student T test p > 0.0001 in each case) fixed and stained for TUNEL positive cells. Conferring the AKT cell survivability and anti- apoptotic nature, the animals lacking AKT contained massive cell death: Control 220.67 ± 15 mm2 , AKT(RNAi) 1613.15 ± 672 mm2 (Fig 5.10 A-C). Thus the lack of proliferative cells and the successive progeny also could be due to the massive cell death encountered. Due to the nature of TUNEL positive cells, we can assume that all cells in the system are probably affected. To assess whether the cells are dying due to programmed cell death or apoptosis, I plan to perform caspase 3 and annexin V staining.

5.2.5 - AKT regulates cell proliferation probably via the TORC1 pathway

Studies had previously shown that TOR mediate pathways has implications towards cell death and cell proliferation [114]. Since AKT has regulatory functions with the TORC1 and TORC2 pathways, I assessed the combinatory effects of AKT with molecules belonging to the TORC1 and TORC2 pathway (Figure 5.11). Mitotic analysis revealed that TOR and AKT RNAi combination down regulated cell division implying synergistic events for both molecules. In particular down regulation with Raptor revealed that some of these regulatory functions are mediated by the TORC1 pathway. Whether this down

61 regulation is due to cell cycle arrest or whether it’s due to increased cell death needs further investigation.

Interestingly Rictor down regulation increase cell proliferation even more than control animals. Synergistic down regulation of AKT and Rictor which impacts the TORC2 pathway up regulated the observed proliferative cell populations, implying in the absence of Rictor or the TORC2 pathway, AKT could be involved with mediating an increase in cell proliferation. However down regulation of Rictor might mediate bonding of Raptor with TOR initiate a possible up regulation in the TORC1 complex and it’s activities and this has been directly involved with cell cycle progression and cell growth. Whether the increase in cell proliferation is due to an increased activity of the TORC1 pathway or whether TORC2 pathway plays a role towards this function remains further investigation.

5.3 - Conclusion

AKT/TOR/PI3k pathway is an important signaling pathway garnered much attention due to cancer progression with the impairment of this pathway. PTEN tumor suppressor that controls this pathway is one of the highest mutated factors in human cancers. Thus understanding the in vivo effects of AKT remains fundamental. The embryonic lethality and the incapability to correctly assess the in vivo normal effects of AKT using mouse partial and tissue specific knock downs, mars our understanding about its regulation. Thus planaria provides an excellent model organism that could be utilized understand in vivo regulation of AKT.

Conferring the pro apoptotic nature of AKT observed in other model organisms, AKT(RNAi) animals produced massive cell death. This further showed a decrease in proliferation down regulating the neoblast population. As a consequence the successive early division and late division progeny of the animal too was down regulated. The size reduction conferred with the down regulation in proliferation and increase in cell death. Thus I the absence of AKT impaired tissue homeostasis. Some of the proliferative and possibly cell death could be mediated together with the TORC1 and TORC2 pathway. How each of these pathways are involved to regulate AKT and promote cell proliferation and or cell death remains to be investigated.

Chapter 6

Bioinformatics Analysis of the DNA Damage Reparative Mechanisms in Schmidtea mediterranea

6.1 - Introduction

6.1.1 – DNA damage is induced by various extrinsic and intrinsic factors

DNA contains the genetic information essential for life and diversity. Therefore maintaining DNA integrity is fundamental for cellular functions in all living organisms. DNA is a chemical structure composed of nucleotides that contain phosphate groups, deoxyribose sugars and a nitrogen containing base. Thus this structure can be altered due to various extrinsic and intrinsic influences. All living species are at a risk of been continuously exposed to DNA damaging agents. This can be attributed to the occupational, scientific, technical advancements humans have achieved over the centuries. Though these achievements have vastly changed our life style and health, they have caused various environmental changes increasing the rate of the DNA damage that occurs within our cells. Examples for external DNA damaging agents include chemicals, ultraviolet (UV) light, ionizing radiation (IR) and heavy metal ions [124-127] (Figure 6.1). These damaging

Figure 6. 1 – DNA damage and Repair pathways All living species are at risk of continuous DNA damage caused by intrinsic and extrinsic sources. UV light, Ionizing radiation, pesticides, chemicals and environmental conditions are examples for extrinsic sources. DNA damage can occur as Bulky adducts, alkylation of bases, mismatches due to insertions and deletions, single strand breaks and double strand breaks. Depending on the type of damage incurred, different repair mechanisms will be utilized to repair the damaged DNA.

63 agents cause an increase in the reactive oxygen species (ROS) within cells, attributing to the DNA damage, compromising the integrity and the stability of the DNA chemical structure [128]. Apart from external environmental assaults, DNA damage could occur due to internal factors such as errors caused during DNA replication and oxidative stress [129, 130]. DNA alterations can be categorized into two types: (i) modifications of a single nucleotide sequence, also known as point mutations, and (ii) disruption of the DNA structure characterized by double stranded breaks (DSBs). The type and the severity of DNA damage can be based on whether it is caused by internal or external stimuli and the severity of the assault.

Fortunately, there are cellular mechanisms that respond and attempt to repair DNA damage. The efficiency of these mechanisms are linked to the severity and amount of induced damage. Cells that have been damaged will first attempt to repair the alterations, and if unable will undergo senescence or programmed cell death [131]. Thus cell viability is greatly compromised during DNA damage. In certain instances, if the cell is incapable of repairing the DNA or remove itself through programmed cell death, it can incur mutations that can become malignant, inducing uncontrolled cell division. Consequences of damaged DNA can lead to development of various diseases such as cancer, Xeroderma pigmentosum, Cockayne's syndrome, ataxia telangiectasia, Fanconi anemia, and Bloom's syndrome[132]. Thus, understanding molecular mechanisms of the DNA damage response and repair is critical to identify the etiology of diseases, and to design effective therapeutic approaches.

6.1.2 – DNA damage: Repair

DNA damage can occur as double stranded breaks (DSBs), single stranded breaks (SSBs), DNA adducts, base alkylations, point mutations, substitutions and deletions [133]. Organisms have created Specific pathways to counteract these damages and utilize different pathways to repair the damaged DNA. The involved pathways are described in figure 1.

The most severe and less understood form of DNA damage is the DSB pathway [134-137]. Though many studies have been done to understand the complexity of the Double stranded breaks (DSBs), the pathways related remain less understood. DSBs also cause severe DNA damage and due to these reasons, I will be focusing on understanding damage and repair mechanisms related with DSBs. DNA Double stranded breaks occur when both strands of the DNA double helix are broken in close proximity [127]. DSBs cause genetic instability that can lead to many disease causing malignancies such as cancer. Therefore the cell has devised various mechanisms to repair the damaged DNA. DNA damage response is triggered via a complex signal transduction pathway. First, when the DSBs occur, sensory proteins will recognize the sites. Then a signal transduction pathway activates transducer molecules, which will then activate effector proteins involved with a DNA repair mechanism (Figure 6.2). If the cell was unable to repair the error successfully,

64 the cell will go through apoptosis [138]. Therefore the pathway involved with DNA repair needs to rapidly recognize the error and repair it immediately in a highly coordinated manner.

DSBs can be repaired via two main mechanisms: (I) homologous recombination (HR): and (II) non-homologous end joining (NHEJ). The NHEJ pathway is further divided

Figure 6. 2 – DNA damage response mediation In response to double stranded breaks, various molecules that act as sensors will be activated. These sensors will activate transducers, which are involved with the phosphorylation and the activation of effector molecules. Depending on the cellular stage and environment the cell will activate effector molecules belonging to HR or NHEJ pathways.

into Classical NHEJ pathway (C-NHEJ) and alternative NHEJ pathway (A-NHEJ). The DNA repair mechanism of choice is dependent on the cell cycle phase and the complexity of the DSB. Between the two mechanisms, HR probably is the DNA repair mechanism of choice, since it is very efficient and less error prone. HR is activated in cells that are

65 progressing through the cell cycle. During cell cycle, HR uses a homologous template to copy the damaged DNA region. The NHEJ pathway is activated when the cells cannot enter cell cycle and therefore do not require a homologous template to copy the damaged region. Thus this is an error prone repair mechanism [139]. Both mechanisms are complex and are operated by various transducers and effector proteins (Figure 6.2).

6.1.3 - Homologous Recombination Pathway

Homologous recombination (HR) is a pathway that is activated upon various genotoxic stresses that create double stranded breaks. Since HR requires undamaged chromosomes for a process known as strand invasion, this mechanism can only be activated during cell cycle progression. Thus the HR mediated repair is template dependent and confers high fidelity, error less DNA repair system, that is conserved across all living organisms. Studies in BRCA2, a crucial factor involved with HR, have established a prominent role for this pathway during diseases such as cancer and fanconi anemia. However specific in vivo studies providing roles for HR during systemic homeostasis, tissue repair and regeneration still needs characterization. Mutation or knock down studies in most curial HR pathway components has shown that compromisation of this pathway leads to embryonic lethality. Thus the lack of a model organism to decipher the HR pathway mechanism creates a barrier towards discerning the importance of this pathway.

HR can be divided into 3 main phases: presynapsis, synapsis and postsynpasis. During pre-synapsis, DSB sensors such as the MRN complex will associate with the DSB sites, recognize and mediate signals to activate downstream repair pathways. Further specific endonucleases will cleave the ends of the damaged DNA and prepare the DNA to contain a 3’ overhangs or 5’ – end resections for a clean repair process. Once the sensors have detected breaks, several pathways could be activated and compete to repair the DSBs: HR, NHEJ, SSA. During this process RPA, a hetrotrimeric protein confers high affinity towards ssDNA at damaged DSB sites, ad binds to them. This binding of RPA to ssDNA minimizes degradation of DNA at the damaged sites. In vivo, several mediator proteins facilitate to form Rad51 nuclear filaments on the RPA coated ssDNA [140]. Rad52, Rad51 paralog complexes and BRCA2 are known important mediator proteins that are vital to promote Rad51 foci formation during DNA damage. However this is a complex process and most studies have been performed in vitro. Since in vivo and in vitro studies do not necessarily co relate all the time, understanding this process in vivo requires more attention.

BRCA2 is missing in yeast, it has been suggested Rad52 is more involved with HR mediator function in yeast and BRCA2 in other eukaryotes, BRCA2 function will be detailed in another section. Further Rad54 which does not confer embryonic lethality is required to load and stabilize Rad51 on to the ssDNA and is important for chromatin remodeling and HJ resolution during HR. The complexes formed by Rad51 paralogs, BCDX2 is also known to be important to mediate Rad51 stabilization and acts upstream of Rad51 function and downstream of BRCA2. It has an epistatic function with BRCA2. Thus

66 these mediators help to displace RPA from ssDNA and help replace it with Rad51 filaments.

Synapsis phase consists of search for the homology strand and subsequent strand invasion. The key player during this phase is Rad51. The process of homology search and strand invasion is complex and still under investigation. During this phase Rad51 filaments are loaded on to the ssDNA and could span over several thousand base pairs of DNA. Rad51 has the capability to bind to ssDNA and dsDNA, however in vivo it prefers the binding of ssDNA. This process requires ATP and studies have demonstrated that ADP presence condenses the Rad51 filaments and eventually results in its dissociation. Rad51 contains two walker motifs which contains ATP or GTP and could necessarily initiate the hydrolysis of ATP for the filament formation. The formed Rad51 nucleoprotein filament will now search for homologous DNA strands. To understand this process more Rad51 crystal structure studies during the filament formation step is required. It is thought that the ability of two DNA strands to remain proximal to each other and bind could be important for the Rad51 filament mediated homology search and strand invasion. Further the invading strand has the capability to weakly bind ssDNA and dsDNA both based on homology and specificity. Post this binding, strand invasion by Rad51 filaments are initiated in order to repair the DNA.

6.1.4 Non homologous end joining

NHEJ pathway can be divided into two sub pathways: C-NHEJ (the classical or the canonical NHEJ pathway), A-NHEJ (the alternative NHEJ pathway) [141]. The ATM and MRN complex can activate the C-NHEJ and the A-NHEJ pathways [142]. The C-NHEJ pathway contains the Ku heterodimer, DNA-PK, Artemis, XRCC4, DNA ligase IV and XLF. Most of these components and the functions have been characterized in chapter 7. Ku70 and Ku80 heterodimer plays a crucial role during C-NHEJ pathway while these molecules are not required for the A-NHEJ pathway [142]. A-NHEJ pathway employs molecules such as MRE11, CtIP, Parp1 which also plays crucial role during homologous recombination. Further these two pathways differ in the required ssDNA resection sizes. C-NHEJ pathway requires only short ssDNA resection while A-NHEJ similar to HR requires a longer ssDNA resection to function. However A-NHEJ could also occur in the absence of homologous sequences and similar to C-NHEJ is error prone and can respond rapidly and repair the DNA quicker than the HR pathway.

Table 6.1 – DNA damage responders and repair mechanisms

6.2 Results

6.2.1 – DNA damage pathway sensors

Planarians are described as masters of regeneration. Their remarkable power of regeneration is attributed to the abundance and the plasticity of the planarian stem cells (neoblasts). Planarians also have the capability to withstand high doses of radiation with the sub lethal irradiation dosage ranging between 0 – 1750 rads. This range is remarkable since 850-900 rads is usually lethal to mice [143]. This implies that planarians possess remarkable recovery post induced DNA damage and is evidence to the existence of possible DNA repair machinery. In this thesis, particular interest were given to the DNA repair machinery involved with double stranded break (DSB) repair: Homologous recombination pathway (HR), Non homologous end joining pathway (NHEJ).

With possible conservation of signaling pathways in mind, I delved into the planarian genome sequence database [67] to find various molecules belonging to the DNA repair machinery. The major sensors post DNA damage is the MRN complex consisting of MRE11, Rad50 and NBS-1 (Xrs2 in yeast). This complex has been highly characterized to be involved with DNA damage sensing and associate with each other to perform DNA damage DSB sensing. Once sensed the appropriate HR and NHEJ pathways could be activated by various pathways and checkpoint kinases.

MRE11 is highly conserved across species and contains phosphodiester domains and DNA binding domains. These domains are important for DNA binding [144, 145] and endo-exo nuclease activities at the presence of ssDNA or dsDNA [146]. MRE11 in vivo exist as a complex where one molecule of MRE11 binds to Rad50 protein and forms a complex. Nbs1 is recruited to form the final MRN complex which has been shown to be important for proper DNA repair. Analysis into the planarian genome discovered a region that could be predicted to be planarian MRE11. Pfam and Blast analysis performed showed a calcineurin like phosphoesterase and MRE11 DNA binding domain next to each other (Figure 6.3 A). This sequence contains 70% identities and positivities to the human MRE11 segment. This sequence has since been cloned and some basic studies have been performed (Chapter 10).

Rad50 is a large 150kDa protein that contains ATPase and DNA binding walker domains. Most functions associated with this protein involves DNA binding and unwinding dsDNA [147-149]. Analysis into the planarian genome predicted several ATP binding sites and walker domains that contained ~70% identities and positivities to the human Rad50 protein sequence (Figure 6.3 B and D). Analysis did not yet discover an Nsb1 counterpart within the planarian genome. Rad50 has since been cloned.

Several key molecules belonging to the PIKK family of proteins have been implicated in DNA DSB damage sensor functions: ATM, ATR, DNA-PK. All these proteins contain similar structural domains such as heat repeats, an FAT domain, Kinase

69 domain and an FATC domain. These proteins could function to activate HR or NHEJ or both.

Figure 6.3 – Planarian homologs for MRE11 and Rad50 MRE11 and Rad50 are major components of the MRN complex. (A) Predicted planarian MRE11 sequence contains MRE11 specific calceneurin-like phosphoesterase and a MRE11 DNA binding domain. (B) Predicted planarian Rad50 sequence contains a Rad50 specific AAA domain. (C) Conserved homology for the MRE11, Rad50 and DNA-PKc compared to human sequences.

ATM (Ataxia- telangiectasia mutated) belongs to the PIKK family of proteins and is a protein kinase. Absence of ATM has been implicated with ataxia telangiectasia a neurodegenerative disorder and cancer in humans. Studies have also implicated ATM as an important factor during damaged DSB repair. ATM contains all the landmark domains belonging to the PIKK family of proteins such as mTOR, ATR, SMG1 and DNA-PKc. The N terminal region of ATM contains a region where several heat repeats and nuclear localization signals can be found. This is followed by a FAT domain, the kinase domain and the FATC domain. Investigation into the planarian genome discovered a PI3K (PI3K) domain and an FATC domain that has 68% homology to the human ATM PI3K and ATM FATC domains. These domains did not contain significant homology to the planarian and human TOR and ATR counterparts. The homology of the discovered PI3k and FATC domains to the human sequence has been depicted in figure 11.1.

DNA damage responses can be mediated by ATM or ATR. Undamaged cells contains homodimerized ATM and which is the inactive form [150]. In response to double stranded breaks, ATM gets activated and becomes monomerized and recruited to the nucleus. The process of ATM activation is an area currently under investigation and is greatly debated [150-153]. However in vivo and in vitro studies have shown that the MRN complex is crucial for ATM activation. ATM binding to the NSB1 counterpart helps to retain ATM at the DSB sites [154, 155]. After recruitment, ATM gets auto-phosphorylated, occupies DSB sites and initiates DNA repair responses [156-158].

ATR also belongs to the same PIKK family of proteins similar to ATM and TOR. As depicted in Figure 11.2, ATR shows similar domains as ATM. Genomic analysis using the planarian genome database, a sequence with an FAT and PI3k domain was discovered. Alignment of this sequence to planarian ATM and TOR counterparts did not show significant homology. This sequence had 62% homology to the human ATR PI3k and FAT domains. Compared to the human TOR and ATM, FAT and PI3k domains this sequence did not show significant homology (mk4.015073.00.01).

Absence of ATR renders embryonic lethality. Studies performed in C. elegans have shown that ATR presence is crucial for cell cycle progression [159]. Mei41 an ATR homolog in Drosophila has also shown to be important for cell cycle progression during embryonic development [160]. Kinase dead ATR overexpression however decreases G2/M arrest post DNA damage [161]. The same study also showed that ATR has the capability to compensate ATM-/- condition. While ATM response is primarily towards DSBs caused by IR and intrinsic occurrences such as VDJ recombination, ATR response can be more varying. ATR has the capability to respond to radiation, various chemicals and agents that can damage DNA and recognize intrinsic replication errors. ATR mostly senses DNA damage at stalled replication forks and functions primarily during cell cycle progression. This could indicate that ATR not ATM could be playing a major role during HR mediated DNA repair. In some literature ATM and ATR is also categorized as signal transducers rather than sensors [162]. Either way these two molecules have a major role in the decision of DNA repair.

Figure 6.4 – Planarian homologs for DNA-PKc DNA-PKc has been implicated with NHEJ mediated DSB repair. (A) Predicted planarian DNA-PKc containing a typical PI3/PI4 kinase domain. (B) Second predicted planarian DNA-PKc sequence containing a typical NUC194 domain. (C) Conserved homology for the DNA-PKc sequence in comparison with the human sequence shows 56% similarities.

DNA-PK in contrast has been implicated with NHEJ mediated DSB repair. DNA- PK contains DNA binding capability which is stabilized by the Ku70-Ku80 heterodimer [163, 164]. Thus the main function of DNA-PK is to repair DSBs during NHEJ mediated repair mechanism. Mutation or silencing DNA-PK results in defective DSB repair and V(D)J recombination [165]. How DNA-PK could contribute towards HR still needs to be investigated [166, 167]. The contig mk4.021130.00.01 though with low similarities and identities (~42%) contains a NUC194 domain which is typically found in DNA dependent protein kinases. Another contig mk4.001198.00.01 maintains higher positives and identities to the human DNA-PK (~56%) and contains the possible kinase domain of the planarian DNA-PK (Figure 6.4 A & B).

Figure 6.5 – Planarian homolog for PARP-1 PARP-1 is a DNA damage sensor (A) Predicted planarian PARP-1 containing a WGR domain, PARP regulatory domain and a PARP catalytic domain. (C) Conserved homology for the PARP-1 sequence in comparison with the human sequence shows 69% similarities.

PARP family is a large family of proteins consisting of 18 proteins with a common PARP catalytic domain. This family has been highly implicated for the use of DNA damage sensing by its N terminal Zn finger domain and repair. PARP-1 (poly(ADP-ribose) polymerase-1) at the presence of DNA damage will mediate accessibility and recruit important repair based molecules such as XRCC1 [168, 169]. Sirtuins such as SIRT6 promote DSB repair and is involved with this mechanism with PARP-1 [170]. PARP-1 acetylation is mediated by p300 and is important for its function. However SUMO1 and SUMO3 have known to inhibit PARP-1 acetylation thereby mediating genomic stability

73 by inducing cell death. However, in higher eukaryotes PARP-1 does not play a major role towards DSB repair but more towards single strand DNA repair [171]. Analysis into the planaria genome has revealed a PARP-1 homolog with high homology (mk4.003135.10.01 and mk4.003135.10.02 - ~69% similarities) to the human counterpart (Figure 6.5 A & B). Whether this homolog is functionally conserved with the mammalian PARP-1 remains to be investigated. Further Sirtuin homologs for Sirtuin 2,3,4,5 and 6 have been discovered.

6.2.2 – DNA damage mediators

Post DNA damage sensor recruitment, mediators play a crucial role towards DNA damage responses and repair. They are checkpoint proteins and will transduce DNA damage signals and will usually function post phosphorylation by kinases [172] . Mediator proteins also function to act as a bridge between proteins and mediate protein-protein interactions [173]. Thus activated mediators play crucial roles during cell cycle arrest and decisions in DNA repair pathways [162]. Most of these mediators are activated by ATM and or ATR and contains BRCT domains. The best known mediator is Rad9 in yeast. However a homolog for Rad9 is absent in human and a homology search in planaria too did not retrieve a Rad9 homolog. Thus mediators found mainly in mammals can be categorized as those mediated and phosphorylated by ATM or ATR checkpoint kinases. ATM phosphorylated mediators: γH2AX, MDC1, BRCA1, 53BP1. ATR phosphorylated mediators: γH2AX, TOPBP1, Claspin.

H2Ax is a variant of the H2A histone protein family. Histones play a crucial role to form the core nucleosome around the DNA. Upon DNA damage, H2Ax gets phosphorylated by ATM and or ATR and forms γH2Ax foci [162]. The formed foci formation can be utilized to identify damaged DNA and cells. But importantly, phosphorylation of H2Ax is a signal to recruit DNA repair based molecules to the damaged sites to begin efficient repair. This further helps to retain mediator proteins such as BRCA1, MDC1, NBS1 and 53BP1 [174-176]. Human H2Ax gets phosphorylated at Ser139 and therefore it will be interesting to find whether this phosphorylation site is conserved within the planarian genome. Planarian sequences genome contained two sequences that contained significant homology to the H2Ax in other species (Figure 6.6A). However the planarian predicted H2Ax sequence did not contain a serine at position 139, and therefore more analysis and functional studies needs to be performed to understand the planarian H2Ax phosphorylation and function during DNA damage.

MDC1 (DNA damage mediator-1) has two BRCT repeats in the C terminal, a PST domain and an FHA domain in the N terminal region [177]. The FHA domain also exists in chk2, Rad53 and Nbs1 [176]. MDC1 gets phosphorylated by both ATM and ATR and rapidly gets recruited to the DNA damage sites [175]. In vitro studies have demonstrated that γH2Ax gets recruited to the damaged sites within a few minutes while MDC1 gets recruited post this time line by 15 minutes after damage occurs. The foci formed by MDC1 seem to overlap with γH2Ax and studies suggest that it exist as a complex at the damaged

74 sites. [176] The MDC1 at this point is involved with recruiting proteins such as BRCA1 and TOPBP1 to help mediate DNA damage responses. Planarian genome contains a sequence that shows homology (~51%) to the human MDC-1 protein (Figure 6.6 B). How this protein is involved during DNA damage response and repair still needs investigation.

Claspin is an ATR phosphorylated DNA repair mediator and is important to phosphorylate and activate chk1 [178, 179]. Studies have shown that activated Claspin

Figure 6. 6 – Planarian homologs for H2Ax and MDC-1 H2Ax and MDC-1 are important DNA damage mediators (A) Predicted planarian H2Ax sequence contains high homology, however the ser139 phosphorylation site does not seem to be conserved. (B) Predicted planarian MDC-1 sequence contains 51% homology to the human MDC-1.

75 down regulates cell proliferation and its function for G/M DNA damage checkpoint [180]. Since ATR functions during cell cycle progression, Claspin essentially would be an important mediator during HR. Claspin proteins has several domains crucial for the above function. At the N terminal end, a replication for interaction domain and a Cdc45 binding domain has been recognized. At the C terminal a Chk1 binding domain (CBD) has been recognized and this is crucial for its chk1 activation [181]. A sequence with ~59% similarities to human Claspin was retrieved (Figure 6.7 A). However whether this is the true Planarian Claspin, and is functionally conserved remains to be answered. With its

Figure 6. 7 – Planarian homologs for Claspin and TOPBP1 Claspin and TOPBP1 are important DNA damage mediators (A) Predicted planarian claspin sequence contains 59% homology to the human Claspin (B) Predicted planarian TOPBP1 sequence contains 50% homology to the human counterpart. The identified BRCT domains are conserved with the human TOPBP1.

76 connection to ATR and possibly the HR pathway this might hold valuable clues towards HR mediated DNA damage repair, maintenance of homeostasis, tissue repair and regeneration.

TOPBP1 (DNA topoisomerase II-binding protein 1) N terminal mainly contains BRCT domains and analysis into the planarian genome retrieved a sequence with 5 BRCT domains and ~50% similarity to human TOPBP1 protein (Figure 6.7 B). TOPBP1 inhibition is known to create embryonic lethality indicating its importance during development and cell proliferation [182]. Similar to Rad51 embryonic lethality, TOPBP1 deficient embryos at E7.5 seems to be resorbed. Further the cells contained an increase in γH2Ax formation indicating a decline in proper DNA repair. Whether the developmental defects are because of the increase in DSB damage remains to be investigated. However comparing the functional roles between Rad51 and TOPBP1 in studies done prior, identify a link between TOPBP1 and Rad51. The planarian model system provided an in vivo system to study Rad51 down regulation in an adult organism. Thus this model organism could provide valuable clues towards our understanding regarding TOPBP1. Further TOPBP1 impacts proper V(D)J recombination in pro B and thymocytes during development [183].

Analysis into the planarian genome still did not retrieve homologs for DNA damage mediators BRCA1 and 53BP1.

6.2.3 – DNA repair and Cell cycle control

DNA damage could induce DNA repair post cell cycle arrest, or initiate cell cycle progression in spite of DNA damage or induce programmed cell death. Cell cycle arrest involves “checkpoints” that helps to monitor proper cell growth and genomic stability. G1/S checkpoint restricts cell cycle progression from the restriction point (R). The crucial component during this pathway is Rb tumor suppressor that inhibits E2F transcription factor. In response to DNA damage, ATM and or ATR can activate Chk1 and Chk2 which blocks the CDK activity and arrests the cells at the G1/S phase. At this position, the cell could attempt to repair the DNA, probably through NHEJ pathway or program the cell to death.

The G2/M checkpoint occurs post the DNA synthesis phase and thus prevent cells with damaged DNA from progressing into the mitosis phase. Therefore the preferred pathway to repair damaged DNA would be the HR pathway, though NHEJ pathway could potentially participate as well. However whether there is a competition between HR and NHEJ during this phase remains an open ended question. Upon DNA damage wee1 and Myt1 inhibits CDK1 and prevents the CDK1/Cyclin B formation inhibiting cell entry into the M phase. Further Cdc25 dephosphorylates CDKs in order to inhibit their function. Further ATM, ATR, Chk1 and Chk2 all have been shown to phosphorylate p53 which prevents Mdm2 binding to p53 and increases its protein half-life and stabilizes it. p53

Figure 6. 8 – Planarian homologs for Wee1 and Myt1 Wee1 and Myt1 are important cell cycle regulators (A) Predicted planarian Wee1 sequence contains 48% homology to the human Wee1 sequence (B) Predicted planarian Myt1 sequence contains 72% homology to the human counterpart. The identified sequence contained typical zf-C2HC domains. accumulation then is involved with transcribing genes important for DNA repair and or apoptosis [184].

p53, chk1 and chk2 homologs have been discovered in the planaria previously [36]. Further cyclin A,B and D also have been characterized in the planaria [185]. Thus I

78 proceeded to look for wee1 and Cdc25 homologs important for G2/M cell cycle checkpoint arrest. A possible Myt1 homolog containing two repeats of zf-C2CH domains were discovered in the planarian genome. These domains contained ~72% similarities to the human Myt1 C2CH domains (Figure 6.8 B). Wee1 is a protein kinase with a distinct protein kinase domain at the C terminal of the protein. A homolog with 48% similarity to the human Wee1 protein kinase domain was found in the planaria (Figure 6.8A). Cdc25b and Cdc25c homologs were also found with ~50% conservation containing significant domains found in human Cdc25 proteins (mk4.000159.09.01, mk4.001222.02.01 and mk4.000437.06.01). Finding the functional conservation of these protein relative to the G2/M arrest and it’s connection to the HR pathway might provide better understanding about DNA damage response in the planaria.

6.2.4 – DNA repair through homologous recombination

DNA repair pathways contain varying amounts of structural conservation across species. The amount of sequence identity of key major players in DNA repair pathways, and the number of genes in proper pathway function varies based on the complexity of the organism. Even though the sequence identity is not always conserved, the function initiated by the pathways seems to be highly conserved across species. One pathway that maintains high degree of functional conservation is the homologous recombination pathway since components of this pathway have been known to repair DSB efficiently across bacteria, fungi, plant and animals. HR possesses high fidelity DNA repair capabilities and is the chosen pathway during cell cycle progression.

Several Rad51 related proteins are embryonically lethal and therefore understanding their in vivo function remains a challenge. Other molecules of high relevance are BRCA2 and RPA. These molecules are highly conserved structurally and functionally across species. Understanding their functions remains higher relevance in my thesis. Thus I focus on explaining these molecules and their function in chapters 7 and 8.

Upon DNA damage the exposed ssDNA are coated by RPA in an attempt to stabilize and prevent exonuclease degradation and formation of secondary structures [186]. In order to repair the DNA, Rad51 needs to replace RPA and perform strand invasion and homologous search. Rad52 in Saccharomyces cerevisiae plays a major role to repair DSBs through homologous recombination by helping to displace RPA and further aiding the Rad51 nucelofilament formation [186-188]. Rad52 is a key player and is involved with further forming a heptameric ring with Rad59 to facilitate HR mediated repair [189]. However no homolog for Rad52 could be found in the planaria. Rad52 unlike Rad51 and BRCA2 is not embryonically lethal and how this protein mediates Rad51 function in mammalian systems remains an open question. However it is believed that BRCA2 might

Figure 6. 9 – Planarian homolog for Rad54 Rad54 is an important component of the HR pathway (A) Predicted planarian Rad54 sequence contains 80% homology to the human Rad54 sequence and contains typical helicase domains.

be playing a crucial role in the place of Rad52 in mammals [190]. Which seems to be similar to planarian BRCA2-Rad51 mediated HR repair as described in chapters 7 and 8. Whether the lack of Rad52 in the planaria is due to efficient BRCA2 function needs further investigation. However, in vitro BRCA2 deficient human cells still mediate HR repair with the help of Rad52. Whether the additional Rad52 function in the absence of BRCA2 is the

80 missing link towards tumor progression in vertebrate cells remains a perplexing open ended question.

Figure 6. 10 - Planarian homolog for Fen1 Fen1 is an important components of the NHEJ pathway (A) Predicted planarian Fen1 sequence contains 84% homology to the human Fen1 sequence and contains typical XPG-N and XPG-I domains.

Rad54 proteins first identified in Saccharomyces cerevisiae belongs to the snf2- family of SF2 helicases. These helicases has the capability to modify chromatin which is crucial for DNA repair mechanisms[191]. Rad54 knockout mice are not embryonically lethal, however the germline of these mice are compromised [192]. Further in mice Rad54 deficiency lowers the HR repair, and activity is closely linked towards telomere length maintenance [193]. Yeast studies further shed light clearly demonstrating increased IR sensitivity in Rad54 deficient cells [194, 195]. Rad54 has known to be involved during several phases of the HR repair pathway: Rad54 ATP hydrolysis initiates DNA remodeling and helps Rad51 to efficiently form D loop structure [196], stabilizes Rad51 bound to the ssDNA or dsDNA during filament formation process and then helps to disassemble Rad51 filaments from dsDNA [197, 198], and chromatin remodeling [199, 200]. Available

81 sequenced planarian genome provided a highly homologous sequence to human Rad54 (~80%) (Figure 6.9). Cloning of this gene might help us to unravel important HR mediated repair mechanisms in vivo in the planaria.

Fen 1 protein has high homology to human counterpart and can facilitate NHEJ and HR. See section 6.2.5 and figure 6.10 for more details.

6.2.5 – DNA repair through non-homologous recombination

Cells that are not dividing, or lacks the S phase progression capability could initiate DNA repair via the NHEJ pathway. NHEJ repairs cells when there is no homology donor to provide the correct sequence strand information, thus compared to HR, NHEJ is more error prone. However NHEJ pathway maintains remarkable flexibility with the various DNA overhangs it accepts upon DNA damage and the biochemistry of the protein- substrate association towards joining fragmented DNA still remains a mystery [141]. Thus this is a survival mechanism that is initiated when genomic instability could compromise the homeostasis and viability of an organism. During NHEJ pathway, the occurred DSB damage will first be recognized, then the nucleases will perform exo- and endonuclease activity to cleave the 5’ and 3’ overhangs and get the damaged edges ready for joining. Next the polymerases will synthesize and add nucleotides to the broken ends and the ligases will help to bind the broken strands together. The following passages demonstrate some of the key players involved with this pathway and the possible homologs found the in the planaria. Based on homology and availability of specific proteins, NHEJ pathway at the structural levels remains conserved in the planaria.

Damage recognition

Ku70 and Ku80 proteins in response to DSB damage binds to the ends of the damaged DNA and help to recruit other important factors involved with NHEJ pathway. Thus ku70/80 heterodimer is vital for the NHEJ pathway. Mice lacking ku70 and or ku80 do not show embryonic lethality and are fertile. However they show immunodeficiency and growth defects at the adult stages. This might imply that the NHEJ pathway though not important during developmental stages might be important for homeostasis at adult stages in mice [201]. Homologs for Ku70 and Ku80 were discovered in the planaria and these will be characterized more in chapter 10. Further the MRN complex also could mediate to process the DSB break regions and help recruit molecules involved with DNA repair [202].

Endo-Exo nuclease activity and DNA end processing

Ku complex recruits nucleases, polymerases and ligases in order to perform DNA repair. Artemis protein is a nuclease that gets activated by phosphorylation by DNA-PKc and complexes with it to form the Artemis:DNA-PKc complex. [203]. This complex cleaves 5” and 3” overhangs and further nicks hair pins and gets the broken DNA strands ready for the ligation process which is mediated by XRCC4:DNA IV ligase complex [203, 204]. This complex possesses flexibility with the site of cleavage performing 5’ to 3’ and 3’ to 5’ cleavage and therefore is versatile [203, 205]. Analysis into the planaria genome did not retrieve an Artemis homolog, but a DNA-PKc homolog exists. Details about this homolog have been described in section 6.2.1 DNA damage pathway sensors. Thus, DNA- PKc could have a homolog or an ortholog for Artemis in planaria and this needs further investigation.

Other than the Artemis-DNA-PKc pathway, Fen1 ((Flap structure specific endonuclease 1 or Rad27) could also be involved with nuclease activity performing 5’ to 3’ exonuclease activity. Fen1 has the capability to bind to PCNA, and PCNA activates the nucleatic activity rendered by Fen1 [206]. However Fen1 also could have other roles in other pathways such as HR and BER [207, 208]. Very interestingly a FEN1 homolog with a remarkable 73% homology was detected in the planaria genome. The discovered sequence contained an XPG-N domain and an XPG-I domain as seen in the human Fen1 counterpart (Figure 6.10). How this molecule could impact the NHEJ and HR individual pathways or how it impacts the overall homeostasis of the planaria remains to be investigated.

Ligation

Post polymerase activity, the ligases will aid the end joining of the broken strands. Several ligases have been suggested as crucial ligases during the NHEJ pathway. The most flexible ligase is DNA ligase IV and it has the capability to effectively ligate double stranded DNA and to some efficiency the single stranded DNA [141, 209]. In order for efficient ligase activity, XRCC4:XLF complex needs to aid DNA ligase IV interaction with the damaged ends [210]. However lack of XRCC4 still enables Ligase Iv activity implying other proteins not yet identified could play an important role [211]. Analysis into the planarian genome retrieved a homolog for DNA ligase IV with 60% similarities containing particular domains found in Ligases (Figure 6.11). Whether this is the Ligase IV and whether it’s functionally conserved in the planaria remains to be found. However XRCC4 and XLF homologs have not been retrieved. This is also significant since XRCC4 deficiency causes embryonic lethality. Studies have further demonstrated that deletion of ku70 rescues the XRCC4 lethality [212]. This could imply that XRCC4 is important for other functions than NHEJ ligation mediation. How ku70 knockdown changes the XRCC4 lethality could provide valuable clues towards development, tissue repair and regeneration.

Studies performed in yeast and mice have demonstrated that NHEJ ligation could occur in the absence of Ligase IV [213]. Thus there has to be other components to perform Ligase IV independent joining. Whether such molecules are present in the planaria will remain for the future.

Figure 6. 11 – Planarian homolog for DNA Ligase IV DNA Ligase IV is important components for the NHEJ pathway (A) Predicted planarian Ligase IV sequence contains 60% homology to the human Ligase IV sequence. This particular sequence contains a DNA ligase N terminus, and an ATP dependent ligase domain and an ATP dependent ligase domain C terminus.

Figure 6. 12 – Planarian homolog for Caspase 2 and Cathepsin B Caspase 2 and Cathepsin B are important for DNA damage induced cell death pathways. (A) Predicted planarian Caspase 2 sequence contains 44% homology to the human Caspase 2. This particular sequence contains a CARD domain and a Peptidase domain typical for caspase 2 proteins. (B) Predicted planarian Cathepsin B sequence contains 72% homology to the human Cathepsin 2. This particular sequence contains a Peptidase C1 domain typical for Cathepsins.

6.2.6 – DNA damage induced cell death

Post DNA damage, the cell attempts DNA repair by chromosome rearrangement or by elimination the cell via cell death. Therefore the activation of cell death pathways post DNA damage has been observed and is important for reducing pathology and to maintain normal homeostasis. The major mode of activation of cell death post DNA damage is apoptosis. This has been demonstrated by DNA repair deficient cells which show increased cell death induced by apoptosis [214, 215]. TUNEL analysis between amputated control and lethally irradiated planarian fragments has not shown a difference. This might imply that planarians might not induce extra cellular death post IR and during amputation. However performance of caspase 3 antibody over a IR time course have indicated a constant up regulation of caspase 3 which might mean that there is an increase in apoptosis post IR . (data not shown)

DSB DNA damage can trigger death receptor associated apoptosis pathway or the mitochondrial damage pathway. Both these pathways lead to the activation of caspase 3. Further, UV radiation can also block transcription of RNA, down regulation other modes of cellular activities, providing apoptosis as the as the preferred damage elimination mode. The main pathway of apoptosis activation is through p53 mediation, which is activated by the DNA damage sensors. p53 will in turn activate p21 which induces cell cycle arrest and trigger apoptosis by activating PUMA, Bax, Bak, Noxa which in turn induces cytochrome c release. Cytochrome release activates caspase 9 and caspase 3 respectively programming the cell to die through apoptosis. Planarian p21 or an ortholog for this protein has not yet been discovered. However the Planarian mitochondrial apoptosis pathway is conserved [216]. Thus analysis into the pathway has retrieved a homolog for Bak and this has been implicated to be important for cell death induction through the mitochondrial apoptosis pathway [216]. Further analysis into the genome did not retrieve Bax, PUMA or Noxa. Thus Bak might play an important role during DNA damage to initiate the decision for cell death progression.

AKT has been implied as an inhibitor of apoptosis by inactivating BAD and caspase 9. In the Rad51(RNAi), AKT gene expression is slightly higher in the posterior (data not shown). Thus the decision to induce cell death more in the posterior than the anterior, and allow a few cells to divide could be made by AKT. Double head (DT) and double head (DH) animals injected with Rad51 and AKT combos might shed further light into the matter,

Apoptosis can also occur independent of p53 [217]. p53 family of proteins contains p63 and p73 which also can activate apoptosis independent of p53 [218]. In fact the identified smed-p53 sequence is similar to human p63, except the lack of a SAM domain categorizes it as smed-p53 [36]. Another pathway is mediated by Caspase 2. Caspase 2 can activate cytochrome c or the mitochondrial apoptotic pathway [219]. Caspase 2 has been implicated in DNA damage induced apoptosis as well [220]. Planarian genome contains a homolog for caspase 2 with a 44% homology (Fig 6.12A). Whether this molecule plays a role during DNA damage responses or whether it is recruited during HR or NHEJ pathways

86 remains to be resolved. Further there are caspase independent cell death pathways, induced due to death receptor stimulation. While cellular stress and death receptor stimulation might stay equal in both modes of cell death, caspase independent pathway is activated by lysosomal stress and continuous activation of cathepsins. A cathepsin B homolog with 72% identity and similarities to the human counterpart was recognized in the planarian genome (Fig 6.12 B). This further could illustrate how much different death pathways could be involved and activated upon DNA damage.

Post Rad51(RNAi) the posterior region increases TUNEL expression compared to controls and anterior region of the Rad51(RNAi). However the amount of cell death is relatively higher when stained by TUNEL versus the annexin V or caspase 3 staining. TUNEL assay could stain cells that have died by modes other than apoptosis, implying Rad51 down regulation could trigger more than apoptosis.

6.3 – Conclusion

Figure 6.13 - DNA damage repair pathways are conserved in the planaria DSB sensors, mediators and DSB specific repair genes are conserved and found in the planaria. This figure illustrates a summary of some of the molecules based on mammalian models.

Planaria can retain higher rate of DNA damage induced by IR. This implies that these animals maintain efficient DNA repair mechanisms. Bioinformatics analysis revealed a number of conserved genes related to sensors, mediators, transducers and DSB repair pathways. Understanding the functions of these genes utilizing planaria as a model organism will give an edge to understanding DNA repair pathways and how they are regulated in vivo in the complexity of the whole organism. The conservation of each pathway indicate that planaria could be utilizing HR and NHEJ pathways to help repair DNA. How efficiently these pathways function, and which is the prioritized DNA repair mechanism upon DNA damage has not been elucidated. Thus I will delve more into understanding how these pathways function to mediate DSB repair in the planaria in the subsequent chapters.

Chapter 7

Rad51 is important for DNA Repair, tissue homeostasis and tissue repair and regeneration

7.1 – Introduction

7.1.1 – Rad Related Proteins

Unicellular and multicellular eukaryotic organisms are frequently at risk of DNA damage that can be induced due to extrinsic and intrinsic causes. Therefore cells have evolved several DNA damage induced defensive mechanisms to mitigate the damage and maintain stability. These pathways could; (1) mediate cell cycle arrest until the damage has been restored, (2) activate cell cycle repair mechanisms to repair the damage (3) mediate programmed cell death to eliminate the damaged cell from the cellular pool. Some of the major players during DNA repair belongs to the Rad (Radiation sensitive) related proteins. Rad proteins were initially discovered in yeast as proteins that were extremely sensitive to DNA damaging reagents, specifically to heat and gamma irradiation [221-223]. Since then homologous genes to different Rad related proteins have been discovered in other species [224, 225] . All these proteins are commonly sensitive to DNA damaging agents and are involved with DNA repair. Bioinformatics analysis have confirmed that these genes are highly evolutionarily conserved. As of August 2014, UniProt protein database contains several entries for Rad or radiation sensitivity related proteins and the number of genes present in each organism shown in table 1.

Table 7. 1 - Rad related proteins across eukaryotes (August 2014)

Species Number of entries for Rad related Proteins in UniProt Homo sapiens 33 Arabidopsis thaliana 16 Saccharomyces cerevisiae 458 Mus musculus 61 Drosophila melanogaster 32 Caenorhabditis elegans 15 Danio rerio 18

Several Rad related proteins are embryonically lethal and therefore understanding their in vivo function remains a challenge. The idea that NHEJ, not HR, is the pre dominant

DNA repair mechanism in the mammalian system has taken the focus away from understanding the function of HR and the Rad related proteins involved with this pathway. Mammalian tissue containing the hematopoietic stem cell compartment maintains low cellular turnover and therefore probably utilizes the NHEJ mechanism rather than the energy consuming HR pathway that requires constant cellular turnover [226]. However different mammalian tissues contains different rates of cellular turnover and therefore we still cannot eliminate the importance of HR towards DNA repair in higher eukaryotes. In this particular chapter I will focus on an important Rad related protein, Rad51. This protein is termed Rad51, Rad51A or RecA through this thesis.

7.1.2 - Rad51 family of proteins and Rad51/RecA structure and function

DNA repair pathways contain varying amounts of structural conservation across species. The percentage of sequence identity of key major players in DNA repair pathways and genes involved, could vary based on the complexity of the organism. Even though the sequence identity is not always conserved, the function initiated by the pathways seems to be highly conserved across species. One pathway that maintains high degree of functional conservation is the homologous recombination pathway since components of these pathways have been known to repair DSB efficiently across bacteria, fungi, plant and animals. HR possesses high fidelity DNA repair capabilities and is the chosen pathway during cell cycle progression. One of the key players in the pathway, Rad51, mediates homologous search and strand invasion. This key protein is conserved in the bacteria where it is known as RecA and forms nucleoprotein filaments and homologous DNA search and strand transfer [227]. Unlike most other proteins that diverged based on sequence similarity, Rad51 homologs have maintained remarkable sequence conservation (figure 7.2). The evolutionary relationship or the emergence of this protein remains unclear. However eukaryotes contain Rad51 (RecA) and several Rad51 paralogs, though these

Figure 7. 1 - Human Rad51A structure Human Rad51 contains an HhH and two walker domains. All these domains are important for DNA binding and ATP hydrolysis. Binding of Rad51 to form nucleoprotein filaments requires energy and thus these domains may play a vital role during filament formation.

paralogs cannot replace Rad51 function in vivo [228]. Most eubacteria contain one RecA, however studies confirm that several archeal species contain two RecA homologs (RadA

90 and RadB)[227]. Further in eukaryotes, a separate Rad51 paralog Dmc1 evolved to mediate recombination during meiosis, whereas Rad51 is involved with meiotic recombination [229, 230].

Rad51 or Rad51A is the eukaryotic ortholog of bacterial RecA protein. Similar to the bacterial homolog, eukaryotic Rad51 proteins are also involved with DNA double strand break repair via the homologous recombination pathway [231-233]. One crucial difference between RecA and human Rad51 is the lack of an N terminal domain in the RecA proteins. This N terminal of human Rad51 harbors an endonuclease III like region, which could be involved with nuclease activity. However the exact function of this domain has not been clarified [234]. Mammalian Rad51 is a 339 amino acid protein that contains an HhH domain (helix-hairpin-helix) which is a DNA binding motif and two walker domains which also is important for DNA binding and ATP hydrolysis (Figure 7.1). Since the functions of Rad51 involves homology search and DNA strand exchange, these domains are vital for the function. Further analysis into the Rad51 sequence structure shows that Rad51 possess binding regions for p53, BRCA2, Chek1, PALB2, Rad51C, Rad52, XRCC3, Rad51AP1 [235-239].

Rad51-/- confers embryonic lethality by E7.5, and seems to arrest cell cycle progression as early as E5.5 [240]. These embryos showed decreased Brdu in cooperation and increased TUNEL staining at E7.5 [240]. Whether the disruption in proliferation in Rad51 null mice is due to arrested cell cycle progression, or due to increase in cell death needs further investigation. Thus understanding Rad51 in vivo function in adults remains a challenge.

RecA protein structure was described to form nucleo-protein filamentous structures [241] The 3D crystal structure of Rad51 which differs in some respect to the RecA structure has been reported and confirms a filamentous structure that loops as a helix. The Rad51 filament in eukaryotes contains a longer pitch than RecA and this could help effective homology search and strand exchange [242]. It has also been suggested that Rad51 oligomerizes and changes the filamentous structure during DNA binding. During DNA binding, oligomerized Rad51 protein filaments fits into the DNA with 19 base pairs per helical turn and helps to unwind and stretch the DNA strand [243, 244]. 3D crystal structure analysis to characterize Rad51 function and structure has provided valuable insights. How Rad51 initially binds to the DNA, displace RPA, and performs homology search requires further research.

7.1.3 - Rad51 is controlled by tumor suppressors and is activated during Cell cycle progression

Rad51 expression is mainly cell cycle dependent. In mice, Rad51 is primarily expressed transcriptionally starting from late G1 phase through the M phase in the nucleus [245]. The observed Rad51 at the G0 phase was primarily localized to the cytoplasm and some to the nuclei [245]. Mammalian Rad51 seems to be controlled by E2F family of

91 transcription factors where E2F4 activates the early onset of Rad51 protein expression, and E2F1 and E2F2 maintains the expression during the G1/S phases of the cell cycle. [246] Since Rb sequesters E2F transcriptional activators and inhibits cell cycle progression, Rad51 expression is probably controlled in quiescence cells by Rb [247]. However in cells where cyclin dependent kinase is hyper activated or Rb inactivated, Rad51 is known to be over expressed. Thus Rb negatively regulates Rad51 expression and function. However, Rb and Rad51 functional interaction to mediate DNA repair, homeostasis, tissue repair and regeneration and during ageing remains unanswered.

Analysis based on Rad51 sequence structure indicates that the WT (wild type) p53 tumor suppressor could directly bind to Rad51 [248]. P53 is activated upon DNA damage and helps to regulate many DNA repair processes (NER, BER, MMR, NHEJ, HR)[249]. Like Rb, p53 is known to negatively regulate Rad51 by suppressing Rad51 expression transcriptionally or functionally by inhibiting Rad51 nucleoprotein filament formation [249]. Rad51 has the capability to interact with p53 and this process is known to occur during several different steps during HR. Thus p53 activation could facilitate impaired HR repair processes. Studies performed in p53 deficient mice shows increased HR activity [250, 251]. In fact early studies have demonstrated that Rad51-/- embryos were capable of progressing beyond E7.5 in a p53 null background [240].

Implications of Rad51 overexpression towards cancer progression could correlate with the above observed tumor suppressor activity. A mutation or a loss of function in Rb and p53 could lead towards Rad51 overexpression, which in turn could increase homologous recombination and disrupt cell cycle progression. Further, cells could resist DNA damaging agents and confer drug resistance, specifically resistance to anti-cancer drugs, which can contribute towards cancer progression. The idea that in adult animals, Rad51 gets over expressed in response to disruptions in normal cell cycle behavior, is a clear indication about its regulatory role during adult cell division.

7.1.4 - Rad51 repairs DNA damage and is involved with cell death

Cell death is a homeostatic mechanism that is utilized by living systems to compensate and balance the cellular proliferation. This mechanism is also vital during DNA damage, tissue repair/regeneration and aging. Upon DNA damage, a cell can utilize several decisions; cell cycle arrest and DNA repair, senescence, cell death to eliminate the damaged cell. Yeast Rad51 mutants show an increase in cell death and with an accumulation of cells at G2/M phase prior to cell death [252]. p53 plays a central role towards the decision towards apoptosis, and p53 is also known to control Rad51 expression and function in vivo [248]. In fact Rad51 promoter region contains a p53 response element and increase in p53 expression is known to down regulate Rad51 expression and function [248, 253]. This implies that down regulation of Rad51 could mediate p53 modulated increase in apoptosis. Thus, Rad51 could be directly or indirectly involved with mediating cell death.

Studies in bovine andTable mouse 7. 2 oocytes – Rad51 have family shown paralogs an increased sensitivity to UV

Name Viability Function

DNA Repair Embryonically Involved with HR Functions downstream of Protein XRCC3, X- lethal DSB repair. Holiday Rad51 and directly binds ray repair cross junction resolution to Rad51, BRCA1 and complementing BRCA2 dependent protein 3

XRCC2 Embryonically Involved with HR Forms the BCDX2 lethal DSB repair. Together complex and a BCDX2 with Rad51D sub complex with stimulate Holiday Rad51D. junction resolution

Rad51B, DNA Embryonically Forms BCDX2 Forms a stable repair protein lethal complex and is heterodimer with Rad51C, Rad51 homolog 2, involved with HR overexpression stalls cell Rad51L2 DSB repair, Senses cycle progression and DNA damage increases cell apoptosis, BRCA1 and BRCA2 dependent, may promote the assembly of presynaptic Rad51 nucleoprotein filaments.

Rad51C, DNA Embryonically Involved with HR Forms the BCDX2 repair protein lethal DSB repair, complex. Interacts with Rad51 homolog 3, Resolution of Holiday Rad51B and XRCC3, Rad51L2 Junctions [2] important during early and late phases of HR

Rad51D, DNA Embryonically Involved with HR Forms the BCDX2 repair protein lethal DSB repair. Together complex and a BCDX2 Rad51 homolog 4, with XRCC2 sub complex with XRCC2. Rad51L3 stimulate Holiday junction resolution

Dmc1, disrupted Viable Important for meiotic meiotic DNA, recombination and LIM15 homolog resolution of meiotic double strand breaks

93 radiation. Mouse oocytes showed increased cell death and cellular fragmentation, while bovine oocytes showed an increase in apoptosis but did not display massive cellular fragmentation. Rad51 down regulation however resulted in massive cell death which was partially rescued by microinjecting recombinant human Rad51 [254]. This study implies that Rad51 could be vital for DNA repair during bovine developmental stages and the mediated cell death could be due to accumulation of cells with damaged DNA.

7.1.5 - Rad51 paralogs

Rad51 paralogs or Rad51 like genes have been characterized first in Saccharomyces cerevisiae and later in other eukaryotic model organisms. All Rad51 paralogs mediate DNA repair and most of them are embryonically lethal. In Saccharomyces cerevisiae Rad51 like genes are represented by Rad55, Rad57 and Dmc1. In humans these are Dmc1, XRCC2, XRCC3, Rad51B, Rad51C, and Rad51D. XRCC2, XRCC3, Rad51B, Rad51C and Rad51D paralogs share 20 – 30% homology with Rad51A, while Dmc1 contains 50% homology to Rad51A. All paralogs contain walker A and walker B domains, however the HhH domain is only found in Rad51 and Dmc1 proteins [255]. All these homologs are involved with DNA repair, but does have distinct functions and cannot function in place of Rad51A (meaning replace it) (Table 7.2). This is evident with the Rad51deficient embryonic lethality. These paralogs forms two complex in vivo; BCDX2 and CX3 [256]. BCDX2 complex contains Rad51B-Rad51C-Rad51D-XRCC2 and CX3 complex is formed by Rad51C-XRCC3. BCDX2 is known to function upstream of Rad51 and downstream from BRCA2 [257]. Therefore it is suggested that the BCDX2 complex is important to recruit Rad51 to the DSB sites and binds to branched DNA [2, 258, 259]. In contrast CX3 is known to function downstream from Rad51 but is crucial for the proper DSB repair. Further BCDX2 complex is dependent on BRCA2 but not Rad52 during homologous recombination.

7.2 - Results

7.2.1 - Schmidtea mediterranea Rad51 homolog maintains remarkable conservation in structure

Schmidtea mediterranea possess remarkable recovery under X-ray radiation exposure. >600 rad of radiation exposure could be lethal for mice, while Schmidtea mediterranea are capable of withstanding up to 1750 radiation [79]. Since X-ray radiation creates DSBs, planaria must possess effective DSB repair mechanisms to tolerate high levels of radiation. Thus, I proceeded to investigate the well-known and conserved DSB repair mechanisms conserved across species; HR and NHEJ. The NHEJ pathway will be described in a later chapter and this chapter will focus more on the HR pathway and specifically the key player in HR mediated repair, Rad51.

Investigation into the sequenced planaria genome revealed one planarian homolog for Rad51 (or RecA). The homolog was identified using Schmidtea mediterranea genome database[67]. A 6 frame translation was performed on the identified mRNA sequence and

Figure 7. 2 - Schmidtea mediterranea Rad51 homolog is structurally conserved (A) Alignment with the smed-Rad51 sequence with human Rad51 using CLUSTALW, implied sequence homology to be ~90% (B) Phylogenetic relationship among Primates and invertebrates based on the protein sequences of Rad51. Alignment of the 12 sequences was done in Clustal X. Maximum Likelihood method was based on the JTT matrix-based model. The percentage of trees in which the associated taxa clustered together is shown next to the branches. Initial tree(s) for the heuristic search were obtained automatically as follows. When the number of common sites was < 100 or less than one fourth of the total number of sites, the maximum parsimony method was used; otherwise BIONJ method with MCL distance matrix was used. A discrete Gamma distribution was used to model evolutionary rate differences among sites (5 categories (+G, parameter = 4.1754). The tree is drawn to scale, with branch lengths measured in the number of substitutions per site. Branch support is under 5000 Bootstrap replicas. Evolutionary analyses were conducted in MEGA5.

95 protein domain predictions were obtained by pfam, BLAST and HHMER. Alignment of the smed-Rad51 sequence with human Rad51 using CLUSTALW, implied sequence homology to be ~90% (Figure 7.2A). Align ment of several Rad51 homologs from different species have confirmed high degree of sequence similarity and conservation with the Schmidtea mediterranea Rad51 (data not shown). The identified sequence maintained some sequence dissimilarities in the N terminal region, however was more conserved at the C terminal region. Since the amino acid sequence determines the protein structure and its 3D confirmation, investigating whether the amino acid changes in the N terminal region possibly play a role to increase endurance post IR could prove to be valuable for the DNA repair field. The 3D crystal structure of human Rad51 has already been characterized and its filament formation capability with DNA has been investigated. Whether the planarian Rad51 protein maintains this capability remains to be characterized. Efficient Rad51 loading on to the DSB ends and unloading is important for proper HR mediated DNA repair. Whether the kinetics of this remains the same between the two species remains further investigation.

Figure 7. 3 – Schmidtea mediterranea Rad51 is expressed in neoblasts (A) Rad51 was primarily expressed in the X1 population (proliferative neoblasts) (N=4) (B) RNA extracted from whole worm fragments indicate equal distribution of Rad51 in the anterior and posterior fragments. (n=20)

To analyze the evolutionary relationship, 12 sequences from different eukaryotic species were aligned together using Clustal X. Maximum Likelihood method was based on the JTT matrix-based model to construct the phylogenetic tree. The percentage of the trees is displayed on the branches. The tree has been drawn to scale and evolutionary analysis was performed using MEGA5 using 1000 Bootsrap replicas (Fig 7.2 B). The phylogenetic scaling provides a closer relationship for planarian Rad51 homolog with mammalian and other vertebrate counterparts.

7.2.2 - Schmidtea mediterranea Rad51 is expressed in proliferative cells and is down regulated upon Rad51(RNAi)

Homologous recombination pathway where Rad51 plays a crucial role repairs DNA damage only [260] during cell cycle progression. Therefore Rad51 is known to be expressed primarily in dividing cells. Rad51 expression was mostly localized to the cytoplasm in quiescent cells or was not expressed at all. With the progression of cell cycle, Rad51 localizes to the nucleus around G1/S phase of the cell cycle. Quantitative pcr on

Figure 7. 4 – Rad51 is down regulated upon Rad51 RNAI microinjections (A) Intact animals received microinjections with water (control) or Rad51 dsRNA as illustrated. (B) Rad51 is down regulated equally across anterior posterior axis in the Rad51(RNAi) (C) Rad51 protein expression is down regulated by Rad51 dsRNA administration.

RNA extracted from anterior and posterior fragments of whole worm control planarians showed no changes in the gene expression along the anterior posterior axis (Fig 7.3 B) (Four independent experiments).

To understand Rad51 expression in different cell populations in the planaria, 7 day starved planarians (n=20) were amputated into anterior and posterior fragments and FACS sorted to isolate X1 (neoblast), X2 (early division progeny) and Xins (late division progeny) populations. Draq5 as a DNA content marker and calcein as a viability marker was used to identify the above populations and AriaII flow cytometer was used to sort them. The sorted cells were immersed in trizol to extract RNA and cDNA was synthesized. The quantitative pcr analysis indicated that Rad51 was primarily expressed in the X1 population (proliferative neoblasts) (Fig 7.3A) (n=20). X2 and Xins populations in the anterior and posterior segments maintained similar Rad51 levels. Since X2 and Xins cells represent post mitotic cell populations, Rad51 expression might be maintained at low levels in these cells

Neoblasts are the only dividing cells in the planaria and therefore HR probably occurs only in the planarian neoblasts. Rad51 gene expression at the quantitative level maintains some differences along the anterior posterior axis. Compared to the posterior, anterior X1 population maintained higher Rad51 expression (Fig 7.3 A). This implies, in intact planaria, during homeostasis an anterior neoblast probably express more Rad51 than a posterior neoblast.

To understand the functional relevance of the planarian homologous recombination pathway, a ~500bp Rad51 fragment was cloned into pBluescript plasmid. This was used to synthesize Rad51 dsRNA which was injected into the animals using the microinjection schedule in figure 7.4 A. Please note that the control set of animals and the injected animals were starved for the duration of the injection schedule. The Rad51(RNAi) animals were processed 30 days post first injection and RNA extracted for quantitative pcr (qpcr). Quantitative analysis of Rad51 gene expression by qpcr confirmed down regulation of Rad51 equally in the Rad51(RNAi) anterior and posterior fragments (Fig 7.4 B) (Three separate experiment). Stability of proteins in vivo differs based on the half-life. In order to confirm Rad51 protein expression, control and Rad51(RNAi) animal protein extracts were analyzed by western blot assay using α-Rad51 antibody. This data validated down regulation of Rad51 at the protein level 30 days post first injection (Fig 7.4C) (N=3). This system that maintains down regulation of Rad51 at the gene and protein level can now be utilized to understand Rad51 function in the Schmidtea mediterranea

7.2.3 - Schmidtea mediterranea Rad51 maintains functional conservation

Irradiation induces DNA damage in the planaria (Figure 7.16). However the animals are capable of recovering from the induced damage post sub-lethal irradiation and maintain proliferation. Thus I hypothesize that there are DSB repair mechanisms conserved

Figure 7. 5 - Schmidtea mediterranea Rad51 maintains functional conservation (A) Control (31.5 ± 6.4) and Rad51(RNAi) (0.006 ± 0.17) indicates a significant down regulation of mitotic cells post sub-lethal IR (Student T test p = 1.5x109 (N=3, n= 12). (B) mitotic cells are severely down regulated 24 hours post irradiation, and gradually increases over time (C) Rad51 at protein level is down regulated 24 hours after IR and gradually increases at 3 days, peaking at day 5 post sub lethal IR in the planaria. Schmidtea mediterranea Rad51 homolog maintains remarkable structural conservation and therefore could also be conserved functionally. To investigate the

99 functional conservation of Rad51, Rad51 expression was down regulated using the RNAi microinjection schedule in Figure 7.4A. 25 days post first injection, control and Rad51(RNAi) animals were provided a sub-lethal dosage of irradiation (1000 Rads). 7 days post irradiation and 32 days post first Rad51(RNAi) injection, animals were fixed using Carnoy fixation method and was stained for mitosis using the mitotic marker histone 3 phosphorylation (H3p). Compared to the control Rad51(RNAi) animals contained no mitotic cells (Fig 7.5 A). Control (31.5 ± 6.4) and Rad51(RNAi) (0.006 ± 0.17) indicates a significant down regulation of mitotic cells (Student T test p = 1.5x109 (3 separate experiments, n= 12). Thus Rad51 expression is required to recover cell proliferation post sub-lethal irradiation.

A time course quantification of control WT planaria post sub-lethal irradiation (1000 rads) confirmed that mitotic cells are severely down regulated 24 hours post irradiation. The cell proliferation levels increase 5-7 days post irradiation (Fig 7.5 B). To investigate whether Rad51 could be playing a role towards this recovery, Rad51 gene expression and protein expression in irradiated worms were evaluated. Control WT animals were sub lethally irradiated and fixed and RNA or protein extracts were isolated at days 1, 3, 5, 7 post sub lethal IR. Western blot analysis indicated that Rad51 at protein level is down regulated 24 hours after IR and gradually increases at 3 days, peaking at day 5 post sub lethal IR (Fig 7.5 C) (3 separate experiments). Gene expression analysis using qpcr also indicated an increase in Rad51 gene expression 5 days post IR which coincide with the protein expression (Fig 7.5 D). This expression further coincides with the mitotic cell recovery seen 5 days post IR (Figure 7.5 B). Thus I hypothesize that Rad51 mediated HR could be involved with DSB repair 3-5 days post sub lethal IR. This expression is essential for the neoblasts to recovery and to maintain proliferation. This set of data further suggests that Rad51 mediated DSB repair is conserved in the Schmidtea mediterranea.

7.2.4 - Rad51 down regulation disrupts cell proliferation during normal homeostasis

Rad51 is primarily expressed in dividing cells, and E2F family of proteins and tumor suppressors, Rb and p53, has known to mediate some regulatory role towards Rad51 expression and function [247, 248]. Planaria possesses a pool of proliferative neoblasts that maintain homeostasis, tissue repair and regeneration. Thus understanding the relevance of Rad51 during maintenance of planarian homeostasis, tissue repair and regeneration remains to be characterized. NHEJ has been described as the primary mammalian DSB repair mechanism and these studies have been mainly performed using hematopoietic stem cells, which is a quiescent population. Lack of proliferative prowess and a focus to conserve energy, might have rendered the hematopoietic stem cell population to choose NHEJ pathway as the main DNA repair mechanism. However, most HR pathway molecules, not NHEJ pathway molecule down regulation confer embryonic lethality. Thus during development where proliferation is at its peak, the choice of the error less HR pathway seems more appropriate. Due to the fact that Rad51 is embryonically lethal and its expression is possibly limited to a few

100 proliferative cells in various mammalian tissues could be a barrier to understand the function and relevance in mammals in vivo.

Down regulation of Rad51 gene and protein expression in the planaria was achieved by 30 days post Rad51(RNAi) (Figure 7.4). However since these animals did not show any lethality around this time, they provide a platform to study Rad51 function in vivo during maintenance of homeostasis in the complexity of the whole organism. Rad51 usually expressed in the cytoplasm localizes to the nucleus around the G1 phase of the cell cycle and maintains expression until the M phase, probably to sustain genomic stability in case genomic stress is induced during the S phase of the cell cycle [260].Yeast studies have demonstrated that Rad51 over expression mediates a G2/M arrest which is not seen in HR deficient mutants [261]. Further studies performed in vitro using cancer cell lines indicate that Rad51 is not important for cell cycle progression [262]. But embryonic lethality observed in the absence of Rad51 and lack of in vivo studies creates a gap and poses many questions regarding the intrinsic roles mediated by Rad51, in vivo, in the complexity of the whole organism.

Striving to understand Rad51 function during cell cycle progression, Rad51(RNAi) and control cohorts 30 days post first injection (PFI) were fixed in carnoy and stained with H3p. Opposing the in vitro studies mentioned above, Rad51(RNAi) contained severer down regulation in H3p positive cells compared to the controls 30 days post first injection (Figure 7.6). Strikingly the down regulation was more dramatic in the posterior region where no proliferative cells were observed. The anterior region maintained few proliferative cells, but still maintained a significant ~5.5 fold down regulation compared to controls (Figure 7.6 A-B). Quantification of the mitotic cell counts over an area mm2 provided the following results for anterior mitotic quantification; Control anterior 260.8 ± 98.9, Rad51(RNAi) anterior 47 ± 19.5 (n=21, p=0.00001). The posterior mitotic analysis: Control posterior 227.7 ± 99.8, Rad51(RNAi) posterior 3.02 ± 3.3 (n=21, p=0.00001) (Figure 7.6 C). This data clearly shows a marked down regulation in proliferation with the impairment of the homologous recombination pathway in the planaria that tries to maintain a large proliferative stem cell pool during normal homeostasis.

The Rad51 dsRNA micro injections were provided at the anterior region of the animal. Studies have confirmed that wounding induces proliferative response in the planaria [263]. To eliminate that the injection performed in the anterior region is the cause for the proliferation observed, animals were either injected anterior only or posterior only and fixed 35 days post first injection. Note that these animals were fixed at least 4 days post last injection. Following this experimental procedure, H3p analysis showed no differences between the anterior only or posterior only injected animals. Further these animals still maintained regional differences in cell proliferation (Figure 7.6 D). Anterior injected; Rad51(RNAi) anterior region 15.43 260.8 ± 7.6, Rad51(RNAi) posterior region 1.16 ± 1 (N=2, n=9). Posterior injected: Rad51(RNAi) anterior region 13.24 ± 11.39, Rad51(RNAi) posterior region 2.41 ± 2.9 (N=2, n=9) Thus the regional differences

101 observed based on H3p positive cells were not due to the wounding introduced during dsRNA administration.

Figure 7. 6 – Rad51(RNAi) down regulates mitosis (A-B) Compared to controls, Rad51(RNAi) down regulated H3p positive cells. Further regional differences were observed where cells only divided in the anterior. (C) Control anterior 260.8 ± 98.9, Rad51(RNAi) anterior 47 ± 19.5 (N=3, n=21, p=0.00001). The posterior mitotic analysis; Control posterior 227.7 ± 99.8, Rad51(RNAi) posterior 3.02 ± 3.3 (N=3, n=21, p=0.00001) (D) Animals injected anterior or posterior still maintained regional differences. Anterior injected; Rad51(RNAi) anterior region 15.43 260.8 ± 7.6, Rad51(RNAi) posterior region 1.16 ± 1 (N=2, n=9). Posterior injected; Rad51(RNAi) anterior region 13.24 ± 11.39, Rad51(RNAi) posterior region 2.41 ± 2.9 (N=2, n=9) (E) Rad51 RNAi by feeding with the lack of a microinjection still maintained regional differences. Control anterior 499.38 ± 171.8, Rad51(RNAi) anterior 163.81 ± 102 (p= 0.00001), Control posterior 408.36 ± 112.67, Rad51(RNAi) posterior 65.24 ± 38.07 (p=0.0000001) (N=2, n=11).

102

To further confirm that the observed regional difference is not due to constant wounding at the anterior region, Rad51 dsRNA was synthesized using the in vitro dsRNA synthesize method and mixed with calf liver and fed to a cohort of planarians [264]. The Rad51 dsRNA feeding was administered 3 times a week for 30 days and fixed accordingly. Staining these animals with the H3p mitotic marker showed that the animals still maintain anterior posterior differences in cell proliferation (Figure 7.6 E). Thus this data validates that Rad51(RNAi) causes regional differences in cell proliferation and stem cell maintenance. Rad51(RNAi) by feeding with the lack of a microinjection still maintained regional differences. Control anterior 499.38 ± 171.8, Rad51(RNAi) anterior 163.81 ± 102 (p = 0.00001), Control posterior 408.36 ± 112.67, Rad51(RNAi) posterior 65.24 ± 38.07 (p =0.0000001) (n=11).

Bromodeoxyuridine (5-bromo-2'-deoxyuridine or BrdU) is commonly used to assess rates of cell proliferation. BrdU is a synthetic thymidine analog that is in-cooperated into newly synthesized DNA during the S phase of the cell cycle. Thus BrdU positive DNA gets passed into the replicating daughter cells, and cells that stain positive for α-BrdU antibody can now we be utilized to assess rates of cell proliferation [265]. Therefore, to confirm changes in the proliferative status, whole animals were in cooperated with BrdU and stained with α-BrdU antibody. Animals were injected with Rad51(RNAi) and post 30 days of RNAi, BrdU was in cooperated for 12 hours using the BrdU soaking method [266]. Since the Rad51(RNAi) animals showed toxicity towards BrdU soaking, I was only able to keep animals alive for 12 hours post BrdU soaking. Injecting BrdU into the control and Rad51(RNAi) cohorts might induce wounding induced cell proliferation and therefore this method of BrdU in cooperation was avoided. The animals were then fixed in Carnoy and stained for BrdU as described in chapter 3 [266]. Similar to H3p staining, BrdU in cooperation was severely decreased in the Rad51(RNAi) compared to controls, and the animals contained more BrdU positive cells in the anterior than the posterior region: Control anterior 6150.3 ± 772.3, Rad51(RNAi) posterior 2171.1 ± 1091.3, Control posterior 3508.6 ± 590, Rad51(RNAi) posterior 1057.1 ± 590 (n=5, p=0.01) (Figure 7.7 A- B & M).

Quantification and analysis of the H3p+BrdU+ double positive cells in the intact animal showed that both markers are mostly concentrated to the anterior region in the Rad51(RNAi) (Figure 7.7A-E). Further control animals contain more H3p+BrdU+ double positive cells than the Rad51(RNAi) (Figure 7.7 G-L). However cells in the posterior region possessed BrdU positive cells which could imply either the following; (1) Proliferative cells incorporated BrdU at the posterior region, but arrested at the S phase or G2/M cell cycle checkpoints and could not proceed to the mitosis phase. (2) Cells migrated to the posterior region from the anterior region, but the cellular environment in the posterior prevented cell cycle progression. This result implies that the cells might be attempting to proliferate but is incapable of proceeding to the mitosis phase, specifically in the posterior region of the Rad51(RNAi).

103

Figure 7. 7 – Rad51(RNAi) maintains regional differences in proliferation – (A-B) Compared to controls, Rad51(RNAi) down regulated BrdU positive cells. (C-D) The same BrdU positive animals were later stained for H3p mitotic marker. (E-F) H3p+BrdU+ double positive cells are found in the anterior region of the animals than the posterior region. (G-L) Enlarging the above H3p+BrdU+ double stained animals indicate that cells that overlap for both BrdU and H3p is found in the control animals. (D) BrdU in cooperation was severely decreased in the Rad51(RNAi) compared to controls and the animals contained more BrdU positive cells in the anterior than the posterior region; Control anterior 6150.3 ± 772.3, Rad51(RNAi) posterior 2171.1 ± 1091.3, Control posterior 3508.6 ± 590, Rad51(RNAi) posterior 1057.1 ± 590 ( n=5, p=0.01). scale bar = 200um.

104

G1 phase S phase G2/M phase

Control anterior 58.3 ± 0.5 14.8 ± 0.3 27.7 ± 0.4

Control posterior 69.1 ± 0.4 12.3 ± 0.3 18.5 ± 0.2

Ead51(RNAi) anterior 69.4 ± 0.7 23 ± 0.4 5.86 ± 0.5

Ead51(RNAi) posterior 69.2 ± 0.2 30.3 ± 0.8 0 ± 0.2

Figure 7. 8 – Rad51(RNAi) induced cell cycle arrest Rad51(RNAi) animals show more cell frequency at the S phase implying possible cell cycle arrest at the S phase. G2/M phase frequency was severely decreased indicating that cells fail to progress from the S phase into the mitosis phase. Rad51(RNAi) anterior showed the possibility of a few cells progressing towards the mitosis phase, while the posterior Rad51(RNAi) contained very little to no cells. Table represents 3 individual experiments and the standard error across the experiments.

105

To test the hypothesis that cell cycle progression is impaired in the Rad51(RNAi), I performed cell cycle analysis using FACS. After amputating the animals post pharyngeal and dissociating the anterior and posterior fragments separately, the cells were stained using either DAPI or Draq5 DNA content marker. This data was analyzed using LSRII flow cytometer. The data indicates a clear down regulation in proliferative cells in the Rad51(RNAi) and there seems to be cell cycle arrest at the S phase in the Rad51(RNAi) anterior and posterior fragments; Control S phase -12.3-14.8%, Rad51(RNAi) S phase - 23-30.3% (Figure 7.8). But the most marked cell cycle arrest was observed during the G2/M phase implying that cells that entered S phase were not able to progress to the mitosis phase. This phenotype was more prominent in the anterior region further confirming the data obtained in figures 8.6 and 8.7; Control G2/M phase 18.5 – 27.7%, Rad51(RNAi) G2/M phase – 0-5.86%. The results portrayed is of N=1 experiment. Similar results with minimal to no G2/M progression in the posterior region was obtained by 3 separate experiments.

Cell cycle mechanism is conserved and highly regulated. A network of proteins which includes cyclins, cyclin dependent kinases (CDK) and tumor suppressors govern cell cycle progression. Thus this process is tightly regulated by several cell cycle positive and negative regulators. In order to understand the gene expression level of several cell cycle regulators I performed quantitative PCR using RNA extracted from control and Rad51(RNAi) anterior and posterior fragments. The gene expression levels of each fragment was analyzed relative to UDP glucose (clone H.55.12e [117]) which was distributed equally

across the control and Figure 7.9 – Cell cycle genes are down regulated in Rad51(RNAi) anterior and the Rad51(RNAi). posterior fragments. Cell cycle regulators are down regulated in the Rad51(RNAi) compared to the controls. Posterior Rad51(RNAi) fragments contain less gene expression than the anterior fragments. The heat map indicates down regulation of each gene relative to the control anterior or the control posterior.

106

Figure 7. 10 - Neoblast markers confer regional differences upon Rad51(RNAi). Compared to control (A) neoblast marker Smedwi-1 was down regulated in the Rad51(RNAi) (D). This is further validated by qpcr (G). Compared to control (B) early division progeny marker NB.21.11e was down regulated in the Rad51(RNAi) (E). This is further validated by qpcr (H). Compared to control (C) late division progeny marker Agat-1 was down regulated in the Rad51(RNAi) (E). This is further validated by qpcr (I). All these markers maintain regional differences. scale bar = 200um.

107

Rb (retinoblastoma protein) a tumor suppressor, tightly controls cell cycle at the G1 phase by inhibiting E2F. E2F transcription factors initiates transcription of components necessary for the progression of cell cycle. Upon Rb hypo phosphorylation, E2F gets activated and G1 phase of the cell cycle proceeds with the aid of Cyclin D and CDK4/6. Initial gene expression analysis indicate a down regulation of the G1 phase regulators Rb and E2F, specifically in the posterior Rad51(RNAi) fragment. Interestingly Rb gene expression is ~5.6 fold up regulated in the anterior Rad51(RNAi) compared to the posterior Rad51(RNAi) implying possible Rb regulation in the anterior. p53 is another tumor suppressor expressed during cell cycle progression. In the presence of DNA damage or cellular stress, cell cycle progression is halted at cell cycle checkpoints, where p53 might modulate a decision of cell cycle arrest, repair, progression or death. p53 is down regulated in the Rad51(RNAi), but is relatively, equally distributed across the anterior and posterior axis. Interestingly Cyclins and CDKs are up regulated in the anterior region implying that cells are possibly attempting to progress through the cell cycle. Indeed FACS analysis

Figure 7. 11 – Neoblasts and successive progeny are down regulated upon Rad51(RNAi) Anterior control 12.6 ± 1.9 and anterior Rad51(RNAi) 5.6 ± 1.5 frequency distribution over 3 separate experiments, (p=0.01). The posterior control 12.17 ± 0.4 and Rad51(RNAi) 5.7 ± 1.6 frequency distribution over 3 separate experiments.

108 indicates that the anterior S phase maintains 23% and G2/M 5.86% frequency of cells, which could be due to such an attempt (Figure 7.8). The absence of these genes in the posterior completely down regulates cells progressing through the cell cycle. Cyclin B which is required during the M phase of the cell cycle is highly down regulated specially in the posterior Rad51(RNAi) fragment expression. Thus lack of Cyclin B could play a role towards the number of cells progressing to the M phase. This further validates the mitotic analysis and FACS cell cycle analysis indicating lack of cell cycle progression in the anterior region. Relative to the posterior, the anterior Rad51(RNAi) fragment contains slight cyclin B levels enough to help a few cells to progress through the cell cycle.

7.2.5 – Rad51 down regulation impacts neoblast and progeny markers

Several genes expressed in neoblasts, the early division progeny (X2) and late division progeny (Xins) has been extensively studied and characterized by several groups in the planaria field [33, 79]. Therefore I proceeded to assess neoblasts and their successive progeny gene expression using well know markers in the literature. Thus ISH and quantitative PCR was performed for markers specific to planarian; Smedwi-1, PCNA, Cyclin B, D. ISH performed on control and Rad51(RNAi) showed an overall down regulation of Smedwi-1 expression and the gene expression was mostly concentrated to the anterior region of the animal. (Figure 7.10 A&D). (n=5). This was confirmed by quantitative PCR analysis which coincided with the ISH data (Figure 7.10 G, N=3). Smedwi-1 gene expression levels thus also impose regional differences in the Rad51(RNAi). This further validates the regional differences observed with H3p stain in the Rad51(RNAi) (Figure 7.6).

The X2 population expresses NB.21.11e gene expression. Therefore to analyze the fate of the early division progeny, animals were either fixed for ISH or RNA was extracted for quantitative PCR. NB.21.11e was overall down regulated in expression in the Rad51(RNAi). Similar to the regional differences observed, the NB.21.11e was expressed in more cells in the anterior region in the Rad51(RNAi) (Figure 7.10 B & E. N=3, n=11). This was further validated by quantitative PCR which showed NB.21.11e expression more in the anterior fragment than the posterior fragment (Figure 7.10 H).

Agat-1 expression marks the more differentiated late division progeny. Compared to control, Rad51(RNAi) contained marked down regulation of Agat-1 expression by ISH and quantitative PCR (Figure 7.10 C, F, I). Specifically Agat-1 down regulation was marked in the posterior region compared to the anterior region in Rad51(RNAi). This could be due to the overall down regulation of proliferative cells and hence the lack of cell attempting to differentiate and maintain tissue homeostasis. This also could imply defects in differentiation capability upon Rad51 down regulation which requires further investigation.

109

Figure 7. 12 - Sigma, Zeta and Gamma neoblast populations are down regulated in the Rad51(RNAi). (A-C) Cyclin B gene expression is down regulated in the Rad51(RNAi). The posterior Rad51(RNAi) contained minimal levels of Cyclin B expression. (D) Neoblast markers expressed in all neoblasts (general neoblast markers), sigma class , Gamma class and Zeta class are down regulated in Rad51(RNAi) anterior and posterior fragments. The down regulation is markedly higher in the posterior fragment compared to the anterior fragment. (N=1, n=20).

110

Flow cytometry analysis using DNA content marker Draq5 and Calcien as a viability marker to isolate X1, X2, Xins populations has been characterized before [113]. Thus cells isolated from anterior posterior regions of control cohorts and Rad51(RNAi) was stained and analyzed using LSRII flow cytometer. In comparison with the controls, Rad51(RNAi) showed ~50% down regulation in X1 frequency. In particular, the anterior region of the controls had an average of 12.6 ± 1.9 frequency distribution over 3 separate experiments, while Rad51(RNAi) contained a decrease with a 5.6 ± 1.5 frequency distribution (p=0.01). The control posterior had a 12.17 ± 0.4 frequency distribution, and the Rad51(RNAi) had 5.7 ± 1.6 frequency distribution over 3 separate experiments (Figure 7.11). This data validates the reduction in neoblast population with the compromisation of Rad51 expression. The anterior and posterior Rad51(RNAi) did not have a difference in the X1 progeny frequency, since this population represents the S/G2/M phases of the cell cycle. However the data validates an overall down regulation in cell proliferation and neoblasts and their successive progeny.

Cyclin B is a well characterized neoblast and cell cycle marker. Cyclin B at the protein level is important for maintaining the M phase of the cell cycle. Qpcr performed showed a down regulation in cyclin B gene expression 30 days post injection in the Rad51(RNAi) compared to the control (Figure 7.12 A). Quantification of the anterior and posterior fragments of the Rad51(RNAi) indicated regional differences in the cyclin B relative expression similar to neoblast markers described in Figure 7.6 and Figure 7.10. (N=3). This was further confirmed by ISH staining using cyclin B specific ribo probes. The ISH results clearly shows decreased cyclin B expression relative to controls, with slight expression levels only in the anterior regions of the Rad51(RNAi) (n ~ 5).

Neoblasts are a heterogeneous population and these can be further categorized as sigma, gamma and zeta neoblasts based on their differentiation capabilities and gene expression patterns [34]. Genes expressed in these groups of neoblasts were further utilized to assess the existence of a particular neoblast population in the Rad51(RNAi). Sigma neoblast class is represented by Soxp-1, Fgfr-1, Soxp-2 and Inx13 and the zeta neoblast class by Zfp-1, p53 and Soxp-3. Gamma class which is a subset of the sigma class is expressed by Nkx2.2 neoblast marker. RNA extracted from control and Rad51(RNAi) anterior and posterior fragments was used to perform qpcr using these neoblast specific markers. Anterior Rad51(RNAi) was compared to anterior controls and there was a down regulation in all these neoblast markers (Figure 7.12 D). Similarly Rad51(RNAi) posterior was compared to control posterior data where the down regulation of these neoblast markers were greater (Figure 7.12D).

The Sigma neoblast class is suggested to be wound responsive and is involved with differentiating into nephridia, muscle, CNS (central nervous system), eyes and intestine. The Zeta class is characterized as a neoblast population that maintains the cells in the epidermis [34]. Based on the gene expression patterns the Zeta class genes are more up regulated than the Sigma class, while the most down regulation was seen in the gamma class. This data suggests that neoblasts that divide in the Rad51(RNAi) is not equally distributed and is probably making Zeta class neoblasts over Sigma and gamma neoblasts

111

which are required for wound response and differentiation into specific tissue. This down regulation in possible sigma class neoblasts could further explain the lack of regeneration and differentiation potential portrayed by Rad51(RNAi) (later explained in this chapter).

7.2.6 – Rad51(RNAi) increases cell death and promotes regional differences in cell death

Upon DNA damage, a cell can utilize several decisions depending on the severity: (1) cell cycle arrest and DNA repair, (2) Senescence, (3) Cell death to eliminate the damaged cell. Mutations in yeast Rad51 promotes an accumulation of cells at G2/M phase and subsequently cell death [252]. p53 plays a central role during maintenance of the above

Figure 7. 13 – Rad51(RNAi) cell death promoting regional differences in cell death levels. (A-B) Down regulation of Rad51 increase cell death in the posterior region compared to the controls. (C) Compared to controls Rad51(RNAi) contains 0.45 ± 0.21 fold down regulation (p=0.00095). Compared to controls, the Rad51(RNAi) posterior contains a 1.8 ± 0.4 up regulation in TUNEL positive cells (N=4, n~12, p=0.009). (D) The site of injection does not impact the number of cell death in the anterior or the posterior region of Rad51(RNAi) (N=1, n~= 4)

112 cellular decisions post DNA damage, specifically cell death. p53 is known to control Rad51 expression and function in vivo [248]. In fact Rad51 promoter region contains a p53 response element and increase in p53 expression is known to down regulate Rad51 expression and function [248, 253]. This implies that down regulation of Rad51 could mediate p53 modulated increase in apoptosis and suggests a direct or an indirect mode of cell death regulation mediated by Rad51 and the HR pathway.

Live cells Dead cells

Control anterior 60.3 ± 3.7 39.1 ± 1.9

Control posterior 64.5 ± 4.4 35.1 ± 4.2

Ead51(RNAi) anterior 67.8 ± 1.7 32.07 ± 2.3

Ead51(RNAi) posterior 48.4 ± 1.2 50.66 ± 2.9

Figure 7. 14 – Apoptosis is up regulated in the Rad51(RNAi). Annexin V stain concludes apoptosis is up regulated in the anterior and posterior regions of Rad51(RNAi). The posterior region contains more apoptotic cells than the anterior region. The frequency distribution of live and dead cells have been summarized in the table below. Three independent experiments. ± represents standard error.

113

Post 25 days of Rad51(RNAi) injections, the live animals were seen to contain thinning of the posterior/tail region. Post 30 days the tail region was replaced by a stumped tail end possibly by the loss of the tail region. This phenotype suggests tissue degeneration and possibly cell death. Therefore, to understand the role of Rad51(RNAi) towards cell death, TUNEL assay was performed on control and Rad51(RNAi) whole worms. Compared to the control, Rad51(RNAi) contained massive cell death, and further analysis showed that the increase in cell death was mostly found in the posterior region of the animal (Figure 7.13 A-C). Quantification of the data was achieved by normalizing the cell death to control anterior and achieving the fold differences. Compared to anterior region of the controls, Rad51(RNAi) anterior region had 0.45 ± 0.21 cell down regulation (N=4, n~12, p=0.00095). Further, compared to controls, the Rad51(RNAi) posterior contains a 1.8 ± 0.4 up regulation in TUNEL positive cells (N=4, n~12, p=0.009). This set of data suggests two important facts: (1) Cell death is increased in the posterior and decreased in the anterior. (2) The cells arrested at the posterior region is probably programmed to cell death but not in the anterior.

Analysis of the cell cycle progression and proliferation study clearly provides that most cells are halted at S phase in the posterior, which is probably the reason for the increase in cell death. The lack of capability and signaling to promote cell cycle progression probably marks these cells to death. p53 expressed in the posterior region probably plays a major role towards this decision. However the cells in the anterior although also arrested at the S phase manages to progress through the cell cycle probably due to the presence of elevated cell cycle genes relative to the posterior region (Figure 7.9). Since TUNEL positive cell death is down regulated in the anterior Rad51(RNAi) region: (1) The decline in neoblasts in this region could be due to a mode other than programmed cell death, such as cellular senescence (2) Modes of cell death other than apoptosis could be operating along the anterior posterior axis and therefore further analysis is required to understand cell death mechanisms along the anterior posterior axis. However the reason for the decision to target most cells in the posterior region for cell death and bypass a few cells in the anterior region for cell division remains further characterization.

Annexin V can be utilized to detect phosphatidylserine (PS) and phosphatidylethanolamine (PE) which is usually expressed on the surface of cells progressing through apoptosis. Therefore Annexin V can be used to estimate apoptotic cells more specifically than TUNEL staining. Thus control and Rad51(RNAi) animals were amputated pre-pharyngeal and each fragment was dissociated separately and stained for Annexin V and 7AAD viability marker that excludes dead cells. These stains were analyzed using LSRII flow cytometer and the frequency of the data was quantified. Quantification of three separate experiments provides an overall increase in Annexin V positive populations in the Rad51(RNAi) anterior and posterior fragments. Overall ~10- 12% increase in cell death frequency was observed in the posterior Rad51(RNAi) compared to control and anterior Rad51(RNAi) (Figure 7.14). This increase in cell death observed in the Rad51(RNAi) was significant compared to the control (p=0.001).

114

Opposed to TUNEL assay, annexin V positive cells were increased in the anterior Rad51(RNAi) frament. However this increase was not significant. FACS procedure requires cell dissociation and mechanical manipulations that could initiate cell death randomly. Whether the differences in the TUNEL staining and Annexin V is due to this technical errors remains to be clarified. Studies have indicated that DNA damage mediated cell death could occur due to apoptosis, necrosis, autophagy or mitotic catastrophe [267]. Therefore characterization of specific cell death mechanisms is required to understand regional differences imposed by cell death. TUNEL positivity could also imply increased DNA damage, and therefore to understand the regional differences observed in the planaria during normal homeostasis the amount of DNA damage accumulated in the anterior and posterior region upon Rad51 down regulation needs to be investigated.

Figure 7. 15 – Planarian Rad51 localizes to the nucleus upon sub lethal IR. (A-B) Rad51 expression is relatively low in undamaged cells and is concentrated mostly in the cytoplasm. Upon IR Rad51 levels increase and is translocated to the nucleus. On Day 5 most Rad51 protein is localized to the nucleus and the levels fall back to normal 7 days post IR.

115

7.2.7 – Rad51(RNAi) increases DNA damage equally in the anterior and posterior regions

DSB DNA damage repair induced by IR requires Rad51 mediated HR repair mechanism in the planaria (Figure 7.5). Rad51 is primarily expressed in the planarian neoblasts and upon DNA damage Rad51 is down regulated in the planaria possibly due to

Figure 7. 16 – DNA is damaged upon Rad51 down regulation. (A) COMET assay scores shows more cells with a score of 2 (most damaged) in the Rad51(RNAi). The damage distribution is equal across the anterior posterior fragments. (N=4, significance indicated on the image) (B) Dissociated control and Rad51(RNAi) chromosomes were analyzed and more dicentric chromosomes, fused chromosomes, acentric chromosomes, double centromeres and chromosome two are deletions were observed in the Rad51(RNAi).

116 the elimination of neoblasts post IR. Rad51 at the gene and protein levels increase 3 days post IR peaking on the 5th day. Rad51 is known to localize to the nucleus to be activated and repair DNA post DNA damage. Therefore in order to understand Rad51 localization post IR in the planaria, WT planarians were sub lethally irradiated and fixed with 70% ethanol and stained with α-Rad51 antibody. The cells and the nucleus were distinguished by DAPI staining. Based on the obtained results, Rad51 protein expression is mostly cytoplasmic up to 3 days post IR, and localizes to the nucleus at day 5 (Figure 7.15 A-B). These data and the data obtained in figure 7.5 indicates that HR mediated DNA repair might be occurring 5 days post sub lethal IR. This coincides with the increase in cell

Figure 7. 17– Post DNA damage X1 population is severely compromised in the planaria equally along the anterior posterior axis. Post 7 days of sub lethal IR, Control anterior posterior X1 frequencies remain similar. X1 populations is heterogeneous. Compared to no IR FACS plot, the number and the type of cells in the control IR is severely decreased. This is further compromised in the Rad51(RNAi) However X1 frequency is equally distributed across the anterior posterior axis.

117 proliferation observed 5 days post sub lethal IR. Thus it is safe to assume that Rad51 is important for DNA repair and HR might play a crucial role to repair the DNA and recover proliferative cells post DNA damage in planaria.

Rad51(RNAi) imposes more cell death in the posterior region as observed by TUNEL staining. Further Cell proliferation is slightly maintained in the anterior region of the animals. This could occur due to differential levels of DNA damage imposed along the anterior posterior axis. To measure DSB damage imposed by Rad51(RNAi), and to investigate whether the absence of Rad51 mediates DNA damage equally along the anterior posterior axis, COMET assay was performed. COMET assay involves dissociated cells that have been run across an agarose gel using gel electrophoresis [268]. If the DNA is damaged, the broken pieces of DNA will run across the gel resembling a COMET. If the DNA is intact, the nucleus will be observed with no fragmented DNA.

COMET assay was performed separately on obtained anterior and posterior regions from the planarian control cohorts and Rad51(RNAi) 30 days PFI. COMET scores were obtained on a scale that ranges from 0 – 2 with zero score given to the undamaged intact nucleus and 2 to the most damaged dissociated nuclei with the longest COMET tail. Overall, compared to the controls, Rad51(RNAi) had a significantly higher percentage of cell nuclei with a score of 2 and a significantly lower percentage with a score of zero (Figure 7.16 A). However comparison between the Rad51(RNAi) anterior and posterior COMET scores did not show significant difference. This result indicates that the level of damaged DNA post Rad51(RNAi) does not differ across the anterior posterior axis.

To further confirm this result, karyotyping was performed to understand the level of DNA damage. Dissociated control and Rad51(RNAi) chromosomes were analyzed and more dicentric chromosomes, fused chromosomes, acentric chromosomes, double centromeres and chromosome two arm deletions were observed in the Rad51(RNAi). The types of chromosomal abnormalities were equally distributed in the Rad51(RNAi) (Figure 7.16 B). This further provides that in the absence of homologous recombination pathway, DNA damage is accumulated in the planaria.

7.2.8 – Animals with disrupted polarity provides antero-posterior differences in cell proliferation and death

Rad51 down regulation mediates cell proliferation in the anterior and not the posterior, while increasing cell death in the posterior. This type of regional differences along the anterior posterior axis during maintenance of homeostasis implies that, pathways belonging to DNA repair are crucial for systemic homeostasis. This concept identifies with a group of studies performed previously in mice, where cell proliferation, tumor growth, tissue engraftment, wound healing and even aging is more aggressively displayed in the anterior region compared to the posterior [269]. Thus in mice during maintenance of homeostasis there seem to be regional differences in cell proliferation. This is probably

118

created due to specific pathways active in specific tissue in the anterior half of the animal or influences by the microenvironment in different regions of the body. Rb and p19Ink4d are tumor suppressors that seem to control cell proliferation primarily in the anterior region in mice [270]. ATR is a transducer involved with DNA repair and specifically homologous

Figure 7. 18 – Rad51 Mediated HR Pathway Regulates Cell Proliferation Along the AP Axis in Planaria. Double head (DH) and double tail (DT) animals were successfully produced. (A) normal live (B) DH live (C) DH animals stained with α-synapsin (CNS marker) show brain formation on both axis. (D) TH live (C) DT animals stained with α-synapsin show no brain formation. (F-I) H3p and α-synapsin stain on DH and DT animals. DH Rad51(RNAi) maintain few proliferative cells while DT Rad51(RNAi) does not. (P) Quantification of H3p stainings on DH animals; Control 319.8 ± 143.6, Rad51(RNAi) 145 ± 98.8, p=0.002 (N= 3, n=11). (Q) Quantification of H3p stainings on DT animals; Control 52.5 ± 19.3, Rad51(RNAi) 3.6 ± 4.3. (p=0.0000003) (N=3, n=15). scale bar = 200um.

119 recombination pathways. ATR hypomorphic mice contain stunted growth with less developed forehead regions and stunted posterior regions. Tissue analysis showed an increase in cell death and damage compared to controls [271]. This might indicate some differential regulation along the anterior posterior axis posed during embryonic development and further during adulthood. Overall studies based on embryonic development confirm anterior posterior specification, and different gradients of factors and pathways that maintain and regulate each axis. However levels of cell proliferation during embryonic development seems to remain equal along the A-P axis [272].

Alterations in the wnt/β-catenin pathways disrupt polarity and specification in the planaria. Down regulation of β-catenin disrupts the polarity and upon amputation and post 7 days forms a two headed planaria [273]. Further, silencing of smed-APC, and successive amputations results in two tailed animals 7 days post amputation [274]. Thus by using the feeding dsRNA method β-catenin or APC was down regulated in animals and double headed (DH) and double tail (DT) animals were obtained. Few animals were then injected with Rad51(RNAi). 30 days later the mitotic cell population was analyzed using H3p mitotic staining. Please note that β-catenin and APC gene levels stabilize back to normal by the time Rad51(RNAi) injections were administered.

β-catenin(RNAi) (DH) animals contained significant ~2.2 fold down regulation in cell proliferation upon Rad51(RNAi); Control 319.8 ± 143.6, Rad51(RNAi) 145 ± 98.8, p=0.002 (N= 3, n=11). The mitotic cell population was expressed in both anterior segments of the animal. APC(RNAi) (DT) animals had overall down regulated cell proliferation even in the control animals 52.5 ± 19.3. However the Rad51(RNAi) injected DT animals had little to no proliferative cells; 3.6 ± 4.3. This ~15 fold down regulation was significant (p=0.0000003) and reproducible (N=3, n=15). This data was reproduced using smed-axin RNAi animals which also maintain posterior polarity (data not shown).

Certain DT animals due to manipulations during Rad51 dsRNA administration proceeded to produce a head. This is expected since during Rad51(RNAi) injection regime, the smed- APC levels would have returned to normal systemic levels in the double tail animals. Thus upon amputation, these animals probably could regenerate a head. DT animals that thus produced heads during injection routine were fixed in Carnoy fixation and stained for H3p mitosis

marker. Thus stained H3p positive cells Figure 7. 19 – Mitotic cells are concentrates to the anterior region probably by were only observed in the region that proliferation. contains the brain and the photoreceptors Mitotic cells in this double tail and single headed (Figure 7.19) (n=5). This data further animal is only seen in the head region. (n=5) could imply the existence of regional

120 differences during systemic homeostasis. The impairment of the HR pathway mediates cell proliferation imbalance promoting cell division possibly near the brain region.

7.2.9 – Rad51(RNAi) animals responds to feeding

Figure 7. 20 – Metabolic cues are impacted by Rad51 down regulation. Rad51(RNAi) contain marked down regulation in cell proliferation upon feeding. However the levels of cell proliferation is slightly increased compared to starving Rad51(RNAi) animals.

Planarians respond to feeding by increasing cell proliferation [93]. During starvation planaria reduce their metabolic functions, limits cell proliferation and is capable of resizing the whole body to maintain homeostasis. This indicates that the metabolic cues and decisions to progress through cell cycle is intricately connected within the organism. In fact down regulation of smed-TOR has known to decrease cell proliferation, and the smed-TOR(RNAi) animal do not increase in size post feeding. TOR inhibitor rapamycin impairs HR and NHEJ pathway and suppressors DSB repair [275] . This causes cell cycle arrest and hence a down regulation in cell proliferation and an increase in cell death. To investigate maintenance of metabolic functions post Rad51(RNAi), planarians injected with Rad51 dsRNA were fed with calf liver over a time course. Compared to the controls, Rad51(RNAi) contained marked down regulation in proliferative cells. However, the proliferative cell counts were increased compared to starved Rad51(RNAi). Very interestingly, animals contained some dividing cells in the posterior region, implying that metabolic cues though not dramatic impose an increase in proliferation in the anterior and posterior region of the animals. How these cells proliferate in the absence of Rad51(RNAi) and which signals regulate this process remains to be identified.

121

Figure 7. 21 – Rad51 down regulation impairs regeneration in planaria. (A) Control animals form a blastema while (B) Rad51(RNAi) animals fail to form a regenerative blastema. (C) Control animals for photorecpetors7 days post amputation while (D) Rad51(RNAi) do not. (E-M) Regenerating animals post 0, 6, 24 and 48 hours post amputations stained with H3p marker and CNS marker α-synapsin. (N) Control animals maintain bi modal cellular peaks necessary for regeneration. However Rad51(RNAi) animals are incapable of maintaining proliferation.

122

7.2.10 – Rad51(RNAi) animals do not regenerate

Planarians are masters of regeneration capable of regenerating any missing tissue in a short period of time. The regenerative responses require proper proliferative responses and cell death to pattern the missing tissue. Regeneration also requires proper maintenance of metabolic functions and DNA repair mechanisms to mitigate damaged DNA along the process. Thus Regeneration requires a number of signaling networks to mediate its proper function. Correct synchronization of spatial and temporal factors and responses thus is for regeneration and repair.

Proliferative and cell death responses required for regeneration has been characterized (Figure 4.14 and [263]) Upon amputation two proliferative peaks at 6 hours and 48 hours post amputations are observed and it is suggested that these cellular responses are required for regeneration. Smed-TOR down regulation prevents blastema formation and we hypothesize the lack of proliferative responses the likely cause for this phenomenon (Figure 4.13). Therefore to investigate Rad51 mediation during regeneration, Rad51(RNAi) was amputated and 7 days post amputation the 100% of the Rad51(RNAi) animals compared to controls did not contain blastema (Figure 7.21 A-B) (N=3, n=~20). Further unlike TOR(RNAi) these animals were not capable of rearranging the existing tissue to regenerate missing tissue such as photoreceptors (VC-1 antibody) (Figure 7.21 C- D). Time course amputation comparing control and Rad51(RNAi) proved that the lack of regeneration is probably likely due to a down regulation in proliferative cells. As observed in the quantified data provided in figure 7.21 N, the animals were not capable of mounting any proliferative peaks. Images 7.21 E-M further visualizes the lack of proliferative responses in comparison with the controls. Thus the impaired regeneration could be coupled with the lack of proliferative responses and lack of proper synchronization of spatial and temporal factors.

7.3 - Conclusions

Rad51 a major player in the HR pathway is important to maintain systemic homeostasis. Down regulation of this pathway impairs systemic homeostasis creating regional differences in cell proliferation (Figure 7.6, 7.7, 7.8) and cell death (Figure 7.13, 7.14). Further neoblast populations and their successive progeny is also impaired possibly related to lack of proliferation and differentiation potential (Figure 7.11, 7.12).

123

The observed regional differences could be mediated by three different outcomes: (1) Potential of stem cells and their heterogeneity in the anterior region and the posterior region as depicted by the schematic (Figure 7.22) could be different. (2) Differences in local signals in the anterior and posterior region (3) Systemic decisions that promotes

Anterior Cells Cannot divide fast Slow cell division enough for proper DNA damaged regenerative responses

Cell cycle arrest Cellular senescence DNA damaged Less Cell death

Posterior Cells Cell cycle arrest DNA damaged More Cell death

Figure 7. 22 - Working model. Rad51 down regulation mediates regional differences in cell proliferation and cell death. This could be due to (1) Potential and differences in stem cells in the anterior region and the posterior region as depicted by the schematic. (2) Differences in local signals in the anterior and posterior region (3) Systemic decisions that promotes regional differences.

regional differences along the anterior posterior axis. Quantitative PCR analysis of cell cycle markers have portrayed possible differences in their gene expression levels in the anterior and posterior regions of the Rad51(RNAi). The proliferative signals at the mRNA level is elevated in the anterior compared to the posterior implying that within the planarian system, there are possibly local signals that maintain function. The relative increase in Rb expression in the anterior fragment could imply possible regulation by Rb, where cell cycle progression could be halted by repressing E2F. Further Rb has been implicated repressing E2F mainly during senescence, implying that Rb mediated senescence as a possible outcome in the anterior region. This further could explain the relatively low cellular death observed in the anterior region. Rb is down regulated in the posterior, implying that the posterior local environment is possibly attempting cell cycle progression, but is halted at a cell cycle checkpoint (Figure 7.7) and possibly programmed to cell death. p53 which is equally distributed along the anterior posterior axis (Figure 7.8) could be a likely candidate that imposes cell death in the posterior region. These data supports the possible outcome #2 which supports the hypothesis that the anterior posterior axis is differentially regulated during maintenance of normal homeostasis, and therefore could likely mediate its own

124 positional cues and decisions. Identifying how tumor suppressors Rb and p53 could regulate regional differences is explored more in chapter 10.

Animals with disrupted polarity also provide proof for outcome #2. The anteriorized animals maintain proliferation throughout, while double tailed animals did not contain proliferation. Whether this is due to signals emanating from the brain, or by the specific anterior or posterior environments remains to be clarified. However, figure 7.19 containing an animal with two tails and a head with proliferative cells only around the head area could help to demonstrate the above hypothesis.

Neoblasts are a heterogeneous population and is further categorized into Sigma, Gamma and zeta classes. Quantitative pcr analysis for genes specifically expressed by each class portray regional differences in the Rad51(RNAi). The anterior region contains higher expression of these neoblast markers compared to the posterior. This once again indicates that anterior and posterior environments mediate and maintain specific differences once again proving outcome #2. Control animals contain about 50% of the sigma class and about 35% of the zeta class. However analysis in figure 7.12 D indicates that the genes of the zeta class is expressed more than the sigma class. Thus with the differential gene expression and the increase in zeta gene expression, I hypothesize that there is a shift in the type of neoblasts expressed in the Rad51(RNAi). Sigma neoblasts are more wound responsive and down regulation of this population in the Rad51(RNAi) could further be responsible for the lack of regenerative potential.

Feeding and Regeneration generates proliferative responses in planaria (ref). Upon Rad51 down regulation, these responses are slightly elevated compared to intact starving Rad51(RNAi). This is specially portrayed by the relative increase in cell proliferation in the posterior region upon feeding (Figure 7.20) and the systemic distribution of neoblasts upon amputation observed specially 6 and 48 hours post amputation (Figure 7.21). These results could suggest possible systemic cues operating to mediate decisions within the planaria and this supports outcome #3.

Thus this chapter focuses on Rad51(RNAi) mediated regional differences and the data obtained indicate that differences in local signals in the anterior and posterior region and systemic decisions could be promoting the observed regional differences.

125

Chapter 8

BRCA2 and RPA are important to maintains Planarian tissue homeostasis

8.1 – Introduction

8.1.1 - BRCA1, BRCA2 and RPA proteins

This chapter focuses on two molecules that play a central role in the HR pathway: BRCA2 and RPA. I aim to understand the functions mediated by these molecules in a Rad51 dependent and independent manner.

Mutations in and related with BRCA1 (Breast cancer type 1 susceptibility protein) and BRCA2 (Breast cancer type 2 susceptibility protein) proteins have high disposition towards initiation of cancer. Therefore, attempts to study the functions and regulation of these proteins have been a major focus in cancer research. BRCA1 and BRCA2 mutations or defects in their regulatory pathways are linked primarily with breast and ovarian cancers in women. 5-10% of all breast cancers and about 15% of ovarian cancers contain either the BRCA1 or the BRCA2 mutation [1, 2]. Cancer progression due to BRCA1 and BRCA2 mutation rate is high: ~50% of the women containing a BRCA1 or BRCA2 mutation will develop cancer [3].

BRCA1 and BRCA2 are tumor suppressors, and in humans these genes are normally expressed in breast tissue. Its main function is to repair damaged DNA, and mutations in these genes can affect the genomic integrity, promoting and progressing towards tumor development and cancer initiation. The BRCA1 gene, which is located in human chromosome 17q was recorded by the King laboratory at UC Berkeley in 1992 [4]. BRCA2 was discovered a few years later and localized to chromosome 13 [5]. Since then, these molecules have been discovered in various other species.

Soon after the discovery of BRCA1 and BRCA2, many attempts were made to create BRCA1 and BRCA2 null mouse models. However, though the heterozygous mice were viable, they did not show a strong phenotype and complete deficiency of these proteins result in embryonic lethality [6]. Conditional knockouts were created, but these do not provide a genetically normal background, and understanding mutations that arise in normal animals due to extrinsic or intrinsic changes cannot be properly investigated in these animals [7]. Thus understanding BRCA1 and BRCA2 function in vivo in the absence of pathology remains a challenge.

RPA (Replication protein A) is a single strand DNA (SSB) binding protein and plays major roles in DNA repair, replication, cell cycle progression [8]. Thus RPA has been implicated in almost all pathways involved with DNA metabolism. This protein was first characterized by Wold and Kelly from Johns Hopkins University, Baltimore [9]. RPA

126 inhibition has been linked with suppression of tumors and is currently explored to generate possible therapeutic approaches [10]. Further, RPA heterozygous mice are viable but are highly susceptibility to cancer and RPA-/- mice result in embryonic lethality [11]. This suggests that RPA is a haploinsufficient product essential for homeostasis. Therefore, using heterozygous or conditional KO mice might not provide a good system to understand in vivo RPA function. Similar to BRCA1 and BRCA2, understanding in vivo RPA function is crucial. Planaria with all the remarkable characteristics outlined in chapter 2 could provide an excellent in vivo model system to understand their cell intrinsic functions.

BRCA2 and RPA play a major role during HR and have direct interactions and functions with Rad51. Therefore, my focus in this chapter is to discover and understand the planarian BRCA2 and RPA homologs. Mainly their functions during maintenance of normal homeostasis with and without Rad51 will be explored.

8.1.2 - BRCA1, Breast cancer type 1 susceptibility protein

BRCA1 gene contains several conserved sequences including the BRCT and RING domains which are involved with activities related to tumor suppression (Fig 9.1A). Mutations in the RING and BRCT domains in addition to the BRCA2-PALB2 interaction domains, are the mostly studied mutations in a clinical setting [12]. Upon DNA damage ATM-ATR phosphorylates H2Ax forming ᵞH2Ax. Post recruitment of MDC1 and RNF8, BRCA1 is recruited to the site of damage. Thus BRCA1 responds and localizes to the site of DNA damage immediately in a BRCT domain dependent manner [13]. At this point, BRCA1 activates Chk1 by phosphorylation and the cell arrests at the G2/M checkpoint.

The BRCA1 gene is conserved across various species and can be found in humans, chicken, mice, rats, dogs, primates and, C. elegans [14]. However, analysis of the planarian genome did not yet retrieve a highly homologous BRCT and RING domain containing sequences.

8.1.3 - BRCA2, Breast cancer type 2 susceptibility protein

The human BRCA2 is a 3418 amino acid protein and does not contain significant homology to any other protein in the human body [5, 15]. Further, the sequence identity between human and mouse BRCA2 gene is 58% with certain regions containing significant conservation [16]. BRCA2 protein contains a transactivation domain, several BRC repeats and a DNA binding domain (Fig 8.1B). The BRC repeats are required to bind Rad51 during HR activation. Out of the several BRC repeats found in human BRCA2, only the first 4 seem to be crucial and more efficient at binding Rad51 [17]. These BRC repeats bind Rad51 with high affinity and recruits Rad51 to the damaged sites immediately upon damage [18]. Studies have demonstrated that BRCA1 and BRCA2 interact and directly

127 bind to the HR pathway key player, Rad51 [19]. The transactivation domain of BRCA2 contains transcriptional activity. However, the in vivo transcriptional activity by BRCA2 and its specific targets requires further characterization since most studies were performed in vitro in the presence of over expressed proteins [20]. The C terminal region is a DNA binding domain and mutations in this region and the Rad51 binding BRC repeat region has shown to slow the rate of DSB repair and increases IR sensitivity [17, 21]. Deletion in the C terminal region around 3140-3328 aa also rendered cells IR sensitive ,further results in decreased Rad51 function and decrease in cell growth leading towards senescence [22].

The mammalian BRCA2 mediated functions seem to correlate with the Saccharomyces cerevisea Rad52 protein. The main function of BRCA2 is to mediate DNA repair where BRCA2 interaction with Rad51 on its BRC repeats is critical for HR mediated DNA repair [17]. This has been demonstrated by in vitro and in vivo studies where lack of BRCA2 expression was linked with sensitivity to IR [19, 23, 24]. BRCA2 deficiency causes G1-S and G-2M checkpoint arrest, which suggests that the IR sensitivity is due to lack of proper DNA repair mechanisms to complete cell cycle progression [21]. Expressing BRCA2 in vitro in BRCA2 deficient cell lines rescues the cells from IR sensitivity [17].

BRCA2 deficiency creates embryonic lethality by E7.5 [23]. This implies the importance of BRCA2 for the proliferative cells in the embryo and towards proper embryonic development. BRCA2 is highly expressed in proliferative cells and is expressed mostly around the G1/S phase transition phase [25]. During embryonic development BRCA2 is highly expressed through the embryo in all the germ layers, especially during phases of rapid cellular proliferation [23]. Remarkably this period of developmental block correspond to the phenotype shown by Rad51 deficient embryos, where the animals show embryonic lethality at E7.5 (chapter 7) [26]. Truncated forms of BRCA2 results in a few viable mice and these mice show high sensitivity to DNA damage causing agents. Further, the mice lacked Rad51 foci post DNA damage, many DSBs, chromosome abnormalities, and increased propensity to progress towards cancer [27, 28].

BRCA1, BRCA2 and Rad51 expression in embryos overlap spatially and temporally and these molecules interact with each other implying that these molecules function together during developmental stages [23, 29, 30]. Correlating to this fact, Rad51 was rescued by the suppression of p53 in embryos, and this phenotype too was observed in embryos that lack BRCA2 and p53 [22, 26]. Since none of the embryos were exposed to any DNA damaging agent, the block in development and proliferation in the Rad51 and BRCA2 deficient embryos might imply the necessity of each of these molecules during cell cycle progression. Whether the cells require the presence of BRCA2 and Rad51, and stall in proliferation due to the lack of expression or whether these molecules physically mediate cellular proliferation remains unanswered. In fact truncated BRCA2 containing mouse strains have been generated and a few animals were able to survive. This could further imply that the presence of BRCA2 might be relevant for the cell’s decision to progress through the cell cycle [21, 31, 32]. Opposed to the developmental requirement of Rad51 and BRCA2, adult tumor cells with BRCA2 deficiency maintain rapid cellular

128 proliferation. How tumor cells lacking Rad51 or BRCA2 could overcome this aspect in vivo requires further attention.

Valuable information regarding BRCA2 activity has been obtained by the fungus Ustilago maydis containing the BRCA2 ortholog Brh2. Brh2 possess a BRC motif which

Figure 8. 1 – Structures of Human BRCA2 and RPA structures (A) BRCA2 contains a transactivation domain followed by BRC repeats which binds Rad51. The DNA binding domain and the nuclear localization signals are located towards the C terminal. The DNA binding domain contains a helical and a oligonucleotide/oligosaccharide-binding domain specific to BRCA2. (B) RPA protein can be found as RPA70, RPA32 and RPA 14. These proteins bind together to form the human RPA protein. Specific to these proteins are the DNA binding motifs.

has been shown to be involved with Rad51 mediated strand exchange [33]. Brh2 helps to mediate the ATP based catalytic activity of Rad51 during RPA displacement and Rad51 foci formation [33]. Further, Brh2 can promote D loop formation implying Rad51 loading on to the DSBs is possibly not the only retained function of BRCA2 [34]. During HR,

129

Rad52 has been known to create second end capture in yeast and interestingly Brh2 also seems to mediate this function in the presence of Rad51. Thus Brh2 seems to be involved with several functions during HR, and due to its structural and functional similarities to BRCA2 investigating whether the mammalian counterparts too possess the characteristic Brh2 functions might help us to understand the relevance of BRCA2 in vivo.

8.1.4 - RPA (Replication Protein A)

RPA (replication protein A) is a heteroretrameric protein known to bind to single stranded DNA (ssDNA). RPA exist as a 3 subunit complex: RPA70 (70KDa), RPA32 (32KDa), RPA14 (14KDa). RPA has been linked with multiple functions in eukaryotic cell, primary function been DNA metabolism. Thus it can be involved with DNA replication, DNA damage repair, and checkpoint activation. The characteristic domains available in RPA are the OB (olgoneucleotide binding) domains which contain zinc finger motifs. These domains are essential for the DNA binding activity of RPA. RPA70 possess the major DNA binding activity while RPA14 mostly is involved with stability of the formed hetrotetrameric protein. Based on preliminary clustalW analysis RPA seems to be fairly conserved across various eukaryotic species that includes fungi, vertebrates, invertebrates and plants. Further E.coli contains a homoteratmeric SSB (Ecssb) which functions similar to RPA in eukaryotic, implying structural diversification and functional conservation of this protein.

The affinity of RPA to ssDNA is high and thus upon DNA damage, the exposed DNA will be coated by RPA immediately. This binding stabilizes and protects the exposed DNA from nucleatic degradation. Therefore, these molecules are crucial for DNA repair especially during homologous recombination.

8.2 - Results

8.2.1- BRCA2 homolog is found in Planaria

Planarian Rad51 homolog was obtained from the sequenced planarian genome [35] and has been characterized in chapter 7. Therefore, with the assumption that the Rad51 and HR mediated DSB repair pathway is conserved, I analyzed the planarian genome for other molecules belonging to the HR pathway. Bioinformatics analysis on some of the molecules belonging to the HR pathway has also been characterized in chapter 6. BRCA2 functions are tightly related with Rad51 and studies have identified BRCA2 as the Rad51 mediator during DSB damage and repair. Further RPA binds to the ssDNA and protect the damaged DNA ends from degradation, and maintains the stability until displaced by Rad51. This function is essential for proper DNA repair and further establishes connection with the HR pathway. With this evidence BRCA2 and RPA homologs were searched in the Schmidtea

130 mediterranea genome. Bioinformatics analysis thus revealed one BRCA2 homolog and one RPA homolog.

The identified BRCA2 homolog contains 52% similarity to the human BRCA2. A 6quent pfam analysis identified two BRCA2 specific domain: BRCA2 helical and BRCA2

Figure 8. 2 – Genomic analysis of the Schmidtea mediterranea BRCA2 homolog. The identified BRCA2 homolog contains 52% similarity to the human BRCA2 pfam analysis identified two BRCA2 specific domain: BRCA2 helical and BRCA2 oligonucleotide/oligosaccharide-binding domain.

oligonucleotide/oligosaccharide-binding domain (Fig 8.2). This observation was further confirmed using NCBI BLAST where the same domain predictions were obtained. Previous analysis has revealed that BRCA2 is not structurally conserved across various species. This is demonstrated by the 57% sequence identity between human and mouse [36] and the 69% sequence identity between rat and human BRCA2 sequences (Uniprot analysis, data not shown). However, functionally this protein seems to be highly conserved across species showing IR sensitivity in the absence of its expression. Therefore, I asked

131 the question whether the identified planarian BRCA2 down regulation plays a major role towards IR sensitivity.

8.2.2 - Schmidtea mediterranea BRCA2 is expressed in proliferative cells and is down regulated upon RNAi

Figure 8. 3 - BRCA2 is down regulated by BRCA2(RNAi) (A) BRCA2 specific dsRNA was synthesized and injected into the planaria on days 1,2,3,12 and 24. The animals were usually fixed on Day 30 post first injection. (B) Qpcr analysis shows that BRCA2 gene expression is down regulated using the injection schedule from (A).

BRCA2 is phosphorylated during DNA damage and has been known to function together with Rad51 in mammalian model systems [37]. Chapter 7 focuses on Rad51 expression in the planarian cell populations. If the function of BRCA2 is conserved, I hypothesize that the phenotype and the expression profiles of BRCA2(RNAi) should be similar to Rad51(RNAi). To assess the functional conservation of BRCA2, a ~600 bp fragment from the BRCA2 sequence was cloned into pBluescript plasmid and dsRNA was

132 synthesized. The dsRNA was injected into the animals using an injection schedule described in Fig 8.3A. Note that the control set of animals were injected with water and each condition (control and RNAi) was starved during the injection schedule. Based on qpcr analysis the BRCA2 injected animals maintained down regulated BRCA2 expression levels. Thus we were able to conclude that our RNAi regime was capable of down regulating BRCA2 gene expression effectively (Fig 8.3B). To understand whether there is functional conservation post DNA damage, The BRCA2(RNAi) and control cohorts were irradiated (IR) with 1000 rads (sub lethal) on day 25 post first injection (PFI) and the animals were fixed 32 PFI using Carnoy fixation method. The animals were stained for H3p mitotic marker. Compared to controls that exhibited proliferative cells, BRCA2 animals did not contain any mitotic cells post sub lethal IR (Fig 8.4). This implies that upon sub lethal IR animals require BRCA2 in order to reinstate proliferative responses. This phenotype is Figure 8. 4 – BRCA2(RNAi) are sensitive to Radiation similar to the Rad51(RNAi) IR (A) Compared to controls, BRCA2(RNAi) animals did not contain any H3p positive cells post sub lethal sensitivity observed in chapter irradiation (1000 rads) 7. Therefore, we can assume that the Rad51 and BRCA2 function is functionally conserved in the planaria and that these two molecules are essential for proper DNA repair upon induced DNA damage in the planaria.

8.2.3 - Schmidtea mediterranea BRCA2 impacts cell proliferation similar to Rad51(RNAi) down regulation

BRCA1 and BRCA2 have functions during developmental stages and during cancer initiation where a constant proliferative status is maintained. BRCA2 down regulation confers embryonic lethality at E7.5 further providing evidence for its importance for proliferation and development. Identifying the spatial and temporal regulation of BRCA1 and BRCA2 gene expression patterns have revealed that they are mostly expressed in rapidly dividing cells [37].

To understand the functional relevance of BRCA2 down regulation in vivo, I stained control and BRCA2(RNAi) animals with α-H3p antibody marking the mitotic cell population. Analyzed data across 4 independent experiments (n=16), showed animals

133 containing a down regulation in proliferative cells. Strikingly, down regulation of H3p was similar to that of Rad51(RNAi) mediated down regulation. where only a few cells proliferated in the anterior region and down regulated cells proliferated in the posterior region of the animals [Control anterior 219.27 ± 37.15, Control posterior 192.92 ± 43.87 BRCA2(RNAi) anterior 96 ± 57.2, BRCA2(RNAi) posterior 28.3 ± 24.1] (Fig 8.5 A-C). This further implies that BRCA2 and Rad51 functions are related in the planaria and the regional differences in cell proliferation are mediated by both molecules, probably synonymously acting together.

The data observed shows slightly elevated cell proliferation in the BRCA2(RNAi), specifically in the posterior region: Rad51(RNAi) posterior 8.1 ± 7.71, BRCA2(RNAi) posterior 28.3 ± 24.1 (figure 8.5). Up regulation in the posterior regions of BRCA2(RNAi) animals compared to the Rad51(RNAi) was significant (p=0.049) This result could imply: (1) BRCA2 in a Rad51 independent manner regulates cell proliferation and or cell death in the posterior (2) BRCA2 could be differentially regulated by pathways in the posterior region that the lack of BRCA2 presence renders few cells to proliferate abnormally in the posterior region. The anterior regions of Rad51(RNAi) and BRCA2(RNAi) did not confer any significant differences: Rad51(RNAi) anterior 85.21± 30.47, BRCA2(RNAi) anterior 96 ± 57.2.

To further analyze the slight up regulation in the posterior region, I performed dual down regulation of Rad51 and BRCA2 using RNAi. The dsRNA for Rad51 and BRCA2 was equally combined and injected based on the injection schedule in figure 8.3A. 30 days post first injection, animals were fixed and stained for proliferative marker H3p. The anterior of the Rad51+BRCA2 data showed no significant difference to the singly down regulated Rad51(RNAi) and BRCA2(RNAi): Rad51+BRCA2 anterior 113.75 ± 59.85. However, in the posterior region, BRCA2+Rad51(RNAi) animals maintained a slight in increase cell proliferation compared to Rad51(RNAi) alone, Rad51+BRCA2(RNAi) anterior contains 20.08 ± 15.11 (Fig 8.5). This however was not significant (p=0.5). But the slight increase in cell proliferation similar to the BRCA2(RNAi) alone result could imply that BRCA2 could be involved with regulating cell proliferation independent of Rad51.

Quantitative PCR performed to understand the levels of Rad51 in a BRCA2(RNAi background and BRCA2 levels in a Rad51(RNAi) background show decreased gene expression levels of BRCA2 and Rad51. This further implies, not only the functional interplay and relation between the two molecules, but that they are possibly involved with regulating each other’s expression at the gene level. However, these genes are mostly expressed in the neoblasts and the down regulation of neoblasts in the Rad51(RNAi) and the BRCA2(RNAi) could also result in the down regulation observed in Figure 8.6.

134

Figure 8. 5 – BRCA2(RNAi) down regulates mitosis maintaining regional differences similar to Rad51(RNAi). (A-B) BRCA2(RNAi animals down regulate mitosis and portray regional differences similar to the Rad51(RNAi) animals observed in chapter 8. (C) Quantification of H3p positive cells: Control anterior 219.27 ± 37.15, Control posterior 192.92 ± 43.87 BRCA2(RNAi) anterior 96 ± 57.2, BRCA2(RNAi) posterior 28.3 ± 24.1, Rad51(RNAi) anterior 85.21± 30.47, Rad51(RNAi) posterior 8.1 ± 7.71, Rad51+BRCA2(RNAi) posterior region maintains slight up regulation of cell proliferation compared to Rad51(RNAi) alone and similar to BRCA2(RNAi) alone. Rad51+BRCA2 anterior 113.75 ± 59.85. Rad51+BRCA2(RNAi) anterior 20.08 ± 15.11.

135

Figure 8. 6 – BRCA2 and Rad51 expression levels (A) BRCA2 gene expression is down regulated in the Rad51(RNAi) equally (N=1). (B) Rad51 gene expression is down regulated in BRCA2(RNAi) mostly in the posterior region (N=1).

Emerging studies have shown that BRCA1 and BRCA2 could be involved with transcriptional regulation and chromatin remodeling [38-41]. Whether similar to the BRCA2 ortholog Brh2 in the fungus Ustilago maydis, planarian BRCA2 could act in a Rad51 independent manner to perform other functions necessary for DNA repair and cell proliferation needs investigation. These studies will provide additional in vivo roles for BRCA2 and whether this molecule could important for maintenance of regional differences, homeostasis and tissue repair and regeneration still remains to be characterized.

136

8.2.4 - BRCA2(RNAi) down regulates neoblasts and successive progeny similar to Rad51(RNAi)

To assess whether BRCA2 down regulation plays a role in mediating regional differences based on the neoblast and successive progeny, Quantitative PCR analysis was performed using characterized Smedwi-1, Cyclin B and NB.21.11e. RNA extracted from BRCA2(RNAi) anterior posterior fragments compared to control anterior and posterior

Figure 8. 7 – BRCA2(RNAi) down regulates neoblast marker expression. (A) Smedwi-1 (B) Cyclin B (C) NB.21.11e markers are down regulated in the BRCA2(RNAi). The neoblast and early division progeny down regulation pattern resembles Rad51(RNAi) neoblast down regulation.

137 fragments clearly showed regional differences in neoblast marker expression. Each representative marker retained some expression in the anterior fragment, however was down regulated in the posterior fragment (Fig 8.7 A-C). This further confirms regional differences associated with the impairment of the HR pathway.

8.2.5 - Schmidtea mediterranea BRCA2 maintains regional differences in cell death similar to Rad51(RNAi)

One of the decisions post DNA damage could be induction of cellular death to eliminate the damaged cell from the cellular population. BRCA2 is well known for mediating Rad51 during HR. BRCA2 embryonic lethality similar to Rad51 can be partially rescued by down regulating p53 [42]. Further BRCA2 is capable of forming complexes with Rad51 and the well-known tumor suppressor p53, which is involved with apoptosis [43]. This is further confirmed by studies demonstrating BRCA2 mediated tumor progression which requires disruptions in the p53 pathway [44]. Further similar to Rad51, BRCA2 mediated embryonic lethality could be partially rescued by down regulating p53 [22]. Thus intrinsic BRCA2 functions could be associated with pathways associated with cellular death. Based on chapter 7 results, Rad51 down regulation in the planaria showed overall increase in cellular death with TUNEL positive cells mostly accumulating at the posterior region of the animal. Thus BRCA2(RNAi) animals 30 days post the first BRCA2 dsRNA injection, were fixed using NAC fixation method for TUNEL, and stained for TUNEL positive cells. Overall, BRCA2(RNAi) contained increased cell death compared to controls: Control anterior 108.56 ± 27.2, BRCA2(anterior) 271.6 ± 113.9, Control posterior 145.5 ± 37.6, BRCA2(posterior) 704.9 ± 188.6. Interestingly, BRCA2 TUNEL positive cells showed the same phenotype shown by the Rad51(RNAi) where posterior TUNEL positivity was up regulated ~2.6 fold compared to the anterior (Fig 8.8 A-C) (two independent experiments, n=6). But interestingly, the BRCA2(RNAi) alone contained increased TUNEL positive cells in the anterior and the posterior region compared to Rad51(RNAi) alone (one independent experiment, n=5).

To understand whether the observed increase in TUNEL positive cells is due to Rad51, we down regulated Rad51 and BRCA2 together and analyzed cell death by TUNEL staining. Although there is a slight up regulation in cell death due to Rad51 down regulation simultaneous with BRCA2, compared to BRCA2(RNAi) alone, this increase is not significant: BRCA2+Rad51(RNAi) anterior 434.1 ± 52.4, BRCA2+Rad51(RNAi) posterior 775.75 ± 117 (fig 8.8D). Therefore, even with Rad51 down regulated, cell death counts equaled to that of BRCA2(RNAi) alone. This signifies that the down regulation of BRCA2 may play a more significant role towards cell death. Rad51 and p53 plays a role maintaining cell death along the anterior posterior axis (Chapter 9 fig 9.3). Therefore, analyzing cell proliferation and cell death post BRCA2 and p53 down regulation might provide insight into how these two molecules maintain homeostasis in the planaria.

138

Figure 8. 8 – BRCA2(RNAi) increases Cell death similar to Rad51(RNAi) (A) Compared to controls (B) BRCA2(RNAi) contains more cell death in the anterior region. (C) Simultaneous down regulation of Rad51 and BRCA2 increased cell death system wide. (D) Overall BRCA2(RNAi) contained increased cell death compared to controls: Control anterior 108.56 ± 27.2, BRCA2(anterior) 271.6 ± 113.9, Control posterior 145.5 ± 37.6, BRCA2(posterior) 704.9 ± 188.6. BRCA2+Rad51(RNAi) anterior 434.1 ± 52.4, BRCA2+Rad51(RNAi) posterior 775.75 ± 117.

139

8.2.6 - RPA homolog is found in Planaria

The identified RPA homolog contains 58% similarity to the human RPA. A 6 frame translation and subsequent pfam analysis identified a RPA specific N terminal domain, a DNA binding domain and RPA specific C terminal domain (Fig 8.9). This observation was further confirmed using NCBI BLAST with the same domain predictions for RPA70 protein. RPA is structurally conserved across species and therefore understanding the functional conservation of this protein in the planaria is relevant towards my thesis. In order to understand functional conservation, a 600bp fragment from RPA was cloned into pBluescript plasmid and RPA specific dsRNA was synthesized. The dsRNA was injected into the animals similar to the injection regime employed for BRCA2 (Fig 8.3).

Figure 8. 9 – Identification of RPA70 homolog in the planaria. The identified planarian RPA homolog contains RPA N terminal domain and a RPA C terminal domain. The structure has 58% similarities to the human RPA70.

140

8.2.7 - Schmidtea mediterranea RPA impacts cell proliferation

RPA is mainly involved with DNA metabolism. Due to its multiple roles in DNA repair, cell cycle arrest and checkpoints, RPA down regulation could impact the stem cell

Figure 8. 10 - RPA(RNAi) impairs neoblast proliferation. Mitotic cells are down regulated in the RPA(RNAi), but is slightly up regulated in the posterior compared to the anterior. Simultaneous down regulation of Rad51 and RPA results in regional differences observed with Rad51(RNAi). Please note that all statistical analysis was performed using the anterior or posterior controls from figure 8.5.

population. A screen provided previously have characterized RPA(RNAi) to contain head regression and confers a lethal phenotype with down regulation of mitotic cell population. Head regression is usually associated with the depletion of the neoblasts in the planaria. Thus to confirm this result, RPA(RNAi) and control cohorts were injected. 30 days post RNAi, the animals showed head regression developing into a more lethal phenotype. Mitotic cell analysis was performed on the RPA(RNAi), Based on preliminary data obtained animals that showed head regression did not contain any mitotic cells (data not shown). Thus the animals post the injection regime was fixed at day 25 post first injection. In this setting a few mitotic cells were still present, however more cells were observed in the posterior region of the animal: RPA(RNAi) anterior 5.3 ± 0.34, RPA(RNAi) posterior 15 ± 3.4 (one independent experiment, n=5). This phenotype opposes the data observed for

141

Rad51(RNAi) where cells divided more in the anterior than then posterior region (Fig 8.10). Thus RPA confers regional differences albeit different from Rad51(RNAi) phenotype observed. To confirm this occurs independent of Rad51, animals injected with equal amounts of Rad51 and RPA dsRNA was fixed and stain with the mitotic marker H3p. Preliminary analysis on the Rad51+RPA(RNAi) showed similar phenotype observed in the Rad51(RNAi) alone animals: RPA+Rad51(RNAi) anterior 53.711 ± 18.5, RPA+Rad51(RNAi) posterior 4.67 ± 6.6 (one independent experiment, n=5). Thus Rad51 absence pertained a dominant function over the absence of RPA. Rad51 displaces RPA to repair DSBs and thus disruption of HR mediated pathway destabilizes homeostasis and confers the anterior/posterior regional differences with cells mainly proliferating at the anterior. RPA singly down regulation confers neoblast down regulation probably due to its status as a DNA metabolizer and a DNA repair contributor. Thus Rad51 and RPA might provide cell cycle progression decisions independently from each other. However, analyzing the gene expression levels imply that Rad51 and RPA might have some regulatory roles with each other and is possibly co-expressed together in neoblasts (Fig 8.11).

Figure 8. 11 – RPA and Rad51 expression levels (A) RPA gene expression is down regulated in the Rad51(RNAi) equally (N=1). (B) Rad51 gene expression is down regulated in RPA(RNAi) mostly in the posterior region (N=1).

142

Figure 8. 12 - RPA(RNAi) down regulates neoblast marker expression (A) Smedwi-1 (B) Cyclin B (C) NB.21.11e (D) AGAT-1 markers are down regulated in the RPA(RNAi). The neoblast, early division progeny and late division progeny down regulation pattern does not resemble Rad51(RNAi) or BRCA2(RNAi) phenotypes observed.

143

8.2.8 - Schmidtea mediterranea down regulates neoblasts and successive progeny but does not impose regional differences

To assess whether RPA down regulation plays a role in mediating regional differences on the neoblast and successive progeny, Quantitative PCR analysis was performed using characterized Smedwi-1, Cyclin B, NB.21.11e and AGAT-1 primers. RNA extracted from RPA(RNAi) anterior/posterior fragments were compared to control anterior and posterior fragments, which clearly showed a marked down regulation of these genes. This supports the down regulation of the H3p positive cells in the RPA(RNAi) implying that proliferation is impaired in the planaria. Successive progeny marker down regulation further implies possible impairment in differentiation potential and cell death. However, RPA(RNAi) did not confer regional differences in neoblast marker expression opposed to BRCA2(RNAi) and Rad51(RNAi). Thus the regional differences were more related to functions imposed by BRCA2 and Rad51. RPA however is involved with DNA metabolism and is closely linked with DNA repair mechanisms. Thus this link in cell proliferation and neoblast expression should be investigated to understand decisions mediated by the system during DNA damage and DNA replication.

8.3 - Conclusions

BRCA2 and RPA are required for mediation of proper DNA repair via the homologous recombination pathway. Impairment of these molecules in vivo during development results in embryonic lethality. Thus studying their in vivo regulation and relevance remains a complication. Conditional knockdowns do not provide the molecular regulation in a natural environment and the truncated BRCA2 could only produce a few viable mice. To ameliorate these issues, and to understand in vivo regulation of BRCA2 and RPA in adult animals, planarians as a model organism can be utilized. After identifying structurally conserved homologs for BRCA2 and RPA, the sequences were cloned and effectively down regulated in the whole animal using RNAi technique. Functional analysis in vivo revealed that BRCA2 is important for DNA repair and similar to Rad51(RNAi), BRCA2(RNAi) disrupts tissue homeostasis. Regional differences conferred by the Rad51(RNAi) is observed upon BRCA2(RNAi), implying regional differences in cell proliferation and cell death is due to impairment in the homologous recombination pathway.

BRCA2(RNAi) renders a slight increase in proliferative cells in the posterior region compared to Rad51(RNAi) and also increases cell death as observed by TUNEL assay. This data suggests BRCA2 could function independent of Rad51. Rad51 has the capability to bind to p53 and simultaneous down regulation of Rad51 and p53 could alleviate the embryonic lethality observed with Rad51 knock down. This same phenotype was observed with simultaneous BRCA2 and p53 down regulation, where partial rescue of the BRCA2 mediated embryonic lethality was accomplished. Data since then has emerged of co- mingled function between Rad51, p53 and BRCA2 during maintenance of genomic

144 integrity [43]. Thus to understand the difference between Rad51 and BRCA2 cell proliferation and cell death, p53 must be simultaneously down regulated with BRCA2. This will provide whether the observed BRCA2(RNAi) cell death and cell proliferation differences are due to p53 mediated differential regulation. BRCA2 has been found to inhibit transcriptional activity of p53 further implying synergistic roles with the p53 pathway [22, 31]. If this remains a fact, the increase in cell death seen in the BRCA2(RNAi) might be related with down regulated p53 functions.

Studies have shown that BRCA2 has the capability to suppress cell division by stabilizing MAGE-D1 in a p53 independent manner [45]. Thus BRCA2 might be interacting with various pathways during maintenance of homeostasis, embryonic development, tissue repair and regeneration. BRCA1 and BRCA2 also has the capability to regulate the mitotic checkpoint and spindle assembly during cell cycle progression [46]. BRCA2 transactivation domain also maintains transcriptional activities. Studies have found that BRCA2 has the capability to complex with Smad3 and initiate gene expression. Smad3 is involved with many cellular functions such as cell cycle progression, apoptosis and differentiation. Smad3 interaction with BRCA2 may convey further cell cycle regulatory defects in the BRCA2(RNAi). Rb is known to regulate DNA damage responses, and whether this molecule has an interplay with BRCA2 during maintenance of tissue homeostasis has not been discovered [47]. Due to the clinical relevance of BRCA2 and our limited understanding of its function in vivo, understanding how BRCA2 is relevant to maintain homeostasis will be crucial.

The studies in this chapter imply that RPA down regulation impairs cellular proliferation and down regulates neoblasts and their successive progeny. However, the neoblast markers did not impose regional differences similar to Rad51 and BRCA2. This implies that lack of RPA might not impose the same decisions mediated by the planarian system. Further analysis for RPA(RNAi) IR sensitivity, cell death and cell division machinery is required to understand the functions mediated by RPA. Interestingly Rad51 and RPA dual down regulation imposes regional differences similar to Rad51(RNAi) alone. Thus this further confirms an important role towards Rad51 and imposing a hierarchy towards systemic decision based on the expression certain factors.

145

Chapter 9

Rad51 interplay with tumor suppressors contribute towards the observed regional differences

9.1 - Introduction

9.1.1 - p53 and DNA damage responses

Cell proliferation is determined and regulated by intricate networks that determine the fate of the cell depending on genomic integrity, availability of metabolic responses and tissue damage and repair. Thus activated various pathways collaborate to progress the targeted cell through the G1 phase to the M phase. Central to this progression are p53 and Rb (Retinoblastoma protein). P53 and Rb are tumor suppressors and deregulation of these molecules have been implicated in a number of pathogenesis including cancer. Understanding various pathways that contribute and collaborate to sustain or inhibit these molecules, and further deduce the regulatory aspects imposed by these molecules in vivo is necessary to provide more refined approaches towards tumor specific therapies.

P53 was first identified as an SV40 large T antigen having oncogenic properties. Since then p53 has emerged as a powerful tumor suppressor that is in a pivotal position controlling cell proliferation and cell death. The central focus of this protein is to maintain cellular homeostasis and therefore p53 has been identified as the “guardian of the genome” and the “cellular gatekeeper” [1]. p53 family of proteins also involves p73 and p63 proteins containing similar structures and functions to p53 and also modulate similar regulatory networks. Thus in certain p53 mutations, p73 and p63 might be compensating for the loss of p53 [2]. p53 functions are varied and central to this functions is the well formatted structure of the p53 protein. p53 contains nuclear localization signals, transactivation domains, and DNA binding domains. Nuclear export signals are essential for its activity as a transcription factor [3, 4]. P53 activation is induced by a varied number of responses such as DNA damage, cell cycle arrest at checkpoints, apoptosis, autophagy, oncogene activation, hypoxia and senescence. Once activated p53 will transcriptionally activate a myriad of genes to regulate pathways based upon the cellular need. An ortholog for a p53 like protein has been discovered and characterized in Schmidtea mediterranea [5].

Upon DNA damage p53 becomes phosphorylated,activated and equates to cell cycle arrest, senescence or programmed cell death. Studies indicate the level of mRNA expression of p53 does not change due to DNA damage, however the protein function increases implying an increase in p53 stability by post translational modifications (Kastak 1991). P53 is important for DNA repair process due to its decision making to either arrest the cell cycle progression until DNA damage has been repair or induce programmed cell death to eliminate the damaged cell from the cellular pool. DNA damage cell cycle arrest can be initiated at the G1 checkpoint or the G2 checkpoint of the cell cycle. P53 is also

146 capable of increasing the duration of the cell cycle arrest based on the induced amount and rate of DNA damage.

The mechanism which decides to arrest a cell at a cell cycle checkpoint or eliminate itself from the cellular pool by apoptosis still remains unanswered. However, p53 seems to be mediating a central role in this decision making and studies have begun elucidating its role in the NHEJ and HR pathways. Even though HR repair is error free, tumors are known to overexpress Rad51 and increase HR mediated activities, increasing resistance to DNA damaging agents [6]. Therefore, this pathway is tightly regulated by p53. P53 can down regulate Rad51 function by either repressing Rad51 transcription or by inhibiting Rad51 foci formation [7-9]. Down regulating p53 in a Rad51-/- background partially rescues the lethal phenotype induced by Rad51 deficiency [10]. This further provide evidence for direction interaction and regulation between p53 and Rad51. Interestingly, even one DSB can induce p53 activation and induce cell cycle arrest which implies that priority is given to recruit p53 upon DNA damage (Huang 1996a). The dynamic between DNA damage response, p53 activation and the decision for p53 to allow the progression of the DNA repair process still remains unclear. Further, DNA-PK involved with the NHEJ pathway has the capability to phosphorylate p53 and further inhibit mdm2 binding to p53 disrupting p53 degradation [11]. On the other hand, NHEJ is an error prone DNA repair mechanism and is highly susceptible to mutations, which can mediate problems especially if the mutation is within a coding region. Therefore, this process too must be tightly regulated and p53 seems to be involved with controlling NHEJ, minimizing mutagenic effects produced by this pathway [12]. Decisions allowing HR or NHEJ mediated DNA repair,subsequent cell cycle arrest, or the progression towards cellular death seems to be maintained centrally by the powerful tumor suppressor p53 gene. Moreover, understanding p53 mediation in vivo together with each repair pathway is essential to our understanding.

9.1.2 - Rb and DNA damage responses

Rb (Retinoblastoma) protein is the first tumor suppressor to be identified and cloned [13]. Rb function revolves around cell cycle progression, especially in controlling the G1 to S phase transition. Rb inhibits E2F transcription factors that is required for cell cycle progression, thereby controlling cellular fate. Rb belongs to a family of proteins termed the “pocket proteins”. Rb family of proteins is made out of Rb (p105), p107 and p130 (Rb2) proteins and the term pocket protein is given due to a grove present in these proteins that facilitates the binding of E2F proteins. Structurally, Rb protein can be divided into 3 main regions: N terminus, small pocket domain and the C terminus. The small pocket domain flanked by the N and C terminus contains the most mutations detected in cancers. Further, this region contains the most conservation in amino acids to the other pocket proteins p107 and p130. The combined regions of the C terminus and the small pocket domain is termed the large pocket domain. This region is important for the protein interaction with the E2F family of transcription factors.

147

Upon external mitogenic stimulation a cell can enter cell cycle. The cell eventually enters the restriction point (R point) whence the cell does not require external mitogenic stimuli to progress through the cell cycle. Rb plays a major role in facilitating the R point switch. Rb mainly binds to E2F proteins at their transactivation domain and inhibits their function maintaining the cell at G0 (quiescent) phase. However, upon entering the cell cycle, Rb gets phosphorylated which frees E2F binding to Rb and transcribes genes essential for cell cycle progression. Thus Rb function fits into the category of tumor suppression. Rb inactivation during development is embryonically lethal with the lethal phenotype conveyed around E12-15. This has been linked with proliferation defects and increase in apoptosis. Several studies performed during development and in adults have indicated that Rb inactivation stimulates p53 dependent apoptosis [14, 15]. Further Rb together with p53 has been implicated in replicative senescence and SIPS [16].

Stress induced premature senescence (SIPS) defers from replicative senescence and is induced usually by DNA damage causing agents such as IR. These cells do not necessarily contain shortened telomeres and by passing SIPs can create aggressive tumor formation [17, 18]. SIPS formation has also been shown to be dosage dependent where rates of high irradiation exposure could enhance SIPS [18]. Inducing IR mediated DSBs can activate p53-p21 dependent pathway that can induce growth arrest and induce senescence [18]. Usually p53 expression will be sustained up to 6 hours post DSBs, however in SIPS cells p53 expression can be DNA Damage sustained for about 10 days [19, 20]. Activation of p16INK4a inhibits Cyclin D and CDK4/6 which terminates the phosphorylation of Rb P53 RB protein inhibiting cell cycle progression at the early phases of cell cycle. Cell Cycle Arrest This level of cell cycle control mediated at the early stages of cell cycle more than likely induces senescence and in the presence of DNA Apoptosis DNA Damage Senescence damaging agents, SIPS. Repair Whether this process is irreversible or reversible Figure 9.1 – DNA damage and Tumor suppressor responses could depend on the type Upon DNA damage, cells arrest at cells cycle. Rb and p53 tumor of DNA damaging agent suppressors are known to mediate several cell cycle regulatory roles such as initiation of DNA damage repair, senescence or apoptosis. and the amount of sustained damage.

148

A Rb homolog has been discovered in the planaria [21]. These animals are capable of mounting some proliferative responses however, proper regeneration is impaired. Interestingly Rb(RNAi) mediate regional differences in cell proliferation, concentrating more cell division in the posterior than in the anterior. This contains opposing regional differences to Rad51(RNAi). Additional characterization is required to determine the modulation of these regional differences due to Rb(RNAi). But since we observed Rb up regulation in the Rad51(RNAi) anterior region relative to Rad51(RNAi) posterior region, investigating Rb and Rad51 interplay might provide valuable information.

Upon DNA damage Rb and p53 mediates decisions that are crucial for cell fate decisions. In this chapter, I focus on how these tumor suppressors might interplay with the HR pathway and possibly impose regional differences in the planaria, in vivo during maintenance of normal homeostasis.

9.2 - Results

9.2.1 – p53 and Rad51 interplay

Smed-p53 and Smed-Rb have been identified in the planarian model organism previously. Single down regulation of each molecule by RNAi has revealed the importance of each tumor suppressor towards maintenance of systemic homeostasis, tissue repair and regeneration [5, 22].

P53 is mainly expressed in the post mitotic progeny (X2) in the planaria, and the down regulation of Smed-p53 results in an increase in cell proliferation during the initial phase. During this phase the X2 population is depleted showing regional differences with the X2 cell marker NB.21.11e (prog-1) where it is more expressed in the anterior than the posterior. Thus this increase in neoblasts (smedwi-1 positive cells) seems to occur while restricting differentiation potential. During the latter phase of Smed-p53 down regulation, the stem cell compartment become depleted and restricted to the posterior region of the animal. In addition, similar to the proliferative cells, the X2 progeny seems to be now increased/restricted to the posterior region than the anterior region of the animal. This phenotype agrees with the head regression phenotype observed in the p53(RNAi). Thus in the absence of p53, some stem cells have the capability to proliferate in the posterior region and the anterior division is completely restricted.

P53 has the capability to directly bind and regulate Rad51 function and further transcriptionally repress its expression. Thus we performed quantitative pcr analysis to understand the levels of p53 gene expressed in the Rad51(RNAi) animal. Anterior and posterior amputated control and Rad51(RNAi) animals were used to extract RNA and quantitative pcr was performed. Based on initial analysis, p53 is equally expressed in the control cohorts in both the anterior and posterior region. This expression was down regulated in the Rad51(RNAi) ~2-3 fold. The posterior region contained less p53 and this

149 could be connected to down regulation of the X2 progeny at the posterior region. Rad51(RNAi) animals also showed decreased quantities of NB.21.11e positive cells in the posterior region of the animal compared to the anterior (Fig 7.11).

Figure 9.2 – P53 interplays with Rad51 to maintain cell proliferation along the anterior posterior axis. (A) p53 expression is equally distributed along the anterior posterior axis of the Rad51(RNAi) (B) p53 downregulatuon by injection increases cell proliferation, however simultaneous downregulation of Rad51 and p53 imposes regional differences. Interestingly relatively increased levels of cell proliferation is observed in the Rad51+p53(RNAi) posterior region.(C) Quantification of mitotic cells: (Three separate experiments, n=15)

150

To assess the p53 function imposed by the p53 down regulation, we performed an injection regime similar to the Rad51(RNAi) down regulation (chapter 7.3). To further understand how Rad51 and p53 interacts in vivo in adult animals we down regulated Rad51 together with p53. Post injection (30 Days), control, p53(RNAi), Rad51(RNAi) and Rad51+p53(RNAi) animals were fixed though carnoy fixation and stained for the mitotic marker H3p. During this phase the p53(RNAi) maintained increased proliferation synonymous with the observed first phase of Smed-p53 down regulation. Rad51(RNAi) as observed earlier maintained down regulated cell division, while Rad51+p53(RNAi) also compared to p53 down regulated its proliferative potential. However, there was a significant but slight increase (p=0.018) in cell proliferation in the Rad51+p53(RNAi) compared to Rad51(RNAi) alone animals (Figure 9.2 C). Further a slight significant increase in cell proliferation was also detected in the Rad51+p53(RNAi) compared to the Rad51(RNAi) alone (p=0.03). This data implies that the absence of p53 renders an increase in cell proliferation which is independent of Rad51. Compared to the anterior Rad51(RNAi) the anterior Rad51+p53(RNAi) contained ~3 fold up regulation in cell division while the posterior of these RNAi animals had a ~16 fold difference. This implies that with p53 and Rad51 down regulation the posterior region of the animal mediate proliferation in the posterior region than the anterior region. This was not observed in the p53(RNAi) alone animals implying the regional differences imposed is due to an interplay between Rad51 and p53. Whether this increase in Rad51+p53 is due to an Rad51 independent p53 mediated increase in proliferation at the sacrifice of down regulated differentiation potential, or whether Rad51 and p53 is playing a role towards mediating cell proliferation together remains to be investigated. Supporting this hypothesis are the partial rescue of phenotypes observed in the Rad51 and p53 dual knock down mice [9]. This phenotype might potentially implicate Rad51 and p53 synergistic functions to promote cell proliferation to maintain homeostasis in the intact animal or during development. However, since p53 down regulation did not initiate a full recovery, I hypothesize that there are other crucial factors that might be affecting cell proliferation together with Rad51.

HR is an important pathway to mediate cell proliferation and maintain homeostasis in the planaria (chapter 7). In the Rad51(RNAi), in the absence of the HR pathway, p53 might be the crucial tumor suppressor that might decide between cell cycle arrest, senescence or apoptosis. In fact the increase in cellular death in the Rad51(RNAi) posterior region could implicate p53 could be involved with imposing apoptosis. To assess this, TUNEL assay was performed on control, p53(RNAi), Rad51(RNAi) and Rad51+p53(RNAi) animals. Previous studies have indicated that p53 down regulation impairs the post mitotic progeny, and the down regulation of NB.21.11e could be happening with less differentiation capability. The data obtained here further adds cell death as a possible mediator that could possibly be involved with maintenance of neoblasts and post mitotic progeny. NB.21.11e is severely down regulated in the p53(RNAi) and the increase in cell death observed in the posterior region of the p53(RNAi) might be an additional reason for this down regulation. Thus decreased differentiation capability and cell death might be crucial to understand p53 mediated systemic regulation. In the absence of Rad51 and p53 the anterior region of the animals contained massive cellular death

151 implying the anterior cell death and cell cycle arrest was probably mediated by p53 (Figure 9.3 A-B). Compared to this, Rad51+p53(RNAi) increased cellular death implying, in the absence of Rad51, p53 might be playing a crucial role to maintain homeostasis and induce either cell cycle arrest or senescence. But in the absence of p53, the cells are induced to die. The mechanisms that induce this cell death remains unanswered, however this could further imply that p53 is involved with cell cycle arrest in the anterior region as well. Further, p53 also is an important senescence regulator and could be initiating senescence

Figure 9.3 – P53 interplays with Rad51 to maintain cell death (A) p53 down regulation increases cell death through the system, while Rad51(RNAi) imposes cell death more in the posterior region. Rad51+p53 simultaneous down regulation increases cell death equally along the anterior posterior axis. (B) Quantification of TUNEL positive cells: (Two separate experiments, n=6)

152 in the anterior region of the Rad51(RNAi) [23]. Compared to the anterior region, the posterior region of the Rad51+p53(RNAi) had a slight down regulation in cell division. With the down regulation of p53 with Rad51 the observed regional difference in cell death was removed implying p53 is a crucial mediator that imposes regional differences in cell death in the absence of Rad51.

The above observation we obtained was from the first phase of smed-p53 down regulation. However understanding the synergistic interplay between p53 and Rad51 at the

Figure 9.4 – Rb interplays with Rad51 to maintain cell proliferation (A) Rb expression is expressed more at the anterior than the posterior of the Rad51(RNAi) (B) Rb down regulation by injection down regulates cell proliferation concentrating cells to the posterior, however simultaneous down regulation of Rad51 and Rb eliminated all proliferative cells.(C) Quantification of mitotic cells: (Three separate experiments, n=15)

153 second phase might impose problems since the RNAi animals show lethality post 30 days of RNAi injection. Therefore, as a future direction, down regulating p53 first and then inducing Rad51 down regulation might be important to understand how Rad51 behaves in a complete p53 null background.

9.2.2 – Rb and Rad51 interplay

The identified Rb homolog in the planaria is crucial for the maintenance of the smedwi-1 positive neoblast population. Even though the smedwi-1 positive cells are equally distributed in the Rb(RNAi), the mitotic progeny is concentrated in the posterior region, implying that Rb is crucial for proliferative signals mediated in the anterior region of the planaria. This data validates the studies performed showing Rb mutations in retinoblastoma [24]. However, post 24 hours of irradiation Rb(RNAi) animals maintained smedwi-1 positive cells [21] implying some cells attempt at cell division post IR in the anterior region. Which molecules are involved with this pathway has not been elucidated.

Figure 9.5 – Tumor suppressors mediate different functions along the anterior posterior axis in the absence of Rad51. Rad51 down regulation imposes regional differences in cell proliferation. An interplay between Rb and p53 with the HR pathway mediates regional differences.

154

Rad51 is a crucial player in the HR pathway and since the down regulation of Rad51 implies regional differences in the planaria. I next observed whether Rb is a crucial tumor suppressor, a mediator of senescence and could interplay with Rad51 to mediate regional differences in the planaria. Observing the Rb gene expression in the control vs Rad51(RNAi) anterior and posterior regions indicated that Rb gene is equally expressed between the anterior control and anterior Rad51(RNAi). However, the posterior Rad51(RNAi) fragment contained a significant down regulation in the Rb gene expression. Rad51(RNAi) eliminates mitotic cells in the posterior region and down regulates H3p+ cells in the anterior region. Since Rb is primarily expressed in the planarian neoblast population I hypothesize that the elimination of the neoblast population could be the reason why Rb is down regulated in the posterior. While the anterior region maintains Rb gene expression to maintain some proliferative responses. Whether Rb is imposing cellular senescence or a halt in the proliferative status remains to be elucidated.

To assess the interplay between Rad51 and Rb during maintenance of cell proliferation, Rad51 was down regulated together with Rb and compared to control, Rad51(RNAi) alone and Rb(RNAi) alone animals (Figure 9.5). Similar to previously published data Rb(RNAi) mitosis was concentrated in the posterior region of the animal. However, dual down regulation of Rad51 and Rb completely eliminates cell division in the posterior region implying that proliferation in the posterior region might involve the HR pathway. While the anterior region in these animals contained a few cell divisions, compared to other RNAi combos Rb and Rad51 dual down regulation had the most implications towards cell division. Rb down regulation with p53 maintained more cells in the posterior compared to the anterior with an up regulation in cell proliferation in the posterior. This further implies that with the down regulation of p53, the cells in the

Figure 9.6 – Tumor suppressors mediate cell proliferation based on systemic positional cues Down regulation of Rb and p53 with Rad51 in DT (APC RNAi) animals show mitotic responses observed in intact posterior regions.

155 posterior region promote more cell proliferation. Overall, down regulation of p53 promotes cell proliferation, and though dual down regulation with Rb decreases the proliferation, compared to p53(RNAi) alone there is significant decline in proliferation. This set of data between p53 and Rb down regulation implies that Rb might have a principle role at modulating cell proliferation than p53 (Figure 9.5).

Overall the triple knockdown animals maintained very little proliferative cells implying the need for Rad51 and Rb during cell proliferation and maintenance of tissue homeostasis. Interestingly Rb, p53 and Rad51 triple down regulation increased some proliferation in the posterior region of the animal compared to the dual Rb+Rad51(RNAi) alone (Figure 9.5). The likely character involved with this up regulation is p53, further implicating its role towards cell death in the posterior region.

9.2.3 – Rb and p53 decisions are governed by systemic positional cues

To assess whether the regional differences maintained by the planaria is due to signals arising from the posterior region of the planaria, I obtained double tail (DT) animals generated by down regulating Smed-APC and injected Rad51, Rb, p53 RNAi as shown in figure 9.6. These animals were fixed 30 days PFI and stained with mitotic marker H3p to understand proliferative levels. Similar to intact planarian posterior region, Rad51(RNAi) animals did not contain any proliferative cells while p53(RNAi) alone or Rb(RNAi) alone contained relatively higher proliferative levels. However, down regulation of Rad51 with either Rb or p53 showed a slight increase in cell proliferation in the DT animals. Triple down regulation also conferred few proliferative cells. This implies that in the presence of an animal that does not contain a brain, Rad51(RNAi) animals did not attempt any proliferation. This was mitigated by Rb and p53 tumor suppressor down regulation. This result implies that the regional differences observed were probably due to positional cues conferred by different regions of the system and tumor suppressors interplay along the axis mediating different regulatory patterns to maintain cell proliferation and possibly cell death.

9.3 - Conclusion Chapter 7 highlighted the importance of Rad51, an important player in the HR pathway towards maintaining systemic homeostasis. Down regulation of Rad51 initiated regional differences. In this chapter I sought to discover factors that could be mediating these regional differences with Rad51. Previous studies have implicated p53 and Rb as crucial cell cycle regulators and important for decisions post DNA damage. Therefore I down regulated Rad51 together with Rb and/or p53 to understand their regulation. My findings implicate that both p53 and Rb could be interplaying with Rad51 during maintenance of in vivo systemic homeostasis. Further my studies provide Rb as a key regulator of cell proliferation together with Rad51. The cell proliferation detected in the anterior region in the Rad51(RNAi) is

156 Systemic Signals completely lost in the Rad51+Rb(RNAi), implying the need for Rb to maintain cell proliferation in the anterior region of these animals. p53 seems to be mostly involved with maintaining cell death in the posterior region of the Rad51(RNAi) animal. As a future direction, understanding the relevance of these two molecules towards senescence in the anterior and posterior regions might be vital.

Rad51(RNAi) Anterior Cells P53 Cell cycle arrest Cellular senescence Rb

Posterior Cells P53 Cell cycle arrest ?? Cell Death

Figure 9.7 - Working model Rad51 is important for the progression of cell cycle. Even in the absence of DNA damage, Rad51 is required to maintain systemic homeostasis. In the absence of Rad51, p53 and Rb tumor suppressors maintain certain local and systemic signals that promote differential cell proliferation or cell death along the anterior posterior axis of the planaria. Whether Rb and p53 functions together or independent of each other in the anterior division needs further clarification.

157

Chapter 10

Ku70 and Ku80 heterodimer may play a role in mediating DNA repair in the planaria.

10.1 – Introduction

10.1.1 - NHEJ pathway

The non-homologous end joining (NHEJ) pathway is characterized as the main DSB repair pathway in mammals. Compared to the error less homologous recombination pathway, NHEJ pathway is more error prone. While NHEJ might not be the most perfect solution in the presence of genomic stress, it however is capable of been activated at any point of the cell cycle to mediate repair by joining two broken strands. In cells and tissue that does not acquire high proliferative capacity such as hematopoietic stem cells, this method is highly suitable in context of energy conservation and finding a quick repair solution. However, the precise implications for multicellular eukaryotes to choose this pathway over the HR pathway are still not well understood.

One theory regarding the use of NHEJ pathway over the HR pathway in the mammalian system is based on the amount of repetitive DNA found [1]. Over 66% of the human genome is thought to contain repetitive sequences or repeat derived DNA [2]. Therefore, if the DNA breaks in a region where the DNA is repeated, the HR mediated DNA repair might not be necessary to maintain genomic integrity. HR process requires a lot of energy and since the broken DNA strand needs to find the homologous chromosome, the repair kinetics are very slow. For the maintenance of tissue in a large multicellular eukaryote, NHEJ might therefore be a quick, effective and less energy costing process to repair DNA. Further, tissue that maintain low number of proliferative cells prefer NHEJ as their repair mechanism since HR is activated only post S phase of the cell cycle and NHEJ can repair DNA during any time of the cell cycle.

Understanding the ratio of HR and NHEJ usage in a tissue or an organism might be a better approach to understand the function and importance of both these pathways. During embryonic development HR pathway is important during the initial rapid proliferative phase. NHEJ pathway plays a role and could mediate birth defects or late set embryonic lethality when components of this pathway are compromised during development [3]. This timeline more corresponds to less cellular division and more cellular differentiation. NHEJ pathway also is important to join the breaks that is created during V(D)J recombination that occurs during B and T cell maturation. Thus relative to the planarian system that does not contain immune cells requiring V(D)J recombination like mechanisms, mammalian systems will maintain a higher ratio of NHEJ mediated activity. However, in an organ that has more proliferative and regenerative capacity such as the

158 human liver, the usage of HR and NHEJ and their implications towards DNA repair and maintenance of homeostasis has not been characterized yet.

NHEJ pathway can be divided into two sub pathways: C-NHEJ (the classical or the canonical NHEJ pathway), A-NHEJ (the alternative NHEJ pathway) [4]. The ATM and MRN complex can activate the C-NHEJ and the A-NHEJ pathways [5]. The C-NHEJ pathway contains the Ku heterodimer, DNA-PK, Artemis, XRCC4, DNA ligase IV and XLF. Most of these components and the functions have been characterized in chapter 7. Ku70 and Ku80 heterodimer plays a crucial role during C-NHEJ pathway while these molecules are not required for the A-NHEJ pathway [5]. A-NHEJ pathway employs molecules such as MRE11, CtIP, and Parp1 which also plays crucial role during homologous recombination. Further, these two pathways differ in the required ssDNA resection sizes. C-NHEJ pathway requires only short ssDNA resection while A-NHEJ similar to HR requires a longer ssDNA resection to function. However, A-NHEJ could also occur in the absence of a homologous sequence and similar to C-NHEJ is error prone and can respond rapidly and repair the DNA quicker than the HR pathway.

10.1.2 - Ku70-80 structure

Ku70 a 70KDa protein and Ku80 a 86KDa protein heterodimerizes to form the Ku complex that binds to the DSBs at the start of the NHEJ pathway. This complex was first found by Mimori et al when studying the serum for autoantibodies in patients with connective tissue diseases [6]. X ray Crystallography has revealed the structure of the Ku70 and Ku80 heterodimer [7]. They both contain an alpha beta domain at the N terminal, a beta-barrel domain which is the Ku domain in the middle and a helical arm at the c terminus. Differentiating the two proteins, Ku70 contains a SAP domain which has been characterized as DNA-binding motifs [8, 9]. The C terminal region of Ku70 is crucial for the recruitment of DNA-PKCs [10].

The Ku proteins have been found in all forms eukaryotic life forms and thus it is structurally conserved. Homologs of Ku has also been discovered in prokaryotes, therefore the functions conveyed by this pathway is important for all forms of life [11] Ku binds to the broken DNA created by DSBs and protects the DNA ends from the nuclease activities imposed by MRE11 and CtIP [12, 13]and then later recruits DNA-PK [4]. DNA-PK, Artemis and several kinases are involved with processing the DNA ends at this stage. Later the ligases will play a crucial role to join the ends of the broken DNA. Thus the central function of Ku70 is to repair DSBs rapidly. Though error prone, this form of rapid DNA repair could be crucial for cell populations with less proliferative capacity. Further studies have shown that Ku70 retains chemo resistance and has anti apoptotic activity [11, 14-16].

159

Studies on Ku70 have implicated its vital function during V(D)J recombination and T and B cell maturation process. RAG1 and RAG2 (recombination activating gene proteins) cleaves DNA ends during V(D)J recombination and, Ku70-80 heterodimer together with DNA-PKCs and XRCC4 is involved with joining these ends [17]. Thus lack of Ku70 or Ku80 produces iummunodeficient mice [18-20]. Ku70 also has the capability to bind to telomeres and prevents telomere shortening [11]. Studies have also shown that Ku70 together with telomerase prevents homologous recombination activity at the telomeres sights [21]. This function might not always be positive towards the maintenance

Chapter 10. 1 - Genomic analysis of the Planarian Ku70 Homolog. Upon 6 frame translation using pfam, the identified Ku70 homolog is shown to contain Ku70 N terminal alpha.beta domain, a Ku70 beta barrel, a Ku70 C terminal arm and a Sap domain. The sequence contains 51% similarities to the human Ku70 protein.

160 and stabilization of telomeres since HR has shown to be important for telomere maintenance in humans [22].

10.2 Results

10.2.1 - Ku70 and Ku80 homologs in the Planaria

Chapter 10. 2 - Genomic analysis of the Planarian Ku80 Homolog.

Upon 6 frame translation using pfam, the identified Ku80 homolog is shown to contain Ku80 beta barrel domain which is specific to Ku proteins. This region has a 59% similarity to human Ku80 Ku domain.

Planarian Rad51, BRCA2 and RPA that plays major roles during homologous recombination pathway and this has been characterized in chapters 7 and 8. Further, chapter 6 focuses on a number of molecules involved with various DNA repair pathways including the non-homologous end joining pathway. Ku protein heterodimer is important for the initiation of the NHEJ pathway. Therefore, compromising Ku70 and/or Ku80 might compromise the C-NHEJ pathway in the planaria. Genomic analysis was performed using the Sanchez laboratory planarian genome database to identify Ku70 and Ku80 homologs. Pfam and BLAST analysis identified possible homologs for Ku70 and Ku80. Ku70 and Ku80 both contain a Ku domain that has significant homology to each other. Ku70 and Ku80 both contain an alpha beta domain at the N terminal, a beta-barrel domain which is the Ku domain in the middle and a helical arm at the c terminus. Further, Ku70 contains a SAP domain which has been characterized as a DNA-binding motif [8, 9]. Based on pfam domain predictions, the discovered Planarian Ku70 homolog (mk4.001927.02.01) contains 51% similarities and possesses a Ku N terminal domain, a Ku beta-barrel domain, a Ku C

161

terminal arm and a Sap domain. This configuration is found in Ku proteins in other species and therefore the identified sequence in the planaria contains structural conservation for Ku70 (Figure 10.1). The identified Ku80 sequence (mk4.022912.01.01) contains only a Ku domain which is typical for Ku proteins and has 59% similarities to the human Ku80 (Figure 10.2). These configurations could imply that these homologs are the planarian Ku70 and Ku80 proteins.

Since the C-NHEJ pathway can repair DNA at any stage of the cell cycle, the expression of Ku is expected to be present in all forms of cells. Preliminary analysis on FACS sorted X1 and X2 progeny indicated an up regulation in Ku70 expression in the X2

Chapter 10. 3 - Ku70 is expressed in anterior and posterior regions of the planaria. (A) Compared to the proliferative neoblasts, the early division progeny maintains elevated levels of Ku70. (B) Ku70 is expressed equally in the anterior posterior fragments of the planaria. Rad51 down regulation does not impact Ku70 expression.

162 progeny relative to the neoblasts (X1) (Figure 10.3 A) (one individual experiment). To understand whether the C-NHEJ pathway could have a relationship with the HR pathway in the planaria, Ku70 expression was quantified in the control and Rad51(RNAi) anterior posterior fragments. Based on the preliminary analysis, the control and the Rad51(RNAi) maintained similar levels of Ku70 expression across the anterior posterior axis. This implies that Ku70 expression is not impacted upon Rad51 down regulation. And further Ku70 seems to be expressed equally across the anterior posterior axis, but more in the post mitotic progeny than in the proliferative neoblasts (Figure 10.3 A-B). Since C-NHEJ mediated DNA repair could be activated in any cell regardless of the proliferative status, we can expect Ku70 to be expressed in various cell populations. However, the down regulation in Ku70 in the neoblasts indicate that the proliferative cells might be utilizing the error less HR pathway than NHEJ pathway. Whether NHEJ is utilized by the neoblasts post induced IR damage requires further attention.

Cloning a ~550bp Ku70 sequence fragment into pBluescript plasmid and subsequent synthesis dsRNA for RNAi mediated gene down regulation helped to understand the function of this protein. Upon Ku70 down regulation by dsRNA, quantitative pcr was performed to measure the level of Ku70 gene expression. With the dsRNA injection schedule used, I was able to down regulate Ku70 expression by 3.5 fold compared to controls (Figure 10.4). Whether this level of down regulation could impose a partial phenotype, or whether it is enough to impose the full Ku70(RNAi) phenotype remains to be evaluated.

Utilizing the Ku70(RNAi) animals I next investigated the importance of Ku70 in the maintenance of homeostasis, DNA damage repair, tissue repair and regeneration.

Chapter 10. 4 - Ku70 is down regulated upon RNAi. The ku70 gene expression was down regulated using similar injection regime used for Rad51 down regulation. Post 30 days of injection, compared to controls, Ku70(RNAi) gene expression was down regulated by ~3.5 fold.

163

10.2.2 Schmidtea mediterranea Ku70 down regulation does not impact DNA repair or cellular proliferation

Ku70 has been implicated as a factor that increases chemo resistance [16]. Thus Ku70 could have important implication towards cell death and proliferation. Chapter 7 describes the importance of HR and Rad51 towards maintaining proliferative cells and homeostasis in the planaria. To investigate whether Ku70 down regulation plays a role

Chapter 10. 5 – Ku70(RNAi) is not responsible for mitotic down regulation. (A) The Ku70(RNAi) did not contain significant differences in cell proliferation compared to the control. Rad51(RNAi) down regulated mitotic cell population, while Ku70+Rad51(RNAi) portrayed the Rad51(RNAi phenotype. (B) Ku70(RNAi) alone did not show regional differences, while Rad51(RNAi) and Rad51+Ku70(RNAi) simultaneous down regulation showed significant regional differences. (Two independent experiments, n>12 each).

164 during maintenance of normal homeostasis animals were fixed 30 days post first injection with Ku70 dsRNA and stained for mitotic cell marker H3p. Ku70(RNAi) down regulation in normal condition did not impact cell proliferation: Control 107 ± 21.2, Ku70(RNAi) 113.86 ± 18 (Three separate experiments, n=11) (Fig 10.5 A-B). Opposed to this result animals that lack Rad51 and Ku70 imposed similar phenotype to Rad51(RNAi) animals where they showed a down regulation of the proliferative cells: Rad51(RNAi) 34.27 ± 13.4, Rad51+Ku70(RNAi) 36.58 ± 10. Further, characterizing regional differences portrayed by Rad51(RNAi) and Rad51+Ku70(RNAi), showing similar regional differences with cells primarily dividing in the anterior region compared to the posterior region: Ku70+Rad51(RNAi) anterior 55.7 ± 10 and Ku70+Rad51(RNAi) posterior 4.9 ± 5.1. Thus

Chapter 10. 6 - Ku70 down regulation does not impact proliferation post induced DNA damage. (A) The Ku70(RNAi) did not contain s44ignificant differences in cell proliferation post sub lethal IR (1000 rads). Rad51(RNAi) alone and Rad51+Ku70(RNAi) proliferation was abolished post sub lethal IR. (B) Post induced DNA damage by 1000 rads (sub lethal) Ku70 is expressed immediately within 24 hours. The expression is maintained at day 5. Animals with lethal IR (6000 rads) do not express Ku70.

165 the regional differences imposed is due to the Rad51 mediated homologous recombination pathway and possibly not the C-NHEJ pathway.

Ku70 is an important counterpart in the NHEJ pathway that repairs DSBs in eukaryotes. This mode of DNA repair can be employed at all phases of the cell cycle. Upon sub-lethal dosage of irradiation planarian proliferative stem cell population arrest progression of cell cycle, possibly to mediate DNA repair. To understand whether Ku70 is important for cell cycle progression post DNA damage, we irradiated control and Ku70(RNAi) animals post 30 days first injection with 1000rads. Staining with mitotic marker H3p provided a slight down regulation in mitotic cells in the Ku70(RNAi) however this was not significant: Control 113.4 ± 45, Ku70(RNAi) 99.86 ± 28 (N=3, n=11) (Figure 10.6A). Based on qpcr analysis, Ku70 mRNA expression gets up regulated 1 day post induced DNA damage, and the levels are maintained through until 7 days post irradiation.

Chapter 10. 7 – Flow cytometry analysis of the X1, X2, Xins populations in the planaria. Ku70(RNAi) unlike Rad51(RNAi) alone does not down regulate X1 populations. Ku70+Rad51(RNAi) also does not down regulate X1 frequency, which implies that simultaneous down regulation of Rad51 and Ku70 might impose cell cycle arrest and thereby down regulate the mitotic cell progeny.

166

This implies that Ku70 might be playing an important role towards DNA repair, but possibly not the proliferative cells.

To assess whether Rad51 is the soul mediator of DNA damage repair in the planarian proliferative cell population, we irradiated Ku70(RNAi), Rad51(RNAi) or Ku70+Rad51(RNAi) animals. Rad51(RNAi) and Ku70+Rad51(RNAi) animals post sub lethal irradiation could not recover any proliferative cells. Planarians possess high levels of cellular turnover and maintenance of a pool of proliferative cells is essential for maintenance of homeostasis. With this data it is imperative that Rad51 is essential for DNA repair of the proliferative cell population and to maintain homeostasis and Ku70 mediated NHEJ might not be essential for this cell population. However, whether Ku70 is essential to repair the DNA of the post mitotic cell population remains to be characterized.

Proliferative neoblasts could be utilizing Ku70 for DNA repair to some extent when Rad51 is deficient. However I have shown that Ku70 mediated pathway alone is not enough to sustain the system (Chapter 7 and 8). If the post mitotic cells requires Ku70 and the NHEJ pathway to maintain cellular integrity, the cells that have been damaged and ost with the absence of Ku70 could get repopulated instantly by the highly proliferative neoblast population. This could pose a problem when dissecting the NHEJ pathway. The Rad51+Ku70(RNAi) phenotype shows the same phenotype as the Rad51(RNAi) alone. This further validates the importance of Rad51 for the proliferative neoblasts and the maintenance of homeostasis with and without induced damage in the planaria. However, as a future direction, understanding the level of DNA damage induced by the lack of NHEJ pathway compared to lack of HR and or lack of NHEJ and HR both will provide the interplay between these pathways and how important they are to maintain homeostasis. For this purpose I propose observing the down regulation of several members of each pathway.

Planarian X1, X2, Xins populations can be stained using DNA content marker Draq5 and the live cell marker Calcien. Staining dissociated control and Ku70(RNAi) animals for flow cytometry and analyzing the populations using LSRII provided a gateway to understand the frequency of these population upon compromisation of Ku70. Figure 10.7 depicts that the X1, X2, Xins populations were not impacted upon down regulation of Ku70 alone. This further validates that H3p/mitotic data with and without induced DNA damage. However, the Rad51+Ku70(RNAi) did not down regulate the X1 frequency, which could imply that the simultaneous down regulation of these two molecules might initiate cell cycle arrest more than Rad51(RNAi) alone. This could be due to (1) down regulation of cell death (2) Cell cycle arrest (3) cellular senescence.

10.2.3 - Schmidtea mediterranea Ku70 down regulation does not impact Cell death

Ku70 acts as a deubiquitinase for the anti-apoptotic factor Mcl-1 [15]. Further, Ku70 inhibits Bax, an important protein mediating apoptosis [14]. To investigate this anti apoptotic behavior of Ku70, TUNEL assay was performed on Ku70(RNAi) animals 30

167 days post first injection. However, the TUNEL positive cells did not change between the control and the Ku70(RNAi) in the planaria: Control 147.6 ± 59.5, Ku70(RNAi) 142.48 ± 48.5 (Figure 10.8 A). However, simultaneous down regulation of Ku70 and Rad51 imposed a phenotype similar to the observed Rad51(RNAi). The Rad51+Ku70(RNAi) had increased cell death and the highest range of cell death was concentrated in the posterior region of the animal (Fig 10.8 B). Further, simultaneous Rad51+Ku70 down regulation when compared to Rad51(RNAi) alone showed a slight reduction in cell death. Flow cytometry analysis indicated an increase in the X1 population in the Rad51+Ku70(RNAi)

Chapter 10. 8 – Ku70 down regulation does not impact cell death in planaria. (A) Controls and Ku70(RNAi) do not have any changes in the rate of cell death. (B) Ku70(RNAi) animals similar to controls do not impose regional differences in ell death. Ku70+Rad51(RNAi) however imposes regional differences in cell death with an increase in the posterior region. However the cell death rate is lower than the Rad51(RNAi) alone. (One independent experiment, n=5)

168 and a down regulation in mitosis (Figure 10.7 and 10.5). Thus the down regulation in cell death could imply increase in cell cycle arrest or cellular senescence with the impairment in both the NHEJ and HR pathway. Whether the simultaneous down regulation of Ku70 and Rad51 does indeed impose differential levels of cell death and regional differences requires further attention.

Chapter 10. 9 – MRE11 down regulation does not impact cell proliferation. (A) MRE11(RNAi) alone did not show regional differences, while Rad51(RNAi) and Rad51+MRE11(RNAi) simultaneous down regulation showed significant regional differences. (Two independent experiments, n>12 each). (B) The Ku70(RNAi) did not contain significant differences in cell proliferation post sub lethal IR (1000 rads). Rad51(RNAi) alone and Rad51+Ku70(RNAi) proliferation was abolished post sub lethal IR. (one independent experiment, n>5)

169

This data further implicates Rad51(RNAi) and the homologous recombination pathway as the mediators for the observed regional differences. Thus the absence of Ku70 does not impose a crucial change in homeostasis. Ku70 down regulation with Rad51 imposes similar phenotype observed in chapter 7. This could imply that to maintain homeostasis, the planaria needs to maintain its proliferative stem cell populations intact and error free. Thus evolutionarily choice is to initiate the HR pathway to repair and replace error driven stem cells that maintain tissue integrity and homeostasis.

10.2.5 - Schmidtea mediterranea Ku70 down regulation does not impact regeneration

Planaria possess a remarkable capability to repair and regenerate missing tissue upon amputation. Thus we amputated Ku70(RNAi) and these animals were able to form a blastema and repair and regenerate the missing tissue effectively. Staining with VC-1 showed that similar to the control animals, the animals contained photoreceptors 7 days post amputation (data not shown). However, the Ku70+Rad51(RNAi) animals similar to Rad51(RNAi) were not able to regenerate (data not shown). Regeneration in the planaria requires rapid proliferation with two peaks of proliferation occurring 6 and 48 hours post amputation. Whether Ku70(RNAi) down regulation impacts these proliferative responses remains to be investigated. We can however hypothesize that the Ku70(RNAi) animals probably mount the proper proliferative and patterning responses to form blastema and regeneration and repair the missing tissue.

10.2.6 - Schmidtea mediterranea MRE11 down regulation does not impact cell proliferation.

MRE11 is an important counterpart in the A-NHEJ (alternative NHEJ) pathway that repairs DSBs in eukaryotes. This mode of DNA repair can be employed at all phases of the cell cycle. A MRE11 homolog was discovered in the planaria and is described in Chapter 6. This was cloned and dsRNA was synthesized to down regulate MRE11. Thus MRE11, Rad51 and Rad51+MRE11 were down regulated in the planaria and mitosis was evaluated. Compared to controls (anterior 109.22 ± 22, posterior 101.15 ± 18.22) the MRE11(RNAi) (anterior 111.04 ± 27.1 , posterior 92.37 ± 34.8) animals did not change the levels of mitosis. Thus MRE11 down regulation does not impact normal homeostasis or the neoblasts. However, down regulation of MRE11 with Rad51 (anterior 27.6 ± 7.48 , posterior 10.74 ± 10.71) initiated down regulation of mitosis and initiated regional differences similar to Rad51(RNAi) (anterior 33.92 ± 17.1 , posterior 6.99 ± 5.91). Thus not MRE11, but Rad51, important for the HR pathway, initiates the neoblast proliferation impairment and regional differences.

Upon sub lethal irradiation planarian proliferative stem cell population arrest progression of cell cycle, possibly to mediate DNA repair. To understand whether MRE11

170 is important for cell cycle progression post DNA damage, control and MRE11(RNAi) animals post 30 days first injection and 1000 rad sub lethal irradiation were stained with the mitotic marker H3p. Controls (28.18 ± 7.68) and MRE11(RNAi) (19.08 ± 7.25) still maintained proliferation 7 days post irradiation. However, Rad51(RNAi) and MRE11+Rad51(RNAi) animals were incapable of mounting any proliferative cells. This further validates that the HR pathway and not the NHEJ pathways (C-NHEJ and A-NHEJ) is important for planaria to repair the damaged DNA.

10.3 Conclusions

Ku70 and Ku80 are important components of the C-NHEJ pathway and down regulation of these molecules impacts the function of the NHEJ pathway. I employed a method to down regulate Ku70 using dsRNA synthesized against a cloned planarian Ku70 sequence. The dsRNA injection regime successfully down regulated the Ku70 expression. However, Ku70(RNAi) animals were capable of maintaining normal proliferative levels and did not induce cell death. The animals were also capable of recovering post sub lethal irradiation dosages, implying this mode of DNA repair might not be primary mode of DNA repair in the planarian model organism. However, the Ku70 gene expression level was increased in control animals post IR up to 7 days, implying Ku70 could still be playing a role towards maintenance of the post mitotic progeny that does not divide.

Further, the characterization of a C-NHEJ and A-NHEJ pathway has promoted two types of error prone rapid DNA repair mechanisms, one dependent and the other independent of the Ku70-80 heterodimer. This implies that there are other important pathways that could be employed by different populations in the absence of Ku70. Whether Ku70 and MRE11 simultaneous down regulation would impact both C-NHEJ and A-NHEJ pathway and how this would impact DNA repair in the planaria needs further investigation.

Ku70 simultaneous down regulation with the HR pathway mediator Rad51 produced phenotype similar to animals that lack only Rad51. The cell proliferation was down regulated and was expressed only in the anterior region of the animal. Similarly cell death in the Ku70+Rad51(RNAi) animals showed regional differences with up regulation in cell proliferation in the posterior region and a slight down regulation in the anterior region compared to the controls. The Ku70+Rad51(RNAi) animals were further incapable of forming a blastema and regenerating missing tissue post amputation. Thus planarian system requires the homologous recombination pathway to maintain its rapid proliferative populations during tissue repair and regeneration. Further, during normal homeostasis the cellular turnover rate is remarkably high in the planaria. Therefore, these data suggest that the large number of proliferative cells spread throughout the animal might be utilizing the homologous recombination pathway opposed to the NHEJ pathway in the planarian model organism. It is hard to quantify the importance of the NHEJ pathway towards maintenance of the post mitotic progeny of the planaria, due to the rapid cellular turnover and stem cell replenishment. However, with the conservation of the NHEJ pathway in the planaria we

171 could surmise that NHEJ pathway maybe playing a role to repair the post mitotic progeny. Moreover, the major pathway employed by the neoblasts is the HR pathway.

172

Chapter 11

DNA damage sensors are important for proper DSB repair in Schmidtea mediterranea

11.1 - Introduction

11.1.1 ATM is an important DNA damage sensor

ATM (Ataxia- telangiectasia mutated) belongs to the PIKK family of protein kinases. In humans, absence of ATM has been implicated with ataxia telangiectasia a neurodegenerative disorder and cancer in humans [1, 2]. ATM is an important DNA damage sensor and initiates downstream elements for proper DSB repair. ATM contains all the landmark domains belonging to the PIKK family of proteins such as mTOR, ATR, SMG1 and DNA-PKc. For example, the N terminal region of ATM contains a region where several heat repeats and a nuclear localization signals. This region is followed by the FAT domain, the kinase domain and the FATC domain [1].

DNA damage response requires DNA damage sensors which recruits the transducers and thus signals the effectors to produce desired cellular responses, cell cycle arrest and control, DNA repair, senescence and, apoptosis. Different studies characterize ATM and ATR as DNA damage sensors or transducers [3-5]. In response to DNA damage ATM responds to DSB sites prior to ATR. However, while ATM can be recruited at any point of the cell cycle when damage occurs, ATR focuses more on cells that are progressing through cell cycle [6]. Therefore, ATM most likely could be involved with HR and NHEJ mediated DNA repair, while ATR is mostly involved with HR mediated DNA repair. In this section we will focus on ATM dependent DNA damage responses.

ATM is a master regulator during DNA repair that requires the activation of NHEJ or HR pathways. Undamaged cells contains homodimerized ATM, which is the inactive form [7]. In response to double stranded breaks, ATM gets activated, becomes monomerized and recruited to the nucleus. The process of ATM activation is an area currently under investigation and is greatly debated [7-10]. However, in vivo and in vitro studies have shown that the MRN complex is crucial for ATM activation and ATM binding to the MRN complex counterpart, NSB1, helps to retain ATM at the DSB sites [11, 12]. After recruitment, ATM gets auto-phosphorylated, occupies DSB sites and initiates DNA repair responses [13-15]. ATM is also involved with phosphorylating histone H2A.X at the DSB sites [16]. Histone H2A.X thus becomes γH2A.X and binds MDC1. MDC1 further activates ATM and binds to it and helps to maintain genomic stability [17, 18]. AVEN, FOXO3A, RNF8, KAT8 and, HMGN1 have also been implicated with ATM activation and dependency [19-22]. How all these factors group together to mediate DNA repair and other effector functions still remains elusive. Since ATM is a kinase, its phosphorylation activities probably is crucial for the activation and mediation of effector pathways.

173

Catalytically inactive kinase dead ATM causes embryonic lethality and conditional knockdown of ATM in the immune system has shown to increase DNA damage in the immune cells [23, 24]. ATM embryonic lethality was observed as early as E9.5 and was detected only in ATMKD/KD (KD = kinase dead). Surprisingly ATM-/- mice did not show any embryonic lethality. While the kinase activity of ATM was required to maintain viability, heterozygous ATM+/KD mice were able to function normal as the WT mice [23]. These catalytically inactive ATM can still be recruited to the DNA damaged sites, however DNA repair response is severely down regulated [23, 24]. Whether the impairment in DNA repair is due to inactive ATM or because ATM occupation at the DNA sites blocks further repair and signaling activity requires further investigation.

Figure 11.1 - Genomic analysis of the Planarian ATM Homolog. Upon 6 frame translation using pfam, the identified ATM homolog contained heat repeats, a FAT domain, a PI3K domain and a FATC domain. The sequence contains 68% similarities to the human ATM protein.

174

Early embryonic developmental stages have shown to prefer HR than NHEJ pathway [25, 26]. This is vital since developmental stages primarily requires constant cell proliferation and differentiation while maintaining errorless DNA repair. Human embryonic stem cells (hESCs) have shown to be capable of activating HR and NHEJ independent from ATM [27]. Therefore, we could assume that developmental stages might not necessarily require ATM for genomic stability, proper development and differentiation. However, ATM function and requirement in vivo in the complexity of the whole organism still remains to be found.

Figure 11. 2 - Genomic analysis of the Planarian ATR Homolog.

Upon 6 frame translation using pfam, the identified ATM homolog contained heat repeats, a FAT domain, a PI3K domain and a FATC domain. The sequence contains 62% similarities to the human ATR protein.

175

11.1.2 - ATR is important for HR mediated DNA damage repair

ATR (Ataxia- telangiectasia and Rad3 related protein) belongs to the PIKK family of proteins kinases and is closely related to ATM in structure and function. ATR similar to ATM contains an N terminal region with several heat repeats, an FAT domain, a kinase domain and a C terminal FATC domain [28]. Thus ATM and ATR biochemical activities remain closely related [6]. ATR is activated during genomic stress and helps to repair the damaged region by activating appropriate downstream pathways. ATR is mostly activated in response to stress created at the replication forks, and therefore is guided by cell cycle machinery [29]. ATR unlike ATM is essential for cell cycle progression and viability in mammalian cells [30-32]. This implies its relevance towards HR more than NHEJ. In contrast, ATM can be activated during any point and therefore has been implicated as a sensor for NHEJ and HR. Thus these two molecules might have different functions during DNA damage response, maintenance of normal homeostasis, tissue repair and regeneration. ATR down regulation creates a specific diseases called the seckel syndrome which induces dwarfism like symptoms. Thus ATR plays an important role in DNA damage responses, development and maintenance of homeostasis.

ATR is known to be up regulated during every phase of the cell cycle, especially during the S phase and the absence of ATR renders embryonic lethality. Studies performed in C. elegans have shown that ATR presence is crucial for cell cycle progression [33]. Conferring this, Mei41 an ATR homolog in Drosophila has been shown to be important for cell cycle progression during embryonic development [34].Thus ATR presence is not only essential for development, it also aids maintenance of systemic homeostasis. Kinase dead ATR overexpression however decreases G2/M arrest post DNA damage [35]. The same study also showed that ATR has the capability to compensate ATM-/- condition. While ATM response is primarily towards DSBs caused by IR and intrinsic occurrences such as VDJ recombination, ATR response can be more varying. ATR has the capability to respond to radiation, various chemicals and agents that can damage DNA and to factors that induce intrinsic replication errors. Interestingly ATR is required for Rad51 foci formation and accumulation connecting Rad51 function with ATR [29, 36].

11.2 - Results

11.2.1 - Identification of smed-ATM and ATR

Investigation into the S. mediterranea genome discovered a PI3K catalytic domain and an FATC domain that has 68% similarities to the human ATM. The discovered planarian domains were more homologous to the ATM counterparts rather than the planarian and human TOR and ATR counterparts. Therefore, we could assume that the region we discovered is the planarian ATM, PI3K and FATC domains. The homology of the discovered PI3K and FATC domains to the human sequence has been depicted in Figure 11.1.

176

ATR also belongs to the same PIKK family of proteins similar to ATM and TOR. As depicted in Figure 11.2, ATR contains similar domains to ATM. Genomic analysis using the planarian genome database discovered a sequence with an FAT and PI3K domain was discovered. This sequence (mk4.015073.00.01) had 62% homology to the human ATR and no significant similarities were observed with alignments to human TOR and ATM. This gene has since been cloned into pBluescript plasmid at the Oviedo lab at UC Merced.

11.2.2 - ATM is expressed primarily in the neoblasts

Quantitative pcr analysis for ATM mRNA expression in the planaria anterior and posterior regions indicated an up regulation in the posterior region rather than the anterior region (Fig 11.3B, One experiment). To investigate ATM expression in individual cells populations, FACS sorted X1 (neoblast), X2 (early division progeny) and Xins (late division progeny) cells was used to perform Qpcr. Relative to the internal control UDP glucose, ATM was mostly expressed in X1 population (Fig 11.3 A, One experiment). This was surprising since ATM is known to function during NHEJ and HR mediated DSB repair. During maintenance of normal homeostasis, planarians have high cellular turnover and thus might focus stabilizing their large pool of

stem cells against genomic Figure 11.3 – ATM expression in planaria. (A) In normal animals, ATM is primarily expressed in neoblasts stress. Therefore, molecules (X1) and not the post mitotic progeny (B) The posterior region of involved with DNA repair the planaria express ATM more than the anterior (One experiment might be primarily expressed each). in this population to be ready for genomic stress at any time.

177

Further, the post mitotic progeny might prioritize cellular activities such as energy conservation, metabolic functions rather than DNA damage repair. While the neoblast population could mainly focus on DNA damage repair in case genomic stress is initiated. It is important to keep genomic integrity in the proliferative population that replaces damaged tissue. This might explain why the X2 and Xins populations contains less ATM expression. Further, the inactive ATM protein homodimerizes and stays inactive, and only recruits to the nucleus upon DNA DSB damage [7]. Thus to understand the level of ATM expression, understanding the active and inactive ATM protein level in vivo is essential.

11.2.3 - Planarian ATM down regulation does not impact cell proliferation

Several modifications from previously described cloning procedure was made and a 550bp Smed-ATM fragment was cloned into pBluescript plasmid containing a T3 and T7 promoter. This was confirmed by sequencing and pcr amplification using T3 and T7 primers. This clone was used to synthesize ATM dsRNA and down regulate ATM expression. Synthesized dsRNA was then injected into planaria following the injection plan described in Fig 9.3A. ATM down regulation did not necessarily create a phenotype that showed any defects or lethality. The live control and ATM(RNAi) did not observe any changes in phenotype or size reduction. Injecting animals up to 50 days post first injection still did not induce any phenotypic changes (data not shown). Thus in the absence of any genotoxic stress, ATM down regulation does not affect the planarian lifespan.

Absence of ATM activity has been implicated with initiation of tumors that could possibly lead towards invasive cancer. ATM is a transducer that can mediate the effector functions such as cell cycle control, cell cycle arrest, DNA repair or apoptosis. ATM down regulation and catalytically inactivation of ATM function can lead to abnormal cell proliferation and cancer in human. How ATM down regulation affects cell proliferation in vivo in mammals is still under investigation.

To investigate ATM function, control and ATM(RNAi) animals were fixed using carnoy fixation method and whole mount immunostaining using H3p antibody was performed. As observed mitotic cells were expressed throughout the animal comparable to the control (Figure 11.4 A). Quantification of the H3p positive cells indicated 215.7 ± 90 mm2 in the controls (N=2, n=17) compared to 255 ± 70 mm2 in the ATM(RNAi) (two separate experiments, n=10) 30 days post first injection (Figure 11.4 A). The ATM(RNAi) contains a slight up regulation of mitotic cells compared to the controls, however this up regulation is not significant. Performing the same experiment 60 days post first injection contained 119.9 ± 21 mm2 in the controls and 71.2 ± 16 mm2 in the ATM(RNAi) indicating a significant reduction in cell proliferation in the ATM(RNAi) over time (one independent experiment, n=5) (data not shown). Quantification of mitotic cells in the anterior and posterior regions of the control and ATM (RNAi) indicated no difference along the anterior-posterior axis (Figure 11.4 A). Thus ATM(RNAi) does not modulate regional differences in cell proliferation.

178

Figure 11.4 – ATM(RNAi) does not impact cell proliferation in planaria. (A) ATM(RNAi) does not change cell proliferation compared to controls (B) ATM down regulation with Rad51 impacts cell proliferation similar to Rad51(RNAi) alone. Further these two conditions portray regional differences in cell proliferation and not ATM(RNAI) alone. (C) ATM simultaneous down regulation with Ku70 did not impact cell proliferation and did not mediate regional differences. (Rad51 and Ku70 data has been discussed extensively in Chapters 6 and 10).

179

11.2.4 - ATM vs NHEJ and HR

I next observed whether ATM is important for NHEJ or HR pathways. Therefore, I down regulated ATM with Ku70 a major player in the NHEJ pathway and Rad51 a major player in the HR pathway. It was seen that a down regulation of Ku70 causes a slight reduction in mitosis (control 215 ± 90 mm2, ATM(RNAi) 255 ± 70 mm2, Ku70(RNAi) 178 ± 57 mm2) compared to ATM and Ku70 alone (Fig 11.4 A). However, this down regulation compared to controls was not significant. The most dramatic response was observed with Rad51 down regulation (34.3 ± 13.4 mm2 , P = 0.0003). ATM+Ku70 down regulation however increased cell proliferation slightly (231 ± 30 mm2) compared to Ku70 alone (Fig 11.4 A). ATM may play a crucial role in mediating cell cycle control or apoptosis and hence down regulation of ATM might be involved with one of these options. Therefore, when Ku70 is down regulated together with ATM, ATM might be playing a crucial role in cell cycle control or apoptosis. Analysis into cell proliferation along the anterior posterior axis based on ATM(RNAi) alone, Ku70(RNAi) alone and ATM+Ku70(RNAi) did not show significant changes with one performed experiment (N>6 animals) (Fig 11.4 C).Thus with this preliminary finding, I assume that, ATM and NHEJ pathway might not be involved with cell proliferation or maintain regional differences. Further these molecules might not be involved with systemic homeostasis in the planaria.

Rad51 together with ATM renders a significant down regulation in cell proliferation which is comparable to the Rad51 alone down regulation (Rad51 alone 34.3 ± 13.4 mm2, Rad51+ATM 32 ± 18 mm2) (Fig 11.4 B). This could mean that Rad51 mediated mitotic down regulation might not be controlled by ATM. While ATM(RNAi) alone did not cause any regional differences ATM+Rad51(RNAi) mediated a phenotype similar to that of Rad51(RNAi). The anterior region of Rad51(RNAi) animals contains 59 ± 17.8 mm2 while Rad51+ATM(RNAi) contains 44.2 ± 25 mm2 mitotic cells. Thus the anterior region contains comparable levels of cell proliferation. The posterior region of these two RNAi shows some differences with Rad51(RNAi) containing 9.6 ± 14 mm2 mitotic cells and Rad51+ATM 18.4 ± 25 mm2 mitotic cells. Therefore, this data shows a twofold up regulation in cell proliferation when Rad51 and ATM are down regulated together in the posterior region. This experiment has been performed once and the data between the Rad51(RNAi) and Rad51+ATM(RNAi) is not significant. However, both sets compared to control are significant with P=0.004 and 0.005 (student T test) respectively.

12.2.5 - ATM and cell death

ATM acts upstream of p53 and is involved with maintaining cellular integrity. Thus we questioned whether ATM might play a role to regulate p53 control and thereby compromise cell viability. Lig4 is an important NHEJ pathway ligator and is required for proper NHEJ mediated repair. Thus Lig4-/- results in very late embryonic lethality which is the timeline suggested for NHEJ activity (NHEJ primarily is needed during late embryonic development during the differentiation stages rather than proliferation). Lig4-/-

180 embryonic lethality is rescued by p53 deficiency, thus this might indicate Lig4 mediated function is dependent on p53 [37, 38]. Another study showed that Lig4-/- embryonic lethality was rescued by ATM deficiency. TUNEL staining performed on Lig-/-ATM+/+ animals showed increased cell death and these animals died at late embryonic stages. The increased cell death could be the due to ATM mediated cell death and the lack of ATM might decrease cell death, therefore understanding cell death in respect to ATM is crucial.

Animals injected with ATM(RNAi) and control cohorts were fixed for TUNEL staining 30 days post first injection. TUNEL positive cells were counted and revealed a slight down regulation, though this was not statistically significant: Control 147.66 ± 59.516 mm2, ATM(RNAi) 64.76 ± 15.3 mm2 (N=1, n=4) (Fig 11.5). However, the slight up regulation in cell proliferation in ATM(RNAi) might be due to the decline in cell death. This could be relevant based on studies performed on decrease in cell death with ATM down regulation. Since this experiment has been only performed once, repeat experiments might find more significant data towards this hypothesis. Unlike Rad51(RNAi) and

Figure 11. 5 – ATM(RNAi) does not impact cell death 30 days post first injection ATM(RNAi) alone did not increase or decrease TUNEL positive cells significantly compared to controls. ATM(RNAi) alone also did not contain regional differences. Regional differences in cell death was observed with Rad51+ATM simultaneous down regulation similar to Rad51(RNAi alone. (one experiment, n=5)

181

BRCA2(RNAi), ATM(RNAi) did not show any regional differences in cell death. To understand whether there is an effect in ATM and Rad51 simultaneously down regulated animals, dual RNAi animals down regulated for ATM and Rad51 was fixed and stained for TUNEL positive cells. TUNEL counting revealed that similar to Rad51(RNAi), ATM+Rad51(RNAi) revealed regional differences (Figure 11.6). The anterior ATM(RNAi) (61.02 ± 15.6 mm2 ), Rad51(RNAi) (77.02 ± 24.7 mm2), ATM+Rad51(RNAi) (70.33 ± 17.5 mm2) did not show any significant changes. However, preliminary studies show that the posterior region of the ATM(RNAi) alone (68.03 ± 15.24 mm2) and ATM+Rad51(RNAi) (172.54 ± 63 mm2) animals maintained a decrease compared to Rad51(RNAi) (286.72 ± 90.76 mm2). This experiment needs to be repeated to improve significance.

12.2.6 - ATM does not impact wound repair and Regeneration

Planaria are master regenerators capable of regenerating all missing tissue within 7 days post amputation or injury. Studies performed have shown that disruption of cell cycle control mechanisms, cell death mediated pathways, DNA repair pathways could disrupt regeneration capabilities (Chapters 4, 5, 7 and 9). ATM knockdown in mice did not render embryonic lethality, however disruption of the catalytic activity of ATM resulted in early embryonic lethality. Since there are similarities between regeneration and development, we downregulated ATM and amputated the animals 30 days post first injection. 7 days post

Figure 11. 6 – ATM(RNAi) does not impact regeneration. 30 days PFI, ATM(RNAi) animals were amputated and fixed 7 days post amputation and mitotic cells counted. Control and ATM(RNAi) animals did not contain significant differences in cell proliferation post amputation (One experiment, n=8)

182 amputation, all ATM(RNAi) animals formed blastema and regenerated the missing tissue including photoreceptors stained by VC-1 (data not shown). Mitoses recovery post 7 days amputation in the ATM(RNAi) did not differ from the amputated controls: Control 456 ± 236 mm2 and ATM(RNAi) 416 ± 120 mm2, N=1 (Figure 11.7). This data agrees with the data provided by mice knockdown study where ATM-/- did not show any embryonic lethality. Thus in order to understand ATM function during normal homeostasis, kinase dead ATM function needs to be investigated.

Figure 11.7 – ATM(RNAi) does not impact neoblast recovery post irradiation. (A) 30 days post injection and 7 days post sub lethal irradiation (1000 rads), control and ATM(RNAi) animals recover cell proliferation. ATM(RNAi) contains a significant increase in cell proliferation compared to controls (p= 0.05). (B) ATM expression on sub-lethal and lethally irradiated animals over a time span of 7 days. ATM expression is increased around day 5.

183

11.2.7 - ATM and DNA Repair

Upon recognition of DNA damage, ATM as a transducer helps mediate specific effector functions. Therefore, in order to understand whether ATM is important for DNA repair in the planaria, ATM was down regulated in Schmidtea mediterranea and 25 days later was exposed to 1000 rad dosage of radiation. Within 24 hours after 1000 rad radiation (sub lethal), Schmidtea mediterranea neoblasts will stop proliferating. Once the radiation induced DNA damage repair responses has been initiated, the cells will start to proliferate in control animals. Similar to control animals, within 7 days post 1000 rad radiation, ATM animals were able to initiate proliferation: Control 31.5 ± 6 mm2 and ATM(RNAi) 44.3 ± 14 mm2, P = 0.05, (One experiment, Figure 11.8 A). A slight significant increase in proliferation was observed in the ATM(RNAi) by 7 days post radiation. Whether this increase is due to defects in cell cycle arrest or apoptosis remains to be investigated.

In order to understand ATM expression, we irradiated control Schmidtea mediterranea with 1000 rad dosage and fixed the animals days 1, 3, 5 and 7 days post radiation. Further we subjected some animals to 6000 rads which is a lethal dosage for these animals. The animals were used to extract RNA and quantitative pcr was performed to measure the ATM gene expression. One day post sub lethal radiation, ATM expression did not change. A cell could contain intrinsic ATM protein levels that could immediately be activated to repair DSBs, regardless of transcriptional activation. Further, ATM protein can also exist in an inactive dimerized form and monomerize upon DSB formation. Whether already existing ATM protein monomers play a crucial role towards DNA repair needs to be evaluated. Day 5 post radiation a major player in the homologous recombination pathway, Rad51 gets upregulated and very interestingly ATM gene expression also gets elevated during this time line. The relevance of this expression pattern needs further investigation.

11.3 – Conclusion

ATM is an important transducer and a DNA damage sensor. However in the planaria, ATM down regulation did not mediate significant changes in cell proliferation or cell death. Unlike Rad51(RNAi) it did not mediate any regional differences. Further ATM did not impact tissue regeneration and repair. However there was a slight upregulation in cell proliferation post IR induced DNA damage. Most of the data provided in this chapter contains one experiment with n>6 animals. The significance of the data and the increase in cell proliferation still remains to be clarified further.

ATR is a well characterized DNA damage responder and a transducer. Down regulation of Rad51 by RNAi abrogated ATR gene expression (data not shown). Further in developmental models, ATR down regulation mediates embryonic lethality. ATR down regulation also impairs cell proliferation in other model systems. Therefore the likely target

184 of the HR pathway might be ATR, and I would like to investigate ATR mediated homeostasis, DNA repair and tissue repair and regeneration in the future.

185

Chapter 12

An In vivo analysis of stem cell regulation

12.1 – Introduction

12.1- Planaria as a model organism

Stem cell research has garnered much attention scientifically and politically. At the frontline of scientific research, stem cell studies offer various novel therapies and approaches. Further, understanding stem cell regulation remains crucial to decipher disease progression, ex: cancer. However research in this area is limited due to various restrictions in the availability of model organisms and political influences. My goal was to understand how different molecules may interplay and regulate stem cell function in vivo, counteracting the above mentioned issues. Therefore, in this thesis, I studied planaria (flatworm) as model organisms to understand stem cell function and regulation in vivo. Planaria provides a powerful mechanism to understand adult stem cells and their function in vivo. Adult organisms uses local and systemic signals to maintain various functions including stem cell regulation, and our current understanding about these regulatory systems are limited (Figure 12.1). For example the hematopoietic stem cells that reside mainly in the bone marrow, require maturation signals and migrates distances in order to replace the missing tissue/cells. The signals that initiate the regulation of these

Figure 12. 1 - Stem cells utilize local and systemic signals. The microenvironment or the niche where the stem cells resides is essential for the regulation of the stem cell (as depicted). However systemic signals also could influence the function and regulation of this stem cell. For example, a hormone that is released into the blood stream could travel to different regions and impact stem cell regulation.

186 cells and how they respond in vivo still require extensive studies. The relative abundance of the neoblasts and the conservation of signaling pathways provide a platform to understand stem cell regulation in vivo in the complexity of the whole organism.

12.2 - Neoblasts are an abundant heterogeneous population

Planarian neoblasts, unlike most other adult stem cell populations in various species maintain relatively higher plasticity and can differentiate into different cell types that can form various tissues along the anterior posterior axis of the adult body. Further, these stem cells are a heterogeneous population. Recent publications have attempted to characterize the existence of different populations based on their proliferative potential, tissue repair and regeneration potential, response to metabolic cues and capability to recover post DNA damage (irradiation) [1]. Studies have shown that even at a single cell level, certain cells in the heterogeneous neoblast population can divide and differentiate into various tissues [2].

Figure 12.2– Neoblasts are a heterogeneous population Hypothesis: depending on the signal received, various stem cells in the population could respond differently. These signals could be mediated by specific genes and thus the down regulation of genes could impact specific cellular functions, and/or specific populations in the pool of heterogeneous neoblast population.

187

The hypothesis that different stem cells will respond differently remains an attractive model. In my thesis down regulation of DNA damage responders initiated regional differences in cell proliferation and cell death, while down regulation of master regulators TOR and AKT initiated changes in stem cell survivability and tissue repair and regeneration. Overall each study confirmed that the potential of stem cells in general was down regulated with the impairment of genes. This could be due to (1) Requirement of specific genes for the proliferation and maintenance of specific stem cell populations (Figure 12.2) (2) Specific genes are required for the regulation of specific cellular functions (Figure 12.3). The work in this thesis provides evidence for both these hypothesis.

12.3 - Genes are required to maintain specific stem cell populations and cellular functions

Down regulation of TOR impaired stem cell proliferation. Data here suggests that TOR might be required to maintain a particular type of stem cell population. The absence of these stem cells impacts regeneration and tissue maintenance. Thus amputated TOR(RNAi) animals resulted in no blastema formation and defects in regenerative potential. However, the stem cells that proliferate with the lack of TOR expression managed to rearrange the tissue for survivability. This data provides evidence for the maintenance of specific stem cell populations regulated by the TOR pathway. However the overall down regulation of this gene also impacted metabolism and growth of the animal, which could imply that TOR is important not just for the maintenance of specific stem cell populations, but cellular functions as well. Since TOR is involved with regulating machineries that govern transcription and translation, an exciting future direction could be the performance of RNA Seq analysis to discover potential downstream targets that could be involved with the phenotypes observed. These studies could answer: What is the driving force behind this type of regulation? What are the molecular mechanisms that drive this paradigm?

Evaluation of the DNA damage response pathways revealed further evidence to the maintenance of specific stem cell populations and cellular functions. This section of the thesis mainly focuses on the relevance of stem cells to maintain homeostasis along the anterior posterior axis. Down regulation of genes impacted specific key regulatory pathways impacting various aspects of homeostasis. These candidate genes are embryonically lethal and therefore the data obtained could provide several promising insights into the functions of these genes in an adult organism. Rad51 and BRCA2 down regulation impacts cell proliferation and cell death. However some cells escape the inevitable cell cycle arrest and cell death and maintain proliferative status. Whether the cells dividing in the anterior region is due to a particular stem cell type that does not require Rad51 for regulation, or whether the proliferation is due to abnormal behavior still requires extensive investigation. Quantitative pcr analysis provided evidence that the cells dividing in the absence of Rad51 could contain epidermal potential rather than the potential to maintain tissue integrity. Transplantation studies further provide that the stem cells that lack Rad51 could be behaving abnormally. This might indicate that Rad51 down regulation

188 mostly impacts DNA damage repair mediated cellular functions rather than the control of a specific neoblast population. Both studies clearly provide evidence towards (1) Requirement of specific genes for the proliferation and maintenance of specific stem cell populations (2) Specific genes are required for the regulation of specific cellular functions. However, the degree of

Figure 12. 3 – Specific genes are required for the regulation of specific cellular functions. Cells will utilize signals that emanate due to various extrinsic and intrinsic signals and with the aid of endogenous molecular sensors and activation of specific pathways direct specific regulatory functions. Ex: TOR pathway mediating Nutrient sensing.

involvement of these pathways and regulatory genes towards both above aspects requires further investigation. The study could garner much evidence from RNA Seq analysis and lineage tracing methods. I have utilized available novel technical methods to understand the function of individual genes belonging to the TOR/AKT and the DNA damage response pathways. However the planaria system still lacks advanced methods of lineage tracing, which slows the capability to understand stem cells in a heterogeneous environment and how they function towards maintenance of homeostasis. An exciting future direction would be to generate a method that could trace specific planarian stem cells. Thus tracking specific stem cells required for cell proliferation, DNA damage response, tissue repair and regeneration and maintenance of systemic homeostasis coupled with transplantation studies will render the planarian model system a powerful system to understand in vivo stem cell regulation. The advancement of these studies will strengthen and aid several areas of research. Understanding the regulatory molecules of neoblasts will help to determine the plasticity of these stem cells and could further aid our understanding regarding the generation of iPS

189 cells. Abnormal behavior of stem cells are currently believed as a main cause of cancer initiation and understanding how a stem cell could lead towards attaining hyper proliferative status is crucial in the fields of cancer. TOR/AKT and DNA damage response pathways are implicated in cancer initiation and understanding the potential of planarian neoblasts in the absence of genes belonging to these pathways may provide valuable insights into cancer stem cells and novel therapeutic approaches.

190

References

1. Reddien, P.W., et al., SMEDWI-2 is a PIWI-like protein that regulates planarian stem cells. Science, 2005. 310(5752): p. 1327-30. 2. Liu, Y., et al., RAD51C is required for Holliday junction processing in mammalian cells. Science, 2004. 303(5655): p. 243-6. 3. Reubinoff, B.E., et al., Embryonic stem cell lines from human blastocysts: somatic differentiation in vitro. Nat Biotechnol, 2000. 18(4): p. 399-404. 4. Geijsen, N., et al., Derivation of embryonic germ cells and male gametes from embryonic stem cells. Nature, 2004. 427(6970): p. 148-54. 5. Hoffman, L.M. and M.K. Carpenter, Characterization and culture of human embryonic stem cells. Nat Biotechnol, 2005. 23(6): p. 699-708. 6. Sugiyama, T. and T. Nagasawa, Bone marrow niches for hematopoietic stem cells and immune cells. Inflamm Allergy Drug Targets, 2012. 11(3): p. 201-6. 7. Fausto, N. and J.S. Campbell, The role of hepatocytes and oval cells in liver regeneration and repopulation. Mech Dev, 2003. 120(1): p. 117-30. 8. Malato, Y., et al., Fate tracing of mature hepatocytes in mouse liver homeostasis and regeneration. J Clin Invest, 2011. 121(12): p. 4850-60. 9. Newmark, P.A. and A. Sanchez Alvarado, Not your father's planarian: a classic model enters the era of functional genomics. Nat Rev Genet, 2002. 3(3): p. 210-9. 10. Pham, K., F. Sacirbegovic, and S.M. Russell, Polarized Cells, Polarized Views: Asymmetric Cell Division in Hematopoietic Cells. Front Immunol, 2014. 5: p. 26. 11. Wang, Q.Z., et al., The asymmetric division and tumorigenesis of stem cells. Chin J Cancer, 2010. 29(3): p. 248-53. 12. Eckfeldt, C.E., E.M. Mendenhall, and C.M. Verfaillie, The molecular repertoire of the 'almighty' stem cell. Nat Rev Mol Cell Biol, 2005. 6(9): p. 726-37. 13. Falanga, V., Wound healing and its impairment in the diabetic foot. Lancet, 2005. 366(9498): p. 1736-43. 14. Falanga, V., Stem cells in tissue repair and regeneration. J Invest Dermatol, 2012. 132(6): p. 1538-41. 15. Falanga, V. and M. Sabolinski, A bilayered living skin construct (APLIGRAF) accelerates complete closure of hard-to-heal venous ulcers. Wound Repair Regen, 1999. 7(4): p. 201- 7. 16. Marston, W.A., et al., The efficacy and safety of Dermagraft in improving the healing of chronic diabetic foot ulcers: results of a prospective randomized trial. Diabetes Care, 2003. 26(6): p. 1701-5. 17. Abad, M., et al., Reprogramming in vivo produces teratomas and iPS cells with totipotency features. Nature, 2013. 502(7471): p. 340-5. 18. Reed, J.C., Dysregulation of apoptosis in cancer. J Clin Oncol, 1999. 17(9): p. 2941-53. 19. Blanpain, C., V. Horsley, and E. Fuchs, Epithelial stem cells: turning over new leaves. Cell, 2007. 128(3): p. 445-58. 20. Insco, M.L., et al., A self-limiting switch based on translational control regulates the transition from proliferation to differentiation in an adult stem cell lineage. Cell Stem Cell, 2012. 11(5): p. 689-700.

191

21. Sun, C. and Y.K. Liu, Induced pluripotent cancer cells: progress and application. Journal of cancer research and clinical oncology, 2011. 137(1): p. 1-8. 22. Bergmann, A. and H. Steller, Apoptosis, stem cells, and tissue regeneration. Science signaling, 2010. 3(145): p. re8. 23. Pearson, J., et al., Recent advances in Drosophila stem cell biology. Int J Dev Biol, 2009. 53(8-10): p. 1329-39. 24. Hubbard, E.J., Caenorhabditis elegans germ line: a model for stem cell biology. Dev Dyn, 2007. 236(12): p. 3343-57. 25. Dooley, K. and L.I. Zon, Zebrafish: a model system for the study of human disease. Curr Opin Genet Dev, 2000. 10(3): p. 252-6. 26. Lapan, S.W. and P.W. Reddien, Transcriptome analysis of the planarian eye identifies ovo as a specific regulator of eye regeneration. Cell Rep, 2012. 2(2): p. 294-307. 27. Rompolas, P., et al., Analysis of ciliary assembly and function in planaria. Methods Enzymol, 2013. 525: p. 245-64. 28. Peiris, T.H., K.K. Hoyer, and N.J. Oviedo, Innate immune system and tissue regeneration in planarians: An area ripe for exploration. Semin Immunol, 2014. 26(4): p. 295-302. 29. Reddien, P.W. and A. Sanchez Alvarado, Fundamentals of planarian regeneration. Annu Rev Cell Dev Biol, 2004. 20: p. 725-57. 30. Pedersen, K.J., Cytological studies on the planarian neoblast. Z Zellforsch Mikrosk Anat, 1959. 50: p. 799-817. 31. Hay, E.D. and S.J. Coward, Fine structure studies on the planarian, Dugesia. I. Nature of the "neoblast" and other cell types in noninjured worms. J Ultrastruct Res, 1975. 50(1): p. 1-21. 32. Morita, M. and J.B. Best, Electron microscopic studies of planarian regeneration. II. Changes in epidermis during regeneration. J Exp Zool, 1974. 187(3): p. 345-73. 33. Eisenhoffer, G.T., H. Kang, and A. Sanchez Alvarado, Molecular analysis of stem cells and their descendants during cell turnover and regeneration in the planarian Schmidtea mediterranea. Cell Stem Cell, 2008. 3(3): p. 327-39. 34. van Wolfswinkel, J.C., D.E. Wagner, and P.W. Reddien, Single-Cell Analysis Reveals Functionally Distinct Classes within the Planarian Stem Cell Compartment. Cell Stem Cell, 2014. 15(3): p. 326-39. 35. Oviedo, N.J., et al., Planarian PTEN homologs regulate stem cells and regeneration through TOR signaling. Dis Model Mech, 2008. 1(2-3): p. 131-43: discussion 141. 36. Pearson, B.J. and A. Sanchez Alvarado, A planarian p53 homolog regulates proliferation and self-renewal in adult stem cell lineages. Development, 2010. 137(2): p. 213-21. 37. Betchaku, T., The cellular mechanism of the formation of a regeneration blastema of fresh-water planaria, Dugesia dorotocephala. I. The behavior of cells in a tiny body fragment isolated in vitro. The Journal of experimental zoology, 1970. 174(3): p. 253-79. 38. Shibata, N., L. Rouhana, and K. Agata, Cellular and molecular dissection of pluripotent adult somatic stem cells in planarians. Development, growth & differentiation, 2010. 52(1): p. 27-41. 39. Houchens, D.P., et al., Human brain tumor xenografts in nude mice as a chemotherapy model. Eur J Cancer Clin Oncol, 1983. 19(6): p. 799-805. 40. Thomson, A.W., H.R. Turnquist, and G. Raimondi, Immunoregulatory functions of mTOR inhibition. Nat Rev Immunol, 2009. 9(5): p. 324-37.

192

41. Garber, K., Rapamycin's resurrection: a new way to target the cancer cell cycle. J Natl Cancer Inst, 2001. 93(20): p. 1517-9. 42. Seto, B., Rapamycin and mTOR: a serendipitous discovery and implications for breast cancer. Clin Transl Med, 2012. 1(1): p. 29. 43. Heitman, J., N.R. Movva, and M.N. Hall, Targets for cell cycle arrest by the immunosuppressant rapamycin in yeast. Science, 1991. 253(5022): p. 905-9. 44. Hall, M.N., mTOR-what does it do? Transplant Proc, 2008. 40(10 Suppl): p. S5-8. 45. Lorberg, A. and M.N. Hall, TOR: the first 10 years. Curr Top Microbiol Immunol, 2004. 279: p. 1-18. 46. Tatebe, H. and K. Shiozaki, Rab small GTPase emerges as a regulator of TOR complex 2. Small GTPases, 2010. 1(3): p. 180-182. 47. Wang, T., et al., LST8 regulates cell growth via target-of-rapamycin complex 2 (TORC2). Mol Cell Biol, 2012. 32(12): p. 2203-13. 48. Wullschleger, S., R. Loewith, and M.N. Hall, TOR signaling in growth and metabolism. Cell, 2006. 124(3): p. 471-84. 49. Hiom, K., DNA repair: how to PIKK a partner. Curr Biol, 2005. 15(12): p. R473-5. 50. Kunz, J., et al., Target of rapamycin in yeast, TOR2, is an essential phosphatidylinositol kinase homolog required for G1 progression. Cell, 1993. 73(3): p. 585-96. 51. Andrade, M.A. and P. Bork, HEAT repeats in the Huntington's disease protein. Nat Genet, 1995. 11(2): p. 115-6. 52. Wang, Q., et al., Interactions of the protein-tyrosine phosphatase-alpha with the focal adhesion targeting domain of focal adhesion kinase are involved in interleukin-1 signaling in fibroblasts. J Biol Chem, 2014. 289(26): p. 18427-41. 53. Dames, S.A., et al., The solution structure of the FATC domain of the protein kinase target of rapamycin suggests a role for redox-dependent structural and cellular stability. J Biol Chem, 2005. 280(21): p. 20558-64. 54. Jiang, X., et al., The FATC domains of PIKK proteins are functionally equivalent and participate in the Tip60-dependent activation of DNA-PKcs and ATM. J Biol Chem, 2006. 281(23): p. 15741-6. 55. Banaszynski, L.A., C.W. Liu, and T.J. Wandless, Characterization of the FKBP.rapamycin.FRB ternary complex. J Am Chem Soc, 2005. 127(13): p. 4715-21. 56. Kim, D.H., et al., GbetaL, a positive regulator of the rapamycin-sensitive pathway required for the nutrient-sensitive interaction between raptor and mTOR. Mol Cell, 2003. 11(4): p. 895-904. 57. Crespo, J.L., et al., The TOR-controlled transcription activators GLN3, RTG1, and RTG3 are regulated in response to intracellular levels of glutamine. Proc Natl Acad Sci U S A, 2002. 99(10): p. 6784-9. 58. Kim, D.H., et al., mTOR interacts with raptor to form a nutrient-sensitive complex that signals to the cell growth machinery. Cell, 2002. 110(2): p. 163-75. 59. Jacinto, E., et al., Mammalian TOR complex 2 controls the actin cytoskeleton and is rapamycin insensitive. Nat Cell Biol, 2004. 6(11): p. 1122-8. 60. Sarbassov, D.D., et al., Rictor, a novel binding partner of mTOR, defines a rapamycin- insensitive and raptor-independent pathway that regulates the cytoskeleton. Curr Biol, 2004. 14(14): p. 1296-302.

193

61. Perkey, E., et al., Increased mammalian target of rapamycin complex 2 signaling promotes age-related decline in CD4 T cell signaling and function. J Immunol, 2013. 191(9): p. 4648-55. 62. Karantza-Wadsworth, V., et al., Autophagy mitigates metabolic stress and genome damage in mammary tumorigenesis. Genes Dev, 2007. 21(13): p. 1621-35. 63. Vessoni, A.T., et al., Autophagy and genomic integrity. Cell Death Differ, 2013. 20(11): p. 1444-54. 64. White, E. and S.W. Lowe, Eating to exit: autophagy-enabled senescence revealed. Genes Dev, 2009. 23(7): p. 784-7. 65. Gonzalez-Estevez, C., et al., Gtdap-1 and the role of autophagy during planarian regeneration and starvation. Autophagy, 2007. 3(6): p. 640-2. 66. Gonzalez-Estevez, C., Autophagy meets planarians. Autophagy, 2009. 5(3): p. 290-7. 67. Robb, S.M., E. Ross, and A. Sanchez Alvarado, SmedGD: the Schmidtea mediterranea genome database. Nucleic Acids Res, 2008. 36(Database issue): p. D599-606. 68. Tu, K.C., B.J. Pearson, and A. Sanchez Alvarado, TORC1 is required to balance cell proliferation and cell death in planarians. Dev Biol, 2012. 365(2): p. 458-69. 69. Gonzalez-Estevez, C., et al., SMG-1 and mTORC1 act antagonistically to regulate response to injury and growth in planarians. PLoS Genet, 2012. 8(3): p. e1002619. 70. Sanchez Alvarado, A. and P.A. Newmark, Double-stranded RNA specifically disrupts gene expression during planarian regeneration. Proc Natl Acad Sci U S A, 1999. 96(9): p. 5049- 54. 71. Guo, T., A.H. Peters, and P.A. Newmark, A Bruno-like gene is required for stem cell maintenance in planarians. Dev Cell, 2006. 11(2): p. 159-69. 72. Wenemoser, D. and P.W. Reddien, Planarian regeneration involves distinct stem cell responses to wounds and tissue absence. Dev Biol, 2010. 344(2): p. 979-91. 73. Raught, B., A.C. Gingras, and N. Sonenberg, The target of rapamycin (TOR) proteins. Proc Natl Acad Sci U S A, 2001. 98(13): p. 7037-44. 74. Munchel, S.E., et al., Dynamic profiling of mRNA turnover reveals gene-specific and system-wide regulation of mRNA decay. Mol Biol Cell, 2011. 22(15): p. 2787-95. 75. Matsubara, S., et al., mTOR plays critical roles in pancreatic cancer stem cells through specific and stemness-related functions. Sci Rep, 2013. 3: p. 3230. 76. Guertin, D.A. and D.M. Sabatini, Defining the role of mTOR in cancer. Cancer Cell, 2007. 12(1): p. 9-22. 77. Robb, S.M. and A. Sanchez Alvarado, Identification of immunological reagents for use in the study of freshwater planarians by means of whole-mount immunofluorescence and confocal microscopy. Genesis, 2002. 32(4): p. 293-8. 78. Barbet, N.C., et al., TOR controls translation initiation and early G1 progression in yeast. Mol Biol Cell, 1996. 7(1): p. 25-42. 79. Wagner, D.E., I.E. Wang, and P.W. Reddien, Clonogenic neoblasts are pluripotent adult stem cells that underlie planarian regeneration. Science, 2011. 332(6031): p. 811-6. 80. Russell, R.C., C. Fang, and K.L. Guan, An emerging role for TOR signaling in mammalian tissue and stem cell physiology. Development, 2011. 138(16): p. 3343-56. 81. Shen, C., et al., TOR signaling is a determinant of cell survival in response to DNA damage. Mol Cell Biol, 2007. 27(20): p. 7007-17.

194

82. Huang, S., et al., Inhibition of mammalian target of rapamycin activates apoptosis signal-regulating kinase 1 signaling by suppressing protein phosphatase 5 activity. J Biol Chem, 2004. 279(35): p. 36490-6. 83. Liu, Q., et al., Akt and mTOR mediate programmed necrosis in neurons. Cell Death Dis, 2014. 5: p. e1084. 84. Bosnjak, M., et al., Inhibition of mTOR-dependent autophagy sensitizes leukemic cells to cytarabine-induced apoptotic death. PLoS One, 2014. 9(4): p. e94374. 85. Kim, J., et al., AMPK and mTOR regulate autophagy through direct phosphorylation of Ulk1. Nat Cell Biol, 2011. 13(2): p. 132-41. 86. Tanida, I., T. Ueno, and E. Kominami, LC3 and Autophagy. Methods Mol Biol, 2008. 445: p. 77-88. 87. Tanida, I., T. Ueno, and E. Kominami, LC3 conjugation system in mammalian autophagy. Int J Biochem Cell Biol, 2004. 36(12): p. 2503-18. 88. Zoncu, R., A. Efeyan, and D.M. Sabatini, mTOR: from growth signal integration to cancer, diabetes and ageing. Nat Rev Mol Cell Biol, 2011. 12(1): p. 21-35. 89. Baguna, J., Dramatic mitotic response in planarians after feeding, and a hypothesis for the control mechanism. J Exp Zool, 1974. 190(1): p. 117-22. 90. Oviedo, N.J., P.A. Newmark, and A. Sanchez Alvarado, Allometric scaling and proportion regulation in the freshwater planarian Schmidtea mediterranea. Dev Dyn, 2003. 226(2): p. 326-33. 91. Oldham, S., et al., Genetic and biochemical characterization of dTOR, the Drosophila homolog of the target of rapamycin. Genes Dev, 2000. 14(21): p. 2689-94. 92. Fingar, D.C., et al., Mammalian cell size is controlled by mTOR and its downstream targets S6K1 and 4EBP1/eIF4E. Genes Dev, 2002. 16(12): p. 1472-87. 93. Kang, H. and A. Sanchez Alvarado, Flow cytometry methods for the study of cell-cycle parameters of planarian stem cells. Dev Dyn, 2009. 238(5): p. 1111-7. 94. Gentile, L., F. Cebria, and K. Bartscherer, The planarian flatworm: an in vivo model for stem cell biology and nervous system regeneration. Dis Model Mech, 2011. 4(1): p. 12-9. 95. Salo, E. and J. Baguna, Regeneration and pattern formation in planarians. I. The pattern of mitosis in anterior and posterior regeneration in Dugesia (G) tigrina, and a new proposal for blastema formation. J Embryol Exp Morphol, 1984. 83: p. 63-80. 96. Oviedo, N.J., et al., Long-range neural and gap junction protein-mediated cues control polarity during planarian regeneration. Dev Biol, 2010. 339(1): p. 188-99. 97. Hwang, J.S., et al., Detection of apoptosis during planarian regeneration by the expression of apoptosis-related genes and TUNEL assay. Gene, 2004. 333: p. 15-25. 98. Tseng, A.S., et al., Apoptosis is required during early stages of tail regeneration in Xenopus laevis. Dev Biol, 2007. 301(1): p. 62-9. 99. Chera, S., et al., Apoptotic cells provide an unexpected source of Wnt3 signaling to drive hydra head regeneration. Dev Cell, 2009. 17(2): p. 279-89. 100. Pellettieri, J., et al., Cell death and tissue remodeling in planarian regeneration. Dev Biol, 2010. 338(1): p. 76-85. 101. Gurley, K.A., et al., Expression of secreted Wnt pathway components reveals unexpected complexity of the planarian amputation response. Dev Biol, 2010. 347(1): p. 24-39. 102. Sanchez Alvarado, A., Regeneration in the metazoans: why does it happen? Bioessays, 2000. 22(6): p. 578-90.

195

103. Brockes, J.P. and A. Kumar, Comparative aspects of animal regeneration. Annu Rev Cell Dev Biol, 2008. 24: p. 525-49. 104. Poss, K.D., Advances in understanding tissue regenerative capacity and mechanisms in animals. Nat Rev Genet, 2010. 11(10): p. 710-22. 105. Feldman, M.E., et al., Active-site inhibitors of mTOR target rapamycin-resistant outputs of mTORC1 and mTORC2. PLoS Biol, 2009. 7(2): p. e38. 106. Garcia-Martinez, J.M., et al., Ku-0063794 is a specific inhibitor of the mammalian target of rapamycin (mTOR). Biochem J, 2009. 421(1): p. 29-42. 107. Shor, B., et al., Targeting mTOR globally in cancer: thinking beyond rapamycin. Cell Cycle, 2009. 8(23): p. 3831-7. 108. Thoreen, C.C., et al., An ATP-competitive mammalian target of rapamycin inhibitor reveals rapamycin-resistant functions of mTORC1. J Biol Chem, 2009. 284(12): p. 8023- 32. 109. Kumar, C.C. and V. Madison, AKT crystal structure and AKT-specific inhibitors. Oncogene, 2005. 24(50): p. 7493-501. 110. Oviedo, N.J., et al., Planarian PTEN homologs regulate stem cells and regeneration through TOR signaling. Disease models & mechanisms, 2008. 1(2-3): p. 131-43: discussion 141. 111. Liao, Y. and M.C. Hung, Physiological regulation of Akt activity and stability. American journal of translational research, 2010. 2(1): p. 19-42. 112. Kim, J.Y., et al., DISC1 regulates new neuron development in the adult brain via modulation of AKT-mTOR signaling through KIAA1212. Neuron, 2009. 63(6): p. 761-73. 113. Peiris, T.H., et al., TOR signaling regulates planarian stem cells and controls localized and organismal growth. J Cell Sci, 2012. 125(Pt 7): p. 1657-65. 114. Peiris, T.H., et al., TOR signaling regulates planarian stem cells and controls localized and organismal growth. J Cell Sci. 125(Pt 7): p. 1657-65. 115. Kannan, N. and A.F. Neuwald, Did protein kinase regulatory mechanisms evolve through elaboration of a simple structural component? J Mol Biol, 2005. 351(5): p. 956-72. 116. Kannan, N., et al., Structural and functional diversity of the microbial kinome. PLoS Biol, 2007. 5(3): p. e17. 117. Reddien, P.W., et al., Identification of genes needed for regeneration, stem cell function, and tissue homeostasis by systematic gene perturbation in planaria. Dev Cell, 2005. 8(5): p. 635-49. 118. Vadlakonda, L., M. Pasupuleti, and R. Pallu, Role of PI3K-AKT-mTOR and Wnt Signaling Pathways in Transition of G1-S Phase of Cell Cycle in Cancer Cells. Front Oncol. 3: p. 85. 119. Ryu, J.M. and H.J. Han, L-threonine regulates G1/S phase transition of mouse embryonic stem cells via PI3K/Akt, MAPKs, and mTORC pathways. J Biol Chem. 286(27): p. 23667- 78. 120. Chen, T., et al., Cannabisin B induces autophagic cell death by inhibiting the AKT/mTOR pathway and S phase cell cycle arrest in HepG2 cells. Food Chem. 138(2-3): p. 1034-41. 121. Ornelas, I.M., et al., Inhibition of PI3K/Akt pathway impairs G2/M transition of cell cycle in late developing progenitors of the avian embryo retina. PLoS One. 8(1): p. e53517. 122. Lee, S.R., et al., Akt-induced promotion of cell-cycle progression at G2/M phase involves upregulation of NF-Y binding activity in PC12 cells. J Cell Physiol, 2005. 205(2): p. 270-7. 123. Wang, Y., et al., nanos function is essential for development and regeneration of planarian germ cells. Proc Natl Acad Sci U S A, 2007. 104(14): p. 5901-6.

196

124. Leon-Mejia, G., et al., Assessment of DNA damage in coal open-cast mining workers using the cytokinesis-blocked micronucleus test and the comet assay. The Science of the total environment, 2011. 409(4): p. 686-91. 125. Holland, N., et al., Micronuclei in neonates and children: effects of environmental, genetic, demographic and disease variables. Mutagenesis, 2011. 26(1): p. 51-6. 126. Bolognesi, C., et al., Micronuclei and pesticide exposure. Mutagenesis, 2011. 26(1): p. 19- 26. 127. Jackson, S.P., Sensing and repairing DNA double-strand breaks. Carcinogenesis, 2002. 23(5): p. 687-96. 128. Bennett, M.R., Reactive oxygen species and death: oxidative DNA damage in atherosclerosis. Circulation research, 2001. 88(7): p. 648-50. 129. Willis, N. and N. Rhind, Regulation of DNA replication by the S-phase DNA damage checkpoint. Cell Div, 2009. 4: p. 13. 130. Cooke, M.S., et al., Oxidative DNA damage: mechanisms, mutation, and disease. FASEB J, 2003. 17(10): p. 1195-214. 131. Harris, J., et al., Mutator phenotype of Caenorhabditis elegans DNA damage checkpoint mutants. Genetics, 2006. 174(2): p. 601-16. 132. Timme, T.L. and R.E. Moses, Diseases with DNA damage-processing defects. The American journal of the medical sciences, 1988. 295(1): p. 40-8. 133. Lord, C.J. and A. Ashworth, The DNA damage response and cancer therapy. Nature, 2012. 481(7381): p. 287-94. 134. Hiom, K., Coping with DNA double strand breaks. DNA repair, 2010. 9(12): p. 1256-63. 135. Barker, C.A. and S.N. Powell, Enhancing radiotherapy through a greater understanding of homologous recombination. Seminars in radiation oncology, 2010. 20(4): p. 267-273 e3. 136. Rassool, F.V. and A.E. Tomkinson, Targeting abnormal DNA double strand break repair in cancer. Cellular and molecular life sciences : CMLS, 2010. 67(21): p. 3699-710. 137. Kass, E.M. and M. Jasin, Collaboration and competition between DNA double-strand break repair pathways. FEBS letters, 2010. 584(17): p. 3703-8. 138. Iliakis, G., et al., DNA damage checkpoint control in cells exposed to ionizing radiation. Oncogene, 2003. 22(37): p. 5834-47. 139. McVey, M. and S.E. Lee, MMEJ repair of double-strand breaks (director's cut): deleted sequences and alternative endings. Trends in genetics : TIG, 2008. 24(11): p. 529-38. 140. Beernink, H.T. and S.W. Morrical, RMPs: recombination/replication mediator proteins. Trends Biochem Sci, 1999. 24(10): p. 385-9. 141. Lieber, M.R., The mechanism of double-strand DNA break repair by the nonhomologous DNA end-joining pathway. Annu Rev Biochem, 2010. 79: p. 181-211. 142. Betermier, M., P. Bertrand, and B.S. Lopez, Is non-homologous end-joining really an inherently error-prone process? PLoS Genet, 2014. 10(1): p. e1004086. 143. Seung, E., et al., Allogeneic hematopoietic chimerism in mice treated with sublethal myeloablation and anti-CD154 antibody: absence of graft-versus-host disease, induction of skin allograft tolerance, and prevention of recurrent autoimmunity in islet-allografted NOD/Lt mice. Blood, 2000. 95(6): p. 2175-82. 144. de Jager, M., et al., DNA-binding and strand-annealing activities of human Mre11: implications for its roles in DNA double-strand break repair pathways. Nucleic Acids Res, 2001. 29(6): p. 1317-25.

197

145. Paull, T.T. and M. Gellert, Nbs1 potentiates ATP-driven DNA unwinding and endonuclease cleavage by the Mre11/Rad50 complex. Genes Dev, 1999. 13(10): p. 1276- 88. 146. Williams, R.S., et al., Mre11 dimers coordinate DNA end bridging and nuclease processing in double-strand-break repair. Cell, 2008. 135(1): p. 97-109. 147. Hopfner, K.P., et al., Structural biology of Rad50 ATPase: ATP-driven conformational control in DNA double-strand break repair and the ABC-ATPase superfamily. Cell, 2000. 101(7): p. 789-800. 148. Hopfner, K.P., et al., Structural biochemistry and interaction architecture of the DNA double-strand break repair Mre11 nuclease and Rad50-ATPase. Cell, 2001. 105(4): p. 473-85. 149. de Jager, M., et al., Human Rad50/Mre11 is a flexible complex that can tether DNA ends. Mol Cell, 2001. 8(5): p. 1129-35. 150. Bakkenist, C.J. and M.B. Kastan, DNA damage activates ATM through intermolecular autophosphorylation and dimer dissociation. Nature, 2003. 421(6922): p. 499-506. 151. Soutoglou, E. and T. Misteli, Activation of the cellular DNA damage response in the absence of DNA lesions. Science, 2008. 320(5882): p. 1507-10. 152. You, Z., et al., Rapid activation of ATM on DNA flanking double-strand breaks. Nat Cell Biol, 2007. 9(11): p. 1311-8. 153. Shiotani, B. and L. Zou, Single-stranded DNA orchestrates an ATM-to-ATR switch at DNA breaks. Mol Cell, 2009. 33(5): p. 547-58. 154. Falck, J., J. Coates, and S.P. Jackson, Conserved modes of recruitment of ATM, ATR and DNA-PKcs to sites of DNA damage. Nature, 2005. 434(7033): p. 605-11. 155. Difilippantonio, S. and A. Nussenzweig, The NBS1-ATM connection revisited. Cell Cycle, 2007. 6(19): p. 2366-70. 156. Andegeko, Y., et al., Nuclear retention of ATM at sites of DNA double strand breaks. J Biol Chem, 2001. 276(41): p. 38224-30. 157. Kozlov, S.V., et al., Involvement of novel autophosphorylation sites in ATM activation. EMBO J, 2006. 25(15): p. 3504-14. 158. Kozlov, S.V., et al., Autophosphorylation and ATM activation: additional sites add to the complexity. J Biol Chem, 2011. 286(11): p. 9107-19. 159. Brauchle, M., K. Baumer, and P. Gonczy, Differential activation of the DNA replication checkpoint contributes to asynchrony of cell division in C. elegans embryos. Curr Biol, 2003. 13(10): p. 819-27. 160. Sibon, O.C., et al., The Drosophila ATM homologue Mei-41 has an essential checkpoint function at the midblastula transition. Curr Biol, 1999. 9(6): p. 302-12. 161. Cliby, W.A., et al., Overexpression of a kinase-inactive ATR protein causes sensitivity to DNA-damaging agents and defects in cell cycle checkpoints. EMBO J, 1998. 17(1): p. 159- 69. 162. Freeman, A.K. and A.N. Monteiro, Phosphatases in the cellular response to DNA damage. Cell Commun Signal, 2010. 8: p. 27. 163. Gottlieb, T.M. and S.P. Jackson, The DNA-dependent protein kinase: requirement for DNA ends and association with Ku antigen. Cell, 1993. 72(1): p. 131-42. 164. Hammarsten, O. and G. Chu, DNA-dependent protein kinase: DNA binding and activation in the absence of Ku. Proc Natl Acad Sci U S A, 1998. 95(2): p. 525-30.

198

165. Smith, G.C. and S.P. Jackson, The DNA-dependent protein kinase. Genes Dev, 1999. 13(8): p. 916-34. 166. Rathmell, W.K., et al., DNA-dependent protein kinase is not required for accumulation of p53 or cell cycle arrest after DNA damage. Cancer Res, 1997. 57(1): p. 68-74. 167. Burma, S., et al., DNA-dependent protein kinase-independent activation of p53 in response to DNA damage. J Biol Chem, 1999. 274(24): p. 17139-43. 168. Dantzer, F., et al., Poly(ADP-ribose) polymerase-1 activation during DNA damage and repair. Methods Enzymol, 2006. 409: p. 493-510. 169. El-Khamisy, S.F., et al., A requirement for PARP-1 for the assembly or stability of XRCC1 nuclear foci at sites of oxidative DNA damage. Nucleic Acids Res, 2003. 31(19): p. 5526- 33. 170. Mao, Z., et al., SIRT6 promotes DNA repair under stress by activating PARP1. Science, 2011. 332(6036): p. 1443-6. 171. Helleday, T., H.E. Bryant, and N. Schultz, Poly(ADP-ribose) polymerase (PARP-1) in homologous recombination and as a target for cancer therapy. Cell Cycle, 2005. 4(9): p. 1176-8. 172. Kuo, L.J. and L.X. Yang, Gamma-H2AX - a novel biomarker for DNA double-strand breaks. In Vivo, 2008. 22(3): p. 305-9. 173. Sar, F., et al., Human claspin is a ring-shaped DNA-binding protein with high affinity to branched DNA structures. J Biol Chem, 2004. 279(38): p. 39289-95. 174. Paull, T.T., et al., A critical role for histone H2AX in recruitment of repair factors to nuclear foci after DNA damage. Curr Biol, 2000. 10(15): p. 886-95. 175. Stewart, G.S., et al., MDC1 is a mediator of the mammalian DNA damage checkpoint. Nature, 2003. 421(6926): p. 961-6. 176. Lukas, C., et al., Mdc1 couples DNA double-strand break recognition by Nbs1 with its H2AX-dependent chromatin retention. EMBO J, 2004. 23(13): p. 2674-83. 177. Wu, L., et al., MDC1 regulates intra-S-phase checkpoint by targeting NBS1 to DNA double-strand breaks. Proc Natl Acad Sci U S A, 2008. 105(32): p. 11200-5. 178. Kumagai, A. and W.G. Dunphy, Claspin, a novel protein required for the activation of Chk1 during a DNA replication checkpoint response in Xenopus egg extracts. Mol Cell, 2000. 6(4): p. 839-49. 179. Chini, C.C. and J. Chen, Human claspin is required for replication checkpoint control. J Biol Chem, 2003. 278(32): p. 30057-62. 180. Lin, S.Y., et al., Human Claspin works with BRCA1 to both positively and negatively regulate cell proliferation. Proc Natl Acad Sci U S A, 2004. 101(17): p. 6484-9. 181. Sercin, O. and M.G. Kemp, Characterization of functional domains in human Claspin. Cell Cycle, 2011. 10(10): p. 1599-606. 182. Jeon, Y., et al., TopBP1 deficiency causes an early embryonic lethality and induces cellular senescence in primary cells. J Biol Chem, 2011. 286(7): p. 5414-22. 183. Kim, J., et al., TopBP1 deficiency impairs V(D)J recombination during lymphocyte development. EMBO J, 2014. 33(3): p. 217-28. 184. Ashcroft, M., M.H. Kubbutat, and K.H. Vousden, Regulation of p53 function and stability by phosphorylation. Mol Cell Biol, 1999. 19(3): p. 1751-8. 185. Zhu, S.J. and B.J. Pearson, The Retinoblastoma pathway regulates stem cell proliferation in freshwater planarians. Dev Biol, 2013. 373(2): p. 442-52.

199

186. Nimonkar, A.V., R.A. Sica, and S.C. Kowalczykowski, Rad52 promotes second-end DNA capture in double-stranded break repair to form complement-stabilized joint molecules. Proc Natl Acad Sci U S A, 2009. 106(9): p. 3077-82. 187. Game, J.C., DNA double-strand breaks and the RAD50-RAD57 genes in Saccharomyces. Semin Cancer Biol, 1993. 4(2): p. 73-83. 188. Bai, Y. and L.S. Symington, A Rad52 homolog is required for RAD51-independent mitotic recombination in Saccharomyces cerevisiae. Genes Dev, 1996. 10(16): p. 2025-37. 189. Shinohara, A., et al., Rad52 forms ring structures and co-operates with RPA in single- strand DNA annealing. Genes Cells, 1998. 3(3): p. 145-56. 190. Sharan, S.K., et al., Embryonic lethality and radiation hypersensitivity mediated by Rad51 in mice lacking Brca2. Nature, 1997. 386(6627): p. 804-10. 191. Pazin, M.J. and J.T. Kadonaga, SWI2/SNF2 and related proteins: ATP-driven motors that disrupt protein-DNA interactions? Cell, 1997. 88(6): p. 737-40. 192. Messiaen, S., et al., Rad54 is required for the normal development of male and female germ cells and contributes to the maintainance of their genome integrity after genotoxic stress. Cell Death Dis, 2013. 4: p. e774. 193. Jaco, I., et al., Role of mammalian Rad54 in telomere length maintenance. Mol Cell Biol, 2003. 23(16): p. 5572-80. 194. Heyer, W.D., et al., Rad54: the Swiss Army knife of homologous recombination? Nucleic Acids Res, 2006. 34(15): p. 4115-25. 195. Kiianitsa, K., J.A. Solinger, and W.D. Heyer, Terminal association of Rad54 protein with the Rad51-dsDNA filament. Proc Natl Acad Sci U S A, 2006. 103(26): p. 9767-72. 196. Van Komen, S., et al., Superhelicity-driven homologous DNA pairing by yeast recombination factors Rad51 and Rad54. Mol Cell, 2000. 6(3): p. 563-72. 197. Mazin, A.V., A.A. Alexeev, and S.C. Kowalczykowski, A novel function of Rad54 protein. Stabilization of the Rad51 nucleoprotein filament. J Biol Chem, 2003. 278(16): p. 14029- 36. 198. Solinger, J.A., K. Kiianitsa, and W.D. Heyer, Rad54, a Swi2/Snf2-like recombinational repair protein, disassembles Rad51:dsDNA filaments. Mol Cell, 2002. 10(5): p. 1175-88. 199. Alexeev, A., A. Mazin, and S.C. Kowalczykowski, Rad54 protein possesses chromatin- remodeling activity stimulated by the Rad51-ssDNA nucleoprotein filament. Nat Struct Biol, 2003. 10(3): p. 182-6. 200. Alexiadis, V., A. Lusser, and J.T. Kadonaga, A conserved N-terminal motif in Rad54 is important for chromatin remodeling and homologous strand pairing. J Biol Chem, 2004. 279(26): p. 27824-9. 201. Gu, Y., et al., Defective embryonic neurogenesis in Ku-deficient but not DNA-dependent protein kinase catalytic subunit-deficient mice. Proc Natl Acad Sci U S A, 2000. 97(6): p. 2668-73. 202. Zhong, Q., et al., Deficient nonhomologous end-joining activity in cell-free extracts from Brca1-null fibroblasts. Cancer Res, 2002. 62(14): p. 3966-70. 203. Ma, Y., et al., Hairpin opening and overhang processing by an Artemis/DNA-dependent protein kinase complex in nonhomologous end joining and V(D)J recombination. Cell, 2002. 108(6): p. 781-94. 204. Ma, Y., et al., A biochemically defined system for mammalian nonhomologous DNA end joining. Mol Cell, 2004. 16(5): p. 701-13.

200

205. Ma, Y., K. Schwarz, and M.R. Lieber, The Artemis:DNA-PKcs endonuclease cleaves DNA loops, flaps, and gaps. DNA Repair (Amst), 2005. 4(7): p. 845-51. 206. Zheng, L., et al., Disruption of the FEN-1/PCNA interaction results in DNA replication defects, pulmonary hypoplasia, pancytopenia, and newborn lethality in mice. Mol Cell Biol, 2007. 27(8): p. 3176-86. 207. Kikuchi, K., et al., Fen-1 facilitates homologous recombination by removing divergent sequences at DNA break ends. Mol Cell Biol, 2005. 25(16): p. 6948-55. 208. Kleppa, L., et al., Kinetics of endogenous mouse FEN1 in base excision repair. Nucleic Acids Res, 2012. 40(18): p. 9044-59. 209. Gu, J., et al., XRCC4:DNA ligase IV can ligate incompatible DNA ends and can ligate across gaps. EMBO J, 2007. 26(4): p. 1010-23. 210. Ahnesorg, P., P. Smith, and S.P. Jackson, XLF interacts with the XRCC4-DNA ligase IV complex to promote DNA nonhomologous end-joining. Cell, 2006. 124(2): p. 301-13. 211. Grawunder, U., et al., Activity of DNA ligase IV stimulated by complex formation with XRCC4 protein in mammalian cells. Nature, 1997. 388(6641): p. 492-5. 212. Karanjawala, Z.E., et al., The embryonic lethality in DNA ligase IV-deficient mice is rescued by deletion of Ku: implications for unifying the heterogeneous phenotypes of NHEJ mutants. DNA Repair (Amst), 2002. 1(12): p. 1017-26. 213. Daley, J.M., et al., DNA joint dependence of pol X family polymerase action in nonhomologous end joining. J Biol Chem, 2005. 280(32): p. 29030-7. 214. Dunkern, T.R., G. Fritz, and B. Kaina, Ultraviolet light-induced DNA damage triggers apoptosis in nucleotide excision repair-deficient cells via Bcl-2 decline and caspase-3/-8 activation. Oncogene, 2001. 20(42): p. 6026-38. 215. Carvalho, H., et al., Effect of cell confluence on ultraviolet light apoptotic responses in DNA repair deficient cells. Mutat Res, 2003. 544(2-3): p. 159-66. 216. Bender, C.E., et al., Mitochondrial pathway of apoptosis is ancestral in metazoans. Proc Natl Acad Sci U S A, 2012. 109(13): p. 4904-9. 217. Alphonse, G., et al., p53-independent early and late apoptosis is mediated by ceramide after exposure of tumor cells to photon or carbon ion irradiation. BMC Cancer, 2013. 13: p. 151. 218. Cai, Y., et al., iASPP inhibits p53-independent apoptosis by inhibiting transcriptional activity of p63/p73 on promoters of proapoptotic genes. Apoptosis, 2012. 17(8): p. 777- 83. 219. Robertson, J.D., et al., Processed caspase-2 can induce mitochondria-mediated apoptosis independently of its enzymatic activity. EMBO Rep, 2004. 5(6): p. 643-8. 220. Kumar, S., Caspase 2 in apoptosis, the DNA damage response and tumour suppression: enigma no more? Nat Rev Cancer, 2009. 9(12): p. 897-903. 221. Eckardt, F., S. Kowalski, and W. Laskowski, The effects of three rad genes on UV induced mutation rates in haploid and diploid Saccharomyces cells. Mol Gen Genet, 1975. 136(3): p. 261-72. 222. Prakash, L., Lack of chemically induced mutation in repair-deficient mutants of yeast. Genetics, 1974. 78(4): p. 1101-18. 223. Reddy, N.M., B.S. Rao, and U. Madhvanath, Comparison of sensitivity of rad mutants of diploid yeast to heat and gamma radiation: cellular target for heat inactivation. Int J Radiat Biol Relat Stud Phys Chem Med, 1981. 40(3): p. 235-43.

201

224. MacInnes, M.A., et al., Human ERCC5 cDNA-cosmid complementation for excision repair and bipartite amino acid domains conserved with RAD proteins of Saccharomyces cerevisiae and Schizosaccharomyces pombe. Mol Cell Biol, 1993. 13(10): p. 6393-402. 225. Lindsey-Boltz, L.A., et al., Purification and characterization of human DNA damage checkpoint Rad complexes. Proc Natl Acad Sci U S A, 2001. 98(20): p. 11236-41. 226. Beerman, I., et al., Quiescent hematopoietic stem cells accumulate DNA damage during aging that is repaired upon entry into cell cycle. Cell Stem Cell, 2014. 15(1): p. 37-50. 227. van der Heijden, T., et al., Homologous recombination in real time: DNA strand exchange by RecA. Mol Cell, 2008. 30(4): p. 530-8. 228. Thacker, J., A surfeit of RAD51-like genes? Trends Genet, 1999. 15(5): p. 166-8. 229. Kurzbauer, M.T., et al., The recombinases DMC1 and RAD51 are functionally and spatially separated during meiosis in Arabidopsis. Plant Cell, 2012. 24(5): p. 2058-70. 230. Bishop, D.K., et al., DMC1: a meiosis-specific yeast homolog of E. coli recA required for recombination, synaptonemal complex formation, and cell cycle progression. Cell, 1992. 69(3): p. 439-56. 231. Shinohara, A. and T. Ogawa, Homologous recombination and the roles of double-strand breaks. Trends Biochem Sci, 1995. 20(10): p. 387-91. 232. Sung, P., Catalysis of ATP-dependent homologous DNA pairing and strand exchange by yeast RAD51 protein. Science, 1994. 265(5176): p. 1241-3. 233. Ogawa, T., et al., Similarity of the yeast RAD51 filament to the bacterial RecA filament. Science, 1993. 259(5103): p. 1896-9. 234. Aihara, H., et al., The N-terminal domain of the human Rad51 protein binds DNA: structure and a DNA binding surface as revealed by NMR. J Mol Biol, 1999. 290(2): p. 495-504. 235. Fong, V., et al., Adenoviral vector driven by a minimal Rad51 promoter is selective for p53-deficient tumor cells. PLoS One, 2011. 6(12): p. e28714. 236. Lord, C.J. and A. Ashworth, RAD51, BRCA2 and DNA repair: a partial resolution. Nat Struct Mol Biol, 2007. 14(6): p. 461-2. 237. Buisson, R. and J.Y. Masson, PALB2 self-interaction controls homologous recombination. Nucleic Acids Res, 2012. 40(20): p. 10312-23. 238. Krejci, L., et al., Interaction with Rad51 is indispensable for recombination mediator function of Rad52. J Biol Chem, 2002. 277(42): p. 40132-41. 239. Masson, J.Y., et al., Complex formation by the human RAD51C and XRCC3 recombination repair proteins. Proc Natl Acad Sci U S A, 2001. 98(15): p. 8440-6. 240. Lim, D.S. and P. Hasty, A mutation in mouse rad51 results in an early embryonic lethal that is suppressed by a mutation in p53. Mol Cell Biol, 1996. 16(12): p. 7133-43. 241. Story, R.M., I.T. Weber, and T.A. Steitz, The structure of the E. coli recA protein monomer and polymer. Nature, 1992. 355(6358): p. 318-25. 242. Conway, A.B., et al., Crystal structure of a Rad51 filament. Nat Struct Mol Biol, 2004. 11(8): p. 791-6. 243. Benson, F.E., A. Stasiak, and S.C. West, Purification and characterization of the human Rad51 protein, an analogue of E. coli RecA. EMBO J, 1994. 13(23): p. 5764-71. 244. Reymer, A., et al., Structure of human Rad51 protein filament from molecular modeling and site-specific linear dichroism spectroscopy. Proc Natl Acad Sci U S A, 2009. 106(32): p. 13248-53.

202

245. Yamamoto, A., et al., Cell cycle-dependent expression of the mouse Rad51 gene in proliferating cells. Mol Gen Genet, 1996. 251(1): p. 1-12. 246. Ren, B., et al., E2F integrates cell cycle progression with DNA repair, replication, and G(2)/M checkpoints. Genes Dev, 2002. 16(2): p. 245-56. 247. van Harn, T., et al., Loss of Rb proteins causes genomic instability in the absence of mitogenic signaling. Genes Dev, 2010. 24(13): p. 1377-88. 248. Arias-Lopez, C., et al., p53 modulates homologous recombination by transcriptional regulation of the RAD51 gene. EMBO Rep, 2006. 7(2): p. 219-24. 249. Lazaro-Trueba, I., C. Arias, and A. Silva, Double bolt regulation of Rad51 by p53: a role for transcriptional repression. Cell Cycle, 2006. 5(10): p. 1062-5. 250. Bertrand, P., et al., Increase of spontaneous intrachromosomal homologous recombination in mammalian cells expressing a mutant p53 protein. Oncogene, 1997. 14(9): p. 1117-22. 251. Akyuz, N., et al., DNA substrate dependence of p53-mediated regulation of double- strand break repair. Mol Cell Biol, 2002. 22(17): p. 6306-17. 252. Sonoda, E., et al., Rad51-deficient vertebrate cells accumulate chromosomal breaks prior to cell death. EMBO J, 1998. 17(2): p. 598-608. 253. Hannay, J.A., et al., Rad51 overexpression contributes to chemoresistance in human soft tissue sarcoma cells: a role for p53/activator protein 2 transcriptional regulation. Mol Cancer Ther, 2007. 6(5): p. 1650-60. 254. Kujjo, L.L., et al., RAD51 plays a crucial role in halting cell death program induced by ionizing radiation in bovine oocytes. Biol Reprod, 2012. 86(3): p. 76. 255. Lin, Z., et al., Origins and evolution of the recA/RAD51 gene family: evidence for ancient gene duplication and endosymbiotic gene transfer. Proc Natl Acad Sci U S A, 2006. 103(27): p. 10328-33. 256. Miller, K.A., et al., Domain mapping of the Rad51 paralog protein complexes. Nucleic Acids Res, 2004. 32(1): p. 169-78. 257. Chun, J., E.S. Buechelmaier, and S.N. Powell, Rad51 paralog complexes BCDX2 and CX3 act at different stages in the BRCA1-BRCA2-dependent homologous recombination pathway. Mol Cell Biol, 2013. 33(2): p. 387-95. 258. Kurumizaka, H., et al., Homologous-pairing activity of the human DNA-repair proteins Xrcc3.Rad51C. Proc Natl Acad Sci U S A, 2001. 98(10): p. 5538-43. 259. Henry-Mowatt, J., et al., XRCC3 and Rad51 modulate replication fork progression on damaged vertebrate chromosomes. Mol Cell, 2003. 11(4): p. 1109-17. 260. Haaf, T., et al., Sequestration of mammalian Rad51-recombination protein into micronuclei. J Cell Biol, 1999. 144(1): p. 11-20. 261. Cohen, Y., M. Dardalhon, and D. Averbeck, Homologous recombination is essential for RAD51 up-regulation in Saccharomyces cerevisiae following DNA crosslinking damage. Nucleic Acids Res, 2002. 30(5): p. 1224-32. 262. Bindra, R.S., et al., Down-regulation of Rad51 and decreased homologous recombination in hypoxic cancer cells. Mol Cell Biol, 2004. 24(19): p. 8504-18. 263. Wenemoser, D., et al., A molecular wound response program associated with regeneration initiation in planarians. Genes Dev, 2012. 26(9): p. 988-1002. 264. Rouhana, L., et al., RNA interference by feeding in vitro-synthesized double-stranded RNA to planarians: methodology and dynamics. Dev Dyn, 2013. 242(6): p. 718-30.

203

265. Cavanagh, B.L., et al., Thymidine analogues for tracking DNA synthesis. Molecules, 2011. 16(9): p. 7980-93. 266. Cowles, M.W., A. Hubert, and R.M. Zayas, A Lissencephaly-1 homologue is essential for mitotic progression in the planarian Schmidtea mediterranea. Dev Dyn, 2012. 241(5): p. 901-10. 267. Surova, O. and B. Zhivotovsky, Various modes of cell death induced by DNA damage. Oncogene, 2013. 32(33): p. 3789-97. 268. Collins, A.R., The comet assay for DNA damage and repair: principles, applications, and limitations. Mol Biotechnol, 2004. 26(3): p. 249-61. 269. Auerbach, R. and W. Auerbach, Regional differences in the growth of normal and neoplastic cells. Science, 1982. 215(4529): p. 127-34. 270. Bai, F., et al., p19Ink4d Is a Tumor Suppressor and Controls Pituitary Anterior Lobe Cell Proliferation. Mol Cell Biol, 2014. 34(12): p. 2121-34. 271. Murga, M., et al., A mouse model of ATR-Seckel shows embryonic replicative stress and accelerated aging. Nat Genet, 2009. 41(8): p. 891-8. 272. Stuckey, D.W., et al., Coordination of cell proliferation and anterior-posterior axis establishment in the mouse embryo. Development, 2011. 138(8): p. 1521-30. 273. Gurley, K.A., J.C. Rink, and A. Sanchez Alvarado, Beta-catenin defines head versus tail identity during planarian regeneration and homeostasis. Science, 2008. 319(5861): p. 323-7. 274. Iglesias, M., et al., Early planarian brain regeneration is independent of blastema polarity mediated by the Wnt/beta-catenin pathway. Dev Biol, 2011. 358(1): p. 68-78. 275. Chen, H., et al., The mTOR inhibitor rapamycin suppresses DNA double-strand break repair. Radiat Res, 2011. 175(2): p. 214-24. 276. Saunus, J.M., et al., Posttranscriptional regulation of the breast cancer susceptibility gene BRCA1 by the RNA binding protein HuR. Cancer Res, 2008. 68(22): p. 9469-78. 277. Pal, T., et al., BRCA1 and BRCA2 mutations account for a large proportion of ovarian carcinoma cases. Cancer, 2005. 104(12): p. 2807-16. 278. Chen, S. and G. Parmigiani, Meta-analysis of BRCA1 and BRCA2 penetrance. J Clin Oncol, 2007. 25(11): p. 1329-33. 279. Hall, J.M., et al., Closing in on a breast cancer gene on chromosome 17q. Am J Hum Genet, 1992. 50(6): p. 1235-42. 280. Wooster, R., et al., Localization of a breast cancer susceptibility gene, BRCA2, to chromosome 13q12-13. Science, 1994. 265(5181): p. 2088-90. 281. Evers, B. and J. Jonkers, Mouse models of BRCA1 and BRCA2 deficiency: past lessons, current understanding and future prospects. Oncogene, 2006. 25(43): p. 5885-97. 282. Jonkers, J. and A. Berns, Conditional mouse models of sporadic cancer. Nat Rev Cancer, 2002. 2(4): p. 251-65. 283. Zou, Y., et al., Functions of human replication protein A (RPA): from DNA replication to DNA damage and stress responses. J Cell Physiol, 2006. 208(2): p. 267-73. 284. Wold, M.S. and T. Kelly, Purification and characterization of replication protein A, a cellular protein required for in vitro replication of simian virus 40 DNA. Proc Natl Acad Sci U S A, 1988. 85(8): p. 2523-7. 285. Glanzer, J.G., et al., RPA Inhibition Increases Replication Stress and Suppresses Tumor Growth. Cancer Res, 2014.

204

286. Hass, C.S., L. Gakhar, and M.S. Wold, Functional characterization of a cancer causing mutation in human replication protein A. Mol Cancer Res, 2010. 8(7): p. 1017-26. 287. Huen, M.S., S.M. Sy, and J. Chen, BRCA1 and its toolbox for the maintenance of genome integrity. Nat Rev Mol Cell Biol, 2010. 11(2): p. 138-48. 288. Yu, X., et al., The C-terminal (BRCT) domains of BRCA1 interact in vivo with CtIP, a protein implicated in the CtBP pathway of transcriptional repression. J Biol Chem, 1998. 273(39): p. 25388-92. 289. Orelli, B.J., J.M. Logsdon Jr, Jr., and D.K. Bishop, Nine novel conserved motifs in BRCA1 identified by the chicken orthologue. Oncogene, 2001. 20(32): p. 4433-8. 290. Tavtigian, S.V., et al., The complete BRCA2 gene and mutations in chromosome 13q- linked kindreds. Nat Genet, 1996. 12(3): p. 333-7. 291. Sharan, S.K. and A. Bradley, Murine Brca2: sequence, map position, and expression pattern. Genomics, 1997. 40(2): p. 234-41. 292. Chen, P.L., et al., The BRC repeats in BRCA2 are critical for RAD51 binding and resistance to methyl methanesulfonate treatment. Proc Natl Acad Sci U S A, 1998. 95(9): p. 5287- 92. 293. Carreira, A. and S.C. Kowalczykowski, Two classes of BRC repeats in BRCA2 promote RAD51 nucleoprotein filament function by distinct mechanisms. Proc Natl Acad Sci U S A, 2011. 108(26): p. 10448-53. 294. Scully, R., et al., Association of BRCA1 with Rad51 in mitotic and meiotic cells. Cell, 1997. 88(2): p. 265-75. 295. Yao, J. and K. Polyak, EMSY links breast cancer gene 2 to the 'Royal Family'. Breast Cancer Res, 2004. 6(5): p. 201-3. 296. Morimatsu, M., G. Donoho, and P. Hasty, Cells deleted for Brca2 COOH terminus exhibit hypersensitivity to gamma-radiation and premature senescence. Cancer Res, 1998. 58(15): p. 3441-7. 297. Ludwig, T., et al., Targeted mutations of breast cancer susceptibility gene homologs in mice: lethal phenotypes of Brca1, Brca2, Brca1/Brca2, Brca1/p53, and Brca2/p53 nullizygous embryos. Genes Dev, 1997. 11(10): p. 1226-41. 298. Yuan, S.S., et al., BRCA2 is required for ionizing radiation-induced assembly of Rad51 complex in vivo. Cancer Res, 1999. 59(15): p. 3547-51. 299. Rajan, J.V., et al., Brca2 is coordinately regulated with Brca1 during proliferation and differentiation in mammary epithelial cells. Proc Natl Acad Sci U S A, 1996. 93(23): p. 13078-83. 300. Tutt, A., et al., Absence of Brca2 causes genome instability by chromosome breakage and loss associated with centrosome amplification. Curr Biol, 1999. 9(19): p. 1107-10. 301. Yu, V.P., et al., Gross chromosomal rearrangements and genetic exchange between nonhomologous chromosomes following BRCA2 inactivation. Genes Dev, 2000. 14(11): p. 1400-6. 302. Blackshear, P.E., et al., Brca1 and Brca2 expression patterns in mitotic and meiotic cells of mice. Oncogene, 1998. 16(1): p. 61-8. 303. Chen, J., et al., Stable interaction between the products of the BRCA1 and BRCA2 tumor suppressor genes in mitotic and meiotic cells. Mol Cell, 1998. 2(3): p. 317-28. 304. Connor, F., et al., Tumorigenesis and a DNA repair defect in mice with a truncating Brca2 mutation. Nat Genet, 1997. 17(4): p. 423-30. 305. Patel, K.J., et al., Involvement of Brca2 in DNA repair. Mol Cell, 1998. 1(3): p. 347-57.

205

306. Yang, H., et al., The BRCA2 homologue Brh2 nucleates RAD51 filament formation at a dsDNA-ssDNA junction. Nature, 2005. 433(7026): p. 653-7. 307. Mazloum, N., Q. Zhou, and W.K. Holloman, D-loop formation by Brh2 protein of Ustilago maydis. Proc Natl Acad Sci U S A, 2008. 105(2): p. 524-9. 308. Jasin, M., Homologous repair of DNA damage and tumorigenesis: the BRCA connection. Oncogene, 2002. 21(58): p. 8981-93. 309. Chodosh, L.A., Expression of BRCA1 and BRCA2 in normal and neoplastic cells. J Mammary Gland Biol Neoplasia, 1998. 3(4): p. 389-402. 310. Monteiro, A.N., BRCA1: exploring the links to transcription. Trends Biochem Sci, 2000. 25(10): p. 469-74. 311. Irminger-Finger, I., B.D. Siegel, and W.C. Leung, The functions of breast cancer susceptibility gene 1 (BRCA1) product and its associated proteins. Biol Chem, 1999. 380(2): p. 117-28. 312. Welcsh, P.L., K.N. Owens, and M.C. King, Insights into the functions of BRCA1 and BRCA2. Trends Genet, 2000. 16(2): p. 69-74. 313. Welcsh, P.L. and M.C. King, BRCA1 and BRCA2 and the genetics of breast and ovarian cancer. Hum Mol Genet, 2001. 10(7): p. 705-13. 314. Brugarolas, J. and T. Jacks, Double indemnity: p53, BRCA and cancer. p53 mutation partially rescues developmental arrest in Brca1 and Brca2 null mice, suggesting a role for familial breast cancer genes in DNA damage repair. Nat Med, 1997. 3(7): p. 721-2. 315. Marmorstein, L.Y., T. Ouchi, and S.A. Aaronson, The BRCA2 gene product functionally interacts with p53 and RAD51. Proc Natl Acad Sci U S A, 1998. 95(23): p. 13869-74. 316. Jonkers, J., et al., Synergistic tumor suppressor activity of BRCA2 and p53 in a conditional mouse model for breast cancer. Nat Genet, 2001. 29(4): p. 418-25. 317. Tian, X.X., et al., BRCA2 suppresses cell proliferation via stabilizing MAGE-D1. Cancer Res, 2005. 65(11): p. 4747-53. 318. Venkitaraman, A.R., Cancer suppression by the chromosome custodians, BRCA1 and BRCA2. Science, 2014. 343(6178): p. 1470-5. 319. Shamma, A., et al., Rb Regulates DNA damage response and cellular senescence through E2F-dependent suppression of N-ras isoprenylation. Cancer Cell, 2009. 15(4): p. 255-69. 320. Lane, D.P., Cancer. p53, guardian of the genome. Nature, 1992. 358(6381): p. 15-6. 321. Collavin, L., A. Lunardi, and G. Del Sal, p53-family proteins and their regulators: hubs and spokes in tumor suppression. Cell Death Differ, 2010. 17(6): p. 901-11. 322. Vousden, K.H. and X. Lu, Live or let die: the cell's response to p53. Nat Rev Cancer, 2002. 2(8): p. 594-604. 323. Levine, A.J., p53, the cellular gatekeeper for growth and division. Cell, 1997. 88(3): p. 323-31. 324. Vispe, S., et al., Overexpression of Rad51 protein stimulates homologous recombination and increases resistance of mammalian cells to ionizing radiation. Nucleic Acids Res, 1998. 26(12): p. 2859-64. 325. Bertrand, P., Y. Saintigny, and B.S. Lopez, p53's double life: transactivation-independent repression of homologous recombination. Trends Genet, 2004. 20(6): p. 235-43. 326. Sengupta, S. and C.C. Harris, p53: traffic cop at the crossroads of DNA repair and recombination. Nat Rev Mol Cell Biol, 2005. 6(1): p. 44-55.

206

327. Shu, Z., et al., Disruption of muREC2/RAD51L1 in mice results in early embryonic lethality which can Be partially rescued in a p53(-/-) background. Mol Cell Biol, 1999. 19(12): p. 8686-93. 328. Shieh, S.Y., et al., DNA damage-induced phosphorylation of p53 alleviates inhibition by MDM2. Cell, 1997. 91(3): p. 325-34. 329. Dahm-Daphi, J., et al., Nonhomologous end-joining of site-specific but not of radiation- induced DNA double-strand breaks is reduced in the presence of wild-type p53. Oncogene, 2005. 24(10): p. 1663-72. 330. Friend, S.H., et al., A human DNA segment with properties of the gene that predisposes to retinoblastoma and osteosarcoma. Nature, 1986. 323(6089): p. 643-6. 331. Pan, H., et al., Key roles for E2F1 in signaling p53-dependent apoptosis and in cell division within developing tumors. Mol Cell, 1998. 2(3): p. 283-92. 332. Macleod, K.F., Y. Hu, and T. Jacks, Loss of Rb activates both p53-dependent and independent cell death pathways in the developing mouse nervous system. EMBO J, 1996. 15(22): p. 6178-88. 333. Kuilman, T., et al., The essence of senescence. Genes Dev, 2010. 24(22): p. 2463-79. 334. Rajaraman, R., et al., Stem cells, senescence, neosis and self-renewal in cancer. Cancer Cell Int, 2006. 6: p. 25. 335. Mirzayans, R., et al., New insights into p53 signaling and cancer cell response to DNA damage: implications for cancer therapy. J Biomed Biotechnol, 2012. 2012: p. 170325. 336. Suzuki, K., et al., Radiation-induced senescence-like growth arrest requires TP53 function but not telomere shortening. Radiat Res, 2001. 155(1 Pt 2): p. 248-253. 337. Ghosh, J.C., et al., Dose-dependent biphasic accumulation of TP53 protein in normal human embryo cells after X irradiation. Radiat Res, 2000. 153(3): p. 305-11. 338. Yen, A., et al., Coupled down-regulation of the RB retinoblastoma and c-myc genes antecedes cell differentiation: possible role of RB as a "status quo" gene. Eur J Cell Biol, 1992. 57(2): p. 210-21. 339. Itahana, K., G. Dimri, and J. Campisi, Regulation of cellular senescence by p53. Eur J Biochem, 2001. 268(10): p. 2784-91. 340. Giacinti, C. and A. Giordano, RB and cell cycle progression. Oncogene, 2006. 25(38): p. 5220-7. 341. Lieber, M.R., et al., Mechanism and regulation of human non-homologous DNA end- joining. Nat Rev Mol Cell Biol, 2003. 4(9): p. 712-20. 342. de Koning, A.P., et al., Repetitive elements may comprise over two-thirds of the human genome. PLoS Genet, 2011. 7(12): p. e1002384. 343. Mimori, T., et al., Characterization of a high molecular weight acidic nuclear protein recognized by autoantibodies in sera from patients with polymyositis-scleroderma overlap. J Clin Invest, 1981. 68(3): p. 611-20. 344. Walker, J.R., R.A. Corpina, and J. Goldberg, Structure of the Ku heterodimer bound to DNA and its implications for double-strand break repair. Nature, 2001. 412(6847): p. 607-14. 345. Aravind, L. and E.V. Koonin, SAP - a putative DNA-binding motif involved in chromosomal organization. Trends Biochem Sci, 2000. 25(3): p. 112-4. 346. Rivera-Calzada, A., et al., Structural model of full-length human Ku70-Ku80 heterodimer and its recognition of DNA and DNA-PKcs. EMBO Rep, 2007. 8(1): p. 56-62.

207

347. Gell, D. and S.P. Jackson, Mapping of protein-protein interactions within the DNA- dependent protein kinase complex. Nucleic Acids Res, 1999. 27(17): p. 3494-502. 348. Downs, J.A. and S.P. Jackson, A means to a DNA end: the many roles of Ku. Nat Rev Mol Cell Biol, 2004. 5(5): p. 367-78. 349. Yan, C.T., et al., IgH class switching and translocations use a robust non-classical end- joining pathway. Nature, 2007. 449(7161): p. 478-82. 350. Bennardo, N., et al., Alternative-NHEJ is a mechanistically distinct pathway of mammalian chromosome break repair. PLoS Genet, 2008. 4(6): p. e1000110. 351. Subramanian, C., et al., Ku70 acetylation mediates neuroblastoma cell death induced by histone deacetylase inhibitors. Proc Natl Acad Sci U S A, 2005. 102(13): p. 4842-7. 352. Wang, B., et al., Role of Ku70 in deubiquitination of Mcl-1 and suppression of apoptosis. Cell Death Differ, 2014. 21(7): p. 1160-9. 353. Ren, F., et al., DNA-PKcs and Ku70 are Predictive Markers for Poor Prognosis of Patients With Gall Bladder Malignancies. Appl Immunohistochem Mol Morphol, 2014. 354. Smider, V. and G. Chu, The end-joining reaction in V(D)J recombination. Semin Immunol, 1997. 9(3): p. 189-97. 355. Nussenzweig, A., et al., Requirement for Ku80 in growth and immunoglobulin V(D)J recombination. Nature, 1996. 382(6591): p. 551-5. 356. Schatz, D.G., V(D)J recombination moves in vitro. Semin Immunol, 1997. 9(3): p. 149-59. 357. Gu, Y., et al., Growth retardation and leaky SCID phenotype of Ku70-deficient mice. Immunity, 1997. 7(5): p. 653-65. 358. Faure, V., et al., Ku70 prevents genome instability resulting from heterozygosity of the telomerase RNA component in a vertebrate tumour line. DNA Repair (Amst), 2008. 7(5): p. 713-24. 359. Verdun, R.E. and J. Karlseder, The DNA damage machinery and homologous recombination pathway act consecutively to protect human telomeres. Cell, 2006. 127(4): p. 709-20.

208

Short Report 1657 TOR signaling regulates planarian stem cells and controls localized and organismal growth

T. Harshani Peiris1,2, Frank Weckerle1, Elyse Ozamoto1, Daniel Ramirez1, Devon Davidian1, Marcos E. Garcı´a-Ojeda1 and Ne´stor J. Oviedo1,* 1Department of Molecular and Cell Biology, School of Natural Sciences, University of California at Merced, 5200 North Lake Road, Merced, CA 95343, USA 2Quantitative and System Biology, Graduate Program University of California at Merced, 5200 North Lake Road, Merced, CA 95343, USA *Author for correspondence ([email protected])

Accepted 13 February 2012 Journal of Cell Science 125, 1657–1665 ß 2012. Published by The Company of Biologists Ltd doi: 10.1242/jcs.104711

Summary Target of Rapamycin (TOR) controls an evolutionarily conserved signaling pathway that modulates cellular growth and division by sensing levels of nutrients, energy and stress. As such, TOR signaling is a crucial component of tissues and organs that translates systemic signals into cellular behavior. The ubiquitous nature of TOR signaling, together with the difficulty of analyzing tissue during cellular turnover and repair, have limited our understanding of how this kinase operates throughout the body. Here, we use the planarian model system to address TOR regulation at the organismal level. The planarian TOR homolog (Smed-TOR) is ubiquitously expressed, including stem cells (neoblasts) and differentiated tissues. Inhibition of TOR with RNA interference severely restricts cell proliferation, allowing the study of neoblasts with restricted proliferative capacity during regeneration and systemic cell turnover. Strikingly, TOR signaling is required for neoblast response to amputation and localized growth (blastema). However, in the absence of TOR signaling, regeneration takes place only within differentiated tissues. In addition, TOR is essential for maintaining the balance between cell division and cell death, and its dysfunction leads to tissue degeneration and lack of organismal growth in the presence of nutrients. Finally, TOR function is likely to be mediated through TOR Complex 1 as its disruption recapitulates signs of the TOR phenotype. Our data reveal novel roles for TOR signaling in controlling adult stem cells at a systemic level and suggest a new paradigm for studying TOR function during physiological turnover and regeneration.

Key words: Regeneration, Stem cells, Planarian, TOR Journal of Cell Science

Introduction remarkable evolutionary conservation of signaling pathways, Target of Rapamycin (TOR) is an evolutionarily conserved and well-characterized regenerative ability (Reddien and Sa´nchez kinase that modulates cell division and growth in response to Alvarado, 2004; Gentile et al., 2011). energy and nutrient levels (Wullschleger et al., 2006; Russell We report the identification of a TOR homolog ubiquitously et al., 2011; Zoncu et al., 2011). TOR functions as an endogenous expressed in S. mediterranea (Smed-TOR, abbreviated to TOR). sensor that directs the behavior of cells across different tissues. RNA interference (RNAi) of TOR disrupts neoblast behavior at Dysfunctional TOR signaling has been implicated in a range of the systemic level. Furthermore, TOR signaling is an essential systemic complications, including cancer, degenerative disease component of the neoblast response to damage and tissue and aging (Wullschleger et al., 2006; Zoncu et al., 2011). Studies turnover. Strikingly, amputated TOR(RNAi) animals regenerate in vertebrate and invertebrate models revealed TOR as a crucial nervous system tissue within the pre-existing tissue. TOR is stem cell regulator, but the mechanism by which this pathway crucial for maintaining the balance between cell division and controls cellular behavior across the adult body remains poorly cell death, which is fundamental during adult tissue turnover. understood (Oldham et al., 2000; Murakami et al., 2004; LaFever Additional analysis using RNAi suggests that TOR phenotype is et al., 2010; Russell et al., 2011). This limitation is twofold: mediated by TOR complex-1 (TORC1). Taken together, we (1) TOR inactivation results in embryonic lethality in both propose the use of S. mediterranea as a powerful model system vertebrates and invertebrates, making the study of its roles in that could be used to provide insights into the roles TOR adults more challenging, and (2) the ubiquitous nature of TOR signaling plays at the organismal level during systemic tissue signaling, together with the difficulty of analyzing tissue turnover turnover and regeneration. in vivo, restricts our ability to dissect TOR regulation at the systemic level (Russell et al., 2011; Zoncu et al., 2011). Results and Discussion The adult planarian Schmidtea mediterranea is an excellent A TOR homolog exists in S. mediterranea and is expressed model organism with which to address roles of TOR in regulating in stem cells and differentiated tissues cell behavior at an organismal level. Planarians possess an TOR is a highly conserved protein kinase among eukaryotes. We abundant and accessible somatic stem cell population (neoblasts) identified a single TOR member in the S. mediterranea genome that maintain differentiated tissues throughout the body, (Smed-TOR, abbreviated to TOR) with unique signature domains 1658 Journal of Cell Science 125 (7)

(supplementary material Fig. S1). Whole-mount in situ the expression (Fig. 1B,C). To characterize further the cell types hybridization (ISH) showed TOR expression to be widely expressing TOR, ISH experiments were carried out on cells distributed throughout the planarian body except the pharyngeal isolated by fluorescence-activated cell sorting (FACS) (Fig. 1D– area (Fig. 1A). Experiments with TOR sense and antisense probes G). These experiments revealed that TOR expression is present in on TOR(RNAi) animals (see below) confirmed the specificity of the majority of proliferative neoblasts (X1 cells), in their Journal of Cell Science

Fig. 1. See next page for legend. TOR regulates neoblasts 1659

postmitotic progeny (X2), and in differentiated cells (Xins). the only proliferative cell in S. mediterranea and it can be Furthermore, double-staining ISH determined that a large identified by staining with an anti-phosphorylated histone-3 proportion of proliferative neoblasts co-express both smedwi-1 (H3P) antibody, which labels mitotic neoblasts (Newmark and TOR (89.2%67.5 and 82.7611.7, respectively) (Fig. 1G). and Sańchez Alvarado, 2000). The mitotic activity in the Altogether, these experiments demonstrate that TOR is widely whole organism was markedly reduced (50%) three weeks expressed in neoblasts and differentiated tissues, which is after TOR(RNAi) (Student’s t-test, P,0.0001), but had not consistent with TOR expression in other organisms (Oldham disappeared by 40 days after the first dsRNA injection et al., 2000; Makky et al., 2007). (Fig. 1H,I). These results indicate that some neoblasts continue to divide even after downregulation of TOR signaling, suggesting Systemic inhibition of TOR restricts neoblast proliferation that neoblast proliferation is not entirely dependent on TOR To assess the role TOR plays in homeostasis, we designed and signaling. This finding is consistent with the reduction in cell optimized a double-stranded RNA (dsRNA) microinjection protocol proliferation observed after TOR inhibition in some mammalian [TOR(RNAi)] that consistently downregulates TOR expression tissues (Feldman et al., 2009; Shor et al., 2009; Thoreen et al., throughout the body (Fig. 1C; supplementary material Fig. S2). 2009). Because mitotic cells account for only a limited The RNAi protocol was optimized until it achieved reproducible population of neoblasts, we sought to expand this analysis by maximum abrogation (Fig. 1C; supplementary material Fig. S2) in including markers that label proliferative, early and late order to reduce the possibility of a TOR partial downregulation. postmitotic progeny of neoblast (smedwi-1, Smed-NB.21.11e Following TOR(RNAi),animals(n.30) displayed slower and Smed-AGAT-1, respectively) (Eisenhoffer et al., 2008). phototactic responses but no lethality 30 days after the first Similar to mitotic cells, a substantial reduction in expression of injection. These data suggest that TOR is not required for short-term proliferative neoblast (82.12%) and early (87.09%) and late tissue turnover. Under these conditions, strong downregulation of (46.60%) postmitotic progeny was sustained over a month after TOR gene expression could be achieved in less than a week, but dsRNA injection (Fig. 1J–K). Intriguingly, despite this systemic stable effects on neoblasts were detectable ,3 weeks after the first reduction in cell proliferation, animals survived for .50 days dsRNA injection (see below). This suggests that abnormalities in with undetectable TOR expression, suggesting that the remaining neoblasts were probably associated with lack of functional TOR neoblasts probably contribute to cellular turnover. protein, and that it takes ,20 days under this RNAi strategy to The effects of TOR(RNAi) on the cell cycle were examined abolish TOR function in the whole adult worm. Although additional further using flow cytometry by staining nuclei of dissociated experiments are needed to test for TOR-protein activity, the cells with DAPI (Fig. 1L). Cell cycle analyses confirmed that timelines reported here are consistent with the turnover rate downregulation of TOR greatly reduces neoblast proliferation reported for other planarian proteins (Guo et al., 2006; (,50%), which is consistent with their mitotic activity as well as Wenemoser and Reddien, 2010). the expression of neoblast markers and their progeny (Fig. 1H– To understand the effects of TOR deficiency better, we K). From these experiments, we concluded that the RNAi analyzed neoblast response to cellular turnover. The neoblast is strategy applied to abrogate TOR function consistently affects cell cycle dynamics in the neoblast population. Although the Journal of Cell Science Fig. 1. TOR is expressed ubiquitously and RNA-interference reduces reasons for this systemic reduction in cell proliferation are not mitotic activity and expression of neoblast markers. (A–C) Whole-mount necessarily clear, it might involve slowing of G1 progression (see ISH with antisense TOR probe shows widespread distribution of TOR increase in the number of cells in G1 and the decrease in G2/M, expression (A). Lack of signal with sense TOR probe and antisense Fig. 1L) as has been noted in other models with dysfunctional TOR(RNAi) probe (B–C) demonstrates signal specificity. (D) FACS plot TOR signaling (Pedersen et al., 1997; Feldman et al., 2009; shows gates used to isolate irradiation sensitive (X1 and X2) and insensitive (Xins) populations based on viability and the DNA content. (E) Bar graph Garcıá-Martıńez et al., 2009; Shor et al., 2009; Thoreen et al., shows TOR-expressing cells are present among neoblasts and differentiated 2009). Taken together, induction of TOR deficiency with RNAi tissues (X1, n5287; X2, n5169; Xins, n5380). No statistical difference is in planarians provides a simplified model for studying its observed between these groups. (F) Proliferative neoblast expressing TOR functions within the complexity of the whole adult organism. (green). DAPI, blue. (G) Double staining with smedwi-1 and TOR fluorescent These analyses indicate that TOR regulates neoblast probes on proliferative cells. The majority of cells co-express both genes. proliferation during systemic cell turnover. The reasons for the Arrowheads indicate positive signal for each probe. (H,I) Whole-mount reduction in proliferative neoblasts and their progeny after TOR- immunostaining with anti-H3P antibody (H) and quantification of mitoses RNAi is not entirely clear, but two possible scenarios could be (I) demonstrates reduction in mitotic activity in TOR(RNAi) animals (Student’s t-test, **P,0.01). Three independent experiments, n.12 animals. suggested: (1) TOR inhibition produces a uniform effect on all (J,K) TOR(RNAi) reduces the expression of the neoblast-associated genes neoblasts that leads to a gradual decline in their proliferative smedwi-1 (82.12%, proliferative), NB.21.11 (87.09%, early progeny) and capacity, and (2) TOR has distinct roles in stem cells along the Smed-AGAT-1 (46.60%, late progeny), which is not necessarily linear with a planarian body, implying that a subset of neoblasts requires this reduction in the number of cells. Student’s t-test, ***P,0.001. qRT-PCR signaling pathway for proliferation whereas some other neoblasts analyses are from triplicated experiments; values represent average and error divide independently of TOR. The complexity of the neoblast bars s.d. Gene expressions are relative to the ubiquitously expressed clone population is not well understood, but recent evidence supports H.55.12e (Reddien et al., 2005). Whole-mount in situ hybridization consisted the notion that intrinsic differences exist among neoblasts of three independent experiments with n.9 animals. Scale bars: 200 mm (Wagner et al., 2011). TOR inhibition does not produce a (A–D) and 12.5 mm in dissociated cells (G). (L) Cell cycle analysis with DAPI indicates neoblasts progression to cell cycle is impaired after uniform cellular response along the mammalian body (Russell TOR(RNAi), Student’s t-test G1 phase (P,0.01), G2/M phase (P,0.05), S et al., 2011), indicating that additional analyses of this phenotype phase (P,0.05). One representative experiment (mean 6 s.d.) of three in planarians might shed some light on the systemic regulation of is shown. TOR in adult tissues. 1660 Journal of Cell Science 125 (7)

TOR signaling is required for blastema formation but characteristic photoreceptor pigmentation close to the anterior regeneration is accomplished within pre-existing tissues wound. A closer evaluation with nervous system markers To investigate the roles of TOR in planarian regeneration, the revealed an unexpected result: nervous system structures (e.g. response to amputation was evaluated in worms subjected to brain, visual neurons) removed during amputation were to some TOR(RNAi). Upon amputation, neoblasts proliferate to form a extent regenerated in TOR-RNAi animals, but within pre-existing specialized structure called the regenerating blastema, which is tissue (Fig. 2C). These observations indicate that, despite the the new tissue from which missing structures are regenerated absence of blastema formation, regeneration in TOR-RNAi (Reddien and Sa´nchez Alvarado, 2004; Gentile et al., 2011). fragments is not completely suppressed, revealing an intriguing After two rounds of amputation, controls (water injected, n.40) process of regeneration in which nervous tissue is regenerated regenerated both head and tail within a week, whereas TOR- within pre-existing tissue. RNAi-treated fragments failed to form recognizable blastemas Our data suggest that downregulation of TOR signaling (95%; Fig. 2A,B). A similar response was also observed after provides an excellent model for identifying mechanisms of single longitudinal cuts, indicating that this phenotype was not injury-induced stem cell response as it specifically prevents restricted to the number or the type of amputation (supplementary blastema formation but does not completely abrogate material Fig. S3). regeneration. Therefore, we sought to understand better the Although neoblasts continue to proliferate after TOR-RNAi, cellular response to amputation after TOR-RNAi. The initial they were unable to form blastema, indicating that TOR signaling response of neoblasts to amputation involves two waves of is required for blastema formation (Fig. 2A,B). Nonetheless, mitoses that are required for blastema formation (Salo´ and TOR-RNAi fragments without blastemas survived for .40 days Bagun˜a`, 1984; Wenemoser and Reddien, 2010). Although the after the first injection. Surprisingly, these fragments became molecular signals driving these mitotic waves are unknown, it has sensitive to light and responded to other external stimuli, recently been shown that the first mitotic peak is a system-wide suggesting that the sensory system was somewhat functional. neoblast response triggered by mechanical injury. This initial Over time, TOR-RNAi fragments without blastema developed wave peaks as early as 6 hours after wounding. The second

Fig. 2. TOR signaling drives early response of the neoblast to amputation but regeneration occurs in the Journal of Cell Science absence of blastema formation. (A) TOR(RNAi) prevents blastema formation after two rounds of amputation or in cuts 20 days after first injection. Cephalic regeneration is shown (five independent experiments, n.180). Scale bar: 500 mm. (B) TOR(RNAi) restricts local growth of the blastema (n.32 animals). (C) Nervous tissue (arrows) that is normally regenerated within the blastema appears in pre-existing tissue after TOR(RNAi). Central nervous system (CNS, smed-pc2) and visual neurons (anti-arresting antibody), 10 days after decapitation. Although the mechanism by which brain and visual neurons are regenerated after TOR(RNAi) is not necessarily clear, animals sense external stimuli, see text for details (n.15, the animal outline is depicted). Scale bar: 200 mm. (D) In control animals, two burst of mitoses (at 6 and .30 hours) are triggered after amputation (black line) but in TOR(RNAi) only one is observed at 20 hours post- amputation (gray line). The difference in the mitotic response in both groups is statistically significant P51.43e- 09 by two-way-Anova. Each data point represents mean 6 s.e.m. of two independent experiments with n.10 animals. (E,F) Apoptosis takes place in absence of functional TOR signaling. The pattern of apoptotic cells remains close to the wounded area and is abnormally increased. TUNEL-positive nuclei are green. In controls, signal is randomly distributed whereas in TOR(RNAi) apoptotic cells it is increased (sixfold) and accumulated near the cut surfaces (arrows). Scale bar: 200 mm. Student’s t-test, ***P,0.0005. One of two independent experiments (n55 animals) is shown. Red dashed line represents plane of amputation. TOR regulates neoblasts 1661

mitotic peak, however, is an amputation-induced neoblast proliferation (Morgan, 1901). However, after more than a response, localized near the wounded area, and is evident ,48 century, the mechanisms regulating each type of tissue repair hours after injury (Wenemoser and Reddien, 2010). remain largely unknown (Sa´nchez Alvarado, 2000; Brockes and Time course regeneration experiments confirmed the post- Kumar, 2008; Poss, 2010). Our results show that TOR forms part amputation bimodal mitotic waves that lead to blastema of the endogenous signals essential for blastema formation during formation in control fragments (Fig. 2D). However, neoblasts epimorphic regeneration. However, in the absence of functional in TOR-RNAi worms failed to mount the early systemic TOR signaling, part of the nervous system regenerates within mitotic response after amputation (Fig. 2D). Nonetheless, their pre-existing tissues by a process that is not entirely clear. widespread proliferative response gradually increased to peak 20 We speculate that it might involve both epimorphosis and hours after amputation, which typically corresponds to the stage morphallaxis. Nevertheless, it reveals TOR signaling to be a key of neoblast recruitment and the onset of the local response to loss molecular regulator of animal regeneration. of tissue (Wenemoser and Reddien, 2010). These results indicate that neoblasts in TOR-RNAi planarians can sense and divide TOR is essential for organismal growth and long-term following injury but are unable to reach the proliferative levels tissue maintenance but not for remodeling pre-existing required after amputation on time. Whether a second mitotic peak tissue in TOR-RNAi animals occurs 48 hours post-amputation needs to Planarians can increase or decrease their body size according be investigated, but it is unlikely that it affects the process of to metabolic and environmental conditions (Bagun˜a, 1975), blastema formation because the initial decisions are made within ` although the molecular bases of this remarkable tissue plasticity the first 12–24 hours after injury (Oviedo et al., 2010). Additional experiments are also needed to rule out the mechanism by which are unknown. This developmental plasticity in the adult has been neoblasts regenerate missing parts within pre-existing tissues, associated with addition of new cells during growth, and and whether the lack of blastema is associated with an impaired elimination of specific cells during size reduction (de-growth), migratory response to injury within the neoblast progeny. which in both cases help to remodel and adjust body proportions However, we propose that TOR is a crucial component for the accordingly (Oviedo et al., 2003). signals driving the early widespread neoblast response after The TOR pathway is a sensor that responds to signals, such as amputation (i.e. the first mitotic peak). We speculate that the lack nutrient and energy availability, by modulating cell growth and of blastema formation in the absence of TOR signaling could be division (Wullschleger et al., 2006; Russell et al., 2011; Zoncu associated with multiple factors (intrinsic and non-intrinsic) that et al., 2011). To test whether TOR plays a role in planarian combine slow proliferative responses in neoblasts upon injury growth and de-growth, we exposed neoblasts to high or low with an impaired migratory property in their progeny. nutrient levels (i.e. continuous feeding or starvation, respectively) Spatiotemporal synchronization between cell division and cell and recorded changes in organismal size for 40 days. When death is a requirement for animal regeneration (Hwang et al., maintained under low nutrient levels, control and TOR(RNAi) 2004; Tseng et al., 2007; Chera et al., 2009; Pellettieri et al., worms decreased in size at the same rate (Fig. 3A). This indicates 2010). In planarians, two waves of apoptosis remove that tissue remodeling could occur in the absence of functional

Journal of Cell Science differentiated cells after amputation (Pellettieri et al., 2010). TOR, which is consistent with TOR inhibition under low nutrient Significantly, the time period between the apoptotic peaks conditions observed in other organisms (Zoncu et al., 2011). overlaps with the neoblast mitotic response. The first apoptotic Indeed, we found that TOR expression is downregulated during wave precedes neoblast response to injury and is localized near starvation (supplementary material Fig. S4). Conversely, control the wound site. By contrast, the second peak is a systemic cell animals fed once a week displayed a sustained increase in size, death response detectable 48 hours post-injury (Gurley et al., whereas fed TOR(RNAi) animals failed to grow and kept their 2010; Pellettieri et al., 2010). Apoptosis was evaluated in overall size with minimal change for 40 days. Independently of regenerating fragments by the whole-mount TUNEL method the metabolic status (i.e. starving or feeding) the overall cellular (Pellettieri et al., 2010). Control fragments regenerated and size in TOR(RNAi) animals was always smaller than in controls displayed a characteristic apoptotic response pattern similar to (supplementary material Fig. S5), suggesting that, as in other that of an uncut animal (i.e. randomly distributed through the species, the planarian TOR is a key regulator of cell size (Oldham body) 7 days post-amputation (Fig. 2E). By contrast, TOR-RNAi et al., 2000; Fingar et al., 2002; Fumarola et al., 2005; Zhang fragments consistently displayed an increased and localized cell et al., 2011). Altogether, these results indicate that TOR signaling death response closely associated with the wound surface, even is a key molecular component of organismal growth in one week post-injury (Fig. 2E). This apoptotic response planarians. This molecular function of TOR could be important resembled the distribution pattern of the first wave of apoptosis for understanding metabolic plasticity during tissue maintenance seen early during regeneration (Pellettieri et al., 2010). and regeneration as has been long sought after in the planarian Furthermore, amputated TOR(RNAi) worms displayed an literature (Bardeen, 1901; Morgan, 1901). unexpected sixfold increase in TUNEL-positive nuclei after a The fact that fed TOR(RNAi) animals kept their size relatively week post-amputation (Fig. 2F). These results suggest that cell stable over time is consistent with the notion that the remaining death induced by regeneration, at least in late stages, takes place neoblasts to some extent sense nutrients and are capable of independently of TOR signaling. However, the effects of supporting tissue turnover (supplementary material Fig. S6). prolonged apoptosis near the wound are unknown. Therefore, the lack of organismal growth in the presence of In 1901, Thomas Hunt Morgan classified animal regeneration nutrients, together with the inability of neoblasts to contribute to into two broad categories: (1) epimorphosis, which requires cell localized growth after amputation (blastemas, Fig. 2A), suggests proliferation, and (2) morphallaxis, which proceeds through that in the absence of functional TOR, the neoblast response to remodeling of pre-existing tissues and does not entail cellular satisfy body demand is restricted, confirming the role of this 1662 Journal of Cell Science 125 (7)

pathway as a systemic regulator. Additional experiments are have a 2.5-fold increase in TUNEL-positive nuclei, suggesting needed to determine whether these effects are the result of a that cell division and cell death are not balanced in the absence delayed cell cycle transition and/or an altered migratory and of functional TOR (Fig. 3B). These data indicate that TOR differentiation response. signaling regulates systemic cell death in planarians, and we During physiological cell turnover, neoblast division is propose that an imbalance between systemic neoblast division counterbalanced by programmed cell death (Pellettieri et al., and cell death probably restricts organismal growth in planarians 2010). However, we found that uninjured TOR(RNAi) planarians subjected to TOR(RNAi). Journal of Cell Science

Fig. 3. See next page for legend. TOR regulates neoblasts 1663

Continuous neoblast division in uninjured planarians supports (supplementary material Fig. S7). RAPTOR(RNAi) restricts tissue turnover (Newmark and Sańchez Alvarado, 2000). neoblast division and the expression of neoblast markers However, if there is an imbalance between neoblast division (Fig. 3D,E) in a manner consistent with the effects observed and cell death, it might affect long-term tissue maintenance. To after TOR(RNAi) treatment (Fig. 1H–K). test this assumption, the integrity of differentiated tissues was The macrolide rapamycin inhibits TOR function through evaluated using organ-specific markers (Fig. 3C). We found that TORC1 (Wullschleger et al., 2006; Zoncu et al., 2011). We tissue integrity in TOR(RNAi) planarians was compromised in at found that continuous treatment with rapamycin at .60 nM least two ways. First, there was mild loss of tissue (8.7%61.6 considerably reduced neoblast division and the expression of decrease) at the most anterior part, a condition that is known as neoblast associated genes (smedwi-1, NB.21.11e and Smed-Agat-1) head regression and is commonly associated with the inability of in a similar fashion to TOR and RAPTOR(RNAi) (Fig. 3D–E; neoblasts to support tissue turnover (Reddien et al., 2005). supplementary material Fig. S7). This result suggests that TOR Second, the low number of cells expressing the excretory system signaling inhibition can be partially recapitulated by targeting only marker smedinx-10, and the allometric indicator cintillo suggests TORC1. Furthermore, RAPTOR(RNAi) consistently prevented that neoblasts in TOR-RNAi animals cannot support long-term regeneration in a way that is consistent with both the proposed systemic tissue turnover (Fig. 3C). We propose that these results, TOR-protein turnover and the TOR(RNAi) phenotype. Moreover, together with high apoptotic levels (Fig. 3B), might lead to RAPTOR(RNAi) amputated worms responded to light stimuli and the generalized tissue degeneration observed in TOR(RNAi) regenerated visual neurons within pre-existing tissue, resembling planarians. the TOR(RNAi) phenotype (Fig. 3F). Altogether, aspects of the TOR(RNAi) phenotype in planarians can be recapitulated by RAPTOR, a component of the TOR complex-1, modulates targeting RAPTOR with either RNAi or treatment with rapamycin TOR function during tissue homeostasis and regeneration (supplementary material Fig. S7), suggesting that the TOR- TOR is the catalytic subunit of two distinct complexes called deficient phenotype described here is likely to be mediated TOR complex-1 (TORC1) and TORC2 (Wullschleger et al., through TORC1. Additional characterization of up- or downstream 2006; Zoncu et al., 2011). Each complex is defined by an targets, including AKT, 4E-BP and S6K, present in S. accessory protein that is essential for complex assembly: mediterranea will provide insights into TOR regulation in adult regulatory-associated protein of TOR (RAPTOR) for TORC1 tissues. Furthermore, analysis using novel TOR inhibitors targeting and rapamycin-insensitive companion of TOR (RICTOR) for members of the TORC1 and TORC2 complexes (Feldman et al., TORC2 (Zoncu et al., 2011). A homolog sequence for RICTOR 2009; Garcıá-Martıńez et al., 2009; Shor et al., 2009; Thoreen has not been identified in planarians. However, a highly et al., 2009) has the potential to identify new drug targets to control conserved homolog sequence for RAPTOR (Smed-RAPTOR, the behavior of stem cells and to induce tissue-specific hereafter referred to as RAPTOR) was identified and it displayed regeneration. a ubiquitous expression pattern resembling that of pTOR Concluding remarks Taken together, our results reveal that it is possible to perform Journal of Cell Science Fig. 3. TOR is required for organismal growth and long-term tissue analysis of TOR function at the systemic level in adult maintenance, and its functions are mediated through RAPTOR, a organisms. Furthermore, by applying this paradigm we component of TOR Complex-1. (A)InTOR(RNAi) starvation does not affect revealed roles for TOR in controlling adult stem cells during ‘de-growth’ but feeding once a week prevents organismal growth (mean 6 tissue turnover and regeneration (Fig. 3G) that are consistent s.d. of the percent change (D) in surface area, n525 animals/time point); with effects observed in mammals (Russell et al., 2011; Zoncu dispersion of data in the TOR(RNAi) fed animals is low. Difference in surface area considers length and width of the whole organism. (B) Apoptosis is et al., 2011). Mammalian cells do not display a uniform response elevated in intact TOR(RNAi) animals (Student’s t-test, **P,0.005, two to TOR inhibition but studies on planarians could provide independent experiments, n.5). Error bars represent standard deviation. additional opportunities for dissecting complex cell regulation (C) Long-term tissue maintenance is not effectively supported after by this pathway in adult tissues. The phenotype described here TOR(RNAi). In situ hybridization analysis of Smed-PC2 (CNS), cintillo provides simplified grounds by which the systemic effect (chemoreceptors) and smedinx-10 (excretory) in control and TOR(RNAi) resulting from manipulation of ubiquitous signaling pathways worms. About 8.7%61.6 of tissue is lost between the tip of the animal and the could be translated to the complexity of the whole organism. most anterior part of the pigment cups, indicated with arrows in TOR(RNAi) Our results reveal that TOR signaling components are conserved but it did not alter cintillo quantification. Numbers represent chemoreceptors/ mm or cluster of smedinx-10 associated-signal 6 s.d. of three experiments 40 in planarians and that TORC1 probably mediates TOR function days starvation, n.8 animals. Scale bars: 100 mm. Notice the reduction in the during early regenerative response and organismal growth. expression of cintillo and excretory system after TOR(RNAi) (Student’s t-test, These findings could enable studies to further characterize P,0.0001). All experiments were performed in parallel. (D,E) A planarian epimorphic regeneration without blastema formation. This is of RAPTOR homolog (RAPTOR) restricts neoblast division (Student’s t-test, particular interest given that not all regenerative processes P,0.001) (D), the expression of smedwi-1 (proliferative, 79.91%), NB.21.11 involve blastema formation and in some organisms (including (early progeny, 68.73%) and Smed-Agat-1 (late progeny, 49.09%) humans), tissue repair can take place without the formation of (E). Student’s t-test, P,0.001. Scale bar: 200 mm. (F) RAPTOR(RNAi) this specialized structure. Our model provides the opportunity to prevents blastema formation but induces regeneration of nervous structures within pre-existing tissue (arrows). In each case, two or more experiments investigate TOR signaling in the whole organism. As the TOR with n.6 animals. (G) Working model illustrating the possibility of following signaling pathway has been the focus of current anticancer a population of neoblasts that remain proliferating after TOR-RNAi during therapy, inhibition of TOR function in planarians could also tissue maintenance and regeneration. TOR is an essential component for provide unique insights into the consequences of long-term maintaining homeostasis and regeneration. inhibition of this pathway. 1664 Journal of Cell Science 125 (7)

Materials and Methods protocols. We thank Mike Cleary and Sabrina Maisel for comments Identification of homolog and phylogenetic analysis on the manuscript and Ricardo Zayas, Peter Reddien and Kenji Homologs for TOR and Raptor were identified in the S. mediterranea database Watanabe for reagents. SmedDb (Sa´nchez Alvarado et al., 2002). The sequences were further confirmed by Blastn, blastx, blastp and alignment tools (http://blast.ncbi.nlm.nih.gov/Blast. cgi). A combination of heat repeats and FAT domain were used as molecular Funding signature to identify TOR homologs within the S. mediterranea genome (Cantarel T.H.P. was supported by a Jane Vilas Scholarship and the University et al., 2008; Robb et al., 2008). Reciprocal BLAST analysis identified a single of California Merced Graduate Research Council. N.J.O. TOR member that was aligned with TOR sequences of other species by using acknowledges support from the University of California Merced CLUSTALW and T-Coffee software. A predictive evolutionary model was built and the University of California Cancer Research Coordinating using MEGA software (www.megasoftware.net). Committee. Planarian culture Planarian culture was maintained as previously described (Oviedo et al., 2008). Author contributions T.H.P., F.W., E.O., D.D., D.R., M.E.G.-O. and N.J.O. performed the dsRNA and microinjections research and analyzed the data. N.J.O. conceived the project and dsRNA synthesis and microinjections were carried out as previously described wrote the manuscript with T.H.P. and M.E.G.-O. (Oviedo et al., 2008). Supplementary material available online at TUNEL assay http://jcs.biologists.org/lookup/suppl/doi:10.1242/jcs.104711/-/DC1 TUNEL assay was performed as previously described (Pellettieri et al., 2010).

qRT-PCR References RNA extraction and quantitative real-time PCR (qPCR) reactions were performed Bagunã`, J. (1976). Mitosis in the intact and regenerating planarian Dugesia mediterranea n.sp. I. Mitotic studies during growth, feeding and starvation. J. Exp. as previously described (Oviedo et al 2008; Reddien et al., 2005). Briefly, Trizol Zool. 195, 53-64. was used to isolate RNA from control and experimental animals at different times Bardeen, C. R. (1901). The function of the brain in Planaria maculata. Am. J. Physiol. 5, after first dsRNA injection. qPCR reactions were performed using the SYBR 175-179. Green Master Mix in a 7500 Fast Real Time PCR cycler (Applied Biosystems). All Brockes, J. P. and Kumar, A. (2008). Comparative aspects of animal regeneration. reactions were performed in triplicates using the median cycle threshold value for Annu. Rev. Cell Dev. Biol. 24, 525-549. analysis. Gene expressions are relative to the ubiquitously expressed clone Cantarel, B. L., Korf, I., Robb, S. M., Parra, G., Ross, E., Moore, B., Holt, C., H.55.12e (Reddien et al., 2005). See supplementary material Table S1 for primer Sańchez Alvarado, A. and Yandell, M. (2008). MAKER: an easy-to-use annotation sequences. pipeline designed for emerging model organism genomes. Genome Res. 18, 188-196. Chera, S., Ghila, L., Dobretz, K., Wenger, Y., Bauer, C., Buzgariu, W., Martinou, Measurements of planaria and image processing J. C. and Galliot, B. (2009). Apoptotic cells provide an unexpected source of Wnt3 Animal behavior was recorded using a Nikon AZ-100 multizoom microscope and signaling to drive hydra head regeneration. Dev. Cell 17, 279-289. Eisenhoffer, G. T., Kang, H. and Sańchez Alvarado, A. (2008). Molecular analysis of NIS Elements AR 3.2 software. Automated area measurements were calculated stem cells and their descendants during cell turnover and regeneration in the planarian with NIS Elements at day 0, day 20 and day 40 after injection. Standard deviations Schmidtea mediterranea. Cell Stem Cell 3, 327-339. were obtained by normalizing the area measurements for each set time point to the Feldman, M. E., Apsel, B., Uotila, A., Loewith, R., Knight, Z. A., Ruggero, D. and average on day 0 to obtain percentage standard deviation and this value was Shokat, K. M. (2009). Active-site inhibitors of mTOR target rapamycin-resistant divided by the data point to calculate the standard error represented on the graph. outputs of mTORC1 and mTORC2. PLoS Biol. 7,e38. Digital pictures were collected using a Nikon AZ-100 multizoom microscope and Fingar, D. C., Salama, S., Tsou, C., Harlow, E. and Blenis, J. (2002). Mammalian cell NIS Elements AR 3.2 software. Brightness and contrast were adjusted with Adobe size is controlled by mTOR and its downstream targets S6K1 and 4EBP1/eIF4E. Photoshop. Genes Dev. 16, 1472-1487. Journal of Cell Science Fumarola, C., La Monica, S., Alfieri, R. R., Borra, E. and Guidotti, G. G. (2005). FACS Cell size reduction induced by inhibition of the mTOR/S6K-signaling pathway Planarians were dissociated as previously described (Reddien et al., 2005). DAPI protects Jurkat cells from apoptosis. Cell Death Differ. 12, 1344-1357. Garcıá-Martıńez, J. M., Moran, J., Clarke, R. G., Gray, A., Cosulich, S. C., was used to stain cell nuclei and the data were collected using an LSRII flow Chresta, C. M. and Alessi, D. R. (2009). Ku-0063794 is a specific inhibitor of the cytometer (BD Biosciences) with DIVA software. Flow cytometry analyses were mammalian target of rapamycin (mTOR). Biochem. J. 421, 29-42. performed with FlowJo software, Version 8 (www.flowjo.com). Gentile, L., Cebria`, F. and Bartscherer, K. (2011). The planarian flatworm: an in vivo model for stem cell biology and nervous system regeneration. Dis. Model. Mech. 4, In situ hybridization 12-19. Riboprobes for in situ hybridization (ISH) were synthesized using T3 or T7 Guo, T., Peters, A. H. and Newmark, P. A. (2006). A Bruno-like gene is required for polymerase (Promega) and digoxigenin-labeled ribonucleotide mix (Roche) with stem cell maintenance in planarians. Dev. Cell 11, 159-169. specific PCR templates as previously described (Oviedo et al., 2008). ISH on Gurley, K. A., Elliott, S. A., Simakov, O., Schmidt, H. A., Holstein, T. W. and isolated cells and quantification were performed as previously described (Oviedo Sańchez Alvarado, A. (2010). Expression of secreted Wnt pathway components et al., 2008). Whole-mount ISH (WISH) was performed as previously described reveals unexpected complexity of the planarian amputation response. Dev. Biol. 347, (Pearson et al., 2009). 24-39. Hwang, J. S., Kobayashi, C., Agata, K., Ikeo, K. and Gojobori, T. (2004). Detection For ISH on dissociated cells, isolated cells from FACS were spotted onto slides of apoptosis during planarian regeneration by the expression of apoptosis-related and fixed using 4% paraformaldehyde. ISH was performed as previously described genes and TUNEL assay. Gene 333, 15-25. (Oviedo et al., 2008). Propidium iodide (PI) or DAPI were used to stain nuclei. LaFever, L., Feoktistov, A., Hsu, H. J. and Drummond-Barbosa, D. (2010). Specific Cells that were double labeled with the nuclei marker and the riboprobe were roles of Target of rapamycin in the control of stem cells and their progeny in the counted in relationship with the total number of nuclei. Fluorescent in situ Drosophila ovary. Development 137, 2117-2126. hybridization was performed as previously described (Pearson et al., 2009). In all Makky, K., Tekiela, J. and Mayer, A. N. (2007). Target of rapamycin (TOR) signaling cases, ten different fields were counted per slide. controls epithelial morphogenesis in the vertebrate intestine. Dev. Biol. 303, 501-513. Morgan, T. H. (1901). Regeneration. New York: The Macmillan Company. H3P staining and immunofluorescence Murakami, M., Ichisaka, T., Maeda, M., Oshiro, N., Hara, K., Edenhofer, F., Planarians were fixed and immunostaining performed as previously described Kiyama, H., Yonezawa, K. and Yamanaka, S. (2004). mTOR is essential for growth and proliferation in early mouse embryos and embryonic stem cells. Mol. Cell. (Oviedo et al., 2008). The mitotic cells (H3P positive) were counted and Biol. 24, 6710-6718. normalized to the area (mm2) using NIS element software (Nikon). Statistical Newmark, P. A. and Sańchez Alvarado, A. (2000). Bromodeoxyuridine specifically analyses were performed using Microsoft Excel. labels the regenerative stem cells of planarians. Dev. Biol. 220, 142-153. Oldham, S., Montagne, J., Radimerski, T., Thomas, G. and Hafen, E. (2000). Acknowledgements Genetic and biochemical characterization of dTOR, the Drosophila homolog of the We are grateful to Edelweiss Pfister-Oviedo for technical assistance; target of rapamycin. Genes Dev. 14, 2689-2694. Oviedo, N. J., Newmark, P. A. and Sańchez Alvarado, A. (2003). Allometric scaling Liza Go´mez-Daglio for assistance with phylogenetic analysis; and and proportion regulation in the freshwater planarian Schmidtea mediterranea. Dev. Jason Pellettieri, Bret Pearson and Jochen Rink for advice with Dyn. 226, 326-333. TOR regulates neoblasts 1665

Oviedo, N. J., Pearson, B. J., Levin, M. and Sańchez Alvarado, A. (2008). Planarian Salo´, E. and Bagunã`, J. (1984). Regeneration and pattern formation in planarians. I. PTEN homologs regulate stem cells and regeneration through TOR signaling. Dis. The pattern of mitosis in anterior and posterior regeneration in Dugesia (G) tigrina, Model. Mech. 1, 131-143, discussion 141. and a new proposal for blastema formation. J. Embryol. Exp. Morphol. 83, 63-80. Oviedo, N. J., Morokuma, J., Walentek, P., Kema, I. P., Gu, M. B., Ahn, J. M., Sańchez Alvarado, A. (2000). Regeneration in the metazoans: why does it happen? Hwang, J. S., Gojobori, T. and Levin, M. (2010). Long-range neural and gap Bioessays 22, 578-590. junction protein-mediated cues control polarity during planarian regeneration. Dev. Sańchez Alvarado, A., Newmark, P. A., Robb, S. M. and Juste, R. (2002). The Biol. 339, 188-199. Schmidtea mediterranea database as a molecular resource for studying platyhel- Pearson, B. J., Eisenhoffer, G. T., Gurley, K. A., Rink, J. C., Miller, D. E. and minthes, stem cells and regeneration. Development 129, 5659-5665. Sańchez Alvarado, A. (2009). Formaldehyde-based whole-mount in situ hybridi- Shor, B., Gibbons, J. J., Abraham, R. T. and Yu, K. (2009). Targeting mTOR globally zation method for planarians. Dev. Dyn. 238, 443-450. in cancer: thinking beyond rapamycin. Cell Cycle 8, 3831-3837. Pedersen, S., Celis, J. E., Nielsen, J., Christiansen, J. and Nielsen, F. C. (1997). Thoreen, C. C., Kang, S. A., Chang, J. W., Liu, Q., Zhang, J., Gao, Y., Reichling, Distinct repression of translation by wortmannin and rapamycin. Eur. J. Biochem. L. J., Sim, T., Sabatini, D. M. and Gray, N. S. (2009). An ATP-competitive mammalian target of rapamycin inhibitor reveals rapamycin-resistant functions of 247, 449-456. mTORC1. J. Biol. Chem. 284, 8023-8032. Pellettieri, J., Fitzgerald, P., Watanabe, S., Mancuso, J., Green, D. R. and Sańchez Tseng, A. S., Adams, D. S., Qiu, D., Koustubhan, P. and Levin, M. (2007). Apoptosis is Alvarado, A. (2010). Cell death and tissue remodeling in planarian regeneration. Dev. required during early stages of tail regeneration in Xenopus laevis. Dev. Biol. 301,62-69. Biol. 338, 76-85. Wagner, D. E., Wang, I. E. and Reddien, P. W. (2011). Clonogenic neoblasts are Poss, K. D. (2010). Advances in understanding tissue regenerative capacity and pluripotent adult stem cells that underlie planarian regeneration. Science 332, 811-816. mechanisms in animals. Nat. Rev. Genet. 11, 710-722. Wenemoser, D. and Reddien, P. W. (2010). Planarian regeneration involves distinct Reddien, P. W. and Sańchez Alvarado, A. (2004). Fundamentals of planarian stem cell responses to wounds and tissue absence. Dev. Biol. 344, 979-991. regeneration. Annu. Rev. Cell Dev. Biol. 20, 725-757. Wullschleger, S., Loewith, R. and Hall, M. N. (2006). TOR signaling in growth and Reddien, P. W., Oviedo, N. J., Jennings, J. R., Jenkin, J. C. and Sańchez Alvarado, metabolism. Cell 124, 471-484. A. (2005). SMEDWI-2 is a PIWI-like protein that regulates planarian stem cells. Zhang, S., Readinger, J. A., DuBois, W., Janka-Junttila, M., Robinson, R., Pruitt, Science 310, 1327-1330. M., Bliskovsky, V., Wu, J. Z., Sakakibara, K., Patel, J. et al. (2011). Constitutive Robb, S. M., Ross, E. and Sańchez Alvarado, A. (2008). SmedGD: the Schmidtea reductions in mTOR alter cell size, immune cell development, and antibody mediterranea genome database. Nucleic Acids Res. 36, D599-D606. production. Blood 117, 1228-1238. Russell, R. C., Fang, C. and Guan, K. L. (2011). An emerging role for TOR signaling Zoncu, R., Efeyan, A. and Sabatini, D. M. (2011). mTOR: from growth signal in mammalian tissue and stem cell physiology. Development 138, 3343-3356. integration to cancer, diabetes and ageing. Nat. Rev. Mol. Cell Biol. 12, 21-35. Journal of Cell Science A Smed-TOR:

Heat Repeat Domain FAT Domain

B Mus Musculus

Rattus norvegicus

Homo sapiens

Canis familiaris

Danio rerio

Gallus gallus

Drosophila melanogaster

Anopheles gambiae

S.mediterranea

C S.mediterranea Rattus norvegicus Homo sapiens Canis familiaris Gallus gallus Danio rerio Drosophila melanogaster Anopheles gambiae

S.mediterranea Rattus norvegicus Homo sapiens Canis familiaris Gallus gallus Danio rerio Drosophila melanogaster Anopheles gambiae

S.mediterranea Rattus norvegicus Homo sapiens Canis familiaris Gallus gallus Danio rerio Drosophila melanogaster Anopheles gambiae A Intact Injection Protocol Injection Injection Injection Fixed Fixed

Day 1 Day 40

B C Amputation Injection Protocol 1 TOR expression qPCR 0.03

0.025

Injection Injection Fixed 0.02 Amputation Amputation

0.015

0.01 Day 1 Day 35 0.005

Relative gene expression *** *** 0 Control 20 days 30 days Injection Injection Amputation Fixed TOR(RNAi) days after 1st injection

Amputation Injection Protocol 2 Peiris et al., Fig. S3

25 Days After 1st Injection Control TOR(RNAi)

10 Days Regeneration A TOR probe whole-mount in situ hybridization

7 Day Starvation 40 Day Starvation

B TOR probe quantitative PCR

0.025

0.02

0.015 ***

0.01

0.005 Relative gene expression 0 7 Day Starvation 40 Day Starvation Peiris et al., Fig. S5

Control

t TOR(RNAi) n u o c l l e C

0 0 200 400 600 800 1K FSC Peiris et al., Fig. S6

Starving TOR(RNAi) 25 Days After 1st Injection

300

250

2 200 m m / 150 s e s

o 100 t i

M 50

0 0hr 6hr 12hr 24hr 48hr 72hr Hours After Feeding Proliferative Early division Late division A B neoblasts progeny progeny Control

RAPTOR anti sense probe C 175 2 150 125 100 Raptor(RNAi) 75 50

Mitoses/mm *** 25 0 Rapamycin Control 40 days Treated

D Proliferative Early division Late division 12 neoblasts 5 progeny 5 progeny 4.5 4.5 10 4 4 8 3.5 3.5 3 3 6 2.5 2.5 2 2 4 *** *** 1.5 1.5 2 1 1 0.5 0.5 *** Relative gene expression 0 0 0 Rapamycin Rapamycin Rapamycin Control Control Control Treated Treated Treated Table S1. Primer sequences for qRT-PCR.

Gene Name Primer Sequence Smed TOR F CCGCTAGTGGAGTCGTTCTC R ATTCACTGGCCTCATGGAAC Smed TOR F AACTCGCGGAACTTGAAGAA R TTGATTTGGTGTCAGGACCA Smed Raptor F TTTCAACACACGCAAACCTC R CTCGGACTTCGGGACTGAT smedwi-1 F TTTATCGTGACGGTGTTGGA R TTGGATTAGCCCCATCTTTG NB.21.11e F GCAGATGACGTGAAACAAGG R TACTTGATTTGGCGGGAGAC Agat-1 F ACCGATTCCAGTTTCGCTTA R TCAATCGCTCCAAAATCTCA H.55.12e F TTCCTACAGCCACTTGAGCGAC R GTCGGTGGTTATTTTGCG

Biochimica et Biophysica Acta 1828 (2013) 109–117

Contents lists available at SciVerse ScienceDirect

Biochimica et Biophysica Acta

journal homepage: www.elsevier.com/locate/bbamem

Review Gap junction proteins: Master regulators of the planarian stem cell response to tissue maintenance and injury☆

T. Harshani Peiris a,b, Néstor J. Oviedo a,⁎ a Department of Molecular and Cell Biology, School of Natural Sciences, University of California at Merced, 5200 North Lake Road, Merced, CA 95343, USA b Quantitative and System Biology Graduate Program, University of California at Merced, 5200 North Lake Road, Merced, CA 95343, USA article info abstract

Article history: Gap junction (GJ) proteins are crucial mediators of cell–cell communication during embryogenesis, tissue re- Received 23 December 2011 generation and disease. GJ proteins form plasma membrane channels that facilitate passage of small mole- Received in revised form 24 February 2012 cules across cells and modulate signaling pathways and cellular behavior in different tissues. These Accepted 9 March 2012 properties have been conserved throughout evolution, and in most invertebrates GJ proteins are known as Available online 16 March 2012 innexins. Despite their critical relevance for physiology and disease, the mechanisms by which GJ proteins modulate cell behavior are poorly understood. This review summarizes ﬁndings from recent work that Keywords: ﬂ Regeneration uses planarian atworms as a paradigm to analyze GJ proteins in the complexity of the whole organism. Stem cell The planarian model allows access to a large pool of adult somatic stem cells (known as neoblasts) that sup- Planarian port physiological cell turnover and tissue regeneration. Innexin proteins are present in planarians and play a Innexin fundamental role in controlling neoblast behavior. We discuss the possibility that GJ proteins participate as Gap junction protein cellular sensors that inform neoblasts about local and systemic physiological demands. We believe that functional analyses of GJ proteins will bring a complementary perspective to studies that focus on the temporal expression of genes. Finally, integrating functional studies along with molecular genetics and epigenetic approaches would expand our understanding of cellular regulation in vivo and greatly enhance the possibilities for rationally modulating stem cell behavior in their natural environment. This article is part of a Special Issue entitled: The communicating junctions, roles and dysfunctions. © 2012 Elsevier B.V. All rights reserved.

Contents

1. Introduction ...... 109 2. Planarians: a model to elucidate systemic cell turnover and regeneration ...... 110 3. Gap junction-mediated stem cell response during tissue turnover ...... 111 4. Gap junction-mediated stem cell response during tissue regeneration in planarians...... 112 5. Future challenges ...... 114 6. Concluding remarks ...... 114 Acknowledgements ...... 115 References ...... 115

1. Introduction and continued tissue renewal as adults. An illustration of this phenomenon is observed in long-lived organisms (e.g. humans), which Effective cell–cell communication is a hallmark of multicellular or- maintain the form and function of differentiated tissues over years. ganisms, which allows for proper embryonic development, growth This extended process of tissue maintenance relies on stem cells that are activated to proliferate and migrate in order to precisely replace aged or damaged cells. Physiological turnover is not restricted to one tissue type and is simultaneously accomplished in many tissues; in humans it involves the daily renewal of billions of cells ☆ This article is part of a Special Issue entitled: The communicating junctions, roles [1,2]. Thus, in order to integrate local and systemic signals that consis- and dysfunctions. ﬁ ⁎ Corresponding author. Tel.: +1 209 228 4541; fax: +1 209 228 4053. tently satisfy physiological demands, ef cient mechanisms for cellu- E-mail address: [email protected] (N.J. Oviedo). lar communication are instrumental.

Gap junction (GJ) proteins contribute to cell communication that Experimental evidence accumulated over the last 40 years has ad- integrates different tissues and organs throughout the body [3–5]. vanced our understanding of GJC and its regulatory aspects, especially This type of cell communication has been illustrated in a wide range those associated with tissue specificity, permeability and the way GJC of invertebrates and vertebrates, which suggests a conserved mecha- relates to homeostasis and disease [3,39,42,43,45,49–51]. However, in nism throughout evolution [3–7]. Traditionally, the function of GJ many cases, deletion of genes encoded for GJ proteins leads to embry- proteins was known to be associated with the formation of mem- onic lethality, highlighting the central role played by GJC during em- brane channels coupling multiple cell layers to enable the passage bryonic development [19,22,25]. Although this limits the analysis of of physiological signals such as ions, second messengers and small GJC in adult tissues, introducing tissue-specific genetic deletions that metabolites to pass from one cell to another. However, recent ad- remove one or more genes encoding for GJ proteins has proved a pow- vances have revealed and assigned additional functions to GJ pro- erful molecular tool. Nonetheless, functional disruption of a GJ protein teins, including roles as sensors of the extracellular environment, in many cases tends to be compensated by others, which can poten- cell–cell adhesion factors that facilitate cell migration, and modula- tially mask the study of its specific systemic roles [3,10–14,24,43,52]. tors of endocrine, pain, signal transduction pathways and pro- The possibility for simultaneously disrupting multiple gap junction grammed cell death [3,8–15]. Significantly, the intercellular proteins represents an attractive alternative to avoid compensatory/ information mediated through gap junctions has been implicated to redundant mechanisms; however this approach is often difficult to regulate the local and systemic physiological demands associated perform, and its effect can be complicated to analyze in the adult or- with embryonic development, growth, differentiation, regeneration, ganism. To understand how tissues integrate to satisfy physiological and tissue homeostasis [3,8]. cell turnover and repair, GJC role at the systemic level (i.e.: in the com- Gap junctions are composed of proteins called connexins and pan- plexity of the whole adult organism), needs to be defined, and the nexins in the vertebrates, and innexins in most invertebrates [4,6]. above difficulties provide a barrier towards this purpose. Though the molecular topology between connexins and innexins re- In this review, we discuss recent attempts to study GJC in the com- mains similar, phylogenetic analyses show dissimilarities in the pri- plexity of the whole adult organism during tissue maintenance and mary sequences of the two types of proteins [16]. Evolutionary regeneration. The approach [38,46,53] capitalizes on a classic model analyses, based on the conservation of motifs group the innexins organism, the flatworm planaria, which provides an excellent system and pannexins into one superfamily, suggesting that these proteins in which to analyze GJC-mediated stem cell regulation during the might have evolved from the same precursor protein [17]. Further- processes of tissue renewal and regeneration in adults. Planarians more, the conservation of primary sequences and motifs also suggests are also amenable to genetic manipulation, in particular loss- the notion that innexins probably evolved prior to connexins, while of-function studies allowing simultaneous downregulation of multiple connexins evolved independently at a later time [16–18]. GJ proteins. The opportunity to study gap junction-mediated signaling In vertebrates and invertebrates GJ proteins form channels that in situ in the adult animal, (by using state-of-the-art molecular genetic mediate cell–cell communication. Disruption of this cellular commu- technology along with electrophysiology and biochemical tools) offers nication can lead to abnormalities in both embryonic and adult a fresh approach to further our understanding of cell regulation stages, ranging from embryonic lethality and cardiac failure to cancer mechanisms. and epilepsy [19–24]. For example, deficiency in connexin 26 leads to embryonic lethality in mice starting with abnormalities at day 10- 2. Planarians: a model to elucidate systemic cell turnover and post coitum and death at day 11 [22]. Connexin 45 is also embryoni- regeneration cally lethal, probably due to deformities caused during cardiac development [19,25]. However, extensive data suggest that GJ proteins are Planarians are multicellular organisms and members of the phy- not simply housekeeping components but are also critical modulators lum platyhelminthes (flatworms). These organisms contain deriva- of morphogenesis and axial patterning during embryonic develop- tives of all three germ layers (ectoderm, mesoderm and endoderm), ment and adult tissue maintenance [3,26,27]. The former is illustrated and this review will mainly focus on the most common species of in the context of left–right asymmetry determination in vertebrate freshwater planarians used in laboratory settings (i.e.: Dugesia japon- embryonic development, where GJ proteins establish long-range ica and Schmidtea mediterranea) [54–61]. Key features of these organ- communication among cells influencing gene expression and consis- isms include bilateral symmetry, cephalization, and dorsoventral and tent organ formation on the left or right side [3,5,28–30]. Inhibition anteroposterior polarities [54–61]. Planarians also possess multiple of this direct cellular communication leads to the inconsistent place- tissues and organs; for example, recent research highlights the com- ment of organs during development in a process known as left– plexity of the planarian nervous system, which includes multiple right visceral randomization [3,5,28–31]. GJ proteins also modulate types of neurons, receptors and neurotransmitters similar to those cellular behavior in adult tissues, controlling cell cycle progression, in vertebrates [54,62–64]. Altogether, planarians display tissue com- growth, apoptosis and cellular response during injury and inflamma- plexity and developmental features that are evolutionarily conserved tory response [3,32–38]. Altogether, gap junction-dependent signals among metazoans. play fundamental roles in cell communication at many levels and The best-known feature of planarians is their capacity to regener- their functions can be essential for the cell survival and behavior. In ate an entire organism from small tissue fragments. This extraordi- many cases, these signals act as intermediaries capable of spatio- nary plasticity in the adult organism relies on a population of stem temporal regulation of morphogenetic patterning and cellular re- cells known as neoblasts. Scattered throughout the animal, neoblasts sponse, providing an excellent paradigm for the rational modulation are the only mitotic cells in the worm, giving rise to all tissues and of cell behavior during therapeutic intervention. supporting of physiological cell turnover in the adult [65–67]. During Studies demonstrate the existence of functional differences be- injury, undifferentiated neoblasts respond with increased prolifera- tween normal and cancer cells based on the presence of various GJ tion, giving rise to progeny that migrate to the damaged site to re- proteins [39–43]. This phenotypic feature also extends to stem cell establish form and function [57–59,66,67]. Neoblasts respond to dam- populations that can be defined based on gap junction signatures age quickly and can rebuild any part of the body (including neuronal [35,44–48]. Thus, gap junction communication (GJC) encompasses a connections within the brain and sensory system, and other tissues physiological phenomenon that modulates cellular behavior at the such as muscle and the digestive system), within a week local and systemic level. Despite the physiological and biomedical rel- [54,56,59–62,64]. Tightly coordinated neoblast proliferation in re- evance of GJC, the mechanisms by which this cellular crosstalk is ac- sponse to damage indicates that these stem cells process information complished in vivo remain largely elusive. regarding their local and systemic environment. In order to T.H. Peiris, N.J. Oviedo / Biochimica et Biophysica Acta 1828 (2013) 109–117 111 effectively guide neoblasts and respond to the demands of tissue Since neoblasts are the only proliferative cells in the entire worm, damage and cell turnover, precise mechanisms of cell communication γ-irradiation is commonly used to eliminate dividing cells and their must exist within the organism. Thus, intrinsic and extrinsic cues progeny. Thus, molecules associated with neoblasts can be identified likely guide neoblast behavior toward unlimited self-maintenance based on their differential expression patterns after irradiation. Two and attendance on physiological demands throughout the years. genes encoding for innexins show significant downregulation of Neoblast behavior is controlled by the needs of its environment, their expression after irradiation, suggesting an association between responding to different types of body demands that may involve the neoblasts and innexin expression [46]. Functional studies with RNA- replacement of: (i) a small number of cells, usually without tissue interference (RNAi) in the whole worm reveal that the innexin gene damage (e.g.: aged differentiated cell), and/or (ii) a large number of smedinx-11 is required for proper expression of other neoblast cells, generally as a response to lost or damaged tissue (e.g. after de- markers, suggesting that this GJ protein is a key regulator of neoblast capitation). The former likely originates within neighboring cells, function [46]. Functional disruption of smedinx-11 was accompanied and therefore may be considered a local demand that probably affects by the gradual disappearance of neoblasts throughout the body few neoblasts (short-range signals). On the other hand, amputation (Fig. 1A), implying that this neoblast-related innexin is required for generally demands the re-establishment of multiple tissues, which the maintenance of the planarian stem cell pool [46]. Importantly, likely involves many neoblasts correlated with the extent of the dam- downregulation of the remaining eleven innexins by RNAi individual- age. In this case, the remaining tissues and organs within the regener- ly did not affect neoblast behavior or number. This once again indi- ating fragment need to be surveyed in order to recognize what parts cates that smedinx-11 is a crucial modulator of planarian stem cells are missing (long-range signals) and to deploy the right number of and that other GJ protein cannot compensate for its loss [46]. cells to the injured site. The signals driving neoblast proliferation In summary, these results suggest that neoblasts may use a partic- and deployment are likely guided by local and systemic cues that pro- ular gap junction (i.e. smedinx-11) to self-maintain and to regulate tis- vide inputs (“cellular inventory”) to inform about the scale of the de- sue turnover. Furthermore, based on the classical functions described mand and the identity of the missing parts. for GJ proteins, it is reasonable to speculate that smedinx-11 may have Intercalary regeneration offers an example of the local and systemic demands that regulate regeneration. Vertebrate and invertebrate studies have shown that when most distal and proximal surfaces of an injured area are conjoined, the missing parts are likely restored through a process called intercalation [68–76]. While the Live Mitotic Neoblast molecular bases of this process are still under investigation, studies worm neoblasts progeny to date suggest that cell–cell interactions mediate positional cues that regenerate the missing parts. Such close cellular interactions may involve short/long-range signals to coordinate regeneration. The developmental plasticity of planarians provides an exquisite system in which to attempt to understand intercalary regeneration, the basis of cell–cell interaction, and the identity of instructive short/ long-range signals. Classic experiments were performed joining fragments from different parts of the planarian body to analyze the cellular contribution of each part towards the re-establishment of form and function [73,76,77]. However, the exact mechanism used by the cells proximal to the injured surface to coordinate neoblast response remains an intriguing aspect requiring further clarification. To understand the local and systemic cues involved with this process, GJC could be an attractive entry point. Irradiation eliminates neoblasts and prevents planarians from regenerating; the transplantation of a few neoblasts into an irradiated host is sufficient to restore Digestive Excretory Nervous stem cell-mediated cellular turnover and regenerative capacities system system system throughout the whole organism [65,66]. Thus neoblast repopulation of an entire irradiated host requires both short- and long-range signals, although the systemic cues responsible for instructing the neoblasts are unknown. However, it would be interesting to test whether gap junction-mediated signals could be manipulated to alter stem cell behavior in their natural environment during the process of repopulation. Neoblasts and differentiated cells must engage in an active exchange of information to satisfy body demands and maintain homeostasis. Currently, the nature of information exchanged and the mechanisms involved in this cellular crosstalk are not well defined, but initial attempts have implicated GJC as possible regulators of short and long-distance signals [38,46,53].

3. Gap junction-mediated stem cell response during tissue turnover

About a dozen genes encoding for innexin proteins were recently Fig. 1. Planarians allow analysis of stem cells and their differentiated progeny in the described in planarians [38,46,53]. These genes were categorized into complexity of the whole organism. Representative images of worms subjected to antibody staining (yellow dots represent dividing neoblasts) and in situ hybridization la- four groups (excretory, digestive, mesenchymal and nervous tissue), beling the early progeny of neoblasts (green signal) and differentiated tissues based on their expression patterns and phylogenetic relationship. (purple precipitation). 112 T.H. Peiris, N.J. Oviedo / Biochimica et Biophysica Acta 1828 (2013) 109–117 roles in establishing communication between neoblasts and the sur- stem cells [35,48,78,91], implying that GJ proteins may represent an rounding environment. Thus, inhibition of smedinx-11-mediated sig- ancient mechanism of cell communication used by progenitor cells nals may result in a disconnection between neoblasts and their to sense and recognize physiological demands during embryogenesis neighboring cells leading to the demise of the proliferative cells and and cellular turnover. Additional experiments using the planarian subsequent lethality. This possibility is consistent with the require- model could provide insights on the nature of the molecules ex- ment for connexin-43 in proliferative cells during zebrafish fin regen- changed during cellular crosstalk. An important aspect of this analysis eration [78], and the involvement of an innexin protein (i.e. zpg)in is the opportunity to reveal molecular targets to modulate stem cell the germ cells of the Drosophila ovary [35,48,79]. Alternatively, behavior in their natural environment. there is also the possibility that GJ proteins may possess non- classical functions that do not require the passage of molecules 4. Gap junction-mediated stem cell response during tissue through channels in order to activate signaling pathways that alter regeneration in planarians cell cycle, migration and adhesion [37]. However, additional experi- mentation is needed to test these hypotheses. Tissue regeneration offers a great paradigm to study signals asso- Bisection of a planarian triggers a neoblast response to re- ciated with the establishment of axial patterning and the functional establish form and function, which is accomplished by forming a tis- integration of new and pre-existing tissues [92–97]. The early molec- sue outgrowth at the edge of the wound (blastema) where recrea- ular events during planarian regeneration remain mostly unknown, tion of the missing structures begins [54,56–58,60]. The molecular but the initial process involves wound closure, dorsal–ventral interac- process that drives blastema formation necessarily includes cell in- tions, and neoblast proliferation to form the blastema at the edge of teractions to efficiently repair missing tissues. Intriguingly, the ex- the wound [56–58]. Remarkably, missing tissues are proportionally pression of smedinx-11 increases in areas surrounding damaged regenerated and correctly placed according to the pre-existing ante- tissue shortly after amputation. Furthermore, most cells that form roposterior, dorsoventral and mediolateral axes [92–97]. Thus, di- the blastema during the first four days express smedinx-11 verse cues originating from differentiated tissues in the form of (Fig. 1B), suggesting that this innexin in particular may play an biochemical gradients, patterns of territorial gene expression, neural important role during regeneration and in the process of blastema inputs, physical signals, and ion flows may instruct the neoblasts re- formation [46]. Similar upregulation of GJ proteins (i.e. Cx37 and garding the positional specification of missing parts. However, deter- Cx40) has been observed in mammals during liver regeneration mining how these signals functionally integrate to establish and [80] and injury [81]. However, upregulation of a GJ protein is not a maintain different axes has proved challenging. Despite recent ad- generalized regeneration response as some tissues respond to regen- vances identifying molecular pathways (e.g. Wnt, Hh, BMP signaling) eration by the downregulation of a specific GJ protein [82]. Wound essential for this process [98–108], the information is still largely repair provides evidence for the transient increase and decrease of fragmented and no functional model yet exists to explain all known GJ protein expression, which could be temporal, spatial and even morphological patterns after amputation [92–97]. tissue specific(e.g. Cx 43) [83–85]. Furthermore, there is extensive Within the first few hours after amputation, the regenerating frag- evidence linking GJ proteins with cell cycle regulation. While the ment is poised to make critical decisions in order to re-establish form mechanisms used by gap junctions to regulate cell progression and function [38,94,109]. Thus, shortly after damage, neoblasts sur- remain vague, the influence mediated by these proteins towards cel- rounding the wounded surface must gather information regarding lular response and behavior during homeostasis, development and the identity of the remaining tissue (e.g., presence of brain), which disease is evident [3,5,33,34,36,86,87]. is crucial for the early response to injury [38]. The nervous system Downregulation of smedinx-11 by RNAi results in the progressive has been typically associated with the initial regenerative response reduction of proliferative neoblasts, resulting in their disappearance in both vertebrates and invertebrates [74,110,111]. Despite recent ad- in about two weeks. However, animals amputated one week after vances, the molecular connection between the nervous system and smedinx-11 RNAi, when mitotic activity is still present, also fail to re- regeneration remains poorly characterized [112]. The planarian cen- generate. This suggests that although the neoblasts are present and tral nervous system (CNS) consists of a bi-lobed brain, a pair of ven- dividing, the lack of smedinx-11 prevents their response to the regen- tral cords running along the anteroposterior (A/P) axis and erative demand [46]. However, regenerating fragments are able to numerous axonal projections that reach every part of the body survive for several weeks without the head region. This supports [54,62,63]. Initial evidence suggests that the planarian CNS has influ- the notion that smedinx-11 is not a regular “housekeeping gene” but ence in regulating the regeneration of posterior areas through an un- could be a critical mediator of the neoblast response to tissue damage. known mechanism [113–116]. Thus, the planarian nervous system These results are consistent with the argument that planarian stem fits well into the type of component that may facilitate instructional cells may use a particular GJ protein to sense physiological body de- cues to the injury-induced neoblast response. mands. Thus, in the absence of functional gap junction-mediated sig- Consistent with the argument that GJ proteins connect multiple nals (mediated by smedinx-11), neoblasts are “virtually isolated” and cell layers, experiments were carried out to investigate the role of unresponsive. Similarly, connexin-43 is specifically expressed within innexins as facilitators of long-range communication along the body proliferative cells and is required to maintain cell division and length [38,53]. The fact that neoblasts depend on a specific GJ protein (i.e., of the fin in zebrafish [78], arguing for an evolutionarily conserved smedinx-11) for self-renewal and response to injury does not exclude role within progenitor cells and during the regeneration of complex the possibility that other innexin proteins expressed in differentiated structures. tissues also participate in long-range cellular communication during Future experiments will need to incorporate biochemical and elec- regeneration (e.g. A/P polarity determination). Indeed, loss of func- trophysiological techniques to rule out whether planarian innexins tion with RNAi of individual innexins other than smedinx-11 does are exclusively acting as cell–cell communicating entities or whether not alter regenerative outcomes [38]. However, treatment with com- there are non-classical roles for gap junctions. The initial implications pounds known to inhibit GJC in vertebrates and invertebrates (i.e. of a particular innexin in modulating stem cell behavior in the com- heptanol or octanol) leads to a consistent alteration of A/P polarity plexity of the whole organism, represent an entry point to begin during regeneration [38,53]. Specifically, removal of both the head unraveling both the genetic and epigenetic signals (e.g. ion flows, and tail with simultaneous exposure to the GJC inhibitors induces pH gradients) known to affect cellular behavior [33,88–90]. Gap junc- the regeneration of viable planarians with heads at both ends (bipolar tions (connexins and innexins) are known to have crucial roles in head) and no tail. Importantly, treatment with heptanol or octanol maintaining the proliferative state of both embryonic and adult does not distinguish among the different innexins thus overcoming T.H. Peiris, N.J. Oviedo / Biochimica et Biophysica Acta 1828 (2013) 109–117 113 the limitations associated with redundancy and compensation offer- brain) within the regenerating fragment. Under these conditions, ing great opportunities to analyze effects after inhibiting multiple two parallel pathways act together to instruct the neoblasts sur- gap junctions during regeneration or tissue maintenance. rounding posterior facing wounds to form a new head and anteropos- Recently, it was reported that treatment with octanol on frag- terior axis that integrates with the pre-existing animal morphology. ments subjected to anterior and posterior amputation led to the re- Importantly, these gap junction and nervous system-mediated cues generation of double-headed bipolar planarians. These two-headed produce their maximum effect within the first 6 h after amputation, worms did not display any apparent defects in tissue turnover, imply- which underscores their relevance in the initial response to injury ing that not all GJ proteins (including the neoblast specific innexin-11) (Fig. 3). were inhibited [38]. This approach provided certain advantages over A combinatorial RNAi screen involving more than 600 planarians the RNAi technique; in particular, it enabled time course experiments identified three genes encoded for innexin proteins (Dj-inx5, 12 and to inhibit innexin protein function immediately after treatment 13). These innexins phenocopied the effect of pharmacological inhi- (b1 min). This method identified GJ proteins as crucial mediators of bition with octanol [38]. Significantly, these genes were mostly pattern determination during early regeneration [38]. Perhaps more expressed within the CNS, and their downregulation induced antero- interesting is the observation that neoblasts were responsive to dam- posterior axis alterations in both regenerating and uninjured ani- age but incorrectly formed ectopic tissues and organs after a transient mals, emphasizing the robustness of the genetic manipulations. blockage of physiological signals. Moreover, an additional anteropos- Together, these analyses implicated three CNS-related innexins as terior axis with heads and other organs could be predictably induced key components in the maintenance of anteroposterior polarity dur- in lateral wounds leading to animals with three or four brains (Fig. 2). ing cellular turnover and regeneration [38]. The specific mechanisms The prospect of coordinating adult stem cell-response independently on how these three innexins mediate to determine A/P polarity and of the organismal needs represents a unique opportunity to attempt neoblast behavior are not clear. Although data from different species rational manipulation of cellular behavior in situ. indicate that innexin and connexin proteins interact with members Chemical inhibition of GJC does not affect the initial response to of the Wnt pathway [32], it is not obvious how gap junction- wounding or blastema formation, but it seems to alter the instruc- mediated cues integrate with components of the Wnt signaling tions neoblasts receive to form missing parts [38]. Although the mo- pathway in the adult planarian. Important differences exist among lecular mechanisms that instruct neoblast responses are largely loss-of-function phenotypes targeting innexins and components of unknown, disruption of the ventral nerve cords together with GJC the Wnt signaling (Table 1), suggesting the requirement for further blockage results in the formation of ectopic heads independent of studies. Thus findings about GJC-mediated neoblast regulation will the pre-existing anteroposterior axis. These results implicate both expand our understanding in areas of stem cell regulation that are GJC and parts of the CNS as key elements in the determination of difficult to appreciate in other experimental models currently long-range signals that sense the presence of remaining tissues (e.g. available.

A Control smedinx-11(RNAi) Dividing neoblasts

7 days 11 days 14 days B 4 days regeneration

Fig. 2. smedinx-11 expression during regeneration and its downregulation leads to neoblast disappearance. A) Confocal projections of whole-mount immunostained animals using an antibody against the phosphorylated form of Histone-3 (H3P) (green dots are positive signal). Control (left); smedinx-11(RNAi) worms at different times after dsRNA exposure (7, 11 and 14 days). H3P signal is disappearing in a gradient, anterior to posterior, in a time-dependent manner. B) In situ hybridization on longitudinal section four days after amputation. The neoblast-related innexin gene (smedinx-11) is expressed within the cells forming the regenerating blastema (purple signal, right side of the picture). Dotted line represents plane of amputation. To improve visualization, purple signal in merge image was pseudocolored to green by using Adobe Photoshop image software. Scale bar is 0.1 mm. Adapted with permission from Oviedo and Levin (2007), Development, 134:3121–3131. 114 T.H. Peiris, N.J. Oviedo / Biochimica et Biophysica Acta 1828 (2013) 109–117 A Cut + octanol treatment i ii iii

B Single head Bipolar head Triple head Quadruple head Live worms CNS

Fig. 3. Gap junction and neural mediated signals permanently affect axes formation in regenerating planarians. A) Single headed animals were amputated (post pharyngeal area, red dotted lines) and gap junction proteins and nervous signals disrupted with octanol treatment and surgery (fragments i–iii, respectively). B) Depending on the type of cut animals can be induced to form bipolar, triple and quadruple heads (white arrows, top). Immunostaining with the central nervous system marker (anti-synapsin antibody) revealed that animals have multiple brains connected by common ventral nerve cords (white arrows bottom). Scale bars 500 μm. Adapted with permission from Oviedo et al. (2010), Developmental Biology, 339:188–199.

5. Future challenges regeneration [3,33,121–123]. Ideally, in vivo analyses to study GJC- mediated regulation should be performed with a systems biology ap- Understanding the roles GJ proteins play in planarian homeostasis proach, where experimental data is used to build predictable models and regeneration will inform us about the regulatory signals affecting of cell and organismal behavior. Therefore, a comprehensive ap- adult stem cell behavior in vivo. Therefore, it is critical to identify proach that integrates molecular genetics, physiological, biochemical whether smedinx-11 functions require (1) formation of gap junction and computational approaches will allow us to precisely determine channels and (2) if the neoblasts lack of response during regeneration how GJ proteins mediate short/long-range cellular communication and homeostasis in smedinx-11(RNAi) is mediated through interac- and their contribution within the systemic circuitry that controls neo- tions with other membrane/structural proteins. Thus, biochemical blast behavior. and electrophysiological recordings in cells expressing SMEDINX-11 protein will provide evidence towards addressing this issue 6. Concluding remarks [117–120]. In order to determine how neural inputs affect neoblast behavior and polarity, it is crucial to relate the dynamics of neoblast The data discussed here indicate that GJ proteins are essential reg- responses to the movement of ions, small molecules, electric- ulators of neoblast biology [38,46,53]. Moreover, innexin proteins currents and pH gradients that are known to inﬂuence polarity and modulate neoblast responses to injury in at least two different ways: 1) by restricting their capacity to self-renew and sense damage (smedinx-11), and 2) by facilitating the formation of ectopic tissues Table 1 and setting up a new anteroposterior (A/P) polarity (Dj, inx-5, -12 Differences between gap junctions and Wnt signaling pathway during the determination of anterior–posterior polarity. and -13). In both cases, short and long-range signals are probably involved. However, smedinx-11 mediated function may be restricted to Gap junctions Wnt signaling neoblasts and their immediate division progeny, which is likely re- Gradient of susceptibility to form Susceptibility to form bipolar animals quired to sense local and systemic cues during cellular turnover and double-headed bipolar animals is mostly uniform along the A/P axis regeneration. On the other hand, gap junction-related neural signals (maximum at post-pharyngeal area) The post-pharyngeal area displays higher Ectopic anteriorization is induced at affecting neoblast behavior likely come through differentiated tissues propensity to develop A/P problems posterior wounds and in some cases (i.e., nervous system), which may be regarded as an indirect input af- after RNAi of innexin genes radial-like hypercephalized animals fecting instructive signals during regeneration rather than cellular after RNAi turnover (Fig. 4). Since the planarian model system incorporates the Functional disruption of innexins with Disruption with RNAi of Wnt signaling study of neoblasts in their natural environment, it is likely that the RNAi or pharmacological compounds members does not necessarily lead to lead to the formation of equal number correspondence between the number gap junction-mediated effects on these stem cells incorporate physi- of pharynxes and ectopic heads of pharynxes and ectopic heads ological signals arising from the surrounding environment. Simulta- Presence of brain and ventral nerve cord Nervous system inputs are not neous downregulation of both gene expression and protein integrity affects A/P polarity during required to induce ectopic function, which potentially overcome compensatory/redundancy regeneration anteriorization mechanisms frequently observed in vivo is another advantage to the T.H. Peiris, N.J. Oviedo / Biochimica et Biophysica Acta 1828 (2013) 109–117 115

Fig. 4. Summary schematic of early events during planarian regeneration involving GJ-mediated neural signals. A) An algorithm based on bimodal decisions was derived, representing in a simplified manner how information mediated by GJ proteins and VNC affects regenerative pattern. The key inputs provided to a wound at early stages of regeneration are schematized in a hypothetical case in which transverse amputations produce 3 fragments (*, “PW” = long fragment including pre-existing brain and a posterior wound, ** = post- pharyngeal fragment with anterior (AW) and posterior (PW) wounds, and *** = tail fragment with only AW). Time post-amputation is shown in the vertical left scale from 0 to >24 h. As soon as the wound surface is minimized by mechanical contractions, instructive inputs from differentiated tissue are required at the wound to begin to establish polarity and identity of the regenerate. Key signals include GJ-mediated signals and VNC integrity functioning within the first 3–6 h of regeneration. Information provided to the wounded area likely includes the presence of brain tissue in the animal's body. Since anterior wounds regenerate heads despite GJ inhibition, additional mechanisms must also exist. In a long fragment (*), both GJ-mediated signals and VNC integrity inform the PW about the presence of brain and that no anterior blastema is needed; thus, neoblasts surrounding PW are specified by other means (e.g.: intercalary regeneration) to form a posterior blastema. If no brain is detected within the regenerating fragment, this narrows down the possibilities to fragments below the head region (e.g.: post-pharyngeal** or tail***). A critical step for the blastema is to identify whether there is only one wound within the pre-existing tissue. If so (it is a fragment only with an anterior wound *), then the neoblasts must be instructed to form an anterior blastema. Conversely, if there are two wounds in the fragment (e.g.: ** post-pharyngeal) the subsequent information instructing neoblasts at those wounds concerns the determination of wound location (i.e.: AW or PW). For AW, alternative cues independent of GJs are in place. Anterior blastemas form faster [124]; thus they can prevent (via neural/GJ-dependent signaling) the differentiation of additional anterior structures (black dotted line). Thus, inputs at this point allow sensing of anterior blastema formation and the PW is instructed to form a posterior blastema that integrates with pre-existing A/ P axis. Fate decisions during this process can be altered by blocking neural GJC and disrupting VNC integrity (which affect the determination of head tissue within the fragment) The model and the timeline are consistent with proposed anterior regenerative process based on gene expression [54]. Reproduced with permission from Oviedo et al. (2010), Developmental Biology, 339:188–199. use of this model system. As such, functional analyses of signals in situ References represent an important complement to studies that focus on the tem- [1] J. Pellettieri, A. Sánchez Alvarado, Cell turnover and adult tissue homeostasis: poral expression of genes. Integrating functional analysis along with from humans to planarians, Annu. Rev. Genet. 41 (2007) 83–105. molecular and biochemical examination would expand our under- [2] J.C. Reed, Dysregulation of apoptosis in cancer, J. Clin. Oncol. 17 (1999) standing of stem cell regulation in vivo and greatly enhance the pos- 2941–2953. [3] M. Levin, Gap junctional communication in morphogenesis, Prog. Biophys. Mol. sibilities to modulate stem cell behavior in their natural environment. Biol. 94 (2007) 186–206. [4] D.A. Goodenough, J.A. Goliger, D.L. Paul, Connexins, connexons, and intercellular communication, Annu. Rev. Biochem. 65 (1996) 475–502. Acknowledgements [5] M. Levin, Isolation and community: a review of the role of gap-junctional communication in embryonic patterning, J. Membr. Biol. 185 (2002) 177–192. [6] P. Phelan, Innexins: members of an evolutionarily conserved family of We are grateful to Belinda Braunstein and Wendy Beane for edito- gap-junction proteins, Biochim. Biophys. Acta 1711 (2005) 225–245. rial inputs. We also thank Elyse Ozamoto and Frank Weckerle for [7] M.W. Turnbull, A.N. Volkoff, B.A. Webb, P. Phelan, Functional gap junction genes are encoded by insect viruses, Curr. Biol. 15 (2005) R491–R492. comments on the manuscript. N.J.O. thanks Mike Levin for many use- [8] L.A. Elias, A.R. Kriegstein, Gap junctions: multifaceted regulators of embryonic ful discussions, and Edelweiss Pfister-Oviedo and the Pfister-Bengoa cortical development, Trends Neurosci. 31 (2008) 243–250. family for their support during the preparation of the manuscript. [9] F.B. Chekeni, M.R. Elliott, J.K. Sandilos, S.F. Walk, J.M. Kinchen, E.R. Lazarowski, A.J. Armstrong, S. Penuela, D.W. Laird, G.S. Salvesen, B.E. Isakson, D.A. Bayliss, N.J.O. acknowledges support from UC Merced and the University of K.S. Ravichandran, Pannexin 1 channels mediate ‘find-me’ signal release and California Cancer Research Coordinating Committee. membrane permeability during apoptosis, Nature 467 (2010) 863–867. 116 T.H. Peiris, N.J. Oviedo / Biochimica et Biophysica Acta 1828 (2013) 109–117

[10] D. Bosco, J.A. Haefliger, P. Meda, Connexins: key mediators of endocrine func- human normal lung fibroblasts and lung carcinoma cells, Carcinogenesis 25 tion, Physiol. Rev. 91 (2011) 1393–1445. (2004) 473–482. [11] E. Leithe, S. Sirnes, T. Fykerud, A. Kjenseth, E. Rivedal, Endocytosis and [43] J.A. El-Saghir, E.T. El-Habre, M.E. El-Sabban, R.S. Talhouk, Connexins: a junctional post-endocytic sorting of connexins, Biochim. Biophys. Acta (2011) (Electronic crossroad to breast cancer, Int. J. Dev. Biol. 55 (2011) 773–780. publication ahead of print). [44] R.C. Wong, A. Pebay, L.T. Nguyen, K.L. Koh, M.F. Pera, Presence of functional gap [12] N. Defamie, M. Mesnil, The modulation of gap-junctional intercellular communi- junctions in human embryonic stem cells, Stem Cells 22 (2004) 883–889. cation by lipid rafts, Biochim. Biophys. Acta (2011) (Electronic publication [45] R.C. Wong, M.F. Pera, A. Pebay, Role of gap junctions in embryonic and somatic ahead of print). stem cells, Stem Cell Rev. 4 (2008) 283–292. [13] A. Wu, C.R. Green, I.D. Rupenthal, G. Moalem-Taylor, Role of gap junctions in [46] N.J. Oviedo, M. Levin, smedinx-11 is a planarian stem cell gap junction gene chronic pain, J. Neurosci. Res. 90 (2012) 337–345. required for regeneration and homeostasis, Development 134 (2007) [14] N. Batra, R. Kar, J.X. Jiang, Gap junctions and hemichannels in signal transmis- 3121–3131. sion, function and development of bone, Biochim. Biophys. Acta (2011) [47] N.J. Oviedo, M. Levin, Gap junctions provide new links in left–right patterning, (Electronic publication ahead of print). Cell 129 (2007) 645–647. [15] X. Wang, H.H. Gerdes, Long-distance electrical coupling via tunneling nano- [48] L. Gilboa, A. Forbes, S.I. Tazuke, M.T. Fuller, R. Lehmann, Germ line stem cell dif- tubes, Biochim. Biophys. Acta (2011) (Electronic publication ahead of print). ferentiation in Drosophila requires gap junctions and proceeds via an intermedi- [16] P. Phelan, T.A. Starich, Innexins get into the gap, Bioessays 23 (2001) 388–396. ate state, Development 130 (2003) 6625–6634. [17] D. Fushiki, Y. Hamada, R. Yoshimura, Y. Endo, Phylogenetic and bioinformatic [49] J.D. Pitts, M.E. Finbow, E. Kam, Junctional communication and cellular differenti- analysis of gap junction-related proteins, innexins, pannexins and connexins, ation, Br. J. Cancer Suppl. 9 (1988) 52–57. Biomed. Res. 31 (2010) 133–142. [50] J.E. Trosko, C.C. Chang, M.R. Wilson, B. Upham, T. Hayashi, M. Wade, Gap junc- [18] C. Stout, D.A. Goodenough, D.L. Paul, Connexins: functions without junctions, tions and the regulation of cellular functions of stem cells during development Curr. Opin. Cell Biol. 16 (2004) 507–512. and differentiation, Methods 20 (2000) 245–264. [19] O. Kruger, A. Plum, J.S. Kim, E. Winterhager, S. Maxeiner, G. Hallas, S. Kirchhoff, [51] B. Yang, H. Lin, J. Xiao, Y. Lu, X. Luo, B. Li, Y. Zhang, C. Xu, Y. Bai, H. Wang, G. Chen, O. Traub, W.H. Lamers, K. Willecke, Defective vascular development in connexin Z. Wang, The muscle-specific microRNA miR-1 regulates cardiac arrhythmo- 45-deficient mice, Development 127 (2000) 4179–4193. genic potential by targeting GJA1 and KCNJ2, Nat. Med. 13 (2007) 486–491. [20] A. Temme, A. Buchmann, H.D. Gabriel, E. Nelles, M. Schwarz, K. Willecke, High [52] C.L. Wu, M.F. Shih, J.S. Lai, H.T. Yang, G.C. Turner, L. Chen, A.S. Chiang, Heterotypic incidence of spontaneous and chemically induced liver tumors in mice deficient gap junctions between two neurons in the Drosophila brain are critical for for connexin32, Curr. Biol. 7 (1997) 713–716. memory, Curr. Biol. 21 (2011) 848–854. [21] A. Kjenseth, T. Fykerud, E. Rivedal, E. Leithe, Regulation of gap junction intercel- [53] T. Nogi, M. Levin, Characterization of innexin gene expression and functional lular communication by the ubiquitin system, Cell Signal 22 (2010) 1267–1273. roles of gap-junctional communication in planarian regeneration, Dev. Biol. [22] H.D. Gabriel, D. Jung, C. Butzler, A. Temme, O. Traub, E. Winterhager, K. Willecke, 287 (2005) 314–335. Transplacental uptake of glucose is decreased in embryonic lethal [54] K. Agata, Y. Umesono, Brain regeneration from pluripotent stem cells in planar- connexin26-deficient mice, J. Cell Biol. 140 (1998) 1453–1461. ian, Philos. Trans. R. Soc. Lond. B Biol. Sci. 363 (2008) 2071–2078. [23] G. Seifert, C. Steinhauser, Neuron–astrocyte signaling and epilepsy, Exp. Neurol. [55] K. Agata, K. Watanabe, Molecular and cellular aspects of planarian regeneration, (2011) (Electronic publication ahead of print). Semin. Cell Dev. Biol. 10 (1999) 377–383. [24] C.K. Abrams, S.S. Scherer, Gap junctions in inherited human disorders of the cen- [56] P.A. Newmark, A. Sanchez Alvarado, Not your father's planarian: a classic model tral nervous system, Biochim. Biophys. Acta (2011) (Electronic publication enters the era of functional genomics, Nat. Rev. Genet. 3 (2002) 210–219. ahead of print). [57] P.W. Reddien, A. Sanchez Alvarado, Fundamentals of planarian regeneration, [25] K. Willecke, J. Eiberger, J. Degen, D. Eckardt, A. Romualdi, M. Guldenagel, U. Annu. Rev. Cell Dev. Biol. 20 (2004) 725–757. Deutsch, G. Sohl, Structural and functional diversity of connexin genes in the [58] E. Saló, The power of regeneration and the stem-cell kingdom: freshwater pla- mouse and human genome, Biol. Chem. 383 (2002) 725–737. narians (Platyhelminthes), Bioessays 28 (2006) 546–559. [26] T. Adell, F. Cebria, E. Salo, Gradients in planarian regeneration and homeostasis, [59] A. Sánchez Alvarado, Planarian regeneration: its end is its beginning, Cell 124 Cold Spring Harbor Perspect. Biol. 2 (2010) a000505. (2006) 241–245. [27] R.W. Taylor, Y.W. Hsieh, J.T. Gamse, C.F. Chuang, Making a difference together: [60] L. Gentile, F. Cebria, K. Bartscherer, The planarian flatworm: an in vivo model for reciprocal interactions in C. elegans and zebrafish asymmetric neural develop- stem cell biology and nervous system regeneration, Dis. Model. Mech. 4 (2011) ment, Development 137 (2010) 681–691. 12–19. [28] M. Levin, M. Mercola, Gap junctions are involved in the early generation of left– [61] N.J. Oviedo, C.L. Nicolas, D.S. Adams, M. Levin, Planarians: a versatile and power- right asymmetry, Dev. Biol. 203 (1998) 90–105. ful model system for molecular studies of regeneration, adult stem cell regula- [29] M. Levin, M. Mercola, Gap junction-mediated transfer of left–right patterning tion, aging, and behavior, Cold Spring Harb. Protoc. 3 (2008) 862–868. signals in the early chick blastoderm is upstream of Shh asymmetry in the [62] F. Cebrià, Regenerating the central nervous system: how easy for planarians! node, Development 126 (1999) 4703–4714. Dev. Genes Evol. 217 (2007) 733–748. [30] L.N. Vandenberg, M. Levin, Perspectives and open problems in the early phases [63] F. Cebrià, Organization of the nervous system in the model planarian Schmidtea of left–right patterning, Semin. Cell Dev. Biol. 20 (2009) 456–463. mediterranea: an immunocytochemical study, Neurosci. Res. 61 (2008) [31] L.N. Vandenberg, M. Levin, Far from solved: a perspective on what we know 375–384. about early mechanisms of left–right asymmetry, Dev. Dyn. 239 (2010) [64] Y. Umesono, J. Tasaki, K. Nishimura, T. Inoue, K. Agata, Regeneration in an evolu- 3131–3146. tionarily primitive brain—the planarian Dugesia japonica model, Eur. J. Neurosci. [32] R. Bauer, B. Loer, K. Ostrowski, J. Martini, A. Weimbs, H. Lechner, M. Hoch, Inter- 34 (2011) 863–869. cellular communication: the Drosophila innexin multiprotein family of gap junc- [65] E. Saló, J. Baguñà, Regeneration and pattern formation in planarians II. Local or- tion proteins, Chem. Biol. 12 (2005) 515–526. igin and role of cell movements in blastema formation, Development 107 [33] M. Levin, Large-scale biophysics: ion flows and regeneration, Trends Cell Biol. 17 (1989) 69–76. (2007) 261–270. [66] D.E. Wagner, I.E. Wang, P.W. Reddien, Clonogenic neoblasts are pluripotent [34] E. Oviedo-Orta, M. Perreau, W.H. Evans, I. Potolicchio, Control of the prolifera- adult stem cells that underlie planarian regeneration, Science 332 (2011) tion of activated CD4+ T cells by connexins, J. Leukoc. Biol. 88 (2010) 79–86. 811–816. [35] S.I. Tazuke, C. Schulz, L. Gilboa, M. Fogarty, A.P. Mahowald, A. Guichet, A. [67] P. Newmark, A. Sánchez Alvarado, Bromodeoxyuridine specifically labels the re- Ephrussi, C.G. Wood, R. Lehmann, M.T. Fuller, A germline-specific gap junction generative stem cells of planarians, Dev. Biol. 220 (2000) 142–153. protein required for survival of differentiating early germ cells, Development [68] J.P. Brockes, Amphibian limb regeneration: rebuilding a complex structure, Sci- 129 (2002) 2529–2539. ence 276 (1997) 81–87. [36] M. Vinken, E. Decrock, E. De Vuyst, R. Ponsaerts, C. D'Hondt, G. Bultynck, L. [69] V. French, P.J. Bryant, S.V. Bryant, Pattern regulation in epimorphic fields, Sci- Ceelen, T. Vanhaecke, L. Leybaert, V. Rogiers, Connexins: sensors and regulators ence 193 (1976) 969–981. of cell cycling, Biochim. Biophys. Acta 1815 (2011) 13–25. [70] A. Satoh, G.M. Cummings, S.V. Bryant, D.M. Gardiner, Regulation of proximal– [37] M. Vinken, E. Decrock, L. Leybaert, G. Bultynck, B. Himpens, T. Vanhaecke, V. distal intercalation during limb regeneration in the axolotl (Ambystoma mexica- Rogiers, Non-channel functions of connexins in cell growth and cell death, Bio- num), Dev. Growth Differ. 52 (2010) 785–798. chim. Biophys. Acta (2011) (Electronic publication ahead of print). [71] D.L. Stocum, J.A. Cameron, Looking proximally and distally: 100 years of limb re- [38] N.J. Oviedo, J. Morokuma, P. Walentek, I.P. Kema, M.B. Gu, J.M. Ahn, J.S. Hwang, T. generation and beyond, Dev. Dyn. 240 (2011) 943–968. Gojobori, M. Levin, Long-range neural and gap junction protein-mediated cues [72] E.M. Tanaka, Regeneration: if they can do it, why can't we? Cell 113 (2003) control polarity during planarian regeneration, Dev. Biol. 339 (2010) 188–199. 559–562. [39] J.E. Trosko, The role of stem cells and gap junctions as targets for cancer chemo- [73] K. Agata, T. Tanaka, C. Kobayashi, K. Kato, Y. Saitoh, Intercalary regeneration in prevention and chemotherapy, Biomed. Pharmacother. 59 (Suppl. 2) (2005) planarians, Dev. Dyn. 226 (2003) 308–316. S326–S331. [74] H.V. Brøndsted, Planarian Regeneration, 1st ed. Pergamon Press, London, 1969. [40] Y. Omori, H. Yamasaki, Mutated connexin43 proteins inhibit rat glioma cell [75] V. French, Leg regeneration in the cockroach, Blatella germanica. II. Regeneration growth suppression mediated by wild-type connexin43 in a from a non-congruent tibial graft/host junction, J. Embryol. Exp. Morphol. 35 dominant-negative manner, Int. J. Cancer 78 (1998) 446–453. (1976) 267–301. [41] Y. Omori, M.L. Zaidan Dagli, K. Yamakage, H. Yamasaki, Involvement of gap junc- [76] E. Saló, J. Baguñà, Proximal and distal transformation during intercalary regener- tions in tumor suppression: analysis of genetically-manipulated mice, Mutat. ation in the planarian Dugesia (S) mediterranea, Roux Arch. Dev. Biol. 194 (1985) Res. 477 (2001) 191–196. 364–368. [42] Z.Q. Zhang, Y. Hu, B.J. Wang, Z.X. Lin, C.C. Naus, B.J. Nicholson, Effective asymme- [77] H.V. Brøndsted, Further experiments on regeneration-problems in planarians, K. try in gap junctional intercellular communication between populations of Dan. Vidensk Selsk. Biol. Medd. 17 (1942) 1–28. T.H. Peiris, N.J. Oviedo / Biochimica et Biophysica Acta 1828 (2013) 109–117 117

[78] A.D. Hoptak-Solga, S. Nielsen, I. Jain, R. Thummel, D.R. Hyde, M.K. Iovine, Con- [102] C.P. Petersen, P.W. Reddien, Polarized notum activation at wounds inhibits nexin43 (GJA1) is required in the population of dividing cells during fin regen- Wnt function to promote planarian head regeneration, Science 332 (2011) eration, Dev. Biol. 317 (2008) 541–548. 852–855. [79] J. Bohrmann, J. Zimmermann, Gap junctions in the ovary of Drosophila [103] P.W. Reddien, A.L. Bermange, A.M. Kicza, A. Sánchez Alvarado, BMP signaling melanogaster: localization of innexins 1, 2, 3 and 4 and evidence for inter- regulates the dorsal planarian midline and is needed for asymmetric regenera- cellular communication via innexin-2 containing channels, BMC Dev. Biol. tion, Development 134 (2007) 4043–4051. 8 (2008) 111. [104] M.A. Gavino, P.W. Reddien, A Bmp/Admp regulatory circuit controls mainte- [80] H. Li, X. Chen, F. Zhang, J. Ma, C. Xu, Expression patterns of the cell nance and regeneration of dorsal–ventral polarity in planarians, Curr. Biol. 21 junction-associated genes during rat liver regeneration, J. Genet. Genomics 34 (2011) 294–299. (2007) 892–908. [105] C.P. Petersen, P.W. Reddien, A wound-induced Wnt expression program controls [81] C. Haupt, O.W. Witte, C. Frahm, Up-regulation of Connexin43 in the glial scar planarian regeneration polarity, Proc. Natl. Acad. Sci. U. S. A. 106 (2009) following photothrombotic ischemic injury, Mol. Cell. Neurosci. 35 (2007) 17061–17066. 89–99. [106] M.D. Molina, A. Neto, I. Maeso, J.L. Gomez-Skarmeta, E. Salo, F. Cebria, Noggin [82] R.E. Gordon, B.P. Lane, M. Marin, Regeneration of rat tracheal epithelium: and noggin-like genes control dorsoventral axis regeneration in planarians, changes in gap junctions during specific phases of the cell cycle, Exp. Lung Curr. Biol. 21 (2011) 300–305. Res. 3 (1982) 47–56. [107] T. Adell, E. Salo, M. Boutros, K. Bartscherer, Smed-Evi/Wntless is required for [83] B. Homkajorn, N.R. Sims, H. Muyderman, Connexin 43 regulates astrocytic mi- beta-catenin-dependent and -independent processes during planarian regener- gration and proliferation in response to injury, Neurosci. Lett. 486 (2010) ation, Development 136 (2009) 905–910. 197–201. [108] M. Iglesias, J.L. Gomez-Skarmeta, E. Salo, T. Adell, Silencing of [84] C.M. Wang, J. Lincoln, J.E. Cook, D.L. Becker, Abnormal connexin expression Smed-betacatenin1 generates radial-like hypercephalized planarians, Develop- underlies delayed wound healing in diabetic skin, Diabetes 56 (2007) ment 135 (2008) 1215–1221. 2809–2817. [109] K.A. Gurley, S.A. Elliott, O. Simakov, H.A. Schmidt, T.W. Holstein, A. Sánchez [85] D.L. Becker, C. Thrasivoulou, A.R. Phillips, Connexins in wound healing; perspec- Alvarado, Expression of secreted Wnt pathway components reveals unexpected tives in diabetic patients, Biochim. Biophys. Acta (2011) (Electronic publication complexity of the planarian amputation response, Dev. Biol. 347 (2010) 24–39. ahead of print). [110] A. Kumar, J.W. Godwin, P.B. Gates, A.A. Garza-Garcia, J.P. Brockes, Molecular [86] A. Cheng, H. Tang, J. Cai, M. Zhu, X. Zhang, M. Rao, M.P. Mattson, Gap junctional basis for the nerve dependence of limb regeneration in an adult vertebrate, Sci- communication is required to maintain mouse cortical neural progenitor cells in ence 318 (2007) 772–777. a proliferative state, Dev. Biol. 272 (2004) 203–216. [111] M. Singer, The influence of the nerve in regeneration of the amphibian extrem- [87] G. Lemaitre, V. Sivan, J. Lamartine, J.M. Cosset, B. Cavelier-Balloy, D. Salomon, G. ity, Q. Rev. Biol. 27 (1952) 169–200. Waksman, M.T. Martin, Connexin 30, a new marker of hyperproliferative epider- [112] A. Kumar, P.B. Gates, J.P. Brockes, Positional identity of adult stem cells in sala- mis, Br. J. Dermatol. 155 (2006) 844–846. mander limb regeneration, C. R. Biol. 330 (2007) 485–490. [88] C.D. McCaig, A.M. Rajnicek, B. Song, M. Zhao, Controlling cell behavior electrical- [113] J. Best, J. Noel, Complex synaptic configurations in planarian brain, Science 164 ly: current views and future potential, Physiol. Rev. 85 (2005) 943–978. (1969) 1070–1071. [89] R. Nuccitelli, A role for endogenous electric fields in wound healing, Curr. Top. [114] J.B. Best, A.B. Goodman, A. Pigon, Fissioning in planarians: control by the brain, Dev. Biol. 58 (2003) 1–26. Science 164 (1969) 565–566. [90] M. Zhao, Electrical fields in wound healing—an overriding signal that directs cell [115] R.A. Flickinger, S.J. Coward, The induction of cephalic differentiation in regener- migration, Semin. Cell Dev. Biol. 20 (2009) 674–682. ating Dugesia dorotocephala in the presence of the normal head and in [91] M.G. Todorova, B. Soria, I. Quesada, Gap junctional intercellular communication unwounded tails, Dev. Biol. 5 (1962) 179–204. is required to maintain embryonic stem cells in a non-differentiated and prolif- [116] T. Lender, A. Gabriel, Etude histochimique des néoblastes de Dugesia lugubris erative state, J. Cell. Physiol. 214 (2008) 354–362. (Turbellarié, Triclade) avant et pendent la régénération, Bull. Soc. Zool. Fr. 85 [92] P.W. Reddien, Constitutive gene expression and the specification of tissue iden- (1960) 100–110. tity in adult planarian biology, Trends Genet. 27 (2011) 277–285. [117] R. Bruzzone, S.G. Hormuzdi, M.T. Barbe, A. Herb, H. Monyer, Pannexins, a family [93] D.J. Forsthoefel, P.A. Newmark, Emerging patterns in planarian regeneration, of gap junction proteins expressed in brain, Proc. Natl. Acad. Sci. U. S. A. 100 Curr. Opin. Genet. Dev. 19 (2009) 412–420. (2003) 13644–13649. [94] A.A. Aboobaker, Planarian stem cells: a simple paradigm for regeneration, [118] W.A. Ayad, D. Locke, I.V. Koreen, A.L. Harris, Heteromeric, but not homomeric, Trends Cell Biol. 21 (2011) 304–311. connexin channels are selectively permeable to inositol phosphates, J. Biol. [95] C.P. Petersen, P.W. Reddien, Wnt signaling and the polarity of the primary body Chem. 281 (2006) 16727–16739. axis, Cell 139 (2009) 1056–1068. [119] A.P. Moreno, V.M. Berthoud, G. Perez-Palacios, E.M. Perez-Armendariz, Biophys- [96] M.D. Molina, E. Salo, F. Cebria, Organizing the DV axis during planarian regener- ical evidence that connexin-36 forms functional gap junction channels between ation, Commun. Integr. Biol. 4 (2011) 498–500. pancreatic mouse beta-cells, Am. J. Physiol. Endocrinol. Metab. 288 (2005) [97] H. Meinhardt, Beta-catenin and axis formation in planarians, Bioessays 31 E948–E956. (2009) 5–9. [120] C. Lehmann, H. Lechner, B. Loer, M. Knieps, S. Herrmann, M. Famulok, R. Bauer, [98] M. Iglesias, M. Almuedo-Castillo, A.A. Aboobaker, E. Salo, Early planarian brain M. Hoch, Heteromerization of innexin gap junction proteins regulates epithelial regeneration is independent of blastema polarity mediated by the Wnt/beta- tissue organization in Drosophila, Mol. Biol. Cell 17 (2006) 1676–1685. catenin pathway, Dev. Biol. 358 (2011) 68–78. [121] W.S. Beane, J. Morokuma, D.S. Adams, M. Levin, A chemical genetics approach [99] J.C. Rink, K.A. Gurley, S.A. Elliott, A. Sanchez Alvarado, Planarian Hh signaling reveals H, K-ATPase-mediated membrane voltage is required for planarian regulates regeneration polarity and links Hh pathway evolution to cilia, Science head regeneration, Chem. Biol. 18 (2011) 77–89. 326 (2009) 1406–1410. [122] T. Nogi, D. Zhang, J.D. Chan, J.S. Marchant, A novel biological activity of prazi- [100] S. Yazawa, Y. Umesono, T. Hayashi, H. Tarui, K. Agata, Planarian Hedgehog/ quantel requiring voltage-operated Ca2+ channel beta subunits: subversion of Patched establishes anterior–posterior polarity by regulating Wnt signaling, flatworm regenerative polarity, PLoS Negl. Trop. Dis. 3 (2009) e464. Proc. Natl. Acad. Sci. U. S. A. 106 (2009) 22329–22334. [123] D. Zhang, J.D. Chan, T. Nogi, J.S. Marchant, Opposing roles of voltage-gated Ca2+ [101] T. Hayashi, M. Motoishi, S. Yazawa, K. Itomi, C. Tanegashima, O. Nishimura, K. channels in neuronal control of regenerative patterning, J. Neurosci. 31 (2011) Agata, H. Tarui, A LIM-homeobox gene is required for differentiation of 15983–15995. Wnt-expressing cells at the posterior end of the planarian body, Development [124] T.H. Morgan, Experimental studies of the regeneration of Planaria maculata, 138 (2011) 3679–3688. Arch. Entwickl. Mech. Org. 7 (1898) 364–397. Seminars in Immunology 26 (2014) 295–302

Contents lists available at ScienceDirect

Seminars in Immunology

journal homepage: www.elsevier.com/locate/ysmim

Review Innate immune system and tissue regeneration in planarians: An area ripe for exploration

T. Harshani Peiris a,b, Katrina K. Hoyer a,b,c,∗, Néstor J. Oviedo a,b,c,∗ a Department of Molecular Cell Biology, School of Natural Sciences, University of California at Merced, 5200 North Lake Road, Merced, CA 95343, USA b Quantitative and Systems Biology Graduate Program, University of California at Merced, 5200 North Lake Road, Merced, CA 95343, USA c Health Sciences Research Institute, University of California at Merced, 5200 North Lake Road, Merced, CA 95343, USA article info a b s t r a c t

Keywords: The immune system has been implicated as an important modulator of tissue regeneration. However, the Planarian mechanisms driving injury-induced immune response and tissue repair remain poorly understood. For Regeneration over 200 years, planarians have been a classical model for studies on tissue regeneration, but the planarian Innate immunity immune system and its potential role in repair is largely unknown. We found through comparative Wound repair genomic analysis and data mining that planarians contain many potential homologs of the innate immune system that are activated during injury and repair of adult tissues. These ﬁndings support the notion that the relationship between adult tissue repair and the immune system is an ancient feature of basal Bilateria. Further analysis of the planarian immune system during regeneration could potentially add to our understanding of how the innate immune system and inﬂammatory responses interplay with regenerative signals to induce scar-less tissue repair in the context of the adult organism. © 2014 Elsevier Ltd. All rights reserved.

1. Introduction Upon injury the host-mediated immune response not only defends against infection, it facilitates the removal of cellular debris The process by which form and function is reestablished after near the site of the wound. These functions may also modulate tissue injury has puzzled the scientific community for hundreds the cellular response that initiates repair and reestablishes tissue of years [1–3]. Tissue injury triggers localized and systemic signals function. It is conceivable that both the injury-induced immune that orchestrate mechanical and cellular responses aimed at reduc- response and the process of tissue repair evolved together to ing the surface area of the wound, repair damage, and coordinating promote and preserve multicellularity. The possibility of shared functional integration between new and pre-existing structures origin is supported by the fact that regeneration is an attribute [4,5]. The immune system and the inflammatory responses asso- widely distributed across multicellular organisms, and immunity ciated with injury have been implicated as critical modulators is an ancient feature that emerged from the common ancestor of wound repair and regeneration [6–10]. For instance, effective of Cnidaria and Bilateria [12–18]. Coexistence of both regenera- repair of wounded skin in mammals, and regeneration of complex tion and the immune system is observed in the simplest animals structures in amphibians (e.g. tail and limbs) rely on the cor- such as the diploblastic cnidarian Hydra, which regenerate entire rect synchronization of the immune response upon injury [6–11]. body parts in presence of a primitive complement system and Recent studies suggest that the difference in regenerative capacity which have many genes associated with the mammalian immune of some species is inversely correlated with the complexity of the response [16,17,19,20]. Evaluating the evolution and intermingling immune system (Fig. 1) [7,9]. However, the mechanisms integrat- of the immune response and process of regeneration following ing immune responses to injury and the process of tissue repair injury may provide a new depth to our understanding of tissue remain poorly understood. repair mechanisms across the animal kingdom. Planarians are non-parasitic flatworms that provide compelling evolutionary reasons to analyze injury-induced immune responses and the process of regeneration in metazoans [21,22]. Planari- ∗ Corresponding authors at: Department of Molecular Cell Biology, School of Nat- ans display bilateral symmetry and derivatives of all three germ ural Sciences, University of California at Merced, 5200 North Lake Road, Merced, CA layers (ectoderm, mesoderm and endoderm). Adult planarians 95343, USA. Tel.: +1 209 228 4541. E-mail addresses: [email protected] (K.K. Hoyer), can regenerate any part of their body and constantly renew [email protected] (N.J. Oviedo). aging and damaged tissues (Fig. 2), which are features missing http://dx.doi.org/10.1016/j.smim.2014.06.005 1044-5323/© 2014 Elsevier Ltd. All rights reserved.

296 T.H. Peiris et al. / Seminars in Immunology 26 (2014) 295–302

in other commonly used invertebrate models (e.g. Drosophila and

Caenorhabditis elegans). Regeneration and adult tissue turnover in

planarians proceed through activation of somatic stem cells known

as neoblasts [23–25]. Planarians have provided a classical model

to study regeneration for over 200 years, but their immune sys-

tem remains largely unexplored [1,26–28]. To our knowledge, no

systematic analysis of the planarian immune system has been

published to date. We present a brief survey of the most salient

components of the innate immune system through genomic anal-

ysis between the freshwater planarian Schmidtea mediterranea and

other animal species. We analyzed two sources: the S. mediter-

ranea genome database, SmedGD [29] and transcriptomic work of

Sandman et al. [30] to evaluate genes associated with the immune

system and their expression during regeneration. Our ﬁndings sug-

gest evolutionary conservation of the triclad immune system. We

identiﬁed components of the S. mediterranea immune system that

may protect against infections, distinguish between commensal

and pathogenic microorganisms, and that actively participate dur-

ing wound repair, regeneration and maintenance of adult tissues.

Fig. 1. Inverse correlation between immune system complexity and regenerative

capacity. With increasing complexity of the immune system, the regenerative capac-

ity of the organism is decreased. In some invertebrate species without an adaptive

immune system, and salamanders with a more complex immune system scar-less

2. The planarian model system and tissue regeneration

repair occurs. In contrast, mammals tend to have scar-forming injury repair and

reduced regenerative capacity.

Planarians are known for their extraordinary capacity to regen-

erate adult tissues. These animals can regenerate any part of their

body including their entire digestive system, brain and neural

connections, muscles, and connective tissues. Planarians are easy

and inexpensive to maintain under laboratory conditions and are

amenable to molecular, genetic, behavioral and computational

analysis [1,26,31–34]. During the past 20 years, planarian research

has attracted attention due to the accessibility of this model

organism and the opportunities to progress our understanding in

long standing biomedical problems associated with regeneration,

cancer and degenerative diseases. Several tools available to aid

in the study of planarians, include the S. mediterranea genome,

proteomic data, results from high-throughput RNAi-screens and

transcriptomic analysis [1,25,26,29,32,34–38]. Altogether with the

availability of standard genetic and biochemical techniques, pla-

narians present an attractive model to study wound repair and

regeneration and the possible interplay of the immune system dur-

ing these processes.

Detailed information about the biology of planarians and recent

advances on research pertaining to its regenerative capacities has

been reviewed elsewhere [1,23–25,28]. In this section, we aim

at providing a brief overview of the process of regeneration in

S. mediterranea, the most commonly used planarian species. Pla-

narian regeneration is quick, taking about a week to reestablish

form and function. Immediately following amputation, contraction

around the injury reduces the damaged surface. In the ﬁrst 24 h

+ +

local cell death peaks, followed by neoblast proliferation and H /K -

ATPase-mediated tissue depolarization around the wounded area

[39–42]. The antagonistic process of cell death and proliferation

around the injured area is critical for the progression of regenera-

+ +

tion. The H /K -ATPase-mediated ion ﬂux and consequent tissue

depolarization is required for anterior tissue speciﬁcation and

may provide signaling that guides neoblast proliferation, migration

and remodeling [5,39,40]. Decisions regarding polarity are deﬁned

within the ﬁrst few hours post-amputation and differentiated tis-

sues may provide molecular cues and guidance during regeneration

Fig. 2. The planarian Schmidtea mediterranea constantly renew aging and damaged

[1,25,28,43]. Neoblasts, the only dividing cells in adult planarians

tissues, and can regenerate any part of their body upon injury. (A) Adult specimen

of S. mediterranea. Red dotted line describes plan of amputation. (B) Regeneration serve as the exclusive source of new cells during the formation of

of the anterior part including the entire brain, part of the digestive system, muscles,

the blastema (a regenerative outgrowth around the injured area).

and other derivatives of the three embryonic germ layers are re-established in only 7

Neoblast division gives rise to cellular progeny that migrate

days after decapitation. After amputation, tissue contraction around the injured area

and differentiate within the blastema. Remodeling and integration

is followed by formation of the regenerative blastema, which is the unpigmented

tissue where the progeny of the dividing neoblasts is instructed to recreate the between the new and pre-existing tissue is an active process during

␮

missing parts. Scale bar is 200 m. regeneration but little is known about the signals mediating these

T.H. Peiris et al. / Seminars in Immunology 26 (2014) 295–302 297

Table 1

Potential candidate genes of the planarians innate immune system.

Innate immune component Domain found Maker ID from Planarian database

Toll-like receptor (TLR) or MyD88 or CD14 Leucine rich repeat mk4.000112.15, mk4.000148.12,

mk4.002858.00, mk4.007365.00,

mk4.019024.00, mk4.026212.00

TIR domain mk4.000285.01, mk4.000346.04,

mk4.027932.00

SARM 1 SAM domain + TIR domain mk4.008544.03

Selectins C-type lectin like domain mk4.000042.08, mk4.000389.11,

mk4.020584.01

Complement CUB domain mk4.001431.05, mk4.001438.03,

mk4.000798.07, mk4.003730.02, mk4.007851.01

Alpha2-macroglobulin mk4.004852.05, mk4.014934.00,

mk4.043975.00, mk4.008692.00,

mk4.008429.01, mk4.043975.00

C1q domain mk4.008251.00

Complement factors or Integrins Von Willebrand factor type A domain mk4.007402.00

Cell adhesion molecules (ICAM, VCAM) Immunoglobulin I-set domain mk4.006497.00

Urokinase-type plasminogen activator Kringle Domain mk4.000652.03

IRAK like kinase I Possible IRAK similar to C. elegans and Protein Kinase domain mk4.004443.00, mk4.004443.01, mk4.027874.00

TRAF-6 zn ﬁnger domain of TRAF and mk4.000002.01–mk4.000002.47

TRAF MATH domain

TRAF related MATH domains mk4.000007.04–mk4.000007.34

Source: SmedGD [29].

events. The planarian model provides the opportunity to analyze recognized by host pathogen recognition receptors (PRR) expressed

local and systemic signaling during tissue repair and regeneration, on host cells. In vertebrates, recognition of pathogens through these

providing a unique prospective for understanding injury-immune PRRs results in inﬂammatory signals, differentiation of immune

responses in the adult body. cells and migration of leukocytes into infected or damaged tissue

[53].

3. The planarian innate immune system The planarian immune system remains largely unexplored, but

it is known that under laboratory conditions planarians suffer from

The immune system in adult animals is essential to maintain- infection just as other eukaryotic species, with bacterial infection

ing body homeostasis as it distinguishes between commensal and a common threat in routine maintenance [54]. Treatment with

pathogenic microorganisms, protects against infections, and serves antibiotics usually resolves the infection but it is unknown what

as a signaling system during tissue repair. Most studies associat- types of bacteria commonly infect S. mediterranea under labora-

ing the immune system and ﬂatworms focus on parasitic species tory conditions. Nonetheless, a mechanism of pathogen recognition

that invade and activate host immune responses [44–46]. There is a must exist in S. mediterranea to prevent or control these infec-

wealth of literature associated with this aspect of host-interaction tions. Histological and functional work identiﬁed active phagocytic

that has important practical and clinical applications and is dis- cells around areas of wounding; suggesting the possibility that a

cussed elsewhere [44–46]. We instead concentrate on the immune primitive innate immune system participates during tissue repair,

response against pathogens that invade non-parasitic planarians cancer, and infection [55–57]. Table 1 includes a collection of can-

and the injury-immune activation associated with adult tissue didate genes from the S. mediterranea genome that are potential

regeneration. components of the innate immune system [29]. Table 2 provides a

The immune response is comprised of two parts: the innate sample of candidate genes of the innate immune system and their

and adaptive responses. Innate immune responses make up the expression during head regeneration in S. mediterranea [30]. Details

ﬁrst responders of the immune system and impart broad (often about these planarian candidate innate immune genes are provided

termed non-speciﬁc) protection from classes of pathogens. This below.

response is immediate, occurring within only a few hours of infec-

tion. The innate immune system provides the ﬁrst line of defense 3.1. Mucus and anti-microbial peptides

giving the adaptive (or acquired) immune response the days to

weeks needed to fully develop. The adaptive immune system then Surfaces that secrete mucus are highly susceptible to pathogens

has the task of clearing the microbial infection using pathogen- and mucosal surfaces are known to contain large amounts of

speciﬁc immune responses [47,48]. There is no systematic proof bacteria that could be pathogenic or symbionts [58,59]. Mucus con-

of an advanced adaptive immune response in invertebrate animals taining antimicrobial activity can be generated as a front line of

[49]. On the other hand, innate immune responses are markedly defense. Microbial adhesion to mucus limits colonization of the

similar between many invertebrates and vertebrates [50–52]. pathogens, providing a defense mechanism to infection [60]. Pla-

The innate immune system is the ﬁrst barrier of defense against narians are normally covered by a thin layer of mucus that may

invasive microbes. It is comprised of many players, from the physi- act as a protective barrier and allows the presence of commen-

cal barrier and secretion of mucus, anti-microbial peptides, fatty sal microorganisms. Stressful situations, such as wounding, in S.

acids and lysozymes to phagocytes that capture and digest the mediterranea induces secretion of mucus that may have a dou-

invading pathogens [53]. Microbes express classes of surface pro- ble role in blocking pathogen entry and aiding in the healing

teins, termed pathogen-associated molecular patterns, which are process. Recent evidence suggests that planarian derived mucus

298 T.H. Peiris et al. / Seminars in Immunology 26 (2014) 295–302

Table 2

Expression of innate immune candidate genes during planarian regeneration. From transcriptomic analysis of head regeneration performed by Sandmann et al. [30].

Innate immune component Domain found Maker ID Time post-amputation

1 h 6 h 10–18 h 24–72 h

↑ ↑ ↑ ↑

Toll Like Receptor (TLR) or MyD88 Leucine rich repeat mk4.007365.00

Leucine rich repeat mk4.002858.00 ↑ ↑ ↑ ↑

↑

↑ ↓ ↓

TIR domain mk4.000285.01

Selectins C-type lectin like domain mk4.000389.11 ↑ ↓ ↑ ↑

C-type lectin like domain mk4.020584.01 ↓ ↓ ↑ ↑

Complement CUB domain mk4.000798.07 ↓ ↑ ↑ ↑

CUB domain mk4.003730.02 ↑ ↑ ↓ ↓

CUB domain mk4.001431.05 ↑ ↓ ↓ ↓

↓ ↓ ↑

alpha2-macroglobulin mk4.005639.01 ↑

↓

alpha2-macroglobulin mk4.008692.00 ↓ ↑ ↑

↑

C1q domain mk4.008251.00 ↑ ↓ ↓

Complement factors or Integrins Von Willebrand factor type A domain mk4.007402.00 ↓ ↑ ↑ ↓

IRAK like kinase I Possible IRAK similar to C. elegans and mk4.027874.00 ↑ ↑ ↓ ↓

Protein Kinase domain

TRAF-6 zn ﬁnger domain of TRAF mk4.000002.06 ↑ ↑ ↑ ↑

TRAF MATH domain mk4.000002.07 ↑ ↑ ↑ ↑

proteins display similarities with mucosal secretion from humans Our analysis of the planarian genome identiﬁed several gene

[35]. However it is unclear whether wound repair and regeneration segments that contain LRRs (mk4.007365.00, mk4.002858.00,

in planarians require components of the mucus to repair tissue. mk4.000112.15, mk4.026212.00, mk4.000148.12). Whether these

Anti-microbial peptides are small peptides with clusters of pos- sequence similarities have TLR-like activity or are unrelated repeats

itively charged and hydrophobic amino acids [61]. These small remains to be investigated. CD14, also involved with innate

peptides are evolutionarily conserved and often secreted in mucus immune function contain multiple LRR repeats, and whether the

by phagocytic cells, and are known to have immunomodulatory LRR repeats found in planarians belongs to TLR or CD14 func-

functions [52]. For example, anti-microbial peptides are known to tionality is unknown. Recent transcriptomic analysis performed

be secreted upon injury in insects [62]. Altincicek et al. screened on a head regeneration time course found upregulation of LRR

for septic wounding inducible genes by introducing bacterial homolog mk4.007365.00 and mk4.002858.00 from one to 72 h

lipopolysaccharide into the wound site of planaria, and identi- post-amputation [30].

ﬁed the induction of several potential anti-microbial peptides [63]. A planarian genome wide search for TIR, the cytoplasmic domain

These anti-microbial homologs are likely involved in regulation of of TLR, identiﬁed four TIR-like domain sequences (mk4.008544.03,

commensal bacterial and pathogen killing in planaria. Further a mk4.000285.01, mk4.000346.04, mk4.027932.00). One gene seg-

sequence suggested to be an antimicrobial peptide resistance and ment (mk4.008544.03) contains two SAM domains suggesting that

lipid A acylation protein, PagP, was found within the planarian this might be a SARM1 protein. SARM1 proteins negatively reg-

genome (mk4.054786.01.01). How these anti-microbial peptides ulate innate immune function by blocking signaling downstream

are activated during injury remains to be ascertained. of the PRRs [72]. None of the TIR domain containing gene seg-

ments included any LRR sequences suggesting that these might

not be TLRs, or that the pattern recognition motifs in the planaria

3.2. Pathogen recognition receptors differ from traditional LRR repeats. One TIR-like sequence in pla-

naria (mk4.000285.01) is also upregulated for 6 h post-amputation

Initiation of innate immune responses relies on early signals [30]. Upregulation of these TIR and LRR motifs may correspond with

following recognition of pathogen- or damage-associated molecu- detection of, or response to, infection during injury, and warrants

lar patterns (PAMPs and DAMPs) [64]. These early events involve further attention.

recognition of molecules such as lipopolysaccharide, ﬂagellin or Mammalian TLR family members share several signaling

dsRNA, found on or in invading pathogens or released by damaged molecules including the adaptor protein MyD88, TRAF6 (TNF

and dying cells [64]. Two members of the PRR family, NOD-like receptor-associated kinase 1), the protein kinase IRAK (IL-1R-

receptors and toll-like receptors (TLRs) are conserved from early associated kinase) and TAK1 (TGF-beta-activated kinase) binding

invertebrates to mammals and are maintained with a small number protein. MyD88 protein also contains a TIR domain and a death

of protein structures [65]. domain. Though we found no signiﬁcant homology for death

TLRs are comprised of a cytoplasmic tail, a transmembrane and domains near the four planarian TIR domains, we cannot elimi-

an extracellular domain that contains leucine rich repeat (LRR) nate the existence of a MyD88-like adaptor protein in planaria.

motifs [66]. Based on chrystallographic studies LRRs are shaped in TRAF proteins contain three domains: a MATH domain, RING-

a 3D horseshoe format that contain the leucine rich repeats. This type zinc ﬁnger domains and TRAF-type zinc ﬁnger domains.

domain is important for interaction with other molecules, pathogen Analysis of the planarian genome identiﬁed MATH homologs

detection and provides structure [66,67]. In mammals interac- domains (mk4.000007.00 and mk4.000002). The gene segments

tions through these LRRs trigger a conformation change to the TLR between mk4.000002.00.01 and mk4.000002.33.01 contains both

that results in a signaling cascade that activates proinﬂammatory MATH and RING-type zinc ﬁnger domains and is upregulated

cytokines and type 1 interferons [68]. LRRs are highly conserved throughout regeneration [30]. Region mk4.000007.00 also remain

across species, and their primary function is in the formation upregulated 1–72 h post-amputation. The gene segments between

of protein–protein interactions [67]. Vertebrate and invertebrates mk4.000002.00.01 and mk4.000002.33.01 contains both Math and

have various numbers of TLRs each with speciﬁc functions, mostly RING-type zinc ﬁnger domains and is also upregulated through-

targeted toward pathogen recognition [69–71]. out regeneration. We identiﬁed one possible TAK1 homolog

T.H. Peiris et al. / Seminars in Immunology 26 (2014) 295–302 299

(mk4.001525.00.01) that is relatively upregulated through the injury in the presence of bacteria, the reticular cell migrates into the

regeneration time course [30]. Possible homologs for IRAK also can wound, phagocytoses and encapsulate bacteria. Reticular cells thus

be found within the genome, but with no signiﬁcant up/down regu- have the capability to recognize foreign particles as distinct from

lation during regeneration (mk4.004443.00, mk4.004443.01). IRAK self, migrate and phagocytose pathogens. Phagocytic engulfment

proteins contain kinase domains and mk4.027874.00 a homologous of cellular debris has also been observed during regeneration after

kinase domain remained upregulated up to 6 h post-amputation. ﬁssioning and after amputation [55–57]. We speculate the reticular

Based on these ﬁndings, it seems likely that planaria have some cells in planarians may represent a primitive form of macrophage.

form of pathogen-recognition and signaling to distinguish between Although it is unconﬁrmed whether planarian phagocytic cells

self-tissue and pathogenic microbes. express PRRs, in other organisms, macrophages are one of the major

cells types that express PRRs and respond to pathogen-associated

3.3. Complement cascade molecular patterns [53,81]. Macrophages produce many proteins

that induce inﬂammation, migration of other cells into the site of

The complement system is a highly conserved component of infection or injury, killing of pathogens and down-modulation of

innate immunity. In mammals, complement functions to recognize these responses following clearance of the infection or damage [78].

and clear invading pathogens by inducing inﬂammatory responses, Perforin is a lytic enzyme produced and secreted by mammalian

activating phagocytic cells and directly lysing microbes [73]. In macrophages that lyses invading pathogens and infected cells. A

mammals the complement system is made up of a cascading membrane attack complex component/perforin/C9 homolog was

series of protein interactions that begin via three independent identiﬁed during sepsis-injury in planaria [63], suggesting a role for

pathogen recognition pathways [73]. These three pathways con- this enzyme in host defense of planaria. Alterations in the debris

verge on one protein C3 and continue through an identical cascade removal process or inﬂammatory responses might alter the ﬁnal

to form a membrane attack complex and amplify inﬂammatory outcome of the repair, thus indicating a potential role for phagocytic

signals. One arm of this system uses antibodies-coated pathogens cells in both host defense and wound repair and regeneration.

in the recognition of pathogens and initiation of the comple- A recently identiﬁed group of molecules secreted by

ment cascade [73]. Although in mammals complement links the macrophages, maresins (macrophage mediators in resolving

innate and adaptive immune responses, the complement sys- inﬂammation) enhance macrophage phagocytosis and limit local

tem appears to be very ancient, with complement-like proteins polymorphonuclear neutrophil inﬁltration [82]. When exposed

found in most invertebrates and vertebrates [17,74,75]. We identi- to human maresin MaR1, the rate of planarian anterior tissue

ﬁed several complement factors and domain homologies within regeneration increased [83]. Further, planaria biosynthesized

the S. mediterranea genome. The CUB domain (for complement MaR1 upon injury, and the formation of MaR1 was blocked by a

C1r/C1s, Uegf, Bmp1) is found in the C1 component of the com- lipoxygenase (LOX) inhibitor, eliminating the enhancement in tis-

plement cascade. We have identiﬁed several homologs for the sue regeneration. Together these data indicate that key planarian

CUB domain (mk4.001431.05, mk4.001438.03, mk4.000798.07, signaling components can respond to human MaR1, and thus

mk4.007851.01, mk4.003730.02) and found mk4.000798.07 to conservation exists between human and planarian maresins and

be upregulated 6 h post-amputation [30]. mk4.001431.05 and their signal cascades. These data further support a link between

mk4.003730.02 which are found adjacent to a Sushi domain immune cell activities and regenerative mechanisms.

(mk4.003591.01), another domain found in the C1 complement

subcomponent, remained upregulated very early during regener-

ation. A C1q-like domain (mk4.008251.00), the C terminal domain 3.5. Cell adhesion molecules

of the C1 enzyme that triggers classical complement activation

[76] was also upregulated post-amputation up to 6 h [30]. Several Cell adhesion molecules are typically transmembrane proteins

C3 complement homologs for the alpha-2-macroglobulin domain expressed on the cell surface. These proteins mediate cell–cell

were also identiﬁed in planaria. As with other early invertebrates, interactions including, signal transduction, cellular communica-

planarians appear to have a conserved complement system that tion, and migration. In mammals, cell adhesion molecules have

may act to control invading pathogens, but this requires conﬁrma- been divided into four families based on protein structure:

tion and further study. Immunoglobulin (Ig) superfamily, cadherins, selectins and inte-

grins [84,85].

3.4. Phagocytic cells (reticulocytes) The Ig superfamily is calcium-independent and composed of

variable numbers of Ig-like repeats. Analysis of the planarian

Macrophages are known to play an important role in the res- genome revealed several Ig-like domains (mk4.006497.00) that are

olution of acute inﬂammation by clearing apoptotic and necrotic commonly found in adhesion molecules such as the ICAMs. The cad-

tissue due to injury and immune responses [77]. Macrophages also herin family, a calcium-dependent cell adhesion molecule, usually

ingest and breakdown invading pathogens and in this way act in contains 3–5 internal repeats of cadherin and form homodimers.

host defense. In mammals macrophages differentiate down two Cadherins play a crucial role in mediating innate and adaptive

distinct pathways dependent upon the local signals encountered. immune functions by maintaining epithelial barrier function and

M1 classical macrophage activation results in macrophages that regulating leukocyte migration [86,87]. Most integrins function as

produce inﬂammatory cytokines and act in host defense to con- receptors for proteins within the extracellular matrix and can bind

trol microbial infections. Alternatively activated macrophages aid to a single ligand or to multiple ligands. In mammals, selectins

in wound repair by phagocytosing damaged tissue and secreting are adhesion molecules with a trans-membrane glycoprotein that

growth factors [78]. Macrophage function is essential during tissue are expressed on leukocytes and activated epithelial cells [88].

repair in most vertebrate animals including mice [79], zebraﬁsh The vertebrate selectin family consists of L-selectin, E-selectin and

[80], and salamanders [8]. However, wound healing in PU.1 mice P-selectin and these are mostly involved with leukocyte hom-

(no neutrophils or macrophages) occurs without scarring, estab- ing and migratory responds to inﬂammation or pathogens. They

lishing alternative regulatory modes for phagocytic cells during mediate leukocyte rolling and adhesion during mammalian wound

regeneration. repair and leukocyte extravasation [89]. Selectins belong to the C-

In planarians, a phagocytic, mesenchymal cell, termed the retic- type lectin superfamily of proteins, are calcium-dependent and are

ular cell has been previously described [55–57]. Within 10 h of widely found in metazoans [90]. Although C-type lectin domains

300 T.H. Peiris et al. / Seminars in Immunology 26 (2014) 295–302

have been linked to a large range of functions, pathogen recognition this mode of immune regulation might not be important in wound

remains a primary function amongst most of this family [90]. repair and regeneration.

Fusaoka et al. recently identiﬁed several vertebrate neural cell

adhesion molecule orthologs in planarian Dugesia japonica that

3.8. Metalloendopeptidases

when knocked-down using RNAi altered neural network mor-

phology [91]. Our analysis of the planarian genome revealed

Metalloendopeptidases are highly conserved across evolution

homologs for several Ig-like domains typically found in adhesion

and are ubiquitously expressed [102,103]. Matrix metallopro-

molecules, integrin-related sequences, C-type lectin domains and

teinases (MMPs) in mammals play a critical role in extracellular

Cys-FGFR domains. Some of these domains were upregulated post-

matrix remodeling and thus wound repair. There are 24 mam-

amputation and remained mostly elevated at 30 min to 72 h [30].

malian MMPs, some that may also have a role in immune responses,

C-type lectin domains are associated with immune responses, cell

activating cytokines and chemokines to induce inﬂammation and

adhesion and cell death [90]. Studies have shown that invertebrate

immunity [104,105]. Injury induces the expression of MMPs, and

genomes have an abundance of C-type lectin-like domains [92].

these perform multiple, distinct functions in wound repair, cell

C-type lectin receptors play a crucial role in pathogen recogni-

migration and bacterial inhibition and killing [106]. MMP-like

tion and could mediate functions associated with cell adhesion. We

proteins have been identiﬁed in a diverse array of invertebrates

found several homologs of C-type lectin domains (mk4.020584.01,

[107,108]. Planarians have four MMP-like genes (Smed-mmp1,

mk4.000042.08, mk4.000389.11) that were upregulated during

Smed-mmp2, Smed-mt-mmpA and Smed-mt-mmpB) with roles in

regeneration in planaria [30]. Analysis of the planarian genome also

proliferation, apoptosis and cell migration [109]. Two of these,

identiﬁed homologs for 8, 11 and 15 cadherins and for E-Cadherin.

Smed-mmp-1 and Dj-mmp-1, are essential for homeostatic remod-

Several of these homologs were upregulated during regenera-

eling of extracellular matrix, but not wound repair [109]. Although

tion. However, the speciﬁc function these proteins during planaria

gene expression was unchanged following wounding, knock-down

wounding and regeneration or in host defense has not been evalu-

of Smed-mt-mmpA resulted in a delay in blastema regeneration

ated.

[109]. Smed-mmp1 was also found to be expressed during septic-

wounding in planaria, suggesting a role for this MMP in innate

3.6. Nitric oxide immune responses in addition to structural homeostasis [63]. A

detailed analysis of MMP-like gene activity in planaria should be

Nitric oxide is utilized in many animal species as a cell signaling evaluated in response to injury and infection as these proteins have

and cytotoxic molecule as it diffuses readily through ﬂuids and potential to be important in both biological activities.

across cell membranes [93]. It is synthesized from l-arginine by

the enzyme nitric oxide synthase in response to calcium-dependent

4. Concluding remarks

and independent signals. Apart from pathogen defense nitric oxide

stimulates clearing of cellular debris and the activation, growth

The presence of molecules associated with innate immune

and death of immune cells [94,95]. A homolog for nitric oxide

response in planarians along with their activation during regen-

synthase has been discovered in several ﬂatworm species [96].

eration implies that the injury-mediated immune response is an

Adh3 an evolutionarily conserved gene that encodes the enzyme

ancient feature of basal Bilateria. Speciﬁc regulatory mechanisms

alcohol dehydrogenase, is another protein involved in nitric oxide

of the immune system during planarian regeneration remain to

metabolism that has been identiﬁed in planaria [97]. The existence

be addressed. In addition to the potential vertebrate immune

of a nitric oxide synthase homolog and an alcohol dehydrogenase

homologs that we identiﬁed, it is unknown if other non-vertebrate

suggests another host defense mechanism by which planarians

immune mechanisms exist in planarians for ﬁghting pathogens.

might control pathogens. Nitric oxide also has a documented role

It is possible that further analysis of the injury-induced immune

in mammalian wound repair. In rats fed with an arginine-free diet

response may reveal invertebrate-speciﬁc responses as part of their

(arginine suppresses nitric oxide production) wound healing was

ancient immune defense mechanisms. Thus, the planarian model

impaired [98], and in patients nitric oxide levels are low in diabetic

provides great opportunities to evaluate evolutionary mechanisms

sores [95]. Nitric oxide may represent another evolutionarily con-

and studies of molecular players during tissue regeneration and

served example with functions in both host defense and wound

host defense that are difﬁcult to interrogate in other experimen-

repair.

tal models. Planarian studies mostly focus on the adult organism,

which facilitate analysis of local and systemic signals in the pres-

3.7. Double strand RNA (dsRNA) ence of a fully developed immune system. RNAi, transcriptomic

and proteomic approaches could be used to categorize components

RNAi technology is widely used in planarian research. dsRNA of the immune system modulating particular phases of wound

and miRNA have been implicated biologically as important tran- healing, blastema formation and tissue remodeling (Fig. 3). Criti-

scription regulators that mediate many signaling pathways during cal aspects such as the role of commensal bacteria during tissue

development, repair, regeneration and maintenance of homeosta- repair and the speciﬁc role of primitive phagocytic cells (reticulo-

sis [99]. Existence of dsRNA creates red ﬂags within eukaryotic cells, cytes) could be investigated in the context of the whole organism.

indicating viral infection [100,101]. Eukaryotic cells have evolved The absence of an adaptive immune system in planarians presents

with speciﬁc rapid and successful mechanisms to remove dsRNA some limitations within the model for comparison to human mech-

as foreign material. Scientists have manipulated this knowledge anisms. However, comparative studies between planarians and

to successfully downregulate genes and their functions from cells. salamanders evaluating scar-free repair and regeneration [9] may

Within an eukaryotic organism this RNAi silencing pathway can point toward common factors within the innate immune system

be used not only for the removal of the viral bi-products, but for with potential clinical applications.

changes in gene expression levels and subsequent signaling path- Evaluation of healing in autoimmune patients suggests that a

ways that might play a crucial role in immune functions. Analysis dysregulated inﬂammatory response delays or impairs the wound

of the planarian genome revealed homologs for DICER and AGO2 repair process [110]. It thus appears that a proper balance of

(mk4.000678.05 and mk4.001736.00), however these genes were immune response must be maintained during wound repair. The

not upregulated during regeneration in the planaria [30] implying data seem to suggest that too strong of an immune response (or

T.H. Peiris et al. / Seminars in Immunology 26 (2014) 295–302 301

[12] Hemmrich G, Miller DJ, Bosch TC. The evolution of immunity: a low-life per-

spective. Trends Immunol 2007;28:449–54.

[13] Sanchez Alvarado A. Regeneration in the metazoans: why does it happen?

Bioessays 2000;22:578–90.

[14] Sánchez Alvarado A, Tsonis PA. Bridging the regeneration gap: genetic insights

from diverse animal models. Nat Rev Genet 2006;7:873–84.

[15] Brockes JP, Kumar A. Comparative aspects of animal regeneration. Annu Rev

Cell Dev Biol 2008;24:525–49.

[16] Nonaka M. Evolution of the complement system. Subcell Biochem

2014;80:31–43.

[17] Nonaka M, Kimura A. Genomic view of the evolution of the complement

system. Immunogenetics 2006;58:701–13.

[18] Tanaka EM, Reddien PW. The cellular basis for animal regeneration. Dev Cell

2011;21:172–85.

[19] Bosch TC. Cnidarian–microbe interactions and the origin of innate immunity

in metazoans. Annu Rev Microbiol 2013;67:499–518.

[20] Bosch TC, Augustin R, Anton-Erxleben F, Fraune S, Hemmrich G, Zill H,

et al. Uncovering the evolutionary history of innate immunity: the simple

metazoan Hydra uses epithelial cells for host defence. Dev Comp Immunol

2009;33:559–69.

[21] Riutort M, Alvarez-Presas M, Lazaro E, Sola E, Paps J. Evolutionary history

of the Tricladida and the Platyhelminthes: an up-to-date phylogenetic and

systematic account. Int J Dev Biol 2012;56:5–17.

[22] Sanchez Alvarado A. The freshwater planarian Schmidtea mediterranea:

Fig. 3. Injury induces immune and repair signaling in planarians. Following injury or

embryogenesis, stem cells and regeneration. Curr Opin Genet Dev

amputation, molecular signals induce proliferation of neoblasts and formation of the 2003;13:438–44.

blastema. Reticular cells migrate into the injury site and can be found with phago-

[23] Reddien PW. Specialized progenitors and regeneration. Development

cytosed dead tissue. Sepsis-injury induces expression of potential host defense 2013;140:951–7.

molecules [63]. As immune-inducing and regeneration signaling events likely occur [24] Baguna J. The planarian neoblast: the rambling history of its origin and some

simultaneously, it is possible that some of these signals impact both biological path- current black boxes. Int J Dev Biol 2012;56:19–37.

ways. In addition, immune components alter the rate of regeneration and potentially [25] Aboobaker AA. Planarian stem cells: a simple paradigm for regeneration.

Trends Cell Biol 2011;21:304–11.

impact the structural outcome of the tissue reconstruction.

[26] Lobo D, Beane WS, Levin M. Modeling planarian regeneration: a primer for

reverse-engineering the worm. PLoS Comput Biol 2012;8:e1002481.

[27] Gentile L, Cebria F, Bartscherer K. The planarian ﬂatworm: an in vivo model

perhaps a more developed immune system) may contribute to

for stem cell biology and nervous system regeneration. Dis Model Mech

scaring during wound repair and reduced regenerative capacity, 2011;4:12–9.

while a lower level of inﬂammation (or more primitive immune [28] Rink JC. Stem cell systems and regeneration in planaria. Dev Genes Evol

2013;223:67–84.

signaling) may be critical in ensuring that the appropriate cell types

[29] Robb SM, Ross E, Sanchez Alvarado A. SmedGD: the Schmidtea mediterranea

migrate into the damaged environment and contribute to the clean-

genome database. Nucleic Acids Res 2008;36:D599–606.

up of localized debris and dead cellular tissue (Fig. 3) [6,7,9,11]. [30] Sandmann T, Vogg MC, Owlarn S, Boutros M, Bartscherer K. The head-

regeneration transcriptome of the planarian Schmidtea mediterranea. Genome

This information could be readily addressed by analyzing planarian

Biol 2011;12:R76.

regeneration and their enigmatic immune system.

[31] Shomrat T, Levin M. An automated training paradigm reveals long-term mem-

ory in planarians and its persistence through head regeneration. J Exp Biol

Acknowledgements 2013;216:3799–810.

[32] Adamidi C, Wang Y, Gruen D, Mastrobuoni G, You X, Tolle D, et al. De

novo assembly and validation of planaria transcriptome by massive parallel

We thank Daniel Ramirez for comments on the manuscript. sequencing and shotgun proteomics. Genome Res 2011;21:1193–200.

[33] Labbe RM, Irimia M, Currie KW, Lin A, Zhu SJ, Brown DD, et al. A comparative

KKH is supported by the National Institutes of Health grant

transcriptomic analysis reveals conserved features of stem cell pluripotency

R00HL090706. Research in the Oviedo Lab is supported by the Uni-

in planarians and mammals. Stem Cells 2012;30:1734–45.

versity of California, Merced; the Health Sciences Research Institute [34] Onal P, Grun D, Adamidi C, Rybak A, Solana J, Mastrobuoni G, et al. Gene

expression of pluripotency determinants is conserved between mammalian

at UC Merced; Jane Vilas faculty award; Hellman Fellows Fund, and

and planarian stem cells. EMBO J 2012;31:2755–69.

the NIH-National Cancer Institute grant number R21CA176114 to

[35] Bocchinfuso DG, Taylor P, Ross E, Ignatchenko A, Ignatchenko V, Kislinger

NJO. T, et al. Proteomic proﬁling of the planarian Schmidtea mediterranea and its

mucous reveals similarities with human secretions and those predicted for

parasitic ﬂatworms. Mol Cell Proteomics 2012;11:681–91.

References [36] Boser A, Drexler HC, Reuter H, Schmitz H, Wu G, Scholer HR, et al. SILAC

proteomics of planarians identiﬁes Ncoa5 as a conserved component of

[1] Elliott SA, Sanchez Alvarado A. The history and enduring contributions of pluripotent stem cells. Cell Rep 2013;5:1142–55.

planarians to the study of animal regeneration. Wiley Interdiscip Rev Dev [37] Zayas RM, Hernandez A, Habermann B, Wang Y, Stary JM, Newmark PA. The

Biol 2013;2:301–26. planarian Schmidtea mediterranea as a model for epigenetic germ cell speci-

[2] Galliot B. Hydra, a fruitful model system for 270 years. Int J Dev Biol ﬁcation: analysis of ESTs from the hermaphroditic strain. Proc Natl Acad Sci

2012;56:411–23. U S A 2005;102:18491–6.

[3] Poss KD. Advances in understanding tissue regenerative capacity and mech- [38] Reddien PW, Bermange AL, Murﬁtt KJ, Jennings JR, Sanchez Alvarado A.

anisms in animals. Nat Rev Genet 2010;11:710–22. Identiﬁcation of genes needed for regeneration, stem cell function, and

[4] King RS, Newmark PA. The cell biology of regeneration. J Cell Biol tissue homeostasis by systematic gene perturbation in planaria. Dev Cell

2012;196:553–62. 2005;8:635–49.

[5] Levin M. Large-scale biophysics: ion ﬂows and regeneration. Trends Cell Biol [39] Beane WS, Morokuma J, Adams DS, Levin M. A chemical genetics approach

2007;17:261–70. reveals H,K-ATPase-mediated membrane voltage is required for planarian

[6] Eming SA, Hammerschmidt M, Krieg T, Roers A. Interrelation of immunity and head regeneration. Chem Biol 2011;18:77–89.

tissue repair or regeneration. Semin Cell Dev Biol 2009;20:517–27. [40] Beane WS, Morokuma J, Lemire JM, Levin M. Bioelectric signaling reg-

[7] Godwin JW, Brockes JP. Regeneration, tissue injury and the immune response. ulates head and organ size during planarian regeneration. Development

J Anat 2006;209:423–32. 2013;140:313–22.

[8] Godwin JW, Pinto AR, Rosenthal NA. Macrophages are required for adult sala- [41] Pellettieri J, Fitzgerald P, Watanabe S, Mancuso J, Green DR, Sanchez Alvarado

mander limb regeneration. Proc Natl Acad Sci U S A 2013;110:9415–20. A. Cell death and tissue remodeling in planarian regeneration. Dev Biol

[9] Godwin JW, Rosenthal N. Scar-free wound healing and regeneration in 2010;338:76–85.

amphibians: immunological inﬂuences on regenerative success. Differenti- [42] Wenemoser D, Reddien PW. Planarian regeneration involves distinct stem

ation 2014;87:66–75. cell responses to wounds and tissue absence. Dev Biol 2010;344:979–91.

[10] Murawala P, Tanaka EM, Currie JD. Regeneration: the ultimate example of [43] Reddien PW. Constitutive gene expression and the speciﬁcation of tissue

wound healing. Semin Cell Dev Biol 2012;23:954–62. identity in adult planarian biology. Trends Genet 2011;27:277–85.

[11] Eming SA, Krieg T, Davidson JM. Inﬂammation in wound repair: molecular [44] Collins 3rd JJ, Newmark PA. It’s no ﬂuke: the planarian as a model for under-

and cellular mechanisms. J Investig Dermatol 2007;127:514–25. standing schistosomes. PLoS Pathog 2013;9:e1003396.

302 T.H. Peiris et al. / Seminars in Immunology 26 (2014) 295–302

[45] Chuah C, Jones MK, Burke ML, McManus DP, Gobert GN. Cellular and toxin-driven lysozyme M-speciﬁc cell lineage ablation on wound inﬂamma-

chemokine-mediated regulation in schistosome-induced hepatic pathology. tory, angiogenic, and contractive processes. Am J Pathol 2009;175:132–47.

Trends Parasitol 2014;30:141–50. [80] Li L, Yan B, Shi YQ, Zhang WQ, Wen ZL. Live imaging reveals differing roles

[46] Hernandez JL, Leung G, McKay DM. Cestode regulation of inflammation and of macrophages and neutrophils during zebrafish tail fin regeneration. J Biol

inﬂammatory diseases. Int J Parasitol 2013;43:233–43. Chem 2012;287:25353–60.

[47] Pellicoro A, Ramachandran P, Iredale JP, Fallowﬁeld JA. Liver ﬁbrosis and [81] Ulvila J, Vanha-Aho LM, Ramet M. Drosophila phagocytosis – still many

repair: immune regulation of wound healing in a solid organ. Nat Rev unknowns under the surface. APMIS: Acta Pathol Microbiol Immunol Scand

Immunol 2014;14:181–94. 2011;119:651–62.

[48] Ankeny DP, Popovich PG. Mechanisms and implications of adaptive [82] Serhan CN, Yang R, Martinod K, Kasuga K, Pillai PS, Porter TF, et al. Maresins:

immune responses after traumatic spinal cord injury. Neuroscience novel macrophage mediators with potent antiinﬂammatory and proresolving

2009;158:1112–21. actions. J Exp Med 2009;206:15–23.

[49] Hauton C, Smith VJ. Adaptive immunity in invertebrates: a straw house with- [83] Serhan CN, Dalli J, Karamnov S, Choi A, Park CK, Xu ZZ, et al. Macrophage

out a mechanistic foundation. Bioessays 2007;29:1138–46. proresolving mediator maresin 1 stimulates tissue regeneration and controls

[50] Chalmers IW, Hoffmann KF. Platyhelminth Venom Allergen-Like (VAL) pro- pain. FASEB J: Off Publ Fed Am Soc Exp Biol 2012;26:1755–65.

teins: revealing structural diversity, class-speciﬁc features and biological [84] Gonzalez-Amaro R, Sanchez-Madrid F. Cell adhesion molecules: selectins and

associations across the phylum. Parasitology 2012;139:1231–45. integrins. Crit Rev Immunol 1999;19:389–429.

[51] Rodriguez RM, Lopez-Vazquez A, Lopez-Larrea C. Immune systems evolution. [85] Petruzzelli L, Takami M, Humes HD. Structure and function of cell adhesion

Adv Exp Med Biol 2012;739:237–51. molecules. Am J Med 1999;106:467–76.

[52] Pasupuleti M, Schmidtchen A, Malmsten M. Antimicrobial peptides: key com- [86] Van den Bossche J, Malissen B, Mantovani A, De Baetselier P, Van Ginderachter

ponents of the innate immune system. Crit Rev Biotechnol 2012;32:143–71. JA. Regulation and function of the E-cadherin/catenin complex in cells of the

[53] Janeway Jr CA, Medzhitov R. Innate immune recognition. Ann Rev Immunol monocyte–macrophage lineage and DCs. Blood 2012;119:1623–33.

2002;20:197–216. [87] Tian X, Liu Z, Niu B, Zhang J, Tan TK, Lee SR, et al. E-cadherin/beta-catenin

[54] Oviedo NJ, Nicolas CL, Adams DS, Levin M. Establishing and maintaining a complex and the epithelial barrier. J Biomed Biotechnol 2011;2011:567305.

colony of planarians. CSH Protoc 2008 [2008:pdb prot5053]. [88] Ley K. The role of selectins in inﬂammation and disease. Trends Mol Med

[55] Morita M, Best JB. Electron microscopic studies of planarian regeneration. II. 2003;9:263–8.

Changes in epidermis during regeneration. J Exp Zool 1974;187:345–73. [89] Prozialeck WC, Edwards JR. Cell adhesion molecules in chemically-induced

[56] Morita M. Phagocytic response of planarian reticular cells to heat-killed bacte- renal injury. Pharmacol Ther 2007;114:74–93.

ria. Hydrobiologia 1991;227:193–9. [90] Cambi A, Figdor CG. Dual function of C-type lectin-like receptors in the

[57] Morita M. Structure and function of the reticular cell in the planarian Dugesia immune system. Curr Opin Cell Biol 2003;15:539–46.

dorotocephala. In: Cannon L, editor. Biology of turbellaria and some related [91] Fusaoka E, Inoue T, Mineta K, Agata K, Takeuchi K. Structure and function

ﬂatworms. Abo/Turku, Finland: Springer; 1995. p. 189–96. of primitive immunoglobulin superfamily neural cell adhesion molecules: a

[58] Backhed F, Ley RE, Sonnenburg JL, Peterson DA, Gordon JI. Host–bacterial lesson from studies on planarian. Genes Cells 2006;11:541–55.

mutualism in the human intestine. Science 2005;307:1915–20. [92] Zelensky AN, Gready JE. The C-type lectin-like domain superfamily. FEBS J

[59] Dethlefsen L, McFall-Ngai M, Relman DA. An ecological and evolu- 2005;272:6179–217.

tionary perspective on human–microbe mutualism and disease. Nature [93] Wink DA, Hanbauer I, Grisham MB, Laval F, Nims RW, Laval J, et al. Chemical

2007;449:811–8. biology of nitric oxide: regulation and protective and toxic mechanisms. Curr

[60] Barr JJ, Auro R, Furlan M, Whiteson KL, Erb ML, Pogliano J, et al. Bacteriophage Top Cell Regul 1996;34:159–87.

adhering to mucus provide a non-host-derived immunity. Proc Natl Acad Sci [94] Schwentker A, Billiar TR. Nitric oxide and wound repair. Surg Clin North Am

U S A 2013;110:10771–6. 2003;83:521–30.

[61] Zasloff M. Antimicrobial peptides of multicellular organisms. Nature [95] Witte MB, Barbul A. Role of nitric oxide in wound repair. Am J Surg

2002;415:389–95. 2002;183:406–12.

[62] Zasloff M. Antibiotic peptides as mediators of innate immunity. Curr Opin [96] Gustafsson MKS, Lindholm AM, Mäntylä K, Reuter M, Lundström CA, Terenina

Immunol 1992;4:3–7. N. No news on the ﬂatworm front! Nitric oxide synthase in parasitic and

[63] Altincicek B, Vilcinskas A. Comparative analysis of septic injury-inducible free-living ﬂatworms. Hydrobiologia 1998;383:161–6.

genes in phylogenetically distant model organisms of regeneration and stem [97] Godoy L, Gonzalez-Duarte R, Albalat R. Analysis of planarian Adh3 supports

cell research, the planarian Schmidtea mediterranea and the cnidarian Hydra an intron-rich architecture and tissue-speciﬁc expression for the urbilate-

vulgaris. Front Zool 2008;5:6. rian ancestral form. Comp Biochem Physiol B Biochem Mol Biol 2007;146:

[64] Akira S, Uematsu S, Takeuchi O. Pathogen recognition and innate immunity. 489–95.

Cell 2006;124:783–801. [98] Seifter E, Rettura G, Barbul A, Levenson SM. Arginine: an essential amino acid

[65] Zhang Q, Zmasek CM, Godzik A. Domain architecture evolution of pattern- for injured rats. Surgery 1978;84:224–30.

recognition receptors. Immunogenetics 2010;62:263–72. [99] Cullen BR. Derivation and function of small interfering RNAs and microRNAs.

[66] Botos I, Segal DM, Davies DR. The structural biology of Toll-like receptors. Virus Res 2004;102:3–9.

Structure 2011;19:447–59. [100] Lindenbach BD, Rice CM. RNAi targeting an animal virus: news from the front.

[67] Kobe B, Kajava AV. The leucine-rich repeat as a protein recognition motif. Curr Mol Cell 2002;9:925–7.

Opin Struct Biol 2001;11:725–32. [101] Jacobs BL, Langland JO. When two strands are better than one: the mediators

[68] Iwasaki A, Medzhitov R. Regulation of adaptive immunity by the innate and modulators of the cellular responses to double-stranded RNA. Virology

immune system. Science 2010;327:291–5. 1996;219:339–49.

[69] Alcaide M, Edwards SV. Molecular evolution of the toll-like receptor multi- [102] Massova I, Kotra LP, Fridman R, Mobashery S. Matrix metalloproteinases:

gene family in birds. Mol Biol Evol 2011;28:1703–15. structures, evolution, and diversiﬁcation. FASEB J: Off Publ Fed Am Soc Exp

[70] Song X, Jin P, Qin S, Chen L, Ma F. The evolution and origin of animal Toll-like Biol 1998;12:1075–95.

receptor signaling pathway revealed by network-level molecular evolution- [103] Fanjul-Fernandez M, Folgueras AR, Cabrera S, Lopez-Otin C. Matrix metal-

ary analyses. PLoS One 2012;7:e51657. loproteinases: evolution, gene regulation and functional analysis in mouse

[71] Satake H, Sekiguchi T. Toll-like receptors of deuterostome invertebrates. Front models. Biochim Biophys Acta 2010;1803:3–19.

Immunol 2012;3:34. [104] Nissinen L, Kahari VM. Matrix metalloproteinases in inﬂammation. Biochim

[72] Carty M, Goodbody R, Schroder M, Stack J, Moynagh PN, Bowie AG. The human Biophys Acta 2014;1840(8):2571–80.

adaptor SARM negatively regulates adaptor protein TRIF-dependent Toll-like [105] Khokha R, Murthy A, Weiss A. Metalloproteinases and their natural inhibitors

receptor signaling. Nat Immunol 2006;7:1074–81. in inﬂammation and immunity. Nat Rev Immunol 2013;13:649–65.

[73] Carroll MC. Complement and humoral immunity. Vaccine 2008;26(Suppl [106] Parks WC. Matrix metalloproteinases in repair. Wound Repair Regen

8):I28–33. 1999;7:423–32.

[74] Nonaka M, Yoshizaki F. Evolution of the complement system. Mol Immunol [107] Sarras Jr MP, Yan L, Leontovich A, Zhang JS, Structure. expression, and devel-

2004;40:897–902. opmental function of early divergent forms of metalloproteinases in hydra.

[75] Pinto MR, Melillo D, Giacomelli S, Sfyroera G, Lambris JD. Ancient origin of Cell Res 2002;12:163–76.

the complement system: emerging invertebrate models. Adv Exp Med Biol [108] Quinones JL, Rosa R, Ruiz DL, Garcia-Arraras JE. Extracellular matrix remodel-

2007;598:372–88. ing and metalloproteinase involvement during intestine regeneration in the

[76] Kishore U, Reid KB. C1q: structure, function, and receptors. Immunopharma- sea cucumber Holothuria glaberrima. Dev Biol 2002;250:181–97.

cology 2000;49:159–70. [109] Isolani ME, Abril JF, Salo E, Deri P, Bianucci AM, Batistoni R. Planarians as a

[77] Serhan CN, Savill J. Resolution of inﬂammation: the beginning programs the model to assess in vivo the role of matrix metalloproteinase genes during

end. Nat Immunol 2005;6:1191–7. homeostasis and regeneration. PLOS ONE 2013;8:e55649.

[78] Murray PJ, Wynn TA. Protective and pathogenic functions of macrophage [110] Loots MA, Lamme EN, Zeegelaar J, Mekkes JR, Bos JD, Middelkoop E. Dif-

subsets. Nat Rev Immunol 2011;11:723–37. ferences in cellular inﬁltrate and extracellular matrix of chronic diabetic

[79] Goren I, Allmann N, Yogev N, Schurmann C, Linke A, Holdener M, et al. A trans- and venous ulcers versus acute wounds. J Investig Dermatol 1998;111:

genic mouse model of inducible macrophage depletion: effects of diphtheria 850–7.