Normal B-1a cell development requires B cell-intrinsic NFATc1 activity Robert Berland* and Henry H. Wortis Department of Pathology and Graduate Program in Immunology, Tufts University School of Medicine, 136 Harrison Avenue, Boston, MA 02111 Edited by Gerald R. Crabtree, Stanford University School of Medicine, Stanford, CA, and approved September 12, 2003 (received for review June 12, 2003) B-1a cells, an anatomically, phenotypically, and functionally dis- CD40 ligation and can transactivate NFAT-dependent reporter tinct subset of B cells that produce the bulk of natural serum IgM constructs (26–28). The physiological functions of NFAT in B and much of gut-associated IgA, are an important component of cells remain unclear. Targeted disruption of NFATc2 was re- the early response to pathogens. Because the induced expression ported to result in a slightly increased B cell proliferative of CD5, a hallmark of B-1a cells, requires a nuclear factor of response to BCR or CD40 signaling (29). NFATc1Ϫ/Ϫ mice activated T cells (NFAT)-dependent enhancer, we examined the exhibit reduced levels of serum IgG1 (30, 31) and IgE (31), but role of NFAT transcription factors in B-1a development. Here we this is apparently the result of impaired IL-4 production by T show that the B-1a compartment is normal in mice lacking NFATc2 cells (30, 31). B cells in these mice were hyporesponsive to BCR but essentially absent in mice lacking NFATc1. Loss of NFATc1 or CD40 ligation ex vivo, but any in vivo consequences of this are affects both peritoneal and splenic B-1a cells. Because there is a loss not known (30, 31). These decreased responses may reflect a B of B-1 cells defined by markers other than CD5, NFATc1 is not cell-intrinsic function of NFATc1 or an effect on B cell devel- required simply for CD5 expression on B-1a cells. Using mixed- opment of the absence of NFATc1 in another cell type. In mice allotype chimeras and retroviral-mediated gene transduction we containing targeted disruptions of both NFATc2 and NFATc1 show that the requirement for NFATc1 is B cell-intrinsic. We also there was overproduction of IgG1 and IgE and a polyclonal demonstrate that NFATc1 protein expression is elevated Ϸ5-fold in plasma cell infiltration of end organs (32). The overproduction B-1a cells compared with B-2 cells. This is the first definitive of IgG1 and IgE was independent of IL-4 and was observed in demonstration of a B cell-intrinsic function for an NFAT family vitro with isolated B cells. transcription factor. Because NFAT appears to be necessary for induction of CD5, the hallmark of B-1a cells, we initiated a study of B-1 develop- he signaling events that lead to the differentiation of B-1a ment in NFAT-deficient mice. Tcells are not well understood. B-1a cells are phenotypically Materials and Methods and functionally distinct from the bulk of B cells (e.g., B-2, B-0, Mice. NFATc2Ϫ/Ϫ, NFATc1Ϫ/ϩ double knockout mice on a and follicular) (reviewed in refs. 1 and 2); they are long-lived cells ͞ that express CD5, CD43, and high IgM together with little or no BALB c background were obtained from Laurie Glimcher IgD and low CD45(B220). In mice, B-1a cells are known to play (Harvard University School of Public Health, Boston). NFATc2Ϫ/Ϫ and NFATc1Ϫ/ϩ single knockout mice were ob- an important role in the response to T-cell-independent type-2 ͞ antigens (3) and produce the bulk of natural serum IgM (4–7). tained by breeding these mice with BALB cByJ mice obtained from The Jackson Laboratory. Some NFATc2Ϫ/Ϫ mice were These antibodies help clear bacterial toxins (8) and are critically Ϫ/Ϫ Ϫ/ϩ important for effective resistance to some pathogens (9). B-1a from crosses of NFATc2 , NFATc3 double knockout mice, also obtained from Laurie Glimcher. Mice were genotyped by cells are also the source of many of the gut-associated plasma PCR by using protocols provided by Ann Ranger (Harvard cells that produce IgA (7). These are important in maintaining Medical School, Boston) and Laurie Glimcher. All PCRs con- homeostasis with intestinal flora (10). B-1a cells have a restricted tained three primers. NeoPCR1 (AGCGTTGGCTACCCGT- IMMUNOLOGY repertoire, reactive with many common bacterial and self- GATATTGCTGAAGA) was used in all reactions to prime antigens. Much evidence indicates that this is a consequence of sequences within the NEOR gene. To distinguish WT from the positive selection by self-antigens of cells into the B-1a subset disrupted NFATc2 alleles, two additional primers, NpIn1 (reviewed in ref. 1). We and others (11, 12) previously showed (GCAAGCCTCAGTGACAAAGTATCCACTTCA) and that crosslinking of the B cell receptor (BCR) on splenic B cells, NpEx1 (CCACGAGCTGCCCATGGTGGAGAGACAAGA), to partially mimic positive selection by self-antigen, induces were included. For the NFATc1 allele, the additional primers several aspects of the B-1a phenotype, including the expression were NcIn1 (CTTCCCTGATGTGTGTTGTGGCAGACAA- of CD5. We subsequently demonstrated that this induction of GAT) and NcEx1 (GTTCCAGGTCAGCCAGAAATCA- CD5 is cyclosporin-sensitive and requires an enhancer located Ϸ AGGGTCAT). For the NFATc3 allele, the additional primers 2 kb upstream of the CD5 coding sequences (13, 14). This were NFATc3 knockout (CCCAAGAAGATCAGAAGACT- enhancer contains two functional nuclear factor of activated T GTG) and NFATc3 WT (GCTCTAAAGATGGCTCCGTGC- cells (NFAT) sites (14) and is highly conserved in humans (15). TTA). All PCRs used Invitrogen PCR buffer and Taq polymer- NFAT was originally identified as a Ca2ϩ-inducible transcrip- ase with 2.1 mM MgCl2 and other components at concentrations tion factor necessary for the expression of IL-2 in T cells (16). It specified by Invitrogen. PCRs were at 94°C for 5 min followed was subsequently determined that there is a family of four by 40 cycles of 1 min each at 94°C, 60°C (NFATc2 and NFATc1) related proteins, encoded by four genes, that have similar or 57°C (NFATc3), and 72°C followed by 10 min at 72°C. properties and function similarly in vivo when ectopically ex- Products were resolved on a 1.8% agarose gel. pressed and in vitro in binding assays (17–21). Individual NFAT proteins are expressed in a variety of cell types, within and outside of the immune system, and they can bind to regulatory This paper was submitted directly (Track II) to the PNAS office. sequences of many different genes (reviewed in refs. 22–24). Abbreviations: APC, allophycocyanin; BCR, B cell receptor; FACS, fluorescence-activated cell ϩ Three Ca2 -sensitive members of the NFAT transcription sorting; MZ, marginal zone; NFAT, nuclear factor of activated T cells; PE, phycoerythrin; PI, factor family, NFATc1 (NFAT2, NFATc), NFATc2 (NFAT1, propidium iodide; PtC, phosphatidylcholine. NFATp), and NFATc3 (NFAT4, NFATx), are expressed in B *To whom correspondence should be addressed. E-mail: [email protected]. cells (21, 25). B cell NFAT is activated by BCR crosslinking or © 2003 by The National Academy of Sciences of the USA www.pnas.org͞cgi͞doi͞10.1073͞pnas.2233620100 PNAS ͉ November 11, 2003 ͉ vol. 100 ͉ no. 23 ͉ 13459–13464 Downloaded by guest on September 30, 2021 RAG-2Ϫ/Ϫ mice on a BALB͞c background were obtained peritoneal lavage with staining buffer and stained with biotin- from Taconic Farms and bred in the Tufts University School of ylated anti-CD23, biotinylated anti-CD3␧, biotinylated anti- Medicine animal facility. Ighb congenic BALB͞c mice for mak- Ter119, FITC-conjugated anti-CD4, and PE-conjugated anti- ing mixed-allotype chimeras were strain C.BKa-Ighb͞IcrSmn CD8 antibodies followed by secondary staining with PE- (obtained from The Jackson Laboratory and bred in our facility). conjugated streptavidin. Unstained, viable (PI-excluding) cells in the lymphocyte gate were isolated. Cells were pelleted by Fetal Liver Reconstitutions. Single-allotype fetal liver reconstitu- centrifugation for 10 min at 250 ϫ g and lysed in 50 ␮lof tions of RAG-2Ϫ/Ϫ mice were performed as follows. Timed SDS͞PAGE sample loading buffer per 2 ϫ 106 cells. Samples matings were set up of NFATc1Ϫ/ϩ or NFATc2Ϫ/Ϫ, NFATc1Ϫ/ϩ were boiled for 5 min and frozen. Subsequently, 50 ␮l of each mice. On day 13.5, fetal livers were harvested and a cell lysate was run on a SDS͞7.5% PAGE gel, and immunoblotting suspension was made by pipetting them up and down 25 times in was performed by standard methods. The blots were probed by complete medium (14) supplemented with 10% heat-inactivated using mouse monoclonal 7A6 anti-NFATc1 antibody (Santa FCS (10% complete medium). One-tenth volumes of the sus- Cruz Biotechnology), rabbit polyclonal anti-NFATc2 antibody pensions were used for genotyping by PCR as described above. 67.1 (gift from Anjana Rao, Center for Blood Research, Harvard The remaining cells were washed once in complete medium with University, Boston), and mouse monoclonal anti-HSP-60 (H-1) 1% FCS (1% complete medium) and resuspended in 0.4 ml of antibody (Santa Cruz Biotechnology). 1% complete medium. Each resuspended liver was injected into one RAG-2Ϫ/Ϫ mouse that had received 300 rad of ␥ radiation Retroviral Constructions and Infections. The murine NFATc1 iso- 4–24 h earlier and 10 units of heparin (i.p.) Ϸ1 h earlier. In some form a (GenBank accession no. GI7208617) complete coding experiments disaggregated fetal livers were frozen in complete sequence was amplified by PCR and a 5Ј EcoR1 site and 3Ј NotI medium with 20% heat-inactivated FCS and 10% DMSO after site introduced by using the forward primer GTTACAGTG- removal of 1͞10th volume for genotyping and the 1% complete GAATTCAAACAGACACCATGCCAAATACCAGCTT- medium wash. For injection, cells were thawed, diluted in 10% TCCA and the reverse primer GTTACAGTCGCGGCCGCT- complete medium, pelleted at 250 ϫ g, washed twice in 1% CAGTAAAAACCTCCTCTCA.