DOCSLIB.ORG

Normal B-1A Cell Development Requires B Cell-Intrinsic Nfatc1 Activity

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Normal B-1A Cell Development Requires B Cell-Intrinsic Nfatc1 Activity Normal B-1a cell development requires B cell-intrinsic NFATc1 activity Robert Berland* and Henry H. Wortis Department of Pathology and Graduate Program in Immunology, Tufts University School of Medicine, 136 Harrison Avenue, Boston, MA 02111 Edited by Gerald R. Crabtree, Stanford University School of Medicine, Stanford, CA, and approved September 12, 2003 (received for review June 12, 2003) B-1a cells, an anatomically, phenotypically, and functionally dis- CD40 ligation and can transactivate NFAT-dependent reporter tinct subset of B cells that produce the bulk of natural serum IgM constructs (26–28). The physiological functions of NFAT in B and much of gut-associated IgA, are an important component of cells remain unclear. Targeted disruption of NFATc2 was re- the early response to pathogens. Because the induced expression ported to result in a slightly increased B cell proliferative of CD5, a hallmark of B-1a cells, requires a nuclear factor of response to BCR or CD40 signaling (29). NFATc1Ϫ/Ϫ mice activated T cells (NFAT)-dependent enhancer, we examined the exhibit reduced levels of serum IgG1 (30, 31) and IgE (31), but role of NFAT transcription factors in B-1a development. Here we this is apparently the result of impaired IL-4 production by T show that the B-1a compartment is normal in mice lacking NFATc2 cells (30, 31). B cells in these mice were hyporesponsive to BCR but essentially absent in mice lacking NFATc1. Loss of NFATc1 or CD40 ligation ex vivo, but any in vivo consequences of this are affects both peritoneal and splenic B-1a cells. Because there is a loss not known (30, 31). These decreased responses may reflect a B of B-1 cells defined by markers other than CD5, NFATc1 is not cell-intrinsic function of NFATc1 or an effect on B cell devel- required simply for CD5 expression on B-1a cells. Using mixed- opment of the absence of NFATc1 in another cell type. In mice allotype chimeras and retroviral-mediated gene transduction we containing targeted disruptions of both NFATc2 and NFATc1 show that the requirement for NFATc1 is B cell-intrinsic. We also there was overproduction of IgG1 and IgE and a polyclonal demonstrate that NFATc1 protein expression is elevated Ϸ5-fold in plasma cell infiltration of end organs (32). The overproduction B-1a cells compared with B-2 cells. This is the first definitive of IgG1 and IgE was independent of IL-4 and was observed in demonstration of a B cell-intrinsic function for an NFAT family vitro with isolated B cells. transcription factor. Because NFAT appears to be necessary for induction of CD5, the hallmark of B-1a cells, we initiated a study of B-1 develop- he signaling events that lead to the differentiation of B-1a ment in NFAT-deficient mice. Tcells are not well understood. B-1a cells are phenotypically Materials and Methods and functionally distinct from the bulk of B cells (e.g., B-2, B-0, Mice. NFATc2Ϫ/Ϫ, NFATc1Ϫ/ϩ double knockout mice on a and follicular) (reviewed in refs. 1 and 2); they are long-lived cells ͞ that express CD5, CD43, and high IgM together with little or no BALB c background were obtained from Laurie Glimcher IgD and low CD45(B220). In mice, B-1a cells are known to play (Harvard University School of Public Health, Boston). NFATc2Ϫ/Ϫ and NFATc1Ϫ/ϩ single knockout mice were ob- an important role in the response to T-cell-independent type-2 ͞ antigens (3) and produce the bulk of natural serum IgM (4–7). tained by breeding these mice with BALB cByJ mice obtained from The Jackson Laboratory. Some NFATc2Ϫ/Ϫ mice were These antibodies help clear bacterial toxins (8) and are critically Ϫ/Ϫ Ϫ/ϩ important for effective resistance to some pathogens (9). B-1a from crosses of NFATc2 , NFATc3 double knockout mice, also obtained from Laurie Glimcher. Mice were genotyped by cells are also the source of many of the gut-associated plasma PCR by using protocols provided by Ann Ranger (Harvard cells that produce IgA (7). These are important in maintaining Medical School, Boston) and Laurie Glimcher. All PCRs con- homeostasis with intestinal flora (10). B-1a cells have a restricted tained three primers. NeoPCR1 (AGCGTTGGCTACCCGT- IMMUNOLOGY repertoire, reactive with many common bacterial and self- GATATTGCTGAAGA) was used in all reactions to prime antigens. Much evidence indicates that this is a consequence of sequences within the NEOR gene. To distinguish WT from the positive selection by self-antigens of cells into the B-1a subset disrupted NFATc2 alleles, two additional primers, NpIn1 (reviewed in ref. 1). We and others (11, 12) previously showed (GCAAGCCTCAGTGACAAAGTATCCACTTCA) and that crosslinking of the B cell receptor (BCR) on splenic B cells, NpEx1 (CCACGAGCTGCCCATGGTGGAGAGACAAGA), to partially mimic positive selection by self-antigen, induces were included. For the NFATc1 allele, the additional primers several aspects of the B-1a phenotype, including the expression were NcIn1 (CTTCCCTGATGTGTGTTGTGGCAGACAA- of CD5. We subsequently demonstrated that this induction of GAT) and NcEx1 (GTTCCAGGTCAGCCAGAAATCA- CD5 is cyclosporin-sensitive and requires an enhancer located Ϸ AGGGTCAT). For the NFATc3 allele, the additional primers 2 kb upstream of the CD5 coding sequences (13, 14). This were NFATc3 knockout (CCCAAGAAGATCAGAAGACT- enhancer contains two functional nuclear factor of activated T GTG) and NFATc3 WT (GCTCTAAAGATGGCTCCGTGC- cells (NFAT) sites (14) and is highly conserved in humans (15). TTA). All PCRs used Invitrogen PCR buffer and Taq polymer- NFAT was originally identified as a Ca2ϩ-inducible transcrip- ase with 2.1 mM MgCl2 and other components at concentrations tion factor necessary for the expression of IL-2 in T cells (16). It specified by Invitrogen. PCRs were at 94°C for 5 min followed was subsequently determined that there is a family of four by 40 cycles of 1 min each at 94°C, 60°C (NFATc2 and NFATc1) related proteins, encoded by four genes, that have similar or 57°C (NFATc3), and 72°C followed by 10 min at 72°C. properties and function similarly in vivo when ectopically ex- Products were resolved on a 1.8% agarose gel. pressed and in vitro in binding assays (17–21). Individual NFAT proteins are expressed in a variety of cell types, within and outside of the immune system, and they can bind to regulatory This paper was submitted directly (Track II) to the PNAS office. sequences of many different genes (reviewed in refs. 22–24). Abbreviations: APC, allophycocyanin; BCR, B cell receptor; FACS, fluorescence-activated cell ϩ Three Ca2 -sensitive members of the NFAT transcription sorting; MZ, marginal zone; NFAT, nuclear factor of activated T cells; PE, phycoerythrin; PI, factor family, NFATc1 (NFAT2, NFATc), NFATc2 (NFAT1, propidium iodide; PtC, phosphatidylcholine. NFATp), and NFATc3 (NFAT4, NFATx), are expressed in B *To whom correspondence should be addressed. E-mail: [email protected]. cells (21, 25). B cell NFAT is activated by BCR crosslinking or © 2003 by The National Academy of Sciences of the USA www.pnas.org͞cgi͞doi͞10.1073͞pnas.2233620100 PNAS ͉ November 11, 2003 ͉ vol. 100 ͉ no. 23 ͉ 13459–13464 Downloaded by guest on September 30, 2021 RAG-2Ϫ/Ϫ mice on a BALB͞c background were obtained peritoneal lavage with staining buffer and stained with biotin- from Taconic Farms and bred in the Tufts University School of ylated anti-CD23, biotinylated anti-CD3␧, biotinylated anti- Medicine animal facility. Ighb congenic BALB͞c mice for mak- Ter119, FITC-conjugated anti-CD4, and PE-conjugated anti- ing mixed-allotype chimeras were strain C.BKa-Ighb͞IcrSmn CD8 antibodies followed by secondary staining with PE- (obtained from The Jackson Laboratory and bred in our facility). conjugated streptavidin. Unstained, viable (PI-excluding) cells in the lymphocyte gate were isolated. Cells were pelleted by Fetal Liver Reconstitutions. Single-allotype fetal liver reconstitu- centrifugation for 10 min at 250 ϫ g and lysed in 50 ␮lof tions of RAG-2Ϫ/Ϫ mice were performed as follows. Timed SDS͞PAGE sample loading buffer per 2 ϫ 106 cells. Samples matings were set up of NFATc1Ϫ/ϩ or NFATc2Ϫ/Ϫ, NFATc1Ϫ/ϩ were boiled for 5 min and frozen. Subsequently, 50 ␮l of each mice. On day 13.5, fetal livers were harvested and a cell lysate was run on a SDS͞7.5% PAGE gel, and immunoblotting suspension was made by pipetting them up and down 25 times in was performed by standard methods. The blots were probed by complete medium (14) supplemented with 10% heat-inactivated using mouse monoclonal 7A6 anti-NFATc1 antibody (Santa FCS (10% complete medium). One-tenth volumes of the sus- Cruz Biotechnology), rabbit polyclonal anti-NFATc2 antibody pensions were used for genotyping by PCR as described above. 67.1 (gift from Anjana Rao, Center for Blood Research, Harvard The remaining cells were washed once in complete medium with University, Boston), and mouse monoclonal anti-HSP-60 (H-1) 1% FCS (1% complete medium) and resuspended in 0.4 ml of antibody (Santa Cruz Biotechnology). 1% complete medium. Each resuspended liver was injected into one RAG-2Ϫ/Ϫ mouse that had received 300 rad of ␥ radiation Retroviral Constructions and Infections. The murine NFATc1 iso- 4–24 h earlier and 10 units of heparin (i.p.) Ϸ1 h earlier. In some form a (GenBank accession no. GI7208617) complete coding experiments disaggregated fetal livers were frozen in complete sequence was amplified by PCR and a 5Ј EcoR1 site and 3Ј NotI medium with 20% heat-inactivated FCS and 10% DMSO after site introduced by using the forward primer GTTACAGTG- removal of 1͞10th volume for genotyping and the 1% complete GAATTCAAACAGACACCATGCCAAATACCAGCTT- medium wash. For injection, cells were thawed, diluted in 10% TCCA and the reverse primer GTTACAGTCGCGGCCGCT- complete medium, pelleted at 250 ϫ g, washed twice in 1% CAGTAAAAACCTCCTCTCA.
Load more

Recommended publications
  • Activated Peripheral-Blood-Derived Mononuclear Cells
    Transcription factor expression in lipopolysaccharide- activated peripheral-blood-derived mononuclear cells Jared C. Roach*†, Kelly D. Smith*‡, Katie L. Strobe*, Stephanie M. Nissen*, Christian D. Haudenschild§, Daixing Zhou§, Thomas J. Vasicek¶, G. A. Heldʈ, Gustavo A. Stolovitzkyʈ, Leroy E. Hood*†, and Alan Aderem* *Institute for Systems Biology, 1441 North 34th Street, Seattle, WA 98103; ‡Department of Pathology, University of Washington, Seattle, WA 98195; §Illumina, 25861 Industrial Boulevard, Hayward, CA 94545; ¶Medtronic, 710 Medtronic Parkway, Minneapolis, MN 55432; and ʈIBM Computational Biology Center, P.O. Box 218, Yorktown Heights, NY 10598 Contributed by Leroy E. Hood, August 21, 2007 (sent for review January 7, 2007) Transcription factors play a key role in integrating and modulating system. In this model system, we activated peripheral-blood-derived biological information. In this study, we comprehensively measured mononuclear cells, which can be loosely termed ‘‘macrophages,’’ the changing abundances of mRNAs over a time course of activation with lipopolysaccharide (LPS). We focused on the precise mea- of human peripheral-blood-derived mononuclear cells (‘‘macro- surement of mRNA concentrations. There is currently no high- phages’’) with lipopolysaccharide. Global and dynamic analysis of throughput technology that can precisely and sensitively measure all transcription factors in response to a physiological stimulus has yet to mRNAs in a system, although such technologies are likely to be be achieved in a human system, and our efforts significantly available in the near future. To demonstrate the potential utility of advanced this goal. We used multiple global high-throughput tech- such technologies, and to motivate their development and encour- nologies for measuring mRNA levels, including massively parallel age their use, we produced data from a combination of two distinct signature sequencing and GeneChip microarrays.
    [Show full text]
  • View Is Portrayed Schematically in Figure 7B
    BASIC RESEARCH www.jasn.org Recombination Signal Binding Protein for Ig-kJ Region Regulates Juxtaglomerular Cell Phenotype by Activating the Myo-Endocrine Program and Suppressing Ectopic Gene Expression † † ‡ Ruth M. Castellanos-Rivera,* Ellen S. Pentz,* Eugene Lin,* Kenneth W. Gross, † Silvia Medrano,* Jing Yu,§ Maria Luisa S. Sequeira-Lopez,* and R. Ariel Gomez* *Department of Pediatrics, School of Medicine, †Department of Biology, Graduate School of Arts and Sciences, and §Department of Cell Biology, University of Virginia, Charlottesville, Virginia; and ‡Department of Molecular and Cellular Biology, Roswell Park Cancer Institute, Buffalo, New York ABSTRACT Recombination signal binding protein for Ig-kJ region (RBP-J), the major downstream effector of Notch signaling, is necessary to maintain the number of renin-positive juxtaglomerular cells and the plasticity of arteriolar smooth muscle cells to re-express renin when homeostasis is threatened. We hypothesized that RBP-J controls a repertoire of genes that defines the phenotype of the renin cell. Mice bearing a bacterial artificial chromosome reporter with a mutated RBP-J binding site in the renin promoter had markedly reduced reporter expression at the basal state and in response to a homeostatic challenge. Mice with conditional deletion of RBP-J in renin cells had decreased expression of endocrine (renin and Akr1b7)and smooth muscle (Acta2, Myh11, Cnn1,andSmtn) genes and regulators of smooth muscle expression (miR- 145, SRF, Nfatc4, and Crip1). To determine whether RBP-J deletion decreased the endowment of renin cells, we traced the fate of these cells in RBP-J conditional deletion mice. Notably, the lineage staining patterns in mutant and control kidneys were identical, although mutant kidneys had fewer or no renin- expressing cells in the juxtaglomerular apparatus.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Predictive Toxicogenomics for the Identification of Chemical Carcinogens : Application to Human Hepatic Cell Lines
    Predictive toxicogenomics for the identification of chemical carcinogens : application to human hepatic cell lines Citation for published version (APA): Christina Magkoufopoulou, C. (2011). Predictive toxicogenomics for the identification of chemical carcinogens : application to human hepatic cell lines. Datawyse / Universitaire Pers Maastricht. https://doi.org/10.26481/dis.20111208cc Document status and date: Published: 01/01/2011 DOI: 10.26481/dis.20111208cc Document Version: Publisher's PDF, also known as Version of record Please check the document version of this publication: • A submitted manuscript is the version of the article upon submission and before peer-review. There can be important differences between the submitted version and the official published version of record. People interested in the research are advised to contact the author for the final version of the publication, or visit the DOI to the publisher's website. • The final author version and the galley proof are versions of the publication after peer review. • The final published version features the final layout of the paper including the volume, issue and page numbers. Link to publication General rights Copyright and moral rights for the publications made accessible in the public portal are retained by the authors and/or other copyright owners and it is a condition of accessing publications that users recognise and abide by the legal requirements associated with these rights. • Users may download and print one copy of any publication from the public portal for the purpose of private study or research. • You may not further distribute the material or use it for any profit-making activity or commercial gain • You may freely distribute the URL identifying the publication in the public portal.
    [Show full text]
  • Supplementary Table S4. FGA Co-Expressed Gene List in LUAD
    Supplementary Table S4. FGA co-expressed gene list in LUAD tumors Symbol R Locus Description FGG 0.919 4q28 fibrinogen gamma chain FGL1 0.635 8p22 fibrinogen-like 1 SLC7A2 0.536 8p22 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 DUSP4 0.521 8p12-p11 dual specificity phosphatase 4 HAL 0.51 12q22-q24.1histidine ammonia-lyase PDE4D 0.499 5q12 phosphodiesterase 4D, cAMP-specific FURIN 0.497 15q26.1 furin (paired basic amino acid cleaving enzyme) CPS1 0.49 2q35 carbamoyl-phosphate synthase 1, mitochondrial TESC 0.478 12q24.22 tescalcin INHA 0.465 2q35 inhibin, alpha S100P 0.461 4p16 S100 calcium binding protein P VPS37A 0.447 8p22 vacuolar protein sorting 37 homolog A (S. cerevisiae) SLC16A14 0.447 2q36.3 solute carrier family 16, member 14 PPARGC1A 0.443 4p15.1 peroxisome proliferator-activated receptor gamma, coactivator 1 alpha SIK1 0.435 21q22.3 salt-inducible kinase 1 IRS2 0.434 13q34 insulin receptor substrate 2 RND1 0.433 12q12 Rho family GTPase 1 HGD 0.433 3q13.33 homogentisate 1,2-dioxygenase PTP4A1 0.432 6q12 protein tyrosine phosphatase type IVA, member 1 C8orf4 0.428 8p11.2 chromosome 8 open reading frame 4 DDC 0.427 7p12.2 dopa decarboxylase (aromatic L-amino acid decarboxylase) TACC2 0.427 10q26 transforming, acidic coiled-coil containing protein 2 MUC13 0.422 3q21.2 mucin 13, cell surface associated C5 0.412 9q33-q34 complement component 5 NR4A2 0.412 2q22-q23 nuclear receptor subfamily 4, group A, member 2 EYS 0.411 6q12 eyes shut homolog (Drosophila) GPX2 0.406 14q24.1 glutathione peroxidase
    [Show full text]
  • What Your Genome Doesn't Tell
    UC San Diego UC San Diego Electronic Theses and Dissertations Title Multi-layered epigenetic control of T cell fate decisions Permalink https://escholarship.org/uc/item/8rs7c7b3 Author Yu, Bingfei Publication Date 2018 Peer reviewed|Thesis/dissertation eScholarship.org Powered by the California Digital Library University of California UNIVERSITY OF CALIFORNIA SAN DIEGO Multi-layered epigenetic control of T cell fate decisions A dissertation submitted in partial satisfaction of the requirements for the degree Doctor of Philosophy in Biology by Bingfei Yu Committee in charge: Professor Ananda Goldrath, Chair Professor John Chang Professor Stephen Hedrick Professor Cornelis Murre Professor Wei Wang 2018 Copyright Bingfei Yu, 2018 All rights reserved. The dissertation of Bingfei Yu is approved, and it is ac- ceptable in quality and form for publication on microfilm and electronically: Chair University of California San Diego 2018 iii DEDICATION To my parents who have been giving me countless love, trust and support to make me who I am. iv EPIGRAPH Stay hungary. Stay foolish. | Steve Jobs quoted from the back cover of the 1974 edition of the Whole Earth Catalog v TABLE OF CONTENTS Signature Page.................................. iii Dedication..................................... iv Epigraph.....................................v Table of Contents................................. vi List of Figures.................................. ix Acknowledgements................................x Vita........................................ xii Abstract of
    [Show full text]
  • Gene Networks Activated by Specific Patterns of Action Potentials in Dorsal Root Ganglia Neurons Received: 10 August 2016 Philip R
    www.nature.com/scientificreports OPEN Gene networks activated by specific patterns of action potentials in dorsal root ganglia neurons Received: 10 August 2016 Philip R. Lee1,*, Jonathan E. Cohen1,*, Dumitru A. Iacobas2,3, Sanda Iacobas2 & Accepted: 23 January 2017 R. Douglas Fields1 Published: 03 March 2017 Gene regulatory networks underlie the long-term changes in cell specification, growth of synaptic connections, and adaptation that occur throughout neonatal and postnatal life. Here we show that the transcriptional response in neurons is exquisitely sensitive to the temporal nature of action potential firing patterns. Neurons were electrically stimulated with the same number of action potentials, but with different inter-burst intervals. We found that these subtle alterations in the timing of action potential firing differentially regulates hundreds of genes, across many functional categories, through the activation or repression of distinct transcriptional networks. Our results demonstrate that the transcriptional response in neurons to environmental stimuli, coded in the pattern of action potential firing, can be very sensitive to the temporal nature of action potential delivery rather than the intensity of stimulation or the total number of action potentials delivered. These data identify temporal kinetics of action potential firing as critical components regulating intracellular signalling pathways and gene expression in neurons to extracellular cues during early development and throughout life. Adaptation in the nervous system in response to external stimuli requires synthesis of new gene products in order to elicit long lasting changes in processes such as development, response to injury, learning, and memory1. Information in the environment is coded in the pattern of action-potential firing, therefore gene transcription must be regulated by the pattern of neuronal firing.
    [Show full text]
  • Isoform-Selective NFAT Inhibitor: Potential Usefulness and Development
    International Journal of Molecular Sciences Review Isoform-Selective NFAT Inhibitor: Potential Usefulness and Development Noriko Kitamura 1 and Osamu Kaminuma 1,2,* 1 Laboratory of Allergy and Immunology, Tokyo Metropolitan Institute of Medical Science, Tokyo 156-8506, Japan; [email protected] 2 Department of Disease Model, Research Institute of Radiation Biology and Medicine, Hiroshima University, Hiroshima 734-8553, Japan * Correspondence: [email protected]; Tel.: +81-82-257-5819 Abstract: Nuclear factor of activated T cells (NFAT), which is the pharmacological target of immuno- suppressants cyclosporine and tacrolimus, has been shown to play an important role not only in T cells (immune system), from which their name is derived, but also in many biological events. There- fore, functional and/or structural abnormalities of NFAT are linked to the pathogenesis of diseases in various organs. The NFAT protein family consists of five isoforms, and each isoform performs diverse functions and has unique expression patterns in the target tissues. This diversity has made it difficult to obtain ideal pharmacological output for immunosuppressants that inhibit the activity of almost all NFAT family members, causing serious and wide-ranging side effects. Moreover, it remains unclear whether isoform-selective NFAT regulation can be achieved by targeting the struc- tural differences among NFAT isoforms and whether this strategy can lead to the development of better drugs than the existing ones. This review summarizes the role of the NFAT family members in biological events, including the development of various diseases, as well as the usefulness of and Citation: Kitamura, N.; problems associated with NFAT-targeting therapies, including those dependent on current immuno- Kaminuma, O.
    [Show full text]
  • Roles of Glycogen Synthase Kinase-3 (GSK-3) in Cardiac Development and Heart Disease
    J UOEH 40（ 2 ）: 147－156（2018） 147 ［Review］ Roles of Glycogen Synthase Kinase-3 (GSK-3) in Cardiac Development and Heart Disease Fumi Takahashi-Yanaga* Department of Pharmacology, School of Medicine, University of Occupational and Environmental Health, Japan. Yahatanishi-ku, Kitakyushu 807-8555, Japan Abstract : Glycogen synthase kinase-3 (GSK-3) is a cytoplasmic serine/threonine protein kinase which is known to regulate a variety of cellular processes through a number of signaling pathways important for cell proliferation, stem cell renewal, apoptosis and development. Although GSK-3 exists in a variety of tissues, this kinase plays very im- portant roles in the heart to control its development through the formation of heart and cardiomyocyte proliferation. GSK-3 is also recognized as one of the main molecules that control cardiac hypertrophy and fibrosis. Therefore, GSK-3 could be an attractive target for the development of new drugs to cure cardiac diseases. The present review summarizes the roles of GSK-3 in the signaling pathways and the heart, and discusses the possibility of new drug development targeting this kinase. Keywords : GSK-3, cardiac development, cardiac hypertrophy, cardiac fibrosis. （Received February 7, 2018, accepted April 6, 2018） Introduction 1. Glycogen synthase kinase-3 (GSK-3) GSK-3 was originally identified as a kinase that can Glycogen synthase kinase-3 (GSK-3) was identified phosphorylate glycogen synthase to inhibit glycogen in 1980 as a protein kinase that inactivates glycogen synthesis. In general, kinases activate their target pro- synthase, the rate-limiting enzyme in glycogen synthe- teins by phosphorylation. However, in 1980, GSK-3 sis.
    [Show full text]
  • Downregulation of Carnitine Acyl-Carnitine Translocase by Mirnas
    Page 1 of 288 Diabetes 1 Downregulation of Carnitine acyl-carnitine translocase by miRNAs 132 and 212 amplifies glucose-stimulated insulin secretion Mufaddal S. Soni1, Mary E. Rabaglia1, Sushant Bhatnagar1, Jin Shang2, Olga Ilkayeva3, Randall Mynatt4, Yun-Ping Zhou2, Eric E. Schadt6, Nancy A.Thornberry2, Deborah M. Muoio5, Mark P. Keller1 and Alan D. Attie1 From the 1Department of Biochemistry, University of Wisconsin, Madison, Wisconsin; 2Department of Metabolic Disorders-Diabetes, Merck Research Laboratories, Rahway, New Jersey; 3Sarah W. Stedman Nutrition and Metabolism Center, Duke Institute of Molecular Physiology, 5Departments of Medicine and Pharmacology and Cancer Biology, Durham, North Carolina. 4Pennington Biomedical Research Center, Louisiana State University system, Baton Rouge, Louisiana; 6Institute for Genomics and Multiscale Biology, Mount Sinai School of Medicine, New York, New York. Corresponding author Alan D. Attie, 543A Biochemistry Addition, 433 Babcock Drive, Department of Biochemistry, University of Wisconsin-Madison, Madison, Wisconsin, (608) 262-1372 (Ph), (608) 263-9608 (fax), [email protected]. Running Title: Fatty acyl-carnitines enhance insulin secretion Abstract word count: 163 Main text Word count: 3960 Number of tables: 0 Number of figures: 5 Diabetes Publish Ahead of Print, published online June 26, 2014 Diabetes Page 2 of 288 2 ABSTRACT We previously demonstrated that micro-RNAs 132 and 212 are differentially upregulated in response to obesity in two mouse strains that differ in their susceptibility to obesity-induced diabetes. Here we show the overexpression of micro-RNAs 132 and 212 enhances insulin secretion (IS) in response to glucose and other secretagogues including non-fuel stimuli. We determined that carnitine acyl-carnitine translocase (CACT, Slc25a20) is a direct target of these miRNAs.
    [Show full text]
  • Analyses of PDE-Regulated Phosphoproteomes Reveal Unique
    Analyses of PDE-regulated phosphoproteomes reveal PNAS PLUS unique and specific cAMP-signaling modules in T cells Michael-Claude G. Beltejara, Ho-Tak Laua, Martin G. Golkowskia, Shao-En Onga, and Joseph A. Beavoa,1 aDepartment of Pharmacology, University of Washington, Seattle, WA 98195 Contributed by Joseph A. Beavo, May 28, 2017 (sent for review March 10, 2017; reviewed by Paul M. Epstein, Donald H. Maurice, and Kjetil Tasken) Specific functions for different cyclic nucleotide phosphodiester- to bias T-helper polarization toward Th2, Treg, or Th17 pheno- ases (PDEs) have not yet been identified in most cell types. types (13, 14). In a few cases increased cAMP may even potentiate Conventional approaches to study PDE function typically rely on the T-cell activation signal (15), particularly at early stages of measurements of global cAMP, general increases in cAMP- activation. Recent MS-based proteomic studies have been useful dependent protein kinase (PKA), or the activity of exchange in characterizing changes in the phosphoproteome of T cells under protein activated by cAMP (EPAC). Although newer approaches various stimuli such as T-cell receptor stimulation (16), prosta- using subcellularly targeted FRET reporter sensors have helped glandin signaling (17), and oxidative stress (18), so much of the define more compartmentalized regulation of cAMP, PKA, and total Jurkat phosphoproteome is known. Until now, however, no EPAC, they have limited ability to link this regulation to down- information on the regulation of phosphopeptides by PDEs has stream effector molecules and biological functions. To address this been available in these cells. problem, we have begun to use an unbiased mass spectrometry- Inhibitors of cAMP PDEs are useful tools to study PKA/EPAC- based approach coupled with treatment using PDE isozyme- mediated signaling, and selective inhibitors for each of the 11 PDE – selective inhibitors to characterize the phosphoproteomes of the families have been developed (19 21).
    [Show full text]
  • 1 Genome-Wide Discovery of SLE Genetic Risk Variant Allelic Enhancer
    bioRxiv preprint doi: https://doi.org/10.1101/2020.01.20.906701; this version posted January 20, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Genome-wide discovery of SLE genetic risk variant allelic enhancer activity Xiaoming Lu*1, Xiaoting Chen*1, Carmy Forney1, Omer Donmez1, Daniel Miller1, Sreeja Parameswaran1, Ted Hong1,2, Yongbo Huang1, Mario Pujato3, Tareian Cazares4, Emily R. Miraldi3-5, John P. Ray6, Carl G. de Boer6, John B. Harley1,4,5,7,8, Matthew T. Weirauch#,1,3,5,8,9, Leah C. Kottyan#,1,4,5,9 *Contributed equally #Co-corresponding authors: [email protected]; [email protected] 1Center for Autoimmune Genomics and Etiology, Cincinnati Children’s Hospital Medical Center, Cincinnati, Ohio, USA, 45229. 2Department of Pharmacology & Systems Physiology, University of Cincinnati, College of Medicine, Cincinnati, Ohio, USA, 45229. 3Division of Biomedical Informatics, Cincinnati Children’s Hospital Medical Center, Cincinnati, Ohio, USA, 45229. 4Division of Immunobiology, Cincinnati Children’s Hospital Medical Center, Cincinnati, Ohio, USA, 45229. 5Department of Pediatrics, University of Cincinnati, College of Medicine, Cincinnati, Ohio, USA, 45229. 6Broad Institute of Massachusetts Institute of Technology (MIT) and Harvard University, Cambridge, Massachusetts, USA, 02142. 7US Department of Veterans Affairs Medical Center, Cincinnati, Ohio, USA 45229. 8Division of Developmental Biology, Cincinnati Children’s Hospital Medical Center, Cincinnati, Ohio, USA, 45229. 1 bioRxiv preprint doi: https://doi.org/10.1101/2020.01.20.906701; this version posted January 20, 2020.
    [Show full text]