Crop and Agroecosystem Health Management
Annual Report 2006 Project PE-1
Centro Internacional de Agricultura Tropical (CIAT) Apartado aéreo 6713 Cali, Colombia, S.A.
Crop and Agroecosystem Health Management (Project PE-1)
Project Manager: Segenet Kelemu Fax: (572) 445 0073 Email: [email protected]
Adminsitrative Assistant: Melissa Garcia Email: [email protected]
Crop and Agroecosystem Health Management (Project PE-1). 2006. Annual Report, Centro Internacional de Agricultura Tropical, (CIAT), Cali, Colombia, 222 pp.
TABLE OF CONTENTS Page Project Description and Log Frame……………………………………………………….. 1 Narrative project description…………………………………………………………….…... 1 Project log Frame ( 2006 – 2008 ) ...... 8 CGIAR Output template 2006 ……………………………………………………………….. 11 Output 1: Pest and pathogen complexes in key crops described and analyzed (779 kb) 12 1.1. Identification of commonbean genotypes and interspecific lines resistant to Rhizoctonia solani 12 1.2. Virulence characterization of Colletotrichum lindemuthianum isolates collected from different bean growing departments of Colombia 15 1.3. Identifying and developing molecular markers linked to ALS resistance genes in common bean 17 1.4. Identifying and developing molecular markers linked Pythium root rot resistance 22 1.5. Identification of molecular markers linked to rice blast resistance genes 26 1.6. Characterization of strains of cassava frogskin virus 32 1.7. Monitoring of whitefly populations in the Andean zone 38 1.8. Mortality levels of new pesticides for the control of whitefly populations 40 1.9. Molecular characterization of isolates of Colletotrichum spp. infecting tree 44 tomato, mangoand lemon Tahiti in Colombia 1.10. Identifying strategies for managing anthracnose (Glomerella cingulata) (Anamorph Colletotrichum gloeosporioides) of soursop ( Anona muricata L.) emphasizing varietal resistance 54 1.11. Molecular and pathogenic characterization of isolates of Colletotrichum spp. associated with anthracnose of Andean blackberry on accessions from Valle del Cauca 67 1.12. Anthracnose of Andean blackberry (Rubus glaucus Benth.): Variability in species and races of the casual agent and identification of sources of resistance to the disease 72 1.13. Characterization and identification of phylotypes and sequevars of isolates of Ralstonia solanacearum obtained from plantain, banana, and Heliconia sp. In Colombia 76 Output 2: Pest-and-disease management components and strategies developed for key crops (392 kb) 86 2.1. Levels of resistance to important insect pests confirmed in bean progenies 86 2.2. Screening for sources of resistance to major insect pests 97 2.3. Screening for virus resistance transmitted by Bemisia tabaci biotype B in snap beans 98 2.4. Evaluation of Brachiaria hybrids for resistance to Rhizoctonia solani under field conditions in Caqueta 100 2.5. Bacterial endophytes in Brachiaria 103
2.6. Endophytic plant growth promoting bacteria associated with Brachiaria 108 2.7. Characterization and comparison of partial sequence of nifH gene in four strains of endophytic bacteria associated with Brachiaria genotypes 113 2.8. Validation of thermotherapy of stem cuttings, plant extract and Trichoderma to manage cassava diseases in the Eastern plains region and in Cauca (Colombia) 119 2.9. Improving nutritional management for the preventive control of downy mildew of roses (Peronospora sparsa) 126 2.10. Resistance induction in roses to reduce severity of downy mildew by applying 132 potassium phosphate 2.11. Microbiological and Physicochemical evaluation of lixiviates from decomposing 136 plantain rachises and pseudostems and their effectiveness in managing bacterial wilt 2.12. Physicochemical characterization of lixiviates from decomposing rachises, pseudostems, and fruit of plantain 138 2.13. Detecting Ralstonia solanacearum in lixiviates from decomposing rachises and pseudostems of plantain 142 2.14. Identifying live and dead cells of Ralstonia solanacearum exposed to lixiviates from plantain residues, phosphoric rock, and french marigold 144 2.15. Determining the control of bacterial wilt in plantain seedlings by different types of lixiviate 146 2.16. Effect of lixiviates on controlling bacterial wilt in soil under field conditions at the santa Elena farm, municipality of Armenia, Quindio 154 Output 3: Strengthened capacity of NARS to design and execute IPM R&D, to apply molecular tools for pathogen and pest detection, diagnosis, diversity studies and to device novel disease and pest management strategies (162 kb) 161 3.1. Developing integrated pest management strategies for whiteflies 161 3.2. Socializing research results on managing bacterial wilt of plantain 165 3.3. Capacity Building 166 3.3.1. List of students supervised in 2006 166 3.4. Training and consultancy services offered during 2006 171 3.5. Conferences, workshops, meetings attended by one or more staff of PE-1 project 174 3.6. List of visitors to the various research activities of PE-1 project 176 3.7. List of awards to staff in Project PE-1 178 3.8. List of ongoing special projects in 2006 179 3.9. List of project proposals and concept notes developed with partners 186 3.10. List of publications 188 3.11. List of partners / collaborators 193 Output 4: Global IPM networks (Integrated Whitefly Management Technology) and knowledge systems developed (382 kb) 198
4.1. Dissemination of validated IPM Technology in developing countries affected by whitefly pests and whitefly - transmitted viruses that hinder food production and socio-economic development in the Tropics. 198 4.2. Integrated management of whiteflies (homoptera: aleyrodidae) on cassava. 210 Annexes (35 kb) 220 5.1. List of Staff 220 5.2. List of Donors 222
Dedication:
With great admiration and respect, we dedicate this annual report to Dr. César Cardona for the many years of outstanding service that he gave and for the high quality of research in tropical entomology and the impact he has made to improve agricultural productivity and to protect the environment.
Born in Colombia, Dr. Cardona received his BSc. in Agronomy in 1965 from the National University of Colombia. He joined the Instituto Colombiano Agropecuario (ICA) [1965-1971], where he held a series of positions from research assistant all the way to senior scientist conducting research on insect pests of cotton and fruit crops in Colombia. He continued his education and pursued a Ph. D. in Entomology at the University of California at Riverside. While at UC- Riverside, he received the "Harry S. Smith" Award. This award is conferred to the best graduate student (1971), given by the Department of Entomology. He received his Ph.D. in entomology in 1972 and soon after joined the Colombian National Association of Cotton Growers as Head of the Technical Department Cotton Growers Federation (1971-1978).
Dr. Cardona joined CIAT in 1978 as an entomologist in the Bean Program and worked in that position until 1981. He was responsible for research on control of insects affecting beans in Latin America, particularly focusing on host plant resistance. He then moved and worked at the International Center for Agricultural Research in the Dry Areas (ICARDA) as a legume entomologist for the following 5 years. He returned to CIAT in 1985 as a bean entomologist. In 1997, he added forage entomology to his research responsibility and continued his outstanding and exemplary research until July 2006. Since July 2006, he has served as a consultant to the Forage Entomology program.
All throughout these years he continued his affiliation with the National University of Colombia. He has served as a lecturer and associate professor to the university in several occasions. He is an innate teacher; and under his supervision and mentorship 25 BSc., 5 MSc. and 4 PhD. thesis have been completed. Among his other professional participation we can list his memberships in the Sociedad Colombiana de Entomología (Socolen, Colombia), the Entomological Society of America (U.S.), Florida Entomological Society, and the American Association for the Advancement of Science.
Dr. Cardona’s contribution to science has been enormous, making direct impacts on improving the lives of poor farmers. Some of his most outstanding research accomplishments include: 1) pioneering work on host plant resistance to six major insect pests affecting bean production in Latin America and elsewhere; 2) elucidation of the role of arcelin (a novel protein) as the factor conferring resistance to the Mexican bean weevil in beans; and 3) development, testing and
implementation of a highly reliable, mass screening methodology to facilitate breeding for resistance to spittlebugs in Brachiaria, thus contributing to the development of Brachiaria hybrids with high levels of resistance to several spittlebug species. This led to the characterization of mechanisms of resistance to all six major spittlebug species present in Colombia.
Dr. Cardona has also distinguished himself as a prolific writer, having authored or co-authored more than 123 refereed journal publications (emphasis on host plant resistance and problems related to insecticide abuse), over 7 book chapters, one book on host plant resistance to insects, and many other publications including, pamphlets, brochures, working documents, etc. He has been the recipient of numerous and prestigious awards such as the” National Agricultural Award“1991, given by the Ministry of Agriculture of Colombia and the “Meritorious Service Award" conferred by The Bean, Improvement Cooperative, BIC, in November 1993, in Michigan, USA. As a proof of his excellent research work, he has been awarded the “Hernán Alcaráz Viecco" Annual Award by the Colombian Entomological Society, SOCOLEN in twenty-three occasions! Within CIAT, he has been granted the Outstanding Research publication award in 1993 and in 2004, as well as the Outstanding Senior Staff Achievement award in 1993.
On the personal side, he has been married to Graciela for 40 years and is father of three children and the proud grandfather of two.
This is only a small glimpse of the man, the scientist, the mentor, and the colleague. He has many admirable and unique traits that cannot simply be put in words. His impeccable personal and scientific integrity, his selfless willingness to provide help to whomever needs it, his love for science and his dedication to the mission of CIAT are all unprecedented. César’s research has unfailingly been characterized by the utmost scientific rigor coupled with intimate and passionate contact with the biological organisms-the insects and plants- that have been the focus of his work. He is the epitome of a “hands on” applied biologist and the best collaborator any scientist could hope for.
1. Project Description and Logframe
Project PE-1: Crop and agroecosystem health management
Research for Development Challenge: Improving Management of Agroecosystems in the Tropics (IMAT), CIAT. The project also contributes to the “Enhancing and Sharing the Benefits of Agrobiodiversity Biodiversity.”
Project Manager: Segenet Kelemu
Project Description:
Goal: To enhance crop yields and quality of products, reduce pesticide use and residue, and improve agro- ecosystem health through enhancement of soil health and integrated management of major pests and diseases in the tropics.
Objective: Develop and transfer pest-and-disease knowledge and management systems for sustainable productivity and healthier agro-ecosystems in the tropics.
Target Ecoregion: Humid and sub-humid tropics in eastern and southern Africa, Central America and Andes.
1.1. Narrative Project Description
1.1.1. Rationale:
Most cultivated plant species are susceptible to a wide range of fungal, bacterial, and viral pathogens, and arthropod pests, particularly in tropical climates. These problems are compounded by the lack of resources and technical assistance to poor farmers in developing countries. Under these conditions, crop losses can often be significant or even total, affecting the livelihoods and food security of millions of poor rural and urban communities. In view of this situation, we could expect that the application of improved and intensive crop protection measures would contribute to the sustainability and enhancement of food production in these regions of the world. The development and application of integrated pest and disease management (IPDM) strategies is the basis of the Crop and Agroecosystem Health Management Project activities. Some of these methods include the development of resistant cultivars, including transgenic plants, and a variety of control measures developed for specific plant diseases/pests and agroecosystems. Biotechnology and/or conventional tools perform essential roles in our research activities dealing with crop and agroecosystem health management.
The Project’s research activities are organized around four major outputs: 1) Pest and disease complexes described and analyzed, 2) Pest-and-disease management components and IPM strategies developed, 3) NARS’ capacity to design and execute IPM research and implementation, and applications of molecular tools for pathogen and pest detection, diagnosis, diversity studies as well as novel disease and pest management strategies strengthened, 4) Global IPM networks (Integrated Whitefly Management Technology) and knowledge systems developed.
Output 1: Pest and disease complexes described and analyzed.
The difficulty of accurately identifying pathogens and pests of tropical crops is often a bottleneck to their control. We, together with various collaborators, have developed several molecular and conventional
1 diagnostic tools to detect, identify, and characterize pathogens and other pests affecting its mandated crops, that is, beans, cassava, tropical forages, and rice, as well as several high value crops currently grown by small-scale farmers in the tropics.
Extensively characterized pathogen populations at CIAT, with substantial practical implications for their management, include Xanthomonas axonopodis pv. manihotis, Colletotrichum gloeosporioides, Phaeoisariopsis griseola, Pyricularia grisea, Sphaceloma manihoticola, Colletotrichum lindemuthianum, species of Pythium, Xanthomonas campestris pv. graminis, Rice hoja blanca virus (RHBV), and begomoviruses and potyviruses that infect important crops found in the tropics. Pests that are well- characterized include species of mealybugs, species of spittlebugs, whiteflies and their parasitoids, biotypes of the whitefly Bemisia tabaci, bruchids, and white grubs.
Output 2: Pest-and-disease management components and IPM strategies developed.
Resistance (conventional breeding): Managing diseases and pests through host resistance is economically attractive and practical. To develop cultivars resistant to diseases and insect pests, a common strategy, known as ‘gene pyramiding’, is to incorporate as many resistance genes into a single plant genotype as possible, in the hope that it will be statistically unlikely for a pathogenic race or insect pest to evolve that can overcome all the resistance genes simultaneously. However, combining several resistance genes simultaneously in one background becomes difficult without using markers for each gene. In this context, the use of marker-assisted selection to contain pest damage becomes essential.
Transgenic crops as components of IPDM strategies: Genomic approaches are increasing our understanding of the genetic basis of plant disease and pest resistance by enabling us to better understand resistance genes themselves, other genes, and the pathways they regulate. While fully recognizing the controversy on transgenic organisms, we value the potential role they can play in arthropod pest, disease, and virus management strategies across several crops. The role of transgenic organisms in IPDM will increase in the future and has already been shown as a way of drastically decreasing pesticide use.
Transgenic crops developed at CIAT include Stylosanthes guianensis containing a rice-basic chitinase gene for resistance to the fungal pathogen Rhizoctonia solani; rice, for resistance to Rice hoja blanca virus (RHBV), containing the RHBV nucleocapsid protein (N) gene. As the possibilities of combining genes from various sources expand, the need for biosafety regulations and risk assessment increases. Our studies on the effect of transgenic (Bt) varieties on non-target soil organisms showed that no statistical differences were detected in abundance and diversity of soil organisms in conventional versus genetically modified cotton [Bollgard ® Bt Cry 1A ©] during the 2003-05 period in the Cauca Valley, Colombia.
Bio-pesticides:
The concerns on excessive pesticide use and the threat to human health and the environment, coupled with increasing regulatory and market pressures, along with pest and pathogen resistance to synthetic chemicals, have led to a reappraisal of approaches to pest and disease control strategies that include the development of safer “biological pesticides.” This excessive use of pesticides threatens to weaken the competitiveness of many Latin American countries' agriculture by: 1) threatening to disqualify export products especially in those countries that have stringent food safety regulations, 2) increasing production cost, 3) degrading the general ecosystem, making their soils less productive over time, 4) contaminating water supplies, 5) causing health problems among agricultural workers and thus affecting the labor force. In this context, we believe
2 natural plant and microbial compounds will play a major role in pest and disease control in both developed and developing countries.
Biological control is an important component of integrated pest and pathogen management. Endophytic microbes, fungi, bacteria, nematodes, viruses, plant-derived compounds are all identified and characterized for use as biocontrol agents against a wide range of pathogens and pests attacking various crops. Biopesticides developed and currently made commercially available in collaborative projects with the private sector include: 1) Biocanii, based on a strain of the fungus Verticillium lecanii for the control of whiteflies and thrips on flowers, beans, avocado, cotton, onion, citrus, asparagus, papaya, tomatoes and other horticultural crops; 2) Biorhizium, based on two strains of the fungus Metarhizium anisopliae for the control of various insects such as spittlebugs in pastures; 3) Biovirus, based on a baculovirus and used for the control of cassava hornworm, 4) Ecoswing®,.a biofungicide formulated from extracts of the plant swinglia (Swinglia glutinosa).
Plant-derived compounds: We have identified plant-derived compounds that are effective in controlling diseases and pests. These include: 1) fique (Furcraea cabuya), 2) swinglia (Swinglia glutinosa), 3) Clitoria ternatea.
Legumes have been used as cover crops and as sources of green manure. The use of cover crops (e.g. Canavalaia ensiformis, Crotalaria rahamiana, Crotalaria juncea, C. ochroleuca, Desmodium intortum, D. unicanatum, Lablab purpureus, Tagetes patula, Mucuna pruriens) has been associated with a decrease in incidence of soil-borne pathogens and pests in several cropping systems.
Output 3: NARS’ capacity to design and execute IPM research and implementation, and applications of molecular tools for pathogen and pest detection, diagnosis, diversity studies as well as novel disease and pest management strategies strengthened.
The purpose of this output is to strengthen our national partners’ capacity to diagnose and detect pests and diseases; develop and execute IPDM strategies that would contribute to the reduction of losses caused by pests and diseases through effective targeting, dissemination and adoption of integrated pest management strategies that are acceptable to smallholder farmers in eastern, central and southern Africa and Latin America. Useful practical experiences have been gained, successes achieved and lessons learnt during the promotion of technologies at target sites. We will help to develop plant diagnostic networks to combat invasive pests, promote regional collaboration, and strengthen local diagnostic and outreach capabilities.
Through strong partnerships with national programs, universities, farmer groups, and the private sector we develop and evaluate diagnostic tools, disease and pest management methods including resistant materials, cultural methods and biopesticides. Capacity building and training of students, farmers and professionals at various levels is a major activity of the project staff.
Output 4: Global IPM networks (Integrated Whitefly Management Technology) and knowledge systems developed.
One of our main research areas is the management of whiteflies as pests and vectors of plant viruses attacking a broad range of crops throughout the tropics. Whiteflies are phloem feeders that cause direct damage in some of their hosts by removing large quantities of sap. In addition, species of whiteflies, such as Bemisia tabaci and Trialeurodes vaporariorum, are vectors of plant viruses of significant economic
3 importance. These whitefly species cause significant and often total direct or indirect (as vectors) damage to a wide range of food and industrial crops throughout the tropics. For example, African cassava mosaic disease is caused by different but related viruses transmitted by B. tabaci. Similarly, Bemisia-transmitted viruses affect many traditional (e.g. common bean) and non-traditional (e.g. tomato, peppers, cucurbits) crops in the tropics. The pest problem that is associated with many horticultural crops is often dealt with multiple applications of pesticides. These and other similar scenarios have major consequences to food security, human and agroecosystem health, and farm income.
In the1990s, new inter-center initiatives including the System-wide Program on Integrated Pest Management (SP-IPM) were created by the CGIAR. Due to the importance of whiteflies and the viruses they transmit, the Tropical Whitefly IPM Project (TWFP) was the first inter-center project within SP-IPM. The Project was developed in three phases to be carried out over a 10-year period, and launched in 1997 with CIAT as the convening Center. Five IARCs (CIAT, IITA, AVRDC, ICIPE, CIP), 12 advanced research institutes, and 31National Agricultural Research and Extension Systems in Latin America, Caribbean, Africa and Asia are included. This extensive partnership was made possible through the financial support of six major donors: Danish International Development Agency (DANIDA), Australian Center for International Agricultural Research (ACIAR), United States Agency for International Development (USAID), Ministry of Foreign Affairs and Trade (MFAT, now New Zealand Aid), U.S. Department of Agriculture-Agricultural Research Service (USDA-ARS), Department for International Development (DFID, UK)
1.1.2. CGIAR System Priorities:
The Crop and Agroecosystem Health Management Project contributes essentially to all the 5 CGIAR Research Priorities (2005-2015). Specific activities conducted by the Project to contribute to the CGIAR priorities are:
• Developing molecular and conventional methods for screening of germplasm for resistance to diseases and pests- (Priority 1) • Characterization of germplasm and identification of sources of resistance to diseases and pests- (Priority 1) • Developing phytosanitory methods and protocols for the safe movement of germplasm-(Priority 1) • Identification, characterization and conservation of beneficial microorganisms associated with plant germplasm (eg. endophytic bacteria and fungi), and predators of harmful pets-(Priority 1) • Enhancing yields of crops through pest and disease resistance- (Priority 2) • Reduction of pesticide use in various crops including high value crops, thus reduction of pesticide residue and improving food safety- (Priority 2) • Monitoring pathogens and pests that develop resistance to pesticides- (Priority 2) • Screening high value crops for resistance to key pathogens and pests- (Priority 3) • Management of diseases and pests in fruits and vegetables- (Priority 3) • Developing methods to prevent post harvest losses- (Priority 3) • Improving water quality through pesticide use reduction- (Priority 4) • Enhancing soil health through improved and integrated disease and pest management strategies- (Priority 4) • Development and implementation of integrated disease and pest management strategies for sustainable management of agroecosystems- (Priority 5) • Development of phytosanitary protocols and certification systems to facilitate international trades- (Priority 5)
4 1.1.3. Impact Pathways:
The project contributes to improved crop productivity and improved livelihoods through development of efficient and accurate tools for disease and pest diagnosis (output 1), and cost-effective disease and arthropod pest management strategies (output 2). We screen for host plant resistance and identify important sources of resistance to a wide range of pests and pathogens. These sources of resistance are used in the breeding programs to incorporate the resistance genes with a number of other genes of agronomic importance. We develop other components of integrated pest and disease management strategies including biopesticides and cultural practices. The capacity of our national partners to diagnose and detect pathogens and pests and to implement effective disease and pest management strategies is enhanced through our activities in output 3. We communicate our results through publications in international and regional journals, books and manuals, articles presented in conferences and workshops, websites, and in English, Spanish and other major local languages. Other communication outlets are newspaper articles and other journals intended for the general public. Global networks on sustainable management of key pests, such as whiteflies, which attack staple crops, high value crops and industrial crops are established (output 4). The outputs of the Project benefit NARS scientists, farmers, and consumers by increasing crop yields, crop quality, agro-ecosystem health and stabilizing production systems. The judicious use of pesticides results in clean harvests with little or no pesticide residues, leading to increased income and market access through healthier products, and cleaner environment.
1.1.4. International Public Goods:
The project works on diseases and pests of rice, beans, cassava, tropical forages and tropical fruits. In addition to the research activities involving CIAT’s commodity crops, the Project scientists are also involved in projects that expand their expertise to other agricultural and industrial crops. These include maize, cotton, onions, asparagus, other vegetables, potatoes, cut flowers and oil palm.
The Project has played a major role in the formation and development of the CGIAR Systemwide Program in IPM (SP-IPM). CIAT is the Convening Center for the major ongoing project in the SP-IPM, The Tropical Whitefly IPM Project. A draft SP-IPM proposal on “Soil Biota, Fertility and Plant Health” is available. The Project staff as well as the TSBF Institute of CIAT have played major roles in this proposal.
The Instituto Agronómico de Colombia (ICA) invited the Project and its scientists to apply for, and acquire accreditation to evaluate the quality and effectiveness of biological pesticides. The CIAT laboratories and scientists would become registered with ICA to perform quality control analysis of biopesticide products of commercial producers seeking ICA registration. Furthermore, the Project is invited to participate in major activities of ICA involving phytosanitary issues. The citrus virus certification work that the Project has conducted in collaboration with ICA and CORPOICA is now considered as a model for expansion to other crops, diseases and regions.
The science dealing with the identification, naming and classification of organisms, is a vital component in a pest management program. An inaccurate identification of a pest organism can result in an acute loss of time and resources and delay the most appropriate response to pest attack. The Project provides a service for the identification of arthropod pests and pathogens collected from various crops, but especially from CIAT’s mandated crops, and related activities. The Project maintains a working collection, now totaling over 20,000 specimens, of arthropod pests and their natural enemies for cassava, beans, rice, tropical pastures and tropical fruits, as well as those collected from related agroecosystems. A database containing information on individual specimens accompanies this collection and this is made available to collaborating institutions, museums, universities and national research and extension programs. The project also maintains large collections of fungal and bacterial pathogens, and beneficial microorganisms including nitrogen fixers, plant growth promoters, biocontrol agents. In addition, a collection of entomopathogenic
5 fungi, bacteria and nematodes is also maintained. These potential biological control agents have been isolated from crop pests through field surveys, or have been received from other research institutions (e.g. CENICAFE) in collaborative exchange projects.
The project uniquely works on endophytic fungi and bacteria, multiple resistances to spittlebugs, microbial and plant-derived biopesticides. Several biopesticides have been commercially made available through collaborative projects with the private sector. The project staff in Africa provide capacity building in molecular tools for disease diagnosis and pathogen characterization, marker assisted selection methods to improve the efficiency of breeding for disease resistance, participatory evaluation and implementation of disease and pest management methods, as well as supervision of graduate student thesis.
The research outputs of the PE-1 Project are in line with the mandate of the CGIAR of producing international public goods (IPGs). The IPGs of the research outputs of this Project are summarized as follows:
1. Mechanisms: a) Understanding mechanisms of resistance to fungal, bacterial and viral pathogens leading to the development of screening methods b) Understanding mechanisms of resistance to arthropod pests thus, leading to development of methods for resistance screening. c) Understanding mechanisms of how pathogens and pests evolve and overcome host resistance d) Understanding mechanisms of how pathogens and pests evolve and develop resistance to pesticides
2. Methods: a) Techniques and methodologies for mass rearing of arthropod pests for resistance screening and biopesticide testing b) Standardized protocols for risk evaluations of genetically modified organisms (GMOs) on non- target soil organisms. c) Genetic transformation methods for pathogenic and non-pathogenic fungi and bacteria. d) Methods for long-term storage of microbes. e) Methods for artificial inoculation/infestation and for resistance measurement for a number of pathogens and pests. f) An improved greenhouse inoculation method to detect quantitative differences for genetic studies and breeding, and evaluation, eg. sheath blight resistance (Rhizoctonia solani) in rice g) Methods for screening potential biopesticides h) Protocols for the safe movement of germplasm within and across regions
3. Products: a) Genotypes with resistance to pests and diseases identified among the collection of beans, cassava, rice, tropical forages and tropical fruits b) High yielding disease and pest resistant breeding lines c) Microbial-derived biopesticides d) Plant-derived biopesticides e) Improved biocontrol agents f) Microbial and arthropod pest databases.
6 1.1. 5. Partners:
• Bolivia- PROIMPA: Management of whitefly. • Brazil- EMBRAPA- CNPMF, - CNPGC, IAC – Development of host plant resistance to spittlebugs • Canada- Agriculture & Agri-Food- Pythium species identification • China- Yunnan Academy of Agricultural Sciences – Development of runner bean project • Colombia- CORPOICA, ICA, Universidad Nacional de Colombia-Palmira and Bogotá, Life Systems Technology (LST) S.A, Universidad del Valle, Universidad de Caldas, Universidad Católica, Universidad de la Amazonía, Universidad de los Andes, Profrutales Ltda, BIOTROPICAL, Palmar del Oriente: provide samples, validation of control and management practices); Corporación BIOTEC, FEDEPLATANO: farmers groups, and many more; graduate and undergraduate thesis of students, development of disease and pest diagnosis tools, evaluation of pest and disease management methods, quarantine pests and diseases, certification programs; - Biotropical: development, evaluation and formulation of biopesticides. • Denmark - The Royal Veterinanry and Agricultural University: induced resistance and training • Ecuador- Instituto Nacional Autónomo de Investigaciones Agropecuarias (INIAP), Escuela Politécnica del Ejército (ESPE): pest and pathogen resistance to pesticides, research on soil arthropods. Manrecur: management of whitefly. • France- IRD: insect physiology and biochemistry. • Germany- Institut für Pflanzenkrankheiten und Pflanzenschutz, Fachbereich Gartenbau, Universität Hannover, Agrar- undErnährungswissenschaftliche Fakultät, Universität Kiel, Federal Biological Research Centre for Agriculture and Forestry (BBA): soil arthropod pests, entomopathogens. • Honduras- PROMIPPAC: biopesticides • Kenya- International Centre of Insect Physiology and Ecology (ICIPE): insect physiology. • Nicaragua- MAGFOR: capacity strengthening in disease and pest diagnosis, disease and pest management. • Nigeria-IITA: System –wide program on IPM, management of whiteflies. • Peru-CIP: management of whiteflies. • Rwanda- Institut des Sciences Agronomiques du Rwanda (ISAR): integrated disease and management and soil fertility management for enhancing soil health • Taiwán- AVRDC: management of whiteflies in tropical crops. • Tanzania- Agricultural Research Institute, African Highlands Ecoregional Program, Adventist Development and Relief Agency, Ministry of Agric.-Armyworm project, Farm Africa, Farm Africa, World Vision, farmers groups, and others: Evaluation of disease and pest management methods. • Uganda- National Agricultural Research Organization (NARO), African Highlands Ecoregional Program, Makerere University, Uganda National Agricultural Advisory services, farmers groups, and others: Evaluation of disease and pest management methods, thesis students. • United Kingdom- Commonwealth Agricultural Bureaux International (CABI), Horticulture Research International (HRI), Natural Resources Institute: management of whiteflies. Scottish Crop Research Institute: Isolation and conservation techniques. • United States-University of Kentucky, Cornell University, Iowa State University, Kansas State University, University of Georgia, University of Florida, University of California-Davis, Michigan State University, Texas A& M, United States Department of Agriculture (USDA): insect taxonomy, analysis of alkaloids from endophytes, diagnosis and detection tools. • Venezuela- Instituto Nacional de Investigación Agrícola (INIA): pesticide use and resistance of pathogens and pests to agrochemicals.
7
1.2. Project Log-frame (2006-2008) Project: Crop and Agroecosystem Health Management Project Manager: Segenet Kelemu Outputs Intended User Outcome Impact
Output 1 Pest and pathogen complexes in NARIs, • Molecular and • Improved crop productivity from key crops described and analyzed. universities, conventional tools for more efficient and accurate tools NGOs, IARCs disease and pest for disease and pest diagnosis, diagnosis, detection and and cost-effective disease and characterization insect pest management developed, evaluated and strategies. disseminated to • Improved livelihoods of small researchers. farmers through higher yields of crops obtained by better disease and insect pest management Output 1 Invasive pest species, white grub, NARIs, • Pest characterization tools Targets burrower bugs and their natural universities, developed and adopted by 2006 enemies taxonomically identified NGOs, IARCs researchers. and characterized Output 1 Molecular tools for detection, NARIs • Disease and pest Targets diagnosis and diversity studies of researchers in characterization tools 2007 key pathogens and pests of CIAT LAC, Asia and developed and adopted by commodities made available Africa, IARCs researchers. Output 1 Two plant- growth promoting NARIs • New options for disease Targets bacteria and one biological control researchers in and pest management and 2008 agent characterized. LAC, Asia and plant health enhancement Africa developed and tested by researchers. Output 2 Pest-and-disease management Researchers in • Integrated disease and • Increased and stable income of components and strategies LAC, Asia and pest management small farmers through increased developed for key crops. Africa strategies developed and crop yields and enhanced quality adopted by farmers. of products Output 2 Bean, cassava, rice and tropical Researchers in • Tools that contribute to Targets forage lines resistant to major LAC, Asia and efficient breeding 2006 diseases and pests and molecular Africa strategies developed markers associated with some of these resistance genes identified
8 PE-1 project Log Frame (Continued) Output 2 At least 2 Brachiaria genotypes Researchers in • Selected genotypes of Targets with spittlebug resistance, a LAC, Asia and Brachiaria, cassava and 2007 whitefly resistant cassava variety, Africa; CIAT rice tested for resistance and 50 blast and sheath blight scientists; farmers to insects and pathogens resistant rice lines developed. in different regions.
Output 2 Three biological pesticides, and Researchers in • Disease /pest resistant crops Targets angular leaf spot and Pythium LAC, Asia and developed and adopted; 2008 resistant bean varieties made Africa; farmers biopesticides formulated and available adopted. Strengthened capacity of NARS to NARIs in LAC, • Improved capacity of • More income to farmers by Output 3 design and execute IPM R&D, to Asia and Africa; NARS partners to using; environmentally-friendly apply molecular tools for pathogen farmers disseminate to farmers disease and pest management and pest detection, diagnosis, disease and pest strategies. diversity studies and to device management strategies novel disease and pest management strategies Output 3 Use biopesticides and other pest NARIs in Africa; • Improved disease and pest Targets management practices on common farmers management strategies 2006 bean crop transferred to farmers in adopted Malawi, Kenya, Tanzania and Uganda
Management strategies for soil- NARIs and • Soil pest management Output 3 borne pests (white grubs and farmers in LAC, methods adopted by Targets burrowers bugs) evaluated with Africa farmers. 2007 farmers Output 3 Combination of whitefly resistant NARIs, NGOs • Improved cassava Targets cassava varieties and biological and farmers varieties together with 2008 control agents made available to improved disease and pest farmers management practices adopted.
9
PE-1 project Log Frame (Continued) Global IPM networks (Integrated NARIs, • Sustainable food and cash • Improved livelihoods, rural and Output 4 Whitefly Management Technology) Universities, crop production systems urban health standards, and and knowledge systems developed. NGOs, IARCs, with reduced environmental increased farm/household farmers impact and production costs income adopted.
Output4 Guidelines and technical NARIs, • Information on improved Targets information on whitefly Universities, whitefly management 2006 management distributed in Asia, NGOs, IARCs, strategies disseminated Africa and Latin America farmers
Output 4 Farmer participatory research NARIs, • Methods in lower pesticide Targets conducted in selected pilot sites of Universities, use resulting in lower 2007 sub-Saharan Africa, S.E. Asia and NGOs, IARCs, production costs and Latin America. farmers environmental contamination adopted.
Output 4 Impact assessment and Policy Government • Food production and Targets guidelines implemented for the Institutions, income-generating 2008 benefit of farmers. NARs, NGOs, strategies for small-scale farmers farmers facilitated by official decrees
10 1.3. CGIAR Output template 2006
PE-1 Crop and Agroecosystem Health Management Output Targets 2006 Proof of Achievements
OUPUT 1 Invasive pest species, white grub, burrower Achieved. Annual Reports Pest and pathogen complexes in bugs and their natural enemies 2005, 2006, other publications key crops described and analyzed. taxonomically identified and characterized (see publication list)
OUTPUT 2 Bean, cassava, rice and tropical forage lines 90% achieved. Annual Reports Pest-and-disease management resistant to major diseases and pests and 2005,2006, other publications components and strategies molecular markers associated with some of (see publication list) developed for key crops. these resistance genes identified
OUTPUT 3 Use biopesticides and other pest 75% achieved: Annual Reports Strengthened capacity of NARS management practices on common bean 2005, other communiques to design and execute IPM R&D, crop transferred to farmers in Malawi, to apply molecular tools for Kenya ,Tanzania and Uganda pathogen and pest detection, diagnosis, diversity studies and to device novel disease and pest management strategies
OUTPUT 4 Guidelines and technical information on Achieved Global IPM networks (Integrated whitefly management distributed in Asia, Whitefly Management Africa and Latin America A book and technical manuals Technology) and knowledge in English and Spanish systems developed. developed; other publications (see publication list)
11 Output 1: Pest and disease complexes described and analyzed.
Activity 1.1. Identification of common bean genotypes and interspecifc lines resistant to Rhizoctonia solani. Contributors: C. Jara, G. Castellanos, and G. Mahuku.
Highlight:
We identified several interspefic lines, combining resistance to angular leaf spot, anthracnose, ascochyta blight and Rhizoctonia root rots. These materials constitute an important set for use in breeding programs intended for multiple constraint improvement.
Rationale
Root rots have become a major bean production constraint, especially for small-holder farmers with limited arable land (declining farm sizes), often do not practice crop rotation resulting in increasing low soil fertility problems. Several pathogen cause root rots, and these often occur in complex. The prevalence of some pathogens is associated with high soil humidity and rain conditions (e.g. Pythium spp, Fusarium spp), while others are associated with water deficit and drought conditions (e.g. Macrophomina phaseolina). Identification of genotypes that are resistant to the largest number of root rot causing pathogens would be a major contribution towards the development of genotypes resistant to multiple constraints. Such materials would be useful as parents in breeding programs, or they can be deployed in areas where these pathogens are a major production constraint. Towards this goal, we have started evaluating genotypes from the international root rot nursery (put together in the 90s) and interspecific lines direved from P. vulgaris by P. coccinrus or P. polyanthus crosss for their reaction to Rhizoctonia solani. The interspecific lines have previously been found to have resistance to other bean pathogens, including Coletotrichum lindemuthianum and Phaeoisariopsis griseola.
Materials and Methods
Forty genotypes representing the international root rot nursery (Table 1.1.1) and 50 interspecific lines (Table 1.1.2) were evaluated under greenhouse conditions for their reaction to a mixture of R. solani isolates, previously isolated from Popayán, Pradera, Darien, Pereira and Quilichao, Colombia. Inoculum preparation was done as described by Abawi and Pastor-Corrales (Abawi and Pastor-Corrales, 1990. Diagnosis, research methodologies and management strategies. CIAT.114 pp). For each entry, 10 seeds were planted in 50 cm rows and covered with 100 grams of R. solani inoculum. Disease evaluations were done 20 days after planting using the 1-9 scale of Schoonhoven and Pastor-Corrales, (Schoonhoven and Pastor-Corrales, 1987. Standard system for the evaluation of bean germplasm. CIAT).
12 Results and Discussion
Only 14 genotypes from the international root rot nursery were tolerant or resistant to the new R. solani isolates used in this study (Table 1.1.1). In contrast, all the interspecific lines were highly resistant or tolerant to R. solani, and none was susceptible (Table 1.1.2). These results point to the potential usefulness of the secondary gene pool as a source of R. solani resistance in bean improvement programs.
Table 1.1.1. Reaction of the international Rhizoctonia root rot nursery to inoculation with several new isolates of Rhizoctonia solani under greenhouse conditions. Genotype Disease Genotype Disease severity severity BAT 332 7.3 G003807 5.2 RIZ 21 7.2 EMP 81 5.1 BAT 1753 6.9 A 195 5.1 RIZ 30 6.8 BAT 1297 5.0 A 197 6.7 PORRILLO SINTETICO 5.0 A 107 6.6 AND 313 5.0 A 300 6.4 NEP-2 4.9 AND 286 6.4 ARGENTINO 4.9 SANILAC 6.3 ICA TUI 4.8 BAT 477 6.2 BAT 1385 4.7 LM-21525-0 6.2 NIMA 4.5 RIO TIBAGI 5.7 XAN 112 4.5 ICA PIJAO 5.7 CG/82-131 4.4 DIACOL CALIMA 5.7 DOR 500 4.4 OJO DE CABRA 400 5.6 AFR 159 4.3 CORNELL-49-242 5.3 ROSINHA 4.2 AND 323 5.3 ECUADOR 1056 4.2 G 003719 5.3 CG/82-108 4.1 MORTINO 5.3 CG/82- 77 3.6 A 211 5.2 CG/82- 81 3.5
13 Table 1.1.2. Response of interspecific lines to inoculation with Rhizoctonia solani isolates fromdifferent locations of Colombia under greenhouse conditions. Origin Identification Gen Type of cross R. solani erati severity on 1 URG BAT1253 x G35325 F6 Pv x Pp 3.4 2 URG BAT 338 x G35252 F 11 Pv x Pc 4.4 3 URG BAT 338 x G35252 F 11 Pv x Pc 3.9 4 URG BAT 338 x G35252 F 11 Pv x Pc 4.4 5 URG BAT 338 x G35252 F 11 Pv x Pc 3.9 6 URG BAT 338 x G35252 F 11 Pv x Pc 4.9 7 URG BAT 338 x G35252 F 11 Pv x Pc 5.6 8 URG BAT 338 x G35252 F 11 Pv x Pc 3.3 9 URG BAT 338 x G35252 F 12 Pv x Pc 2.9 10 URG BAT 338 x G35252 F 12 Pv x Pc 4.7 11 URG BAT 338 x G35252 F 12 Pv x Pc 4.6 12 URG BAT 338 x G35252 F 12 Pv x Pc 5.3 13 URG BAT 338 x G35252 F 12 Pv x Pc 3.8 14 URG BAT 338 x G35252 F 12 Pv x Pc 2.9 15 URG BAT 338 x G35252 F 12 Pv x Pc 4.5 16 URG BAT 338 x G35252 F 12 Pv x Pc 2.7 17 URG BAT 338 x G35252 F 12 Pv x Pc 4.2 18 URG BAT 338 x G35252 F 12 Pv x Pc 3.7 19 URG BAT 338 x G35252 F 12 Pv x Pc 2.9 20 URG ((G35876 x G 3807)x G35182)x A 114 F 10 ((Pcw x Pv)x Pp)x Pv 2.6 21 URG ((G35876 x G 3807)x G35182)x A 114 F 10 ((Pcw x Pv)x Pp)x Pv 1.5 22 URG ((G35876 x G 3807)x G35182)x S31003 F 10 ((Pcw x Pv)x Pp)x Pv 3.1 23 URG ((G35876 x G 3807)x G35182)x S31003 F 10 ((Pcw x Pv)x Pp)x Pv 2.1 24 URG ((G35876 x G 3807)x G35325)x VRA81043 F 6 ((Pcw x Pv)x Pp)x Pv 2.3 25 URG ((G35876 x S30985)x G21715)x G35336 F 5 ((Pcw x Pv)x Pv)x Pp 2.1 26 URG ((G35876 x S30985)x G35182)x G21715 F 5 ((Pcw x Pv)x Pp)x Pv 1.9 27 URG ((S13811 x G 677)x G35023)x BAC 24 F 7 ((Pcp x Pv)x Pc)x Pv 1.0 28 URG (G35649 x G 3807)x BAC 24 F 7 (Pcw x Pv)x Pv 2.3 29 URG (G35649 x G 3807)x BAC 24 F 7 (Pcw x Pv)x Pv 2.0 30 URG (G35649 x G 3807)x BAC 24 F 7 (Pcw x Pv)x Pv 1.6 31 URG (G35649 x L32)x BAC 24 F 9 (Pcw x Pv)x Pv 1.8 32 URG (G35649 x G 3807)x G35023 F 8 (Pcw x Pv)x Pc 3.2 33 URG AND 107 x Piloy F 5 Pv x Pp 2.8 34 URG AND 279 x G35337 F 5 Pv x Pp 2.1 35 URG Pasto x G35122 F 11 Pv x Pp 3.0 36 URG Pasto x G35122 F 12 Pv x Pp 2.6 37 URG PVA1426 x G35180 F 6 Pv x Pp 2.0 38 MEJ2 (ICA PIJAO X G 35171)F1 X ICA PIJAO/-(NN)P-(NN)P(F8) F 12 2V1C1_1657 5.3 39 MEJ2 (ICA PIJAO X G 35171)F1 X ICA PIJAO/-(NN)P-(NN)P(F8) F 12 2V1C1_1662 2.6 40 MEJ2 (ICA PIJAO X G 35172)F1 X ICA PIJAO/-4P-(NN)P(F8) F 12 2V1C2_1670 3.7 41 MEJ2 (ICA PIJAO X G 35172)F1 X ICA PIJAO/-19P-(NN)P(F8) F 12 2V1C2_1681 5.0 42 MEJ2 ICA PIJAO X (ICA PIJAO X G 35877)F1/-(NN)P-(NN)Q-MP F 8 2V1L2_1702 2.3 43 MEJ2 ICA PIJAO X (ICA PIJAO X G 35877)F1/-(NN)P-(NN)Q-MP F 8 2V1L2_1734 2.4 44 MEJ2 ICA PIJAO X (ICA PIJAO X G 35877)F1/-(NN)P-(NN)Q-MP F 8 2V1L2_1755 3.9 45 MEJ2 ICA PIJAO X (ICA PIJAO X G 35877)F1/-(NN)P-(NN)Q-MP F 8 2V1L2_1756 3.1 46 MEJ2 ICA PIJAO X (ICA PIJAO X G 35877)F1/-(NN)P-(NN)Q-MP F 8 2V1L2_1757 3.4 47 MEJ2 ICA PIJAO X (ICA PIJAO X G 35877)F1/-(NN)P-(NN)Q-MP F 8 2V1L2_1765 3.1 48 MEJ2 ICA PIJAO X (ICA PIJAO X G 35877)F1/-(NN)P-(NN)Q-MP F 8 2V1L2_1775 2.2 49 MEJ2 ICA PIJAO X (ICA PIJAO X G 35877)F1/-(NN)P-(NN)Q-MP F 8 2V1L2_1776 2.0 50 MEJ2 ICA PIJAO X (ICA PIJAO X G 35877)F1/-(NN)P-(NN)Q-MP F 8 2V1L2_1813 1.9
14 Conclusion: The interspecific lines showed good levels of resistance to R. solani, while no resistance was available in the international root rot nursery. The international root rot nursery need to be revised, and include new genotypes that show resistance. A starting point would be to evaluate the core collection for their reaction to the new R. solani isolates. The potential of the secondary gene pool as a source of useful traits in common bean improvement was again confirmed. These interspecific lines have previously been found resistant to several races of P. griseola and C. lindemuthianum. The evaluation of these lines for resistance to other root rot causing pathogens (Fusarium solani, Fusarium oxysporium, Pythium spp, Scletinia rolfsi. etc) is in progress.
Activity 1.2. Virulence characterization of Colletotrichum lindemuthianum isolates collected from different bean growing departments of Colombia.
Contributors: G. Mahuku, C. Jara, G. Castellanos, J. Fory
Highlight:
Showed that the anthracnose population structure in Colombia has changed, with the disappearance of some previously prevalent pathotypes. However, the population remains exclusively of the Andean lineage.
Rationale
Crop protection strategies that provide stability have two basic components: (1) breeding for stable forms of resistance and (2) deploying varieties in ways to prolong their useful lifetime. Knowledge of pathogen population structure can contribute both to resistance breeding efforts and to the development of strategies for the deployment of resistant genes. By analyzing the structure of pathogen populations and the ways in which populations respond to experimental, agricultural and natural constraints, mechanisms by which pathogen populations change can be understood. This understanding can provide the basis for formulating disease support systems that lead to effective disease management. Monitoring, collection and characterization of the anthracnose pathogen is therefore, an on going process in an effort to understand the distribution and diversity of this pathogen, optimize the use of existing sources of resistance and where necessary, identify appropriate new resistance genes.
Materials and Methods
Samples with typical anthracnose symptoms were collected from Boyaca, Santander, Cundinamarca, Cauca, and Darien – Valle. Single spore isolates were established using standard procedures. The virulence phenotype of these isolates was determined based on their differential interaction with a set of 12 international differential varieties (Schoonhoven and Pastor-Corrales, 1987. Standard system for the evaluation of bean germplasm. CIAT). Plant establishment, growth, inoculation and evaluations were
15 according to procedures reported by Mahuku et al. (Mahuku et al., 2004. European Journal of Plant Pathology 110: 253-263).
Results and Discussion A total of 46 monosporic isolates of C. lindemuthianum were recovered from 50 samples collected. The majority of the isolates (27) were from Santander, eight from Darien, five from Boyaca and three each from Cundinamarca and Cauca. A total of eight pathotypes (races) were characterized among 46 isolates (Table 1.2.1). Pathotype 3 was the most prevalent, represented by 35 isolates from Santander, Boyaca, Darien and Cauca. In addition to pathotype 3, pathotype 1, 4 and 5 were also detected from Boyaca, pathotypes 0, 7 and 13 from Santander, while pathotypes 0, 1 and 137 were characterized from Cundinamarca (Table 1.2.1). Previous characterization studies identified pathotypes 388, 513 and 9 in Cundinamarca, 263 in Cauca, 261 in Santander that were not detected in the present studies. The rest of the pathotypes have been detected before. The presence of mostly simple pathotypes in these departments is probably a reflection of the cultivation of predominantly of varieties from the Andean gene pool and mostly four varieties, Radical, Floiran, Calima and Cargamanto. These results show that the C. lindemuthianum population pathogen structure in Colombia is predominantly Andean and composed of relatively simple pathotypes. Introgressing and pyramiding resistance genes found in the following differential cultivars (Mexico 222, PI 207262, J = Tu, K = AB 136, Widusa, Kaboon and G 2333) will be sufficient to manage the anthracnose disease in Colombia.
16 Table 1.2.1. Characterization of Colletotrichum lindemuthianum isolates collected from different departments of Colombia. Anthracnose Differential Cultivars Isolate A B C D E F G H I J K L Race Origin Variety CL-554-COL 0 Santander Radical CL-517-COL 0 Cundinamarca CL-521-COL a 1 Boyaca CL-519-COL a 1 Boyaca CL-518-COL a 1 Cundinamarca CL-556-COL a b 3 Santander CALIMA CL-555-COL a b 3 Boyaca CERINZA CL-553-COL a b 3 Santander Radical CL-549-COL a b 3 Santander Calima CL-548-COL a b 3 Santander Calima CL-547-COL a b 3 Santander Calima CL-546-COL a b 3 Santander Radical CL-545-COL a b 3 Santander Radical CL-544-COL a b 3 Santander Floiran CL-543-COL a b 3 Santander Cargamanto CL-542-COL a b 3 Santander Floiran CL-541-COL a b 3 Santander Floiran CL-538-COL a b 3 Santander Floiran CL-537-COL a b 3 Santander Radical CL-536-COL a b 3 Santander Floiran CL-535-COL a b 3 Santander Calima CL-533-COL a b 3 Santander Radical CL-532-COL a b 3 Santander Floiran CL-531-COL a b 3 Santander Floiran CL-530-COL a b 3 Santander Floiran CL-529-COL a b 3 Santander Floiran CL-528-COL a b 3 Santander Floiran CL-527-COL a b 3 Santander Floiran CL-526-COL a b 3 Santander Floiran CL-525-COL a b 3 Cauca CL-524-COL a b 3 Cauca CL-523-COL a b 3 Cauca CL-516-COL a b 3 Darien-Valle Linea 7091 CL-515-COL a b 3 Darien-Valle Linea 7099 CL-514-COL a b 3 Darien-Valle Linea 7128 CL-513-COL a b 3 Darien-Valle Linea 7246 CL-512-COL a b 3 Darien-Valle Linea 7597 CL-511-COL a b 3 Darien-Valle CL-510-COL a b 3 Darien-Valle Linea 7150 CL-509-COL a b 3 Darien-Valle Linea 7140 CL-552-COL c 4 Boyaca Cerinza CL-551-COL a c 5 Boyaca Cerinza CL-534-COL a b c 7 Santander Jiji CL-540-COL a c d 13 Santander Floiran CL-539-COL a c d 13 Santander Floiran CL-550-COL a d h 137 Cundinamarca Cargamanto Differential cultivars: A = Michelite, B = Michigan dark red kidney; C = Perry Marrow; D = Cornell 49242; E = Widusa; F = Kaboon; G = Mexico 222; H = PI 207262; I = To; J = Tu; K = AB 136 and L = G 2333.
Activity 1.3. Identifying and developing molecular markers linked to ALS resistance genes in common bean.
Contributors: G. Mahuku, A.Iglesias, M. Navia, M.C. Hernadez and S. Beebe
Highlight:
17 Showed that the PF9260 SCAR marker linked to the resistance genes in G10474 and G10909 functions effectively in both Andean and Mesoamerican backgrounds.
Rationale
Angular leaf spot disease (ALS) of common bean, caused by the fungus Phaeoisariopsis griseola is the most widely distributed and destructive bean disease in tropical and subtropical countries that can cause yield losses of up to 80% (Stenglein et. al., 2003. Advances in Applied Microbiology 52:209-243.). Stacking or pyramiding resistance genes of Andean and Mesoamerican origin into the same background is most likely to result in stable and durable resistance to this devastating disease. This can be effectively achieved through use of markers tightly associated with the resistance genes of interest. Previously, we have identified molecular markers linked to angular leaf spot resistance genes from the Mesoamerican gene pool. Our focus this year was to (i) identify molecular markers that are linked to one of our best source of ALS resistance genes of Andean origin, G 5686; (ii) identifying additional markers that are linked to the Mesoamerican sources of resistance in the hopes of saturating the resistance locus and improve the efficiency of MAS in bean breeding; and (iii) validating identified markers and developing protocols for their use in MAS.
Materials and Methods
Identifying markers linked to resistance genes in G5686: The Andean genotype, G5686 has been highly resistant to both Andean and Mesoamerican pathotypes of P. griseola. Inheritance studies showed that at least two complementary genes condition resistance to P. griseola (CIAT, Annual Report Bean Program 2003) in this genotype. The bulk segregant analysis was used to evaluate 59 RAPD primers in an effort to identify markers linked to resistance genes in G5686. DNA extractions, PCR amplifications and gel electrophoresis were conducted as previously described (Mahuku et al., 2004. Crop Science 44: 1817-1824).
Validation of SCAR markers linked to resistance genes in G10909: Three previously described SCAR markers (OPE4709, PF9260, and PF13310) were polymorphic when evaluated on the G10909 x Spite population. The markers OPE4709, PF9260 were developed for Mexico 54 and G 10474 respectively (CIAT, Annual report Bean Program 2004). These markers were used to amplify several genotypes that have been used in crosses with G10909 (Table 1.3), in order to validate the utility of these markers in MAS breeding.
Evaluation of common bean microsatellite markers: A total of 11 SSR markers that have been developed for the common bean (Yu et al., 1999 Journal of Heredity 91 (6): 429- 434.) were used to amplify DNA from G10909, G10474, G5686, G10613 Mexico 54, VAX 6, MAR 1 and Sprite, in the hopes of identifying markers that segregate either in coupling or repulsion with the resistance genes in these genotypes. PCR amplification,
18 polyacrylimaide gel electrophoresis and visualization were done as described previously (Mahuku et al., 2004 Crop Science 44: 1817-1824).
Results and Discussion
Identifying markers linked to resistance genes in G5686: Of the 59 RAPD primers evaluated, 15 were polymorphic in the parental genotypes, G5686 and Sprite, the resistant and susceptible bulks. When these markers were evaluated on an additional 8 resistant and susceptible individuals, only three RAPD primers were polymorphic. These primers were evaluated on an F2 population of 139 individuals. However, none of these markers were closely linked to the G5686 resistance genes.
Validation of SCAR markers linked to resistance genes in G10909: The three SCAR markers (SCAR_PF9260, SCAR_OPE4709, and SCAR_PF13310) segregated in coupling with the resistance genes in G10909. SCAR_PF9260 was located 9.9 cM from the resistance
gene, while markers SCAR_OPE4709, and SCAR_PF13310 were located 7.4 cM and 5.5 cM respectively, from the resistance gene (Figure 1.3.1). When tested on genotypes that are commonly used in crosses with G10909, SCAR_PF9260 was only detected in G10474, but was absent from all other genotypes, irrespective of whether they were of Andean or Mesoamerican origin (Table 1.3.1). These results show that SCAR_PF9260 can effectively be used to introgress resistance genes from G10909 or G 10474 into any background (Table 1.3.1). The presence of SCAR_PF9260 in G10474 was expected, as this marker was originally found to be linked in coupling and located at 3.0 cM from the resistance gene in G 10474.
Therefore, the resistance genes in G10909 and G10474 maybe be closely linked and might be members of a cluster of ALS resistance genes. Mapping of these markers to the bean core map are in progress and might reveal the relationship of these genes. However, from phenotypic evaluations, the spectrum of activity of these genes is different. We have characterized some P. griseola pathotypes that overcome the G10909 resistance gene, while they are unable to overcome the G10474 resistance gene.
19 Table 1.3.1. Response of bean genotypes used in crosses with G10909 to inoculation with Phaeoisariopsis griseola pathotype 63-63 and evaluation with SCAR_PF9260, SCAR_OPE4709, and SCAR_PF13310 markers. a Genotype Pg 63- PF9260 OPE4709 PF13310 Genotype Pg 63-63 PF9260 OPE4709 PF13310 63 1 A 247 7 - + - 30 GLP 2 2.5 - - - 2 A 686 8 - + + 31 GLP 585 8 - + + 3 A 811 8 - + + 32 MA 23-24 BRASIL 8 - - + 4 AFR 699 6.7 - - - 33 MAM 38 1 - + + 5 AND 279 6 - - - 34 MAR 1 4 - - + 6 AND 1055 4 - - - 35 MAR 2 6.7 - + + 7 AND 1064 3.7 - - - 36 MAR 3 3.7 - - + 8 BEAVER 4 6.3 - - + 37 MD 23-24 8 - - + 9 BRB 198 3 - - - 38 MEX 54 8 - + - 10 CAL 96 7 - - - 39 MLB 40-89A 8 - + + 11 CAL 96_ss 7 - - - 40 MLB 49-89A 1 - + + 12 CAL 143 8 - - - 41 Montcalm 2 - - 13 DOR 390 8 - - + 42 MR 12439-18 7 - - + 14 DOR 500 8 - - + 43 MR 13304-74 8 - + + 15 FEB 212 8 - + + 44 MR 13363-14 8 - + + 16 FEB 214 8 - + + 45 PARAGACHI 8 - - - 17 G 685 1.3 - + + 46 TIO CANELA 7 - + + 18 G 3353 8 - - + 47 Ruda 8 - + + 19 G 4090 8 - - + 48 RWR 719 8 - - + 20 G 4691 4.7 - + + 49 RWR 1092 1 - - + 21 G 5207 1 - + + 50 SAM 1 7 - - + 22 G 9603 2.7 - - - 51 SCAM 80-CM/15 2 - - - 23 G 10909 1 + + + 52 SUG 137 6 - - - 24 G 10613 1 - - + 53 POA 12 7 - - - 25 G 13910 7 - - - 54 URUGEZI 6 - + 26 G 15430 7 - - - 55 VAX 1 5.7 - + + 27 G 19833 2 - - - 56 VAX 2 5 - + + 28 G 21212 8 - - + 57 G10474 1 + + + 29 G 23070 1 - - - 58 Sprite 8 - - - a + = presence of marker; - = absence of marker
20 Dist Marker cM Id Name
(1) (1) (1) G10909 R gene 5.5
7.4 (3) (3) PF13310 9.9 6.7 4.3 (4) (4) PF9260 4.9
(2) (2) (2) OPE4709
Figure 1.3.1. Organization of three SCAR markers relative to the resistance gene in the Mesoamerican genotype G10909.
SCAR markers (SCAR_OPE4709, and SCAR_PF13310) were present in some genotypes and absent in others, revealing that a parental survey is necessary before these markers can be used in a MAS breeding program.
Identification of common bean microsatellite markers linked to ALS resistance in common bean: Eight microsatellite markers were identified that segregated with the resistance gene in G5686 (Table 1.3.2). One of these markers, was evaluated on a population of 139 F2 individuals derived from crossing G5686 x Sprite. The marker was found to be located at 19.8 cM from the resistance gene in G5686. The marker is co-dominant, and the resistant and susceptible fragments have been cloned and are currently being sequenced. New markers will be developed based on the differences between the fragments from resistant and susceptible individuals and it is hopped that a tight association between marker and phenotype will be obtained. Work is in progress to evaluate the other 7 markers on the 139 F2 populations. Other SSR markers that have been identified for other genotypes are shown in Table 1.3.2. These markers are currently being evaluated on the entire F2 population. The association of the markers with the resistance genes in these genotypes, and their utility for MAS breeding will be known once evaluations have been completed.
21 Table 1.3.2. Common bean microsatellite markers that are linked to angular leaf spot resistance in the common bean genotypes G5686, G10909, G10474, MAR 1 and Mexico 54. G5686 x Sprite G10909 x Sprite G10474 x Sprite MAR 1 x VAX 6 Mex 54 x Sprite SSR marker Parents F2 plants Parents F2 plants Parents F2 plants Parents F2 plants Parents F2 plants PV-ctt001 + + - - - - PV-atgc001 + ns - + ns - + ns PV-atgc002 + ns + + + + + ns + ns PV-ag001 - - + ns + ns - - PV-ag004 + + - + ns - - PV-gaat001 - - + ns + ns - + + PV-gaat002 + ns - - - - PV-at003 - - + ns + ns + ns - PV-at004 + - - - - - PV-cct001 + - + ns + ns + ns + ns PV-at007 + + + ns + ns + ns + ns + represents polymorphic in parental and F2 individuals (5 resistant and 5 susceptible F2 plants). - represents no polymorphism ns = pending evaluation in F2 individuals.
Conclusion: The results presented here show that SCAR_PF9260 is a more reliable and useful marker that can be used to introgress resistance from G10909and G10474 into both Andean and Mesoamerican genotypes. A protocol for the use of this marker in MAS breeding was developed and this marker is currently being validated in Kawanda, Uganda. For the other markers,
SCAR_OPE4709, and SCAR_PF13310, a parental survey is necessary before they can be effectively used in a MAS breeding program. The identification of molecular markers linked to G5686 is crucial for efficient use of resistance genes in this genotype. G5686 is a crucial source of ALS resistance of Andean origin. These genes need to be stacked with Mesoamerican ALS resistance genes from Mexico 54, G10909 and G10474, for stable and durable ALS resistance. Additional markers that have been identified need to be tested in the entire mapping population and validated outside the mapping population. However, it is crucial to saturate the resistance loci of these genotypes so as to increase the efficiency of MAS.
Activity 1.4. Identifying and developing molecular markers linked Pythium root rot resistance.
Contributors: G. Mahuku, M. Navia, A. Matta, R. Buruchara, R. Otsyula
Highlight:
Molecular markers that are linked to pythium root rot resistance in RWR 719, MLB 49- 89A, and AND 1062 were identified and protocols for two SCARs PYAA19 and PYB08 were developed. These markers are currently being used in MAS fro root rots in Kampala, Uganda.
Rationale
Bean root rot, caused by several Pythium species is one of the most destructive diseases affecting common bean (Phaseolus vulgaris) in East and Central Africa where beans are grown in intensive agricultural production systems (Buruchara and Rusuku, 1992. CIAT Workshop Series
22 No. 23. pp. 49-55 ). Use of resistant cultivars is considered to be the most viable option for controlling bean root rot particularly for small-scale growers (Otsyula et al., 1998. African Crops Science Journal 6:61-67 ). A few bean genotypes with resistance to Pythium root rot have been identified, among them RWR 719, MLB 49-89A and AND 1062 (Buruchara and Rusuku 1992. CIAT Workshop Series No. 23. pp.49-55 ). Last year, we reported the identification of molecular markers linked to the resistance genes in RWR 719 and MLB 49-89A, and the conversion of the markers linked to the resistance gene in RWR 719. This year, we report the identification of additional markers for these genotypes, including AND1062, the conversion of these markers to sequence characterized amplified region (SCAR) marker types, and their suitability for marker assisted selection (MAS) breeding.
Materials and Methods
Plant material and evaluations: The resistant varieties RWR 719, MLB49089A, and AND 1062 were crossed to the susceptible commercial cultivar, GLP2 to establish F1, F2, and backcross populations to susceptible (BCS) and resistant progenitors (BCR). These populations were evaluated under greenhouse conditions using an isolate of Pythium ultimum, previously established as the most important and widely distributed species causing bean root rots in East and Central Africa (Mukalazi et al, 2001.African Crop Sci. Conference Lagos, Nigeria.). Plant establishment, inoculations and evaluations were done as described previously (CIAT, Annual report 2005). Plants with no or limited symptoms (score 1-3) were rated as resistant, and the rest of the plants as susceptible.
DNA extraction: Young trifoliate leaves were collected from the two parents, and from resistant and susceptible F2 progenies, and DNA was extracted using the procedure described by Mahuku (2004. Plant Molecular Biology Reporter 22: 71-81.). In addition, DNA was extracted from other varieties that are commonly used as parents in root rot breeding program.
Marker identification: Five resistant and 5 susceptible F2 plants, including the parents were used to evaluate 300 RAPD, 10 SSR, 40 UBC microsatellites and 50 RAMS primers as previously described (CIAT, Annual Report 2004). Candidate markers showing evidence of correlation to disease resistance or susceptibility were further evaluated on an additional 10 resistant and susceptible F2 plants. Where polymorphism was maintained, the potential markers were evaluated on the entire F2 population (Table 1.4.1). The marker scoring data in the F2 were merged with the disease scoring data for linkage analysis using the computer program MAPMAKER
Marker development and validation: Candidate fragments were excised from agarose gels, cloned and sequenced as described by Mahuku et al.( Mahuku et al., 2004. Crop Science 44: 1817-1824.). Primers were designed using the Primer3 software (Center for Genome Research, Whitehead Institute, MA, USA - http://www-genome.wi.mit.edu/cgi-bin/primer/primer3). Developed primers were used to amplify DNA from parental materials, and ten resistant and susceptible F2 individuals. If polymorphism was maintained, the designed SCAR primers were tested in the entire F2 population. In the case of an identical sequence length, the fragment from the susceptible individuals was cloned and sequenced. The sequences derived from resistant and susceptible individuals were then aligned using the program MEGALIGN within DNAStar, and where possible the primer pairs were re-designed to exploit differences between the resistant and susceptible sequences.
23 Results and Discussion
Marker identification: RWR 719: A total of 12 markers have been identified that are linked in coupling to the resistance gene in RWR 719. Six of these markers are RAPDs (OPAA19, OPBA08, OPG3, OPH20, OPY20 y B459), one is RAMS (VHVGT)5G) and five are SSR markers previously developed for common bean. Three of the RAPDprimers were successfully converted to SCAR markers at 1.5 cM (PYAA19800), 4.0 cM (PYBA08350) and 6.0 cM (PYY201200) from the resistance gene. The RAMS derived marker is located 6.3 cM from the RWR 719 resistance gene. The identified SSR markers are currently being evaluated in the entire F2 population composed of 150 individuals (Table 1.4.1).
MLB 48-89A: Five markers (OPBA08, OPF10, OPG3, OPY20 y UBC 815) have been identified that are linked in coupling to the resistance gene in MLB 49-89A. Linkage analysis showed that the OPF10 marker was located 7.5 cM from the resistance gene, while the OPG3 markers was located at 5.7 cM, and UBC815 was 7.4 cM from the resistance gene. SCAR markers for these fragments have been developed and are currently being evaluated in the entire population. In addition, two SSR markers linked to the pythium resistance gene in MLB 49-89A have been identified (Table 1.4.1). These are currently being evaluated in the entire F2 population.
Table 1.4.1. Common bean microsatellite markers linked to Pythium root rot resistance in the common bean genotypes RWR 719, MLB 49-89A and AND 1062. SSR Marker Pythium root rot resistance sources RWR-719 AND-1062 MLB49-89A PV-atgc001 + - - PV-ag004 - - - PV-gaat001 - + - PV-ag001 - - - PV-gaat002 - - - PV-cct001 + + - PV-at007 - - - PV-ctt001 + - - PV-atgc002 - - + PV-at004 ns ns ns PV-at003 ns ns ns
+ represents polymorphic in parental and F2 individuals (5 resistant and 5 susceptible F2 plants). - represents no polymorphism ns pending evaluation
AND 1062: Two RAPD primers OPAA19 and OPBA08, located 2.9 cM and 5.5 cM from the pythium resistance gene in AND 1062 have been identified. These fragments have been converted to SCAR markers and are currently being evaluated in the F2 population. In addition, three SSR markers have been identified linked to this resistant gene (Table 1.4.1). These are currently being evaluated in the F2 population.
SCAR Markers: A total of eight SCAR markers have been designed. These are derived from the RAPD primers OPAA19, OPBA08, OPY20, B459, OPF10, OPG3, OPR2 and the RAMS (GT)n primers. The RAPD primers OPAA19, OPBA08 are linked to the resistance gene in the three
24 sources of resistance (RWR 719, MLB 49-89A and AND 1062), probably signifying that a single locus or a cluster of closely associated genes conditions pythium resistance in common bean. These results are in agreement with allelism tests that showed no segregation, thus revealing that a common locus or closely associated loci controls resistance to Pythium in common bean. Both SCARs (PYA A19800 (Figure 1.4.1a) and PY BA08350 (Figure 1.4.1.b) are dominant in nature. The primers designed for OPY20 and (GT)n were monomorphic and new ones have been designed. We are currently testing SCAR primers derived from the RAPD primers B459, OPF10, OPG3 and OPR2 and new ones developed for OPY20 and (GT)n. MAS protocols for PYA A19800 and PY BA08350 SCAR markers were developed and these primers are currently being validated in Kawanda, Uganda.
A B
Figure 1.4.1. Validation of the SACR markers (A) PYAA19 and (B) PYBA08 for their utility in marker assisted selection breeding. The markers are linked in coupling with the resistance gene and are dominant in nature.
Conclusion: Several marker types have been identified that segregate in coupling phase with pythium resistance in RWR 719, MLB 49-89A and AND 1062. A total of eight SCAR markers have been developed and two of these (PYA A19800 and PY BA08350) are currently being validated in Kawanda. In addition, several SSR markers have been identified and these are being evaluated in the mapping population. More information on marker quality will be obtained once all these markers have been tested in the F2 mapping population. Our objective is to saturate the pythium resistance loci with several marker types so as to increase the efficiency of marker assisted selection for this very important disease.
25 Activity 1.5. Identification of molecular markers linked to rice blast resistance genes
Contributors: J.L. Fuentes, F. Correa-Victoria, F. Escobar, G. Prado, G. Aricapa, M.C. Duque & J.Tohme
Highlight
The present work evidenced the usefulness of combining near-isogenic progeny analysis with rice genome information available in public databases to identify molecular markers highly linked to blast resistance genes in rice. Although a limited number of polymorphic markers can be expected when near-isogenic lines are used as progenitors, here we found six polymorphic markers in a region of only 13 cM surrounding the blast resistance gene Pi-1(t). Additionally, two of these markers (RM1233*I and RM224) were closely linked to the gene. Our results support the utility of these DNA markers in MAS and gene pyramiding rice breeding programs addressing the improvement of blast resistance in rice cultivars; and eventually to map based cloning of the gene. The speed, simplicity and reliability of PCR based approaches make microsatellite analysis on agarose gels an attractive tool for marker-assisted selection in rice breeding programs aiming at developing durable rice blast resistant cultivars.
Rationale
Rice blast caused by Pyricularia grisea (Cooke) Sacc., the anamorphous state of Magnaporthe grisea, is the most limiting biotic factor for rice production in the world. The use of resistant cultivars is the most effective and economical way of controlling blast disease, therefore, breeding efforts for developing resistant cultivars continue to be a priority of rice breeding programs. One way to improve the durability of blast resistance is to “pyramid” resistance genes by crossing rice varieties with complementary genes to provide multigenic resistance against a wide spectrum of blast races. Combining these resistance genes broadens the number of races that a variety can resist, and there is evidence that multiple resistance genes make it more difficult for virulent races to evolve (Correa-Victoria et al., 2002. Fitopatología Colombiana 26: 47-54). Unfortunately, pyramiding genes is difficult using conventional greenhouse screening procedures because blast races carrying individual avirulence genes to be used in inoculations for the identification of the corresponding resistance gene are normally not present in nature. As a result, accumulation of several resistance genes in a common background cannot be easily distinguished without a test cross. Recent advances in molecular marker technology, such as development of tightly linked molecular markers, has made it possible to pyramid major genes and QTL’s into one genotype and to simultaneously select several complex characters.
The blast resistance gene Pi-1(t), originally identified in the cultivar LAC23, an upland cultivar from Liberia confers complete resistance to several blast populations from Latin America when combined with the blast resistance genes Pi-2(t) and Pi-33(t) (Correa-Victoria et al., 2002. Fitopatología Colombiana 26: 47-54). The Pi-1 gene confers resistance to all races present in one of the most predominant genetic lineages (SRL-4) from Colombia, while the other two genes confer resistance to all races within two other predominant lineages (SRL-5 and SRL-6), respectively. Mapping studies showed that the Pi-1(t) gene is located near the end of
26 chromosome 11, linked to the Npb181 and RZ536 RFLP markers at a distance of 3.5 and 14.0 cM, respectively. However, RFLP approaches are expensive and laborious limiting their use in applied breeding programs, where a considerably high number of samples need to be analyzed. Convenient and cost-effective microsatellite markers, particularly those that can be scored on agarose gels, seem to be promising for the identification of blast resistance genes and for pyramiding or introgression of these genes into rice commercial varieties and elite lines. Microsatellite markers are hypervariable, abundant and well distributed throughout the rice genome and they are now available through the published high-density linkage map or in the public database (www. gramene.org).
We have designed a molecular marker-assisted breeding program in rice aiming at developing durable blast resistance in elite rice lines and cultivars by pyramiding the resistance genes Pi- 1(t), Pi-2(t) and Pi-33(t); which are potentially useful to control blast pathogen populations in the Latin American region (Correa-Victoria et al., 2002. Fitopatología Colombiana 26: 47-54). Here we report new microsatellite markers that cosegregate with the blast resistance gene Pi-1(t), using sequences available in a public database. These markers can be potentially used in MAS to introduce this gene into blast susceptible varieties, and provide the basis for map based cloning of this blast resistance gene.
Materials and Methods
The near-isogenic lines C101LAC (resistant line to isolates carrying avr Pi-1(t)) and C101A51 (susceptible line) developed at IRRI were crossed (cross CT 13432) and F1 seeds generated. The F2 progeny, resulting from self-pollination of F1 individuals, were self-pollinated to generate 283 CT13432 F3 lines. Rice varieties from Latin America were obtained from CIAT’s rice germplasm bank. Ten rice seedlings 21 days old per pot were sprayed with 2.0 ml of blast inoculum suspension (5x105 spores/ml of isolate Oryzica Yacu 9-19-1 carrying avr Pi-1(t)) and incubated in the greenhouse at a temperature of 24- 28oC and relative humidity above 85 %. Plants were evaluated 15 days (two life cycles of the pathogen) after inoculation and scored for resistance and susceptibility in two replications as described by Correa-Victoria and Zeigler (Correa-Victoria and Zeigler, 1993. Plant Disease 77: 1029-1035.). Resistant genotypes exhibit complete resistance with no lesions or few non-sporulating lesions type 1 or 2, and susceptible genotypes exhibit typical sporulating blast lesions type 3 or 4 covering more than 1 % of leaf area.
DNA concentrations were determined in a TKO 100 minifluorometer with the DNA-specific fluorescent dye. DNA bulks were prepared from 13 resistant and 13 susceptible lines within the CT13432 F3 families evaluated for their blast reaction using the blast isolate Oryzica Yacu 9-19- 1. Polymerase chain reaction (PCR) was conducted in a final volume of 20 l containing between 25-50 ng of template DNA, 0.5 M of each primer, 200 M of each dNTP, 3.1 mM MgCl2 and 1 unit of Taq DNA polymerase. For the majority of microsatellite markers studied the reaction was processed as follow: 94oC for 1 min, followed by 40 cycles consisting of 94oC for 30 sec, 50 and/or 55oC for 30 sec and 72oC for 30 sec and a final extension step of 72oC for 10 minutes. After the PCR reaction, 5 l of blue juice (30 % glycerol, 0.25% bromophenol blue) was added to the amplification product and 20 l per sample were loaded on high-resolution agarose gels prepared mixing 1.5 % Sinergel (Diversified Biotech) and 0.7 % molecular grade products and containing 0.5mg/mL of ethidium bromide.
27 Twenty-four primer pairs corresponding to nineteen microsatellite loci (Figure 1.5.1.B) were selected from the Gramene database (www. gramene.org) considering their relative proximity to the Pi-1(t) gene in the current rice genetic map (Figure 1.5.1.A). The isogenic lines C101LAC and C101A51 and their common genetic background, the susceptible recurrent parent CO39, were used to identify microsatellite polymorphisms associated to the blast resistance genes. Polymorphic markers identified above were assayed by bulked segregant analysis (BSA).
Figure 1.5.1. Genetic map of rice chromosome 11 (A) as indicated by Temnykh et al. (2001) and by McCouch et al. (2001). Region between the 110.0 and 123.2 cM (B) was complemented with public information available at Gramene database (www.gramene.org). Information about position of the resistance genes on chromosome 11 was obtained as follow: Pi-1(t) (Yu et al. 1996; Hittalmani et al. 2000), Pi-7(t) and quantitative trait locus (QTL) to partial resistance to blast (Wang et al. 2001; Zenbayashi et al. 2002), Pi- CO39(t) (Chauhan et al. 2002), Pi-18(t) (Ahn et al. 2000), Pi38 (Gowda et al., 2006), Pi-44(t) (Chen et al. 1999), Pi-a, Pi-k, Pi-sh, Pi-f, Pi-lm2 and Pi-30(t) (Sallaud et al. 2003), Pi-kh (Sharma et al., 2005), Xa3, Xa4, Xa10, Xa21 and Xa22(t) (Causse et al. 1994; Mackill and Ni, 2001). Chromosome 11 generated through linkage analysis (C).
28 Genetic analysis of the resistance was conducted measuring the goodness-of-fit to the expected ratio for a single gene model using a chi-square test. For this purpose, we used 283 F3 near- isogenic lines derived from 283 F2 plants with no selection. Molecular markers that resulted positive in BSA for the Pi-1(t) gene were used in linkage progeny analysis using 158 F3 near- isogenic lines. Associations between markers and the resistance gene were demonstrated using a chi-square test. Linkage analysis was performed using the software MAPMAKER/EXP V 3.0 on the segregation data obtained from markers and blast resistance scoring of the CT13432 F3 population. Conversion of the recombination fraction into centiMorgans (cM) units was obtained with the Kosambi’s mapping function. The final map was drawn using the software QGene V 3.04.
The diagnostic potential of the markers associated with the Pi-1(t) gene was also evaluated on DNA obtained from nineteen rice genotypes including seventeen elite cultivars grown in Latin America. For this purpose, the criteria followed for determining the presence or absence of the resistance gene was the amplification of the specific Pi-1(t) microsatellite allele in each rice genotype. Comparing with phenotypic evaluation obtained as indicated above, the veracity of the assay was corroborated.
Results and Discussion
Genetic analysis of the resistance was conducted using 283 F3 near-isogenic lines of the cross CT 13432. Expected and observed segregation ratios for this population are shown in Table 1.5.1. The population analysis showed a good fit to the expected segregation ratio (1:2:1) for a single gene model confirming the hypothesis of a single dominant gene for Pi-1(t) locus.
Table 1.5.1. Segregation of F3 near-isogenic lines of the genetic cross between C101LAC (Pi-1(t))/C101A51 inoculated with the blast isolate Oryzica Yacu 9-19-1 of Pyricularia grisea. No. of lines No. of lines observed Population Expected ratio1 expected S SG R S SG R
2 F3 near-isogenic lines 1:2:1 ( = 1.0, p < 0.05) 71 141 71 76 133 74
(1) According to a model based on a single dominant gene as indicated in materials and methods; (S): Susceptible, (SG): Segregant; (R): Resistant
From the reported position of Pi-1(t) on chromosome 11 relative to RZ536 RFLP marker, it was possible to estimate its approximate position on the Rice-Cornell microsatellite genetic map (Figure 1.5.1.A). Using this information, twenty-four microsatellite sequences were selected from this region of chromosome 11 from the Gramene database (www.gramene.org) as potential markers for Pi-1(t). These markers were first tested for polymorphism in the susceptible and resistant parent and later for linkage to Pi-1(t) in pooled C101LAC/C101A51 samples. Of the twenty-four primer pairs tested six (corresponding to four microsatellite loci) were polymorphic in agarose gel electrophoresis, all of them showing positive results in bulked segregant analysis; five markers were not polymorphic, and thirteen principally repeats with TA sequences did not show consistent amplification with the different annealing temperatures assayed.
29 Linkage between these six markers and blast resistance was confirmed by screening 158 F3 near- isogenic lines from the cross C101LAC/C101A51 segregating for Pi-1(t). Chi-square test indicated that these markers were linked to Pi-1(t). The genetic distance between the markers and the Pi-1(t) locus ranged from 0.0 (no recombination between the markers and the resistance factor) to 23.8 cM (Figure 1C). Among the six makers linked to Pi-1(t) gene, two (RM1233*I and RM224) mapped in the same position (0.0 cM) with the Pi-1(t) gene. Other three dominant markers corresponding to the same genetic locus (RM7654) were located at 18.5 cM above the Pi-1(t) gene, while marker RM6094 was identified at 23.8 cM below the gene.
To examine whether the markers identified would be of general utility on a wider range of rice germplasm used in applied breeding programs in Latin America, the presence of resistant bands for five markers were examined in elite rice cultivars and compared to the reported inheritance of Pi-1(t) (Table 1.5.2). For this purpose, we used known sources of blast resistance as positive controls and considered as predictive criteria of the resistance event the amplification in each variety of the resistant microsatellite band and therefore the presence of the resistant allele for the Pi-1 (t) gene. Comparing with phenotypic data on blast resistance our results showed that our known sources of resistance (C101LAC, Cica 8, Oryzica 2, BR IRGA 409, CR 1113, El Paso 144 and Panama 1048) carry the resistance Pi-1(t) allele; on the other hand, the susceptible cultivars (Colombia XXI, Epagri 108, Capirona and Oryzica 1 and CO-39) had not the resistant allele. In addition, other seven varieties (Jucarito-104, Fedearroz 2000, CR 1821, Primavera, Cimarrón, Bonanza and Fedearroz 50), which were resistant in the pathogenicity assay, did not show the allele characteristic of the Pi-1(t) gene. This study demonstrates that approaches combining near isogenic progeny analysis and rice genome information available in a public database constitute a very useful tool for identifying molecular markers closely linked to blast resistance genes. The reported marker most closely linked to blast resistance gene Pi-1(t) was the cDNA Npb181, identified at 3.5 cM from the gene. Here, using a segregating population with identical genetic background (CO39) but with a higher number of segregant lines than the one used by these authors, we have identified two new microsatellite markers (RM1233*I and RM224) highly linked to gene Pi-1(t) (at 0 cM of the gene). From the reported position of the Pi-1(t) gene relative to the RZ536 marker, it was possible to estimate its putative position on the Rice-Cornell microsatellite genetic map flanked by the microsatellite RM254 and the RFLP RZ536 markers between the 110.0 and 125.6 cM at the end of chromosome 11. Here we have reported two microsatellite markers very closely linked to gene Pi-1(t), which is in agreement with the information included in the Rice-Cornell microsatellite genetic map, positioning these markers between 112.9 and 120.1 cM at the end of chromosome 11. However, the two remaining microsatellite loci RM7654 and RM6094 were outside of the mentioned 7.2 cM chromosomal region, mapping to 18.5 and 23.8 cM from the gene Pi-1(t), respectively.
30 Table 1.5.2. Analysis of the predictive capacity of six microsatellite markers for blast resistance gene Pi-1(t) in 19 commercial rice cultivars. Marker analyzed Variety Origin PA RM1233*I RM7654*A RM7654*H RM7654-2 RM224 CO-39 1 Philippines S - - - - - C101LAC 2 Philippines R + + + + + Cica-8 Colombia R + + + + + Fedearroz 2000 Colombia R - - - - - Colombia XX1 Colombia S - - - - - Oryzica 1 Colombia S - - - - - Oryzica 2 Colombia R + + + + + Fedearroz 50 Colombia R - - - - - Epagri 108 Brazil (irrigated) S - - - - - BRIRGA409 Brazil (irrigated) R + + + + + Primavera Brazil (upland) R - - - - - Bonanza Brazil (upland) R - - - - - El Paso 144 Uruguay, Argentina R + + + + + Cimarron Venezuela R - - - - - Capirona Peru S - - - - - Panamá 1048 Panama R + + + - + CR 1113 Costa Rica R + + + + + CR 1821 Costa Rica R - - - - - Jucarito-104 Cuba R - - - - - (1): Susceptible control; (2): Resistant control; PA: Results of the pathogenicity assay using blast isolate Yacu 9-19-1, R: resistant genotype, S: susceptible genotype, (+) presence of resistant allele, (-) absence of resistant allele.
We have shown that the known Pi-1(t) resistance sources such as C101LAC, Cica-8, Oryzica 2, BRIRGA409, El Paso 144, Panamá 1048 and CR1113 (Correa-Victoria et al., 2002. Fitopatología Colombiana 26: 47-54) exhibited microsatellite alleles associated with this gene of resistance, while susceptible varieties don’t. Interestingly, six varieties (Fedearroz 2000, Fedearroz 50, Primavera, Bonanza, Cimarrón and Jucarito-104) that were resistant to the rice blast isolate Oryzica Yacu 9-19-1 did not show the resistant Pi-1(t) alleles. One possibility for this resistance reaction in these cultivars could be the presence of different resistance genes interacting with corresponding avirulence genes different from the avr Pi-1(t) in the pathogen.
This study is part of a molecular marker-assisted rice breeding program aiming at developing durable blast resistance in rice cultivars by pyramiding the resistance genes Pi-1(t), Pi-2(t), and Pi-33(t), which are potentially useful for controlling blast pathogen populations in the Latin American region (Correa-Victoria et al., 2002. Fitopatología Colombiana 26: 47-54). Disease assays to evaluate resistance to rice blast are time-consuming and laborious procedures that also require specialized facilities. PCR analysis can greatly reduce the amount of labor needed for evaluating phenotypes by prescreening with MAS. Cost-effective microsatellite markers linked to the blast resistance Pi-1(t) gene and suitable for agarose gel electrophoresis facilitating the introgression and pyramiding of the gene into rice commercial cultivars, were developed here. The microsatellites reported in this study seem to be suitable for assisting rice breeders in the introduction of the Pi-1(t) resistance gene in different rice cultivars, and serve as an indicator for the presence of others. Thus, the Pi-1(t) gene markers may serve as indicators for the presence of resistance gene clusters in the indicated chromosome region and for the selection of breeding parents for developing rice cultivars with a broader-resistance spectrum to blast. Additionally, these microsatellite markers could provide a starting point for efforts eventually aimed at cloning and isolating this gene.
31 Conclusions The present work evidenced the usefulness of combining near-isogenic progeny analysis with rice genome information available in public databases to identify molecular markers highly linked to blast resistance genes in rice. Although a limited number of polymorphic markers can be expected when near-isogenic lines are used as progenitors, here we found six polymorphic markers in a region of only 13 cM surrounding the blast resistance gene Pi-1(t) (Figure 1.5.1). Additionally, two of these markers (RM1233*I and RM224) were closely linked to the gene. This finding supports the hypothesis that when polymorphisms are found in near-isogenic derived populations, differing only in the presence or absence of a gene, the probability that these markers be closely linked to the gene is very high. Besides, polymorphic markers linked to resistance genes in near-isogenic populations, can also be expected to detect polymorphism and presence of the linked genes in commercial rice varieties with certain level of inbreeding. Our results support the utility of these DNA markers in MAS and gene pyramiding rice breeding programs addressing the improvement of blast resistance in rice cultivars; and eventually to map based cloning of the gene. However, the use of these markers as a diagnostic tool for determining the presence of the resistance gene Pi-1(t) in a wider range of rice germplasm require additional studies for further confirmation of the results reported here. The speed, simplicity and reliability of PCR based approaches make microsatellite analysis on agarose gels an attractive tool for marker-assisted selection in rice breeding programs aiming at developing durable rice blast resistant cultivars.
Activity 1. 6. Characterization of strains of cassava frogskin virus.
Contributors: L.A. Calvert, N. Villareal, M.Cuervo and I. Lozano.
Rationale
Cassava frogskin disease (CFSD) is a disorder of unknown etiology that affects cassava and was first reported in 1971 from southern Colombia, and is endemic in the Amazon regions of Colombia, Peru, and Brazil. In the Amazon region, one common name for CFSD is "jacaré" (caiman). The disorder is also present in Venezuela and Costa Rica. While the primary means of transmission are infected stem cuttings that are used to propagate cassava, there is circumstantial evidence suggesting that an aerial vector spreads disorder. The disease is transmitted through grafting. We report on the progress that has been made in characterizing the genomic segments, the identification of three strains of the virus and their association with cassava frogskin disease.
Materials and Methods
Source of host plants and isolates. The CFSD affected plant materials were collected in the Andean and Amazonian regions of Colombia and maintained in greenhouses by vegetative propagation. The CFSD isolates used in this study were collected from different areas of Colombia between 1983 and 2003 and were designated Secundina 5, Secundina 80, FSD 29, CM- 5460-10, SM 909-25, Regional Tolima, Amazonas 16, Catumare Jamundi and CMC-40. Recently additional collections were made from the Departments of Atlantico, Cauca, Meta, Tolima, and Valle de Cauca, Colombia.
32 The healthy control plants were obtained from CFSD-free materials that were subjected to heat therapy and cultured in vitro. The in vitro plants were hardened and subsequently maintained in a greenhouse. Since Secundina develops mosaic leaf symptoms, it was used as a biological assay for the presence of CFSD. Control test plants were periodically grafted to Secundina to assure that they had not become affected with CFSD.
Double-stranded RNA extraction, cDNA synthesis and cloning. Double-stranded RNA (dsRNA) was isolated from young leaves, petioles or roots of CFSD affected plants. When the dsRNAs were purified from 2% low melting point agarose gels, the selected gel pieces were melted a 70C, 2X STE, 2% SDS and 0.1% bentonite were added, and the extraction procedure describe for the plant material was followed. The cDNAs were modified by adding a 3’A-overhangs and ligated in to the pCR 2.1 vector (TA cloning Kit, Invitrogen). The dsRNA were amplified using standard PCR protocols with primers designed from the CFSV S4 sequence. The PCR products were cloned into the TA plasmid (Invitrogen). Nucleotide sequences were determined using an ABI Prism 377 sequencer (Perkin-Elmer) using the ABI dye terminator reaction ready kit. The sequence data were analyzed using SEQUENCHER version 4.1.2 for Macintosh, NCBI BLASTX, and DNAMAN Version 4.13 (Lynnon Biosoft, Vaudreuil, Quebec).
Results and Discussion
Molecular Characterization of CFSV. Approximately 7000 nucleotides of CSFV have been sequenced and this represents about 30% of the genome. Based upon the ten genomic segment of rice ragged stunt virus, we have cDNA clones of six of the genomic segments of CFSV. The predicted proteins from the cDNA clones and contigs were compared and found to have similarity with RRSV proteins. The percentage of similarity is reported in Table 1.6.1.
Several attempts were made to clone the 5’and 3’termini of selected genomic segments. The 5’ terminus of RNA 4 of the isolates CMC-40 and Amazonia 16 and the 3’terminus of CMC-40 were successfully cloned and sequenced. These were compared with the termini from RRSV and they are distinct. Many of the other Reoviridae have conserved termini but these are general only six conserved nucleotides.
33 Table 1.6.1. The cDNA clones that represent approximately 30% of the genome of cassava frogskin virus. Clone name and Viral Isolate Size of cDNA AA similarity with RNA segment Nucleotide RRSV CFSV RNA1 228 Amazonas 16 288 48% CFSV RNA1 683 FSD 29 683 36% CFSV RNA2 381 CMC-40 424 53% CFSV RNA2 361 Contig CFSV RNA2 434 CMC-40 434 23% CFSV RNA3 315 CMC-40 315 60% CFSV RNA3 232 FSD 29 232 47% CFSV RNA3 432 CMC 40 1476 30% CFSV RNA3 716 contig CFSV RNA3 900 CFSV RNA3 400 CFSV RNA3 294 R CFSV RNA3 310 FSD 29 396 59% CFSV RNA3 281 contig CFSV RNA4 743 R Amazonia 16 743 35% CFSV RNA4 743 R CMC-40 1192 35% CFSV RNA4 867 contig CFSV RNA4 580 CFSV RNA4 652 CMC-40 652 62% CFSV RNA4 284 FSD 29 284 60% CFSV RNA5 351 5460-10 351 41% CFSV RNA10 640 Secondia 5 640 27% 1. The comparison for amino acid similarity is to rice ragged stunt virus (RRSV). The assignment of the RNA genomic segment for CFSV is based on the similarity with RRSV.
Using PCR, hybridization probes were developed for the six genomic segments. These were used to detect the double-stranded RNA genomic segments of the isolate CMC-40. The genomic segments were the size that we have predicted previously using RNA markers and visualization of these dsRNAs. The only genomic segment that is slightly larger than predicted is the CFSV segment 5, but these polyacrylamide gels did not contain a denaturing agent and more precise gels are need to make a decision on the size of the genomic segments. This confirms that the cDNA clones recognize the genomic segments that were predicted by their size and with their similarity to RRSV.Conserved motifs among the RNA-dependent polymerase encoding elements are often used to study the relationships of viruses. There are four common motifs that are conserved in the sequences of the polymerases showing RNA template specificity (1989, EMBO, v8:p3887-3874). We have cloned that region of the polymerase encoded by the RNA S4 of CFSV and have compared it to other members of the family Reoviridae. A comparative analysis demonstrates that CFSV is most closely related to RRSV and then to the Cypo- viruses (Table 1.6.2). This analysis clearly identifies CFSV as a plant reovirus that is most closely related to RRSV. Further analysis is needed to determine if CFSV should be placed into a unique genus of the Reoviridae.
34 S1S2 S3 S4 S5 S10
3.8 Kb
2.7 Kb
1.2 Kb
Figure 1.6.1. Hybridization of the genomic segments (S1-S6) of CFSV using probes generated from cDNA clones of this virus.
Table 1.6.2. A comparison of sequences surrounding the conserved RdRp motifs of members of the virus family Reoviridae. Under host vertebrates (V), plant (P), and insects (I).
Genus Type species Abbreviations RdRp Host Orthoreovirus Avian orthoreovirusNC98 ARV RNA1 (V) Aquareovirus Golden shiner virus GSRV RNA2 (V, I) Coltivirus Colorado tick fever virus CTFV-F1 RNA1 (V, I) Fijivirus Fiji disease virus FDV RNA1 (P, I) Oryzavirus Rice ragget stunt virus RRSV RNA4 (P, I) Unclassified Cassava frogskin virus CFSV RNA4 (P, ?) Cypovirus Bómbix mori BmCPV-1 RNA2 (I) Orbivirus Bluetongue virus BTV RNA1 (V, I) Phytoreovirus Rice dwarf virus RDV RNA1 (P, I) Rotavirus Simian Rotavirus A SiRV-A RNA1 (V) Seadornavirus Banna virus BAV-Ch RNA1 (V, I)
Motifs I II III I ARV VQRRPRSI DISACDAS SGSTATSTEHTANNST YVCQGDDGLM.IIDG GSRV VQRRARSI YAAFLAPI SGSTATSTEHTANNGA IVKDMNIQNNYVCQ. CTFV ..RRPRVI DSSTKPNT SGLLNTADQHT FLGV GSVLGDDQVAGAFCQ FDV IDRRARVI DMKGMDAH SGFFATSAQHTLFLSL HSVMGDDVFEVIVN. RRSV IGRRQRAI DASVQASV SGQPFTTVHHTFTLSN LTVQGDDTRT.INYG CFSV IGRRQRAV DASVQAAV SGLPFTNVHHTFILTS LTIQGDDIRM.AN-- BmCPV-1 SDRRQRAI DASVTTNT SGRADTSTHHTVLLQG KIL GDDIME IFQG BTV PIKATRTI DYSEYDTH SGENSTLIANSMHNMA EQYVGDDTLFYTKLD RDV AWRPVRPI DCTSWDQT SGRLDTFFMNSVQNLI FQVAGDDAIM.VYDG SiRV-A PGRRTRII DVSQWDSS SGEKQTKAANSIANLA IRVDGDDNYAVLQFN BAV-Ch VSDLDVVV MAPQLAVT EKPLKYKMNGLVCESA TVALDDYNNRAYRLN
35 Isolate variation and the association of CFSV with CFS disease. During the development of an rt- PCR diagnostic method, it was determined that there existed substantial variation some isolates of CFSV. Using the information that was developed for the study of diversity, primers that generate a sequenced characterized amplified region (SCAR) were developed and they identify all known variants of the cassava frogskin virus. These amplify a 958 nucleotide region in the 5’region of CFSV S4 which is the polymerase gene. New isolates were collected from the Departments of Meta, Cauca, and Sucre. Also included in the analysis were older isolates from the Departments of Magdalena, Valle del Cauca, Amazonas and Tolima. A total of 39 independent cDNA clones were produced and sequenced representing 16 independent isolates. The majority of these isolates were in one group (Figure 1.6.3). It is remarkable, that the two isolates were collected in the Department Magdalena in 1980 and the seven isolates that were collected in 2005 from the Departments of Sucre, Meta and Cauca had 99% identity. The isolate Amazonia 16 collected from the Tarapoto Amazonia in 1990 and the isolate FSD 29 collected in Quilcacé, Cauca in 1983 were distinct from the other isolates an had only 89% identity with them. These isolated had 93% identity with each other. This is evidence that there are at least three distinct strains of CFSV. It is also evident from the finding of the same virus in plants affected with cassava frogskin disease from seven Departments of Colombia over a period of 25 years that there is a strong association of the virus with the disease.
36 100 90 80 70 60 50 40
Cauca2 Cauca2 CM5460B CM5460C 100% Cauca1 Cauca2 CM5460 CMC40C CMC40 CMC40 Llano1A Llano1 99% Cauca1 Cauca1 SM909A SM909 Cauca1 CatumareA CatumareB 99% Cauca3 Cauca3 FSD80A FSD5A FSD5B FSD80 99% Costa2 Costa1 RegTolimaA RegTolima 98% RegTolimaB Costa2 99% Costa2 Costa1 89% Llano2A Amazonas16 100% Amazonas16 48% Amazonas16 FSD29A 93% FSD29 100% RRSVS4
Figure 1.6.3. A comparison of a 958 nucleotide region of the RNA 4 of CFSV that were collected in 16 different sites over a period of 25 years. The percentages represent the identity between the different isolates.
37 Activity 1.7. Monitoring of whitefly populations in the Andean zone.
Contributors: J. M. Bueno, I. Rodríguez, C. Cardona and F. Morales.
Highlight:
Detected important changes in whitefly species composition in the target area
Rationale Continuous monitoring of changes in whitefly populations and species composition in target areas is one of the most important objectives of the DFID-funded project on Sustainable Management of Whiteflies. This is needed to develop appropriate management systems and, if necessary, to modify existing systems so as to be able to cope with new situations. Materials and Methods
In 2006 we processed a total of 17 whitefly samples (adults and pupae) collected in 11 locations of the Cundinamarca Department of Colombia, at altitudes ranging between 1300 and 2100 meters above sea level (MSL). Samples were taken from beans, snap beans, tomatoes and several other annual crops. When possible, identification was initially based on morphological characteristics of pupae. To differentiate between biotypes (which are impossible to differentiate by morphology) RAPD techniques (primer OPA-04) were used. RAPD patterns of pupae and adults brought from the field were compared with those of existing mass rearings of different whiteflies maintained at CIAT (Figure 1.7.1).
Results and Discussion
In order to know about the distribution of the whitefly, other areas in Colombia are continued to be monitored, where it is considered to be an important pest. Four sites of the Cundinamarca Department (Fómeque, Cáqueza, Fusagasugá and Arbeláez) located in the Central Zone of Colombia, with altitudes ranging between 1300 and 2100 MSL, were sampled. We found that 64.7% of the collected samples were of T. vaporariorum and the other 35.3%, which were found under 1700 MSL, correspond to a complex of T. vaporariorum and B. tabaci biotype B. Presence of biotype B of B. tabaci was evidenced in the field by proofs of physiological disorders (irregular ripening) in tomatoes that was also associated with the presence of begomovirus and by morphological differentiations with T. vaporariorum. These identifications were confirmed by means of RAPD molecular tests, as seen in Figure 1.7.1.
38 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19
Figure 1.7.1. RAPD’s of whiteflies collected in the Cundinamarca Department. Amplification of the primer OPA-04: 1, T. vaporariorum (CIAT breeding adults); 2, B. tabaci biotype A (CIAT breeding adults); 3, B. tabaci biotype B (CIAT breeding adults), 4-5, adults of B. tabaci biotype B collected in Fusagasugá (1491 MSL): 6-7, adults of T. vaporariorum and pupae of B. tabaci biotype B, collected in Fusagasugá (1719 MSL); 8-9, adults of B. tabaci biotype B collected in Fusagasugá (1312 MSL); 10, adults of T. vaporariorum collected in Fusagasugá (1376 MSL); 11-12, adults of T. vaporariorum and pupae of B. tabaci biotype B, collected in Arbeláez (1430 MSL); 13-14, adults of T. vaporariorum and pupae of B. tabaci biotype B, collected in Arbeláez (1478 MSL; 15, B. tabaci biotype B (CIAT breeding adults); 16, B. tabaci biotype A (CIAT breeding adults); 17, T. vaporariorum (CIAT breeding adults); 18, reaction target; 19, marker (100 pb).
As shown in Figure 1.7.2, species composition in the Cundinamarca Department has changed drastically in the past 9 years and the trend continues: since the introduction to Colombia of the biotype B, which is occupying niches previously reserved to T. vaporariorum even in areas located above 1300 MSL. The biotype B is an aggressive form of whitefly that is causing all the serious problems described in our 2003 and 2004 Reports. These include physiological disorders in several different crops (silver-leaf in squash, uneven ripening of tomatoes, pod chlorosis in snap beans), and the ability to transmit a geminivirus that has devastated snap beans in areas below 1200 MSL.
39 T. vaporariorum T. vaporariorum and B. tabaci B 100
80
60
40 Samples (%) Samples
20
0 1997 2006 Figure 1.7.2. Changes in whitefly species composition in the Cundinamarca Department (Fómeque, Cáqueza, Fusagasugá and Arbeláez) located in the Central highlands of Colombia, with altitudes ranging between 1300 and 2100 MSL (1997-2006).
Activity 1.8. Mortality levels of new pesticides for the control of whitefly populations
Contributors: J.M. Bueno, H. Morales and C. Cardona.
Highlight :
Evaluation of the efficiency of pesticide that could help to control whiteflies in the target region
Rationale
Besides monitoring resistance to pesticides, which is one of the major targets of the DFID- funded project on Management of Whiteflies in the Tropics, it is necessary to try new active ingredients and generic products that can help control this pest, without drastically affecting the economy of the farmer and harming the environment.
Materials and Methods
In order to evaluate the efficiency of pesticides on first instar nymphs (N1), we proceeded to obtain populations of nymphs in the same development stage of a susceptible strain by confining adults in clip cages attached to leaves of common bean seedlings. The adults (10 per clip cage) were allowed to oviposite during 24 hours and then were taken out of the cage. After the eclosion of the eggs, the area of the infested leaves with first instar nymphs was marked and the amount of individuals obtained was registered. Infested seedlings were further dipped during 5 seconds in 1000 mL of the pre-established concentration of each tested pesticide. Formulated material
40 was used in all the tests and the pre-established concentrations were prepared by dilution with distilled water. Controls were dipped in distilled water. Plants were left inside the cages for the counting of adult emergence (26 days after treatment). The difference between the initial N1 and the amount of adult emergence is a surviving method.
For the evaluation of adults, leaves were immersed in the pre-established dosage for each treatment. The leaves were dried at room temperature, and circles of about 5cm in diameter were cut placing them on noble agar in Petri cases. Adults were left inside each Petri case. After 48 hours, the amount of living and deceased individuals was registered. We used a randomized complete block design: 10 repetitions per treatment and 20 individuals per repetition. Everything was performed under controlled conditions of temperature and humidity. Mortality of the controls was not accepted over 10%. Mortality percentages were calculated, having Abbott making the corrections. The treatments used are as follow:
Orgocontrol 1 = one part of Orgocontrol and 32 parts of water Orgocontrol 2 = one part of Orgocontrol and 64 parts of water Orgocontrol 3 = one part of Orgocontrol and 128 parts of water Imidor 1 = 600cc/ha (generic Imidacloprid) Imidor 2 = 300cc/ha Confidor = 600cc/ha (chemical control) Control (Test) = water control
Results and Discussion
The toxicological reaction of the T. vaporariorum N1’s to the six treatments are presented in Figure 1.8.1. It is observed that treatments with Orgocontrol 1 and 2, and Imidor 1 present mortality higher than 80%, which is a similar result obtained with the chemical control with Confidor. This indicates that these treatments can be used as a solution for the control of immature insects. For the control of adults, the pre-established dosages of Orgocontrol only reached a 60% of mortality, while the dosages of Imidor 1 and Imidor 2 were similar in results obtained with Confidor. The treatment with Imidor can be used for the control of both immature and adult stages of T. vaporariorum (Figure 1.8.2).
41 100 a a a a a 80 c
60
mortality 40 Percentage corrected corrected Percentage 20
0 Orgocontrol 1 Orgocontrol 2 Orgocontrol 3 Imidor 1 Imidor 2 Confidor Treatment
Figure 1.8.1. Response (corrected percentage mortality) of Trialeurodes vaporariorum first instarnymph of three insecticides with diferent doses. Dosages were as follows: Orgocontrol 1= one part Orgocontrol to 32 parts water; Orgocontrol 2= one part Orgocontrol to 64 parts water; Orgocontrol 3= one part Orgocontrol to 128 parts water; Imidor 1= 600cc/ha; Imidor 2= 300cc/ha and Confidor = 600cc/ha.
100 a aa 80 b a 60 c
mortality mortality 40
Percentage corrected corrected Percentage 20
0 Orgocontrol Orgocontrol Orgocontrol Imidor 1 Imidor 2 Confidor 1 2 3 Treatment
Figure 1.8.2. Response (corrected percentage mortality) of Trialeurodes vaporariorum Adultsof three insecticides with diferent doses. Dosages were as follows: Orgocontrol 1= one part Orgocontrol to 32 parts water; Orgocontrol 2= one part Orgocontrol to 64 parts water; Orgocontrol 3= one part Orgocontrol to 128 parts water; Imidor 1= 600cc/ha; Imidor 2= 300cc/ha and Confidor = 600cc/ha.
42 Figure 1.8.3 shows the response of N1 nymphs of Bemisia tabaci biotype B to different treatments, evidencing high susceptibility to the different pre-established dosages of each pesticide. For adults, the pre-established dosages of Orgocontrol only eliminated a 30%, while the dosages of Imidor produced a mortality of 80%, similar to Confidor results (Figure 1.8.4).
100 aa a b b b 80
60
mortality 40 Percentage corrected corrected Percentage 20
0 Orgocontrol 1 Orgocontrol 2 Orgocontrol 3 Imidor 1 Imidor 2 Confidor Treatment
Figure 1.8.3. Response (corrected percentage mortality) of Bemisia tabaci B first instar nymph of three insecticides with diferent doses. Dosages were as follows: Orgocontrol 1= one part Orgocontrol to 32 parts water; Orgocontrol 2= one part Orgocontrol to 64 parts water; Orgocontrol 3= one part Orgocontrol to 128 parts water; Imidor 1= 600cc/ha; Imidor 2= 300cc/ha and Confidor = 600cc/ha.
100 a a
80 a
60
mortality 40 b b b Percentage corrected 20
0 Orgocontrol 1 Orgocontrol 2 Orgocontrol 3 Imidor 1 Imidor 2 Confidor
Treatment Figure 1.8.4. Response (corrected percentage mortality) of Bemisia tabaci B adults of three insecticides with diferent doses. Dosages were as follows: Orgocontrol 1= one part Orgocontrol to 32 parts water; Orgocontrol 2= one part Orgocontrol to 64 parts water; Orgocontrol 3= one part Orgocontrol to 128 parts water; Imidor 1= 600cc/ha; Imidor 2= 300cc/ha and Confidor = 600cc/ha.
43 Activity 1.9. Molecular characterization of isolates of Colletotrichum spp. infecting tree tomato, mango and lemon Tahiti in Colombia.
Contributors: M.Cadavid, J. Osorio (CORPOICA) and S. Kelemu
Rationale
Colombia dedicates approximately 42,000 hectares of land to production of citrus, and 13,500 and 7,500 hectares to tree tomato and mango, respectively (Páez, 1995, ASCOLFI-Informa 21:36-39). The disease anthracnose caused by the fungal pathogen Colletotrichum spp. is a major production constraint resulting in losses in the range of 50-100% in various production zones. Anthracnose disease symptoms include fruit rots and blights in shoots, leaf and flowers. The disease can cause up to 50% yield loss in citrus in areas such as Valle del Cauca, Piedemonte and some areas in Magdalena (Osorio, 2000, unpublished results). In tree tomato, the disease directly affects the fruit causing total losses in areas such as Antioquia, Caldas, Risaralda, Cesar, Cundinamarca, Boyacá, Huila, Magdalena, Nariño, Tolima, Cauca and Valle del Cauca, in the absence of control measures are taken, and losses between 10-25% under continuous use of fungicides. Mango anthracnose symptoms include blossom and leaf blight, fruit lesions and in severe cases tree dieback.
Effective control measure of the disease in various fruit crops is complicated by the complexity of the pathogen population structure and high variability. The high variability in morphology of Colletotrichum spp. in culture and the wide host range makes it difficult to use these criteria for taxonomic purposes. Molecular tools have been used for a more reliable species identification method. The objectives of this study are: 1) to characterize the pathogen population structure infecting mango, tree tomato and lemon Tahiti, and 2) to use molecular approach and determine the species infecting these fruit crops.
We have analyzed the internal transcribed spacer (ITS) regions of the ribosomal DNA of the Colletotrichum isolates using the polymerase chain reaction (PCR) method. Furthermore, we used RAPD (random amplified polymorphic DNAs) and AFLP (amplified fragment length polymorphism) to characterize the isolates. We report here the results of this work.
Materials and Methods
Fungal isolates: Ninety-one monoconidial isolates of Colletotrichum spp. that are maintained at the Integrated Disease and Pest Management Program of CORPOICA were used (Table 1.9.1). The isolates were obtained from naturally diseased tissues in various regions of Colombia. The isolates were grown on oatmeal agar at 28 C for 5-8 days for DNA isolation. For DNA isolations, fungal cultures were grown in V-8 tomato juice broth supplemented with 10 g/ml of streptomycin and incubated at 28C for 8 days in the dark and in a shaker at 130 rpm. A C. gloeosporioides isolate CIAT 16100 was included as a control.
DNA extraction: DNA was isolated using methods described previously (Kelemu et al., 1999, European Journal of Plant Pathology 105: 261-272). DNA concentration was quantified using DyNA QUANT 200, aliquot at concentrations of 20 ng/l, and stored at –80 C for further analysis.
44 Table 1.9.1. Isolates of Colletotrichum spp infecting citrus fruits and tree tomato used in this study. Isolate code Zone/Munici- Extracted DNA pality Farm Host Tissue Colletotrichum spp. concentration ng/l 5 Caicedonia Danubio Limón Tahití Flor C. acutatum 120 6 Manizales La Bejuca Limón Tahití Botón C. acutatum 65 14 Caicedonia Danubio Limón Tahití Botón C. acutatum 98 55 Pereira Catalina (FEDECAFË) Limón Tahití Botón C. acutatum 81 83 Pereira Catalina (FEDECAFË) Limón Tahití Botón C. acutatum 100 100 Caicedonia Maracaibo Limón Tahití Flor C. acutatum 101 107 Pereira Catalina (FEDECAFË) Limón Tahití Botón C. acutatum 132 212 Caicedonia Maracaibo Limón Tahití Flor C. acutatum 95 269 Pereira Yarima Limón Tahití Botón C. acutatum 110 275 Pereira Yarima Limón Tahití Botón C. acutatum 264 589 Villavicencio El Refugio Limón Tahití Flor C. acutatum 107 590 Villavicencio El Refugio Limón Tahití Flor C. acutatum 116 592 Cumaral Las Brisas Limón Tahití Flor C. acutatum 277 593.a. Cumaral Las Brisas Limón Tahití Flor C. acutatum 189 593.b. Cumaral Las Brisas Limón Tahití Botón C. acutatum 83 594 Cumaral Las Brisas Limón Tahití Botón C. acutatum 143 595 Cumaral Las Brisas Limón Tahití Botón C. acutatum 127 596 Cumaral Las Brisas Limón Tahití Botón C. acutatum 113 597 Cumaral Las Brisas Limón Tahití Flor C. acutatum 195 599 Cumaral Las Brisas Limón Tahití Botón C. acutatum 114 600 Villavicencio El Refugio Limón Tahití Flor C. acutatum 113 611 Villavicencio El Refugio Limón Tahití Flor C. acutatum 209 619 Villavicencio El Refugio Limón Tahití Flor C. acutatum 119 644 Zona Bananera La Inmaculada Limón común Flor C. acutatum 125 651 Ciénaga Las Margaritas Limón común Botón C. acutatum 126 656 Ciénaga Las Margaritas Limón común Flor C. gloeosporioides 308 663 Ciénaga Las Margaritas Limón común Flor C. acutatum 126 677 Zona Bananera La Inmaculada Naranja Tangüelo Hoja C. gloeosporioides 374 679 Zona Bananera La Inmaculada Limón común Botón C. acutatum 339 687 Zona Bananera La Inmaculada Limón común Botón C. acutatum 130 699 Montenegro Estancia Naranja Valencia Flor C. gloeosporioides 125 754 Meta El Naranjal Limón tahití C. acutatum 220 755 Meta El Naranjal Limón tahití C. acutatum 350 756 Meta El Naranjal Limón tahití C. acutatum 249 757 Meta El Naranjal Limón tahití C. acutatum 149 758 Meta El Palmar Limón tahití C. acutatum 196
45 Table 1.9.1 continued Extracted Zone/Munici- DNA Isolate code Farm Host Tissue Colletotrichum spp. pality concentration ng/l 759 Meta El Palmar Limón tahití C. acutatum 149 761 Meta Los Ramos Limón tahití C. acutatum 241 762 Meta El Elefante Limón tahití C. acutatum 195 763 Meta El Elefante Limón tahití C. acutatum 325 764 Meta El Elefante Limón tahití C. gloeosporioides 178 765 Meta Las Brisas Limón tahití C. acutatum 251 766 Meta Limón tahití C. acutatum 217 768 Santander Casaloma Limón tahití C. acutatum 232 769 Santander Casaloma Limón tahití C. acutatum 273 771 Santander Casaloma Limón tahití C. acutatum 219 774 Santander Lorenzo Limón tahití C. acutatum 478 775 Santander San Antonio Limón tahití C. acutatum 396 776 Santander San Antonio Limón tahití C. acutatum 295 777 Santander San Antonio Limón tahití C. acutatum 284 778 Santander La Esmeralda Limón tahití C. acutatum 445 779 Santander La Esmeralda Limón tahití C. acutatum 446 780 Santander La Esmeralda Limón tahití C. acutatum 422 781 Santander La Esmeralda Limón tahití C. acutatum 233 782 Santander La Esmeralda Limón tahití C. acutatum 386 783 Santander Alto de la Sabana Limón tahití C. acutatum 415 784 Santander Alto de la Sabana Limón tahití C. acutatum 246 785 Santander Los Mangos Limón tahití C. acutatum 258 786 Santander Los Mangos Limón tahití C. acutatum 424 787 Santander Asomadita Limón tahití C. acutatum 587 788 Santander Asomadita Limón tahití C. acutatum 381 789 Santander El Mirador Limón tahití C. acutatum 396 790 Santander Chimita Limón tahití C. acutatum 410 791 Santander El Pangil Limón tahití C. acutatum 291 792 Santander Villa Diana Limón tahití C. acutatum 204 793 Tomate de árbol C. acutatum 291 794 Tomate de árbol C. acutatum 230 796 Tomate de árbol C. acutatum 244 797 Tomate de árbol C. acutatum 196 798 Tomate de árbol C. acutatum 278 801 Tomate de árbol C. acutatum 356 802 Tomate de árbol C. acutatum 243 805 Tomate de árbol C. acutatum 311 806 Tomate de árbol C. acutatum 247 808 Tomate de árbol C. acutatum 300 809 Tomate de árbol C. acutatum 364 810 Tomate de árbol C. acutatum 381 812 Tomate de árbol C. acutatum 210 813 Tomate de árbol C. acutatum 478 814 Tomate de árbol C. acutatum 262 816 Tomate de árbol C. acutatum 377 820 Tomate de árbol C. acutatum 353 821 Tomate de árbol C. acutatum 242 822 Tomate de árbol C. acutatum 378 824 Tomate de árbol C. acutatum 199 826 Tomate de árbol C. acutatum 327 827 Tomate de árbol C. acutatum 262 828 Tomate de árbol C. acutatum 218 830 Tomate de árbol C. acutatum 478 831 Tomate de árbol C. acutatum 416 832 Tomate de árbol C. acutatum 338
46 Polymerase chain reaction (PCR) amplifications: For random amplified polymorphic DNAs (RAPD) analysis and primer screening, several arbitrary 10-base, oligonucleotide primers from Operon Technologies (Alameda, CA) were used for polymerase chain reaction (PCR) amplification. Amplification conditions were as described earlier (Kelemu et al., 1999, European Journal of Plant Pathology 105: 261-272). PCR primers for taxonomic purposes included internal transcribed spacer, ITS4 (5’-TCCTCCGCTTATTGATATGC-3’), C. gloeosporioides (CgInt) [5’-GGCCTCCCGCCTCCGGGCGG-3’] and C. acutatum (CaInt2) [5’- GGGGAAGCCTCTCGCGG-3’] To determine C. acutatum, the primers ITS4 and CaInt2 were used. PCR reactions were conducted in a total volume of 20 l, containing 40 ng of DNA, 1.5 mM MgCl2, 200 M each of dNTP, 0.3 M each of the primers, 1 unit of Taq Polimerasa Promega (Promega Corp, Madison, WI), and 1X buffer (10 mM Tris-HCl pH 8.3, 50 mM KCl, 0.1% Triton X-100). Amplifications were carried out in a PTC-100 thermal cycler (MJ Research, Inc, Watertown, MA) beginning with a 5 min of denaturation step at 95C, followed by 40 cycles consisting of 30 seconds at 95C, 30 seconds at 60C and 1 min at 72C (final for 7 min).
To determine the species C. gloeosporioides, the primers ITS4 and CgInt were used. PCR reactions were conducted in a total volume of 20 l, containing 40 ng of DNA, 2.0 mM MgCl2, 200 M each of dNTP, 0.5 M each of the primers, 1 unit of Taq Polimerasa Promega (Promega Corp, Madison, WI), and 1X buffer (10 mM Tris-HCl pH 8.3, 50 mM KCl, 0.1% Triton X-100). Amplifications were carried out in a PTC-100 thermal cycler (MJ Research, Inc, Watertown, MA) beginning with a 5 min of denaturation step at 95C, followed by 40 cycles consisting of 30 seconds at 95C, 30 seconds at 65C and1 min at 72C (final for 7 min). Amplification products were resolved by electrophoresis in a 1.2 % agarose gel, stained with ethidium bromide, and photographed under UV lighting.
RAPD markers: Forty-five arbitrary primers of 10 bases purchased from Operon Technologies were evaluated, of which 13 were selected for generating polymorphisms among the fungal isolates tested. Table 1.9.2.shows the list of RAPD primers that were selected for evaluation of all ninety-one isolates (65 isolated from citrus and 26 from tree tomato)
AFLP (Amplified Fragment Length Polymorphism) analysis: The Kit AFLP Analysis System for Microorganisms (Invitrogen, 2004) was used largely according to the manufacturer’s instructions except that the reaction volume was reduced by 75% while still maintaining the recommended concentrations.
47 Table 1.9 2. RAPD primers selected in this study. Primer code Sequence (5` 3`) A-04 AATCGGGCTG AJ-05 CAGCGTTGCC AJ-08 GTGCTCCCTC AJ-09 ACGGCACGCA AJ-11 GAACGCTGCC AJ-15 GAATCCGGCA AJ-20 ACACGTGGTC AK-04 AGGGTCGGTC AK-09 AGGTCGGCGT AN-03 AGCCAGGCTG B-01 GTTTCGCTCC B-04 GGACTGGAGT C-01 TTCGAGCCAG
The genomic DNA of each isolate was digested with restriction enzymes EcoRI and MseI. Specific adopters were then ligated to the ends of the digested DNA fragments. Subsequently, PCR amplifications were conducted using primers that are specifically designed that recognize the sequences of the adopters. For AFLP analysis, only 57 isolates (31 from citrus and 26 from tree tomato) were used to date. Various combinations of primers, E-AC/M-C, E-AC/M-A, and E-AA/M-C, were used in order to generate information that reflects genetic diversity among the isolates. The amplified products were separated on denaturing 6% polyacrylamide gels with 5M urea and run in electrophoretic vertical equipment Sequi-Gen GT BIO-RAD. OncThe gels were stained with silver nitrate according to protocols provided by Promega (1998. Technical manual. Silver sequence TM DNA sequencing system. Promega Corporation). to visualize the results. Inorder to identify the fragment sizes, a molecular size marker (molecular DNA ladder 10 bp Invitrogen) was used that has size markers in the range of 30-330 bp. Analysis of RAPD and AFLP data: comparisons of each banding profile for each primer were conducted on the basis of presence or absence (1/0) of amplified products of the same size. Band of the same size were scored as identical. An analysis of similarity was conducted with data collected for the two types of makers. The similarity matrix was constructed using NTSYS version 2.1 (Rohlf, 2000, Exeter Publ). The coefficients of similarity were introduced in the subprogram SAHN in order to construct dendrograms. Furthermore, a multiple correspondence analysis (MCA) was conducted using SAS (SAS Institute, 1989).
Results and Discussion
PCR amplifications: The DNA extraction protocol used generated high quality DNA. Many of the arbitrary primers tested so far resulted in limited polymorphisms). We are currently screening 40-50 more primers in an attempt to identify those that would generate polymorphism.
Amplifications with the primers CaInt2 – ITS4, indicated that all the isolates tested, with the exception of isolates 656, 677, 699, 764 and the control isolate C. gloeosporioides (Cg),
48 amplified a product with a 490 bp size that indicates that the species is Colletotrichum acutatum. On the other hand amplifications with the primers CgInt – ITS4 resulted isolates 656, 677, 699, and 764 as well as the control isolates generated a DNA product of 450 bp indicating that they all belong to the species Colletotrichum gloeosporioides (Figure 1.9.1). The results of the molecular identification of all the isolates tested are presented in Table 1.9.1.
M 56 66666 6666C 6 ( M MM56666666666C 6 (
1000 bp 1000 bp 49 750 bp 750 bp 45 500 bp 500 bp
Colletotrichum 250 bp 250 bp A Colletotrichum acutatum B gloeosporioides
Figure 1.9.1. Taxonomic identification of isolates of Colletotrichum spp. using PCR analysis A, Colletotrichum acutatum (using primers CaInt2 and ITS4); B, Colletotrichum gloeosporioides (with primers CgInt and ITS4). The numbers at each lane are isolate numbers described in Table 1.9.1. Lanes (), negative control without sample DNA; M, size marker; Cg, positive control C. gloeosporioides.
RAPD data analysis: Amplification products of the 91 isolates using the selected random primers showed very limited polymorphisms (see Figure 1.9. 2). The isolates that were identified as C. gloeosporioides (656, 677, 699 and 764), generated patterns very different from the rest of the isolates of C. acutatum. The C. acutatum isolates with the exception of numbers 596, 611, and 792 generated very similar band patterns (Figure 1.9. 2). Fungal isolates from citrus produced more applification bands than those from tree tomato (Figure 1.9. 2C)
M 5 5 6 6 6 6 6 6 6 6 6 6 6 M 7 7 7 7 7 7 7 7 7 7 7 7 7 M 7 7 7 7 7 8 8 8 8 8 8 8 8
3000 bp 3000 bp 3000 bp
1500 bp 1500 bp 1500 bp 1000 bp 1000 bp 1000 bp 750 bp 750 750 bp
A B C
Figure 1. 9. 2. RAPD amplification products of DNA from isolates of Colletotrichum spp. isolated from anthracnose lesions amplified using random primer B-01 (see sequence in Table 1. 9. 2). A and B, citrus; C, tree tomato. The numbers indicated in each lane correspond to the isolate codes listed in Table 1.9. 1. Lane M corresponds to the 1 kb molecular size marker Promega.
49 Analysis of the collected data corroborates these observations. Figure 1. 9.3 demonstrates a similarity dendrogram using coefficient of Nei-Li (1979, Proc. Natl. Acad. Sci. USA. 79:5269- 5273), where a clear separation of C. acutatum and C. gloeosporioides is observed at the level of 23% similarity. Interestingly, the isolates of C. acutatum were separated along the line of their original hosts: citrus and tree tomato, with a 61% similarity. However, the isolates 596 and 611, although isolated from citrus, the dendogram grouped them within the group formed by isolates from tree tomato at a level of 74% similarity (Figure 1.9.3). Within each group, there is a high level of similarity that ranged between 88-100% indicating a very limited level of diversity.
5 6 14 107 212 0.23 0.61 83 589 590 592 600 619 754 762 766 757 0.74 759 755 756 761 765 758 763 55 100 269 593a 593b 594 595 597 599 644 651 Citrus 663 679 687 768 783 778 779 769 784 771 775 781 791 788 786 785 787 777 774 790 776 789 780 C. acutatum 782 275 792 596 611 793 810 812 814 796 828 801 827 802 832 826 822 820 Tree tomato 824 821 809 816 813 794 805 806 808 798 830 831 797 C. gloeosporioides 656 677 699 764
0.0 0.2 0.4 0.6 0.8 1.0 Similarity
Figure 1.9.3. Similarity dendrogram (UPGMA) of 91 isolates of species of Colletotrichum infecting citrus and tree tomato based on RAPD data using 13 random primers listed in Table 1.9. 2.
Multiple correspondence analysis (MCA) further corroborates the results of the similarity analysis. Figure 1.9.3 presents a three dimensional visualization of the variation among the fungal isolates. In the first dimension, there is a clear differentiation of C. acutatum and C.
50 gloeosporioides. In the second dimension, a clear separation among isolates that infect citrus and tree tomato is observed within the species C. acutatum. The third dimension demonstrates a narrow separation forming two related groups (similarity analysis of 92%). These results using the selected random primers and the 91 isolates indicate that there is a narrow genetic base with high level of similarity among these isolates. The geographic origin and the exact source of the isolates 596, 611 and 792 remain unclear.
Dim2 0.07 792 596 & 611 C. acutatum (Tree tomato) C. acutatum -0.39 (Citrus)
-0.84
-1.30 -0.0265
C. gloeosporioides -0.0042
Dim3 0.0182
0.144 -0.162 -0.009 0.0406 -0.315 Dim1
Figure 1.9.4. Three-dimensional graph derived from multiple correspondence analysis (MCA) of 91 isolates of species of Colletotrichum infecting citrus and tree tomato based on RAPD data with 13 arbitrary primers. AFLP analysis: Of the 91 isolates of the anthracnose pathogen used in this study and evaluated with RAPD analysis, 57 were examined with three combinations of AFLP primers, E-AC/M-C, E-AC/M-A, and E-AA/M-C. Figure 1.9.4 shows an example of AFLP gel pattern of some isolates. A large number of bands were generated with AFLP analysis which allow the evaluation of greater number of loci and thus a wide coverage of the genome. The isolates that showed a pattern of polymorphism were 656, 677, and 699 that were identified as C. gloeosporioides;, and isolates 596 and 611 that belonged to C. acutatum (Figure 1.9.4), exactly corresponding to the results obtained with RAPD analysis (Figure 1. 9.2). Among the isolates originating from the two plant hosts, there was some differentiation, although they share a number of bands in common. The isolates that originated from citrus generated more bands than those from tree tomato (Figure 1.9.5B).
51 M 1 2 3 4 5 6 7 8 9 1111 1 1 11M1 M12222 2 222332 23333M3 22 21
20 20
18 18
16 16
15 15
13 13
12 12 A B
Figure 1.9.5. AFLP amplification profiles of DNA from isolates of Colletotrichum spp. infecting citrus (A) and tree tomato (B), amplified with a combination of primers E-AA/M-C. Lane M is size marker 30-330 bp AFLP Invitrogen. Lanes (1) isolate 593a, (2) 593b, (3) 594, (4) 595, (5) 596, (6) 597, (7) 599, (8) 600, (9) 611, (10) 619, (11) 644, (12) 651, (13) 656, (14) 663, (15) 677, (16) 679, (17) 687, (18) 699, (19) 808, (20) 809, (21) 810, (22) 812, (23) 813, (24) 814, (25) 816, (26) 820, (27) 821, (28) 822, (29) 824, (30) 826, (31) 827, (32) 828, (33) 830, (34) 831, (35) 832, (36) 797.
Within the isolates of C. acutatum, those infecting citrus were separated from those that infect tree tomato with a 60% similarity. However, isolates 596 and 611, although isolated from citrus, the dendrogram grouped them within the tree tomato subgroup with a 66% similarity (Figure 1.9.6). Isolate 792 was not included in this AFLP analysis and thus, it is not shown in the AFLP dendrogram. Within each group and excluding the unique isolates described, a high similarity of 86-100% was observed indicating a low level of diversity.
Multiple correspondence analysis further confirmed the results obtained using the similarity index analysis. Figure 1.9.7 presents a tri-dimensional figure demonstrating the variation among isolates. In the first dimension, the clear separation of C. acutatum and C. gloeosporioides is shown. In the second dimension, a distinct differentiation within isolates of C. acutatum is evident based on their respective hosts. In the third dimension, no separation was evident within the isolates that originated from the same host plant. There is an 87% similarity among isolates from tree tomato and a 91% similarity within those that originated from citrus (Figure 1.9.6). The statistical analysis conducted using three combinations of AFLP primers and with the 57 isolates tested to date, indicate that a limited genetic diversity exist. These conclusions corroborate those obtained using RAPD analysis. In the next several months, we plan to increase the number of isolates, including isolates from mango, collected from more locations and analyze them using methods described in this study.
52 5 212 14 6 83 589 590 0.18 0.6 0.66 592 107 600 619 55 269 100 Citrus 593a 593b 594 595 597 651 663 679 687 599 644 275 596 C. acutatum 611 793 798 806 808 810 801 809 802 805 794 813 824 827 Tree tomato 828 814 830 832 820 816 822 826 821 831 812 796 797 C. gloeosporioides 656 677 699 0.0 0.2 0.4 0.6 0.8 1.0 Similarity
Figure 1.9.6. Similarity dendrogram (UPGMA) of 57 isolates of species of Colletotrichum infecting citrus and tree tomato based on AFLP data.
53 C. acutatum (Citrus)
Dim2 596 &
0.15
-0.47
C. acutatum (Tree tomato) -1.08
-1.70 0.25 0.153
-0.13 0.100
Dim1 Dim3 -0.52 0.046
-0.90 -0.007 C. gloeosporioides
Figure 1.9.7. Three-dimensional graph derived from multiple correspondence analysis (MCA) of 57 isolates of species of Colletotrichum infecting citrus and tree tomato based on AFLP data.
Activity 1.10. Identifying strategies for managing anthracnose (Glomerella cingulata (Anamorph Colletotrichum gloeosporioides) of soursop (Annona muricata L.), emphasizing varietal resistance
Contributors: A. Rojas Triviño, E.Álvarez, and D. Sánchez
Rationale
Anthracnose is the disease that most limits soursop production in Colombia and other countries. Incidence and losses can be 100% (Oliveros 2000, Recopilación bibliográfica de seis especies de frutales tropicales: lulo, mora, uchuva, pitaya, guanábana y tomate de árbol. CIAT, Cali, Colombia.), depending on agroecological conditions, crop management, and planting material. The disease is favored by inadequate cultural management practices. To successfully manage the disease, we must identify genetic resistance in soursop and understand the disease’s epidemiology. Activities towards these ends would include determining markers for pathogenicity and the pathogen’s genetic variability, and genetically characterizing different soursop clones selected for their desirable agronomic traits and good performance in production zones.
54 Materials and Methods
Collecting plant materials: Sampling of plant materials infected with anthracnose was carried out in the Departments of Valle del Cauca, Cauca, Huila, Tolima, Meta, Santander del Sur, Norte de Santander, Quindío, Caldas, Córdoba, and Sucre. Samples were taken from established crops and individual trees in which symptoms appeared in leaves, branches, stems, flowers, and/or fruits. Each sample was identified according to a format for noting information on origin, conditions, and observations.
Isolating, identifying, and storing the fungus: Colletotrichum isolates were obtained according to the direct method for isolating plant pathogenic microorganisms (Castaño-Zapata 1997,Manual para el diagnóstico de hongos, bacterias, virus y nemátodos fitopatógenos. Universidad de Caldas, Colombia), but with some modifications. Observations were then made, using a compound light microscope and examining for presumed fungal growth such as types of colony growth and the presence of acervuli, cirri, and spore types. The fungus was then purified on PDA agar, and monosporic cultures later prepared on 2% water agar. The monosporic cultures thus obtained were stored at 4º and -20ºC on Whatman No. 1 filter paper colonized by the fungus (Aricapa and Correa, 1994. ASCOLFI Inf 20(3): 29–30.).
Morphological characterization of Colletotrichum isolates: One objective of morphological characterization is to determine the macroscopic variability of the fungus such as color and type of colony growth, cirrus color, length of conidia, presence of microsclerotia, and other parameters such as speed of growth, presence of the teleomorph stage, and length of asci and ascospores.
Molecular characterization of Colletotrichum isolates: To extract the maximum amount of DNA from each Colletotrichum isolate, we followed the methodology reported by Mahuku (Mahuku, 2004. Plant Molecular Biology Reporter 22: 71-81 ). We made some modifications such as adding 1.5 L of proteinase K of 10 mg/mL, adding an equal volume of cold isopropanol to the supernatant obtained by adding chloroform and isoamyl at a ratio of 24:1, and washing twice with ethanol at 70%.
Amplifying the ITS region. To identify the species of each isolate, we used the following primers to amplify the internal transcribed spacer region (ITS) of rDNA: those specific to Colletotrichum gloeosporioides (CgInt) and C. acutatum (CaInt2) (Brown et al. 1996); and Col1 for the related C. graminicola and C. dematium that had not amplified with the first two primers (Afanador- Kafuri et al. 2003.Phytopathology 93:579 – 587). These primers were coupled with the primer ITS4 (White et al. 1990. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In: Innis MA; Gelfand DH; Sninsky JJ, eds. PCR protocols: a guide to methods and applications. Academic Press, San Diego, CA, USA. pp 315–322.). Table 1.10.1 presents the primers used and their corresponding sequences.
55 Table 1.10.1. Primers used in PCR analysis for amplifying specific fungal taxa. Primer Sequence 5′-3′ CaInt2a GGGGAAGCCTCTCGCGG CgInta GGCCTCCCGCCTCCGGGCGG Col1b GCCGTCCCCTGAAAAG ITS4c TCCTCCGCTTATTGATATGC a. Brown et al. (1996). b. Afanador-Kafuri et al. (2003). c. White et al. (1990).
To visualize the amplified products for their later analysis, they were separated on agarose gel with ethidium bromide at 1.0 mg/mL and adding buffer 10X TBE to a final concentration of 0.5X. A marker with a molecular weight of 100 bp was included, together with positive controls (C. gloeosporioides and C. acutatum) and a negative control composed of a PCR cocktail (Álvarez et al., 2005, Fitopatología Colombiana 28: 1-8.).
Amplifying RAM microsatellites at random: To determine the genetic variability existing among the isolates belonging to the same Colletotrichum species (previously determined by amplification of the ITS region), we used the technique of random amplification of microsatellites (RAMs), based on the polymerase chain reaction (PCR) (Hantula et al., 1996. Eur J Forest Pathol 26:159–166.).
A B
Figure 1.10.1. Inoculating soursop trees of cv. Elita. (A) Wounding method. (B) Spraying method.
56 Pathogenic characterization of Colletotrichum isolates: To evaluate the pathogenicity of Colletotrichum isolates, we are currently conducting tests in the greenhouse, artificially inoculating plants of cv. Elita to select the most pathogenic isolates belonging to different RAM groups.
Preparing Colletotrichum inoculum: Each isolate conserved on filter paper was planted on AA+E basal medium (Silveira et al. 2004. Sci Agric Piracicaba Brazil 61:542–544) and incubated in an inverted box at 28oC for 15 days under 24 h of light. Alternatively, isolates of Colletotrichum spp. were propagated on Marthur’s agar medium (0.1% yeast extract, 0.1% Bacto™ Peptone, 1% sucrose, 0.25% MgSO4 7H2O, 0.27% KH2PO4, 1.2% agar supplemented with 25 mg ampicillin in 1 L sterilized distilled water). With this medium, the fungus produced considerable sporulation (Freeman et al., 1996. Appl Environ Microbiol 62(3): 101–1020.).
After incubation, a suspension of spores was prepared, directly adding 10 mL of sterilized distilled water over the growing organisms in the Petri dish. This initial suspension was collected in 50-mL sterilized BD Falcon™ tubes, filtering with sterilized gauze to eliminate mycelia and fragments of medium. The suspension was then adjusted to a concentration of 1 × 107 spores/mL, using a hemacytometer (Reichert, Buffalo, NY, USA). Finally, Inex-A (COSMOAGRO S.A., Colombia) was added to disperse spores at a final concentration of 0.5%.
Preparing plants for inoculation: All the plants (including the checks) to be used in the experiment were cleaned of old leaves and any pests present on the stems and branches by rubbing down with gauze. To create microscopic wounds, the upper surfaces of healthy young leaves were then rubbed down with sterilized gauze impregnated with Carborundum®.
Inoculating the plants: On completing the treatment mentioned above, each isolate was inoculated on three plants, each constituting a replication, as follows (Figure 1.10.1):
• Method of woundin: Small rectangular cuts were made on stems with sterilized scalpels and 6-mm discs of isolate were placed in them. The isolate discs were taken from the center of the colony developed on PDA+E basal medium. Cuts were made on three parts of the stem, spaced at 10 cm, starting from the tree’s canopy and finishing at its base, while ensuring that their locations were above the grafting point and in young tissues. Once completed, the inoculations were covered with Parafilm®.
• Spraying method: A suspension of 1 × 107 spores/mL of the fungus was used to spray the stem, apex, and youngest leaves (i.e., the first six leaves next to the apex). We used a vacuum pump and a DeVilbiss® sprayer.
As control, three plants of the same cultivar were used, except that their wounds were not inoculated with fungus and they were sprayed with sterilized distilled water.
Incubating the inoculated plants: The inoculated plants were taken to a humidity chamber, and each replication placed at random in three separate blocks, ensuring that they were not in contact. They were left for 72 h at a relative humidity of 90%–95% and an average temperature of 27o– 29oC. The plants were then taken to a greenhouse with an average temperature of 27o–29oC and wetting for 1 min every hour for 17 days.
57 Designing the severity scale and diagrams to evaluate anthracnose on leaves and branches of artificially inoculated soursop: The scale was designed according to percent values corresponding to 1, 5, 10, 25, and 50% (represented by grades 1, 3, 5, 7, and 9). Once the severity scale was established, and to conduct the evaluation in the greenhouse, we prepared severity diagrams corresponding to each established value.
First, we determined the types of lesions most frequently observed on leaves and branches in the field, and then we examined symptom development in the same tissues inoculated in vitro.
Once we ascertained the typical symptoms of anthracnose on leaves and branches of soursop we designed the diagrams to show the typical symptoms at different levels of severity. Each diagram was digitalized in an Epson Expression 1680 scanner, on a scale of grays, with a resolution of 300 dpi and stored in the TIFF format. The stored diagrams were interpreted with the WinRHIZO™ image analysis system (Regent Instruments, Inc., Quebec, Canada). With the values obtained on the infected area as interpreted by the system (black area = healthy tissue; white area = infected tissue), we selected diagrams that adjusted to the scale, ending up with three patterns of symptom development on leaves and one pattern for branches.
Evaluating the disease: To evaluate the disease, a scale was designed that took into account the presence of lesions on stems (considered by producers as the most serious symptom and as causing the most damage to the trees) and leaves. Evaluations began after 72 h of continuous wetting. The second and third evaluations were made on Days 10 and 20, starting from the first reading.
Evaluating germplasm in the greenhouse: Characterizing the pathogenicity of the Colletotrichum isolates and the RAM analysis, which permitted the formation of genetic groups, allowed us to select, at least one pathogenic isolate from each group and at least one isolate that was minimally pathogenic to cv. Elita. Thus, we could evaluate 20 accessions of soursop with participation of farmers (Table 1.10.2). The evaluations of disease’s progress were conducted at equal intervals of time, using the same scale designed to characterize the pathogenicity of the Colletotrichum isolates.
Table 1.10.2. Soursop (Annona muricata L.) accessions evaluated for anthracnose. Accession name Accession name Accession name Accession name San Francisco Rojas 1 Cítrica 1 Cítrica 6 Joya 1 Rojas 2 Cítrica 2 Cítrica 7 Joya 2 Cs1 Cítrica 3 Cítrica 8 Joya 3 Cs2 Cítrica 4 Cítrica 9 Costa Rica Cs3 Cítrica 5 Cs4
Molecular evaluation of the germplasm
To conduct a molecular characterization of the 20 accessions, we extracted DNA from each accession, using the random amplification of microsatellites or RAM technique, and electrophoresis of single-stranded conformational polymorphisms (SSCPs). The primers (synthesized by Technologies, Inc.) used to amplify the DNA extracted from soursop (Table 1.10.3) had been reported as polymorphic in assessments of plant and animal diversity
58 (Piedrahita et al. 2005. Biotecnol Sect Agropecu Agroind 3:16–26.; Oslinger 2003. Caracterización molecular de cerdos criollos colombianos mediante la técnica molecular RAMs. BSc thesis in Zootechny. Universidad Nacional de Colombia, Palmira, Colombia; Alvarez et al., 2005. Fitopatología Colombiana Vol. 28 (1): 1-8.; Morillo et al. 2005. Acta Agronómica 54 (2): 15-24; Espinosa et al. 2005. Colección y caracterización molecular con marcadores tipo RAMs (microsatélites aleatorios de heliconias y especies relacionadas). In Proc. IX Congress of the Asociación Colombiana de Fitomejoramiento y Producción de Cultivos, held in Palmira, 11–13 May 2005. CORPOICA, Palmira, Colombia. p. 118. ; Arcos et al., 2005. Colección, caracterización fenotípica y molecular de poblaciones de uchuva Physalis peruviana. In Proc. IX Congress of the Asociación Colombiana de Fitomejoramiento y Producción de Cultivos, held in Palmira, 11–13 May 2005. CORPOICA, Palmira, Colombia. p. 103; Sanabria et al. 2006. Acta Agron 55 (1): 23-30).
Table 1.10.3. RAM primers and nucleotide sequences. Condensed sequence RAM primer (5′ to 3′) Sequence (5′ to 3′) TG HVH (TG)7T 5′ HVH TGT GTG TGT GTG TGT 3′ CGA DHB(CGA)5 5′ DHB CGA CGA CGA CGA CGA 3′ CT DYD(CT)7C 5′ DYD CTC TCT CTC TCT CTC 3′ CA DBDA (CA)7 5′ DBD ACA CAC ACA CAC ACA 3′ GT VHV (GT)7G 5′ VHV GTG TGT GTG TGT GTG 3′ AG HBH (AG)7A 5′ HBH AGA GAG AGA GAG AGA 3′ CCA DDB (CCA)5 5′ DDB CCA CCA CCA CCA CCA 3′ ACA BDB (ACA)5 5′ BDB ACA ACA ACA ACA ACA 3′ Source: Hantula et al., 1996. Eur J Forest Pathol 26:159–166.
Results and Discussion
Collecting plant materials. In forming the bank of Colletotrichum strains, we collected and processed 93 samples of soursop from Valle del Cauca, Cauca, Huila, Tolima, Meta, Santander del Sur, Norte de Santander, Quindío, Caldas, Córdoba, and Sucre. We obtained 80 isolates from trees infected with the disease and conserved them for use in the trials (Table 1.10. 4).
Table 1.10.4. Sites (departments and municipalities) and number of Colletotrichum isolates collected from soursop with symptoms of anthracnose. Department Municipalities sampled Isolates (no.) Valle del Cauca Palmira, Pradera, Tulúa, Cali, Toro, El Cerrito, Buga 41 Cauca Caldono 1 Huila Yaguará, Palermo 6 Tolima Melgar 4 Meta Villavicencio 4 Santander del Sur Cimitarra 1 Norte de Santander Bochalema 4 Quindío Armenia, Montenegro 4 Caldas Supía 4 Córdoba Chinú 1 Sucre Corozal, Sampués, Sincelejo 10 Total 80
59 Morphological characterization of Colletotrichum isolate: Most of the initial isolates were Colletotrichum spp., except for isolate GM61-L01, which came from Norte de Santander and had been sampled from leaves. Under microscopic observation, Glomerella spp. were determined as being present and lesions were atypical for anthracnose. Instead, lesions appeared as black spots (perithecia) on the main vein near the peduncle, the fungus having developed its asexual stage on culture medium. The sexual stage was also observed on culture medium for isolates GM57 and GM26 from Valle del Cauca and for which samples obtained were initially of Colletotrichum spp.
Molecular characterization of Colletotrichum isolates, amplifying the ITS region: With these amplifications, we sought to determine the presence of one unique genus by observing the typical electrophoretic patterns of the Colletotrichum genus (Figure 1.10.2).
Figure 1.10.2. Electrophoretic profiles of DNA from 55 isolates of Colletotrichum spp., obtained from amplifying the ITS region, using primers ITS1 and ITS4. Lane M = marker with a molecular weight of 100 bp; positive control = C. lindemuthianum; negative control = PCR cocktail; check = Phaeoisariopsis griseola. The lanes identified as T, Gr, and Ca constitute Colletotrichum isolates from tea, granadilla, and cacao, respectively.
60 We partly determined the hybridization temperatures at which the primers in the PCR reaction would amplify the ITS region, coupling ITS4 primers with the specific primers CaInt2, CgInt, and Col1 to identify the species. With primers CgInt and Col1, we obtained the best results for hybridization at 60ºC, even though hybridization was more specific at this temperature for primer Col1 (Figure 1.10.3) and at 62ºC for CgInt (Figure 1.10.4).
Figure 1.10.3. Electrophoretic profiles of DNA from 55 isolates of Colletotrichum spp., obtained by amplifying the ITS4 region + Col1 at a hybridization temperature of 60ºC. Lane M = marker with a molecular weight of 100 bp; positive control = C. lindemuthianum; negative control = PCR cocktail; check = Phaeoisariopsis griseola. The lanes identified as T, Gr, and Ca constitute isolates of Colletotrichum spp. from tea, granadilla, and cacao, respectively.
61 Figure 1.10.4. Electrophoretic profiles of DNA from 55 isolates of Colletotrichum spp., obtained by amplifying the ITS4 region + CgInt at a hybridization temperature of 62ºC. Lane M = marker with molecular weight of 100 bp; positive control = C. lindemuthianum; negative control = PCR cocktail; check = Phaeoisariopsis griseola. The lanes identified as T, Gr, and Ca constitute isolates of Colletotrichum spp. from tea, granadilla, and cacao, respectively. The partial results obtained with primer CaInt2 are presumed to indicate the absence of C. acutatum as none of the isolates so far evaluated had amplified with the primer specific to this species (Figure 1.10.5).
Figure 1.10.5. Electrophoretic profiles of DNA from 55 isolates of Colletotrichum spp., obtained by amplifying the ITS4 region + CaInt2 at a hybridization temperature of 60ºC. Lane M = marker with molecular weight of 100 bp; positivecontrol = C. lindemuthianum; negative control = PCR cocktail; check = Phaeoisariopsis griseola. Lanes identified as T, Gr, and Ca constitute isolates of Colletotrichum spp. from tea, granadilla, and cacao, respectively.
62 The results so far obtained with amplifications, using three primers specific to Colletotrichum spp. are summarized in Table 1.10.5. The species so far established are C. gloeosporioides and Colletotrichum sp., as no isolate was observed to amplify for C. acutatum.
Table 1.10.5. Prior identification of Colletotrichum species. Primer reaction Consecutive Col1 number Sample code Department of origin CaInt2/ITS4 CgInt/ITS4 /ITS4 1 GM01-L02 Huila (-) (+d)a (+) 2 GM03 Huila (-) (+) (-) 3 GM04-L01 Huila (-) (+) (+d) 4 GM04-L02 Huila (-) (-) (-) 5 GM05 Huila (-) (-) (+) 6 GM06 Huila (-) (+d) (+) 7 GM25-L01 Valle del Cauca (-) (+) (-) 8 GM25-L02a Valle del Cauca (-) (+) (-) 9 GM25-L02b Valle del Cauca (-) (+) (-) 10 GM26 Valle del Cauca (-) (+d) (+) 11 GM27 Valle del Cauca (-) (+) (-) 12 GM28 Valle del Cauca (-) (+) (-) 13 GM29 Valle del Cauca (-) (+) (-) 14 GM30-L01 Valle del Cauca (-) (+) (-) 19 GM35-L01 Valle del Cauca (-) (+) (-) 20 GM35-L02 Valle del Cauca (-) (+) (-) 21 GM36-L02 Valle del Cauca (-) (+) (-) 22 GM37 Valle del Cauca (-) (+) (-) 23 GM38a Valle del Cauca (-) (+d) (-) 24 GM38b Valle del Cauca (-) (+) (-) 25 GM39-L02 Valle del Cauca (-) (+) (-) 26 GM40 Valle del Cauca (-) (+d) (+) 27 GM41 Valle del Cauca (-) (+) (-) 28 GM42 Valle del Cauca (-) (+) (-) 29 GM44-L01 Quindío (-) (+d) (+) 30 GM49-L01 Valle del Cauca (-) (+) (-) 31 GM49-L02 Valle del Cauca (-) (+) (-) 33 GM52- L01 Valle del Cauca (-) (-) (+) 34 GM52- L02 Valle del Cauca (-) (+) (-) 35 GM52- L03 Valle del Cauca (-) (+) (-) 38 GM57 Valle del Cauca (-) (+) (+) 39 GM58-L02 Valle del Cauca (-) (+d) (+) 40 GM59a Norte de Santander (-) (-) (-) 41 GM59b Norte de Santander (-) (+d) (+) 42 GM60-L01 Valle del Cauca (-) (+d) (+) 43 GM61-L01 Norte de Santander (-) (+d) (+) 44 GM61-L02 Norte de Santander (-) (+) (-) 45 GM62-L01 Valle del Cauca (-) (+) (-) 47 GM62-L03 Valle del Cauca (-) (+) (-) 48 GM63 Cauca (-) (-) (+) 49 GM64-L02 Valle del Cauca (-) (+) (-) 51 GM66-L01 Valle del Cauca (-) (+) (-) 52 GM66-L02 Valle del Cauca (-) (+) (-) 53 GM67-L01 Valle del Cauca (-) (+) (-) 54 GM67-L02 Valle del Cauca (-) (+d) (+) 56 GM68 Valle del Cauca (-) (+d) (+) 57 GM69-L01 Valle del Cauca (-) (+d) (+) 59 GM70 Valle del Cauca (-) (+) (-) 60 GM71 Tolima (-) (+d) (+) 62 GM73 Tolima (-) (+d) (+) 63 GM74 Tolima (-) (+) (-) 64 GM75 Santander del Sur (-) (+) (+) 65 GM77 Quindío (-) (-) (-) 66 GM78 Quindío (-) (+) (-) 67 GM79 Quindío (-) (+) (-) T Tea Valle del Cauca (-) (-) (+) Gr Granadilla Huila (-) (-) (-) Ca Cacao Huila (-) (+) (-) a. (+d) indicates weak positive reaction
63 Pathogenic characterization of Colletotrichum isolates: Initially, an evaluation scale was designed for soursop plants inoculated artificially by the methods described above.
Designing the severity scale and diagrams to evaluate anthracnose on artificially inoculated leaves and branches of soursop: With the scale we previously designed in grades and percentages (Table 1.10.6), we prepared severity diagrams corresponding to each value, using the previous information on the types of symptoms that develop on branches, stems, and leaves.
Table 1.10.6. Severity scale to evaluate anthracnose on leaves and branches of soursop. Grade Severity (%) 1 1 3 5 5 10 7 25 9 50
Finally, we determined three patterns of symptom development on leaves and one pattern for stems and branches (Figure 1.10.6).
Figure 1.10.6. Severity scale (at right) and diagrams for evaluating anthracnose on leaves and branches of soursop. White areas indicate infected areas
Evaluating the disease on plants of cv. Elita. We conducted the respective evaluations with the isolates inoculated on soursop cv. Elita. With the values obtained, we calculated the rates of development (r) for each treatment (Table 1.10.4) and conducted curves of disease development. We observed differences in disease progress occasioned by each isolate and by the rate at which each progressed over time.
64 Table 1.10.4. Rates of development of anthracnose in soursop according to Colletotrichum isolate. Isolate Origin r (units per day) GM01-L02 Huila 0.12 GM03 Huila 0.12 GM04-L01 Huila 0.01 GM04-L02 Huila 0.06 GM05 Huila 0.04 GM59a Norte de Santander 0.04 GM59b Norte de Santander 0.06 GM63 Cauca 0.04 GM68 Valle del Cauca 0.15 GM89-L01 Sucre 0.02 GM89-L02 Sucre 0.13 GM90-L01 Sucre 0.10 GM90-L02 Sucre 0.09 GM91-L01a Sucre 0.05 GM91-L01b Sucre 0.15 GM91-L02 Sucre 0.21 GM92a Sucre 0.25 GM92b Sucre 0.08 GM93 Sucre 0.08 GM94 Córdoba 0.06
Isolates GM91-L02 and GM92a presented the highest rates of development (0.21 and 0.25 units per day, respectively). That is, these two isolates showed more progress than the others evaluated, which fluctuated between 0.01 and 0.15 units per day (Figures 1.10.7 and 1.10.8 and 1.10.9). These latter isolates were therefore less virulent.
Figure 1.10.7. Progress curves of soursop anthracnose in cv. Elita inoculated with eight different isolates of Colletotrichum spp.
65 Figure 1.10.8. Progress curves of soursop anthracnose in cv. Elita inoculated with seven different isolates of Colletotrichum spp.
Figure 1.10.9. Progress curves of soursop anthracnose in cv. Elita inoculated with five different isolates of Colletotrichum spp.
Acknowledgment to Myriam Sanchez, Corporación BIOTEC.
66 Activity 1.11. Molecular and pathogenic characterization of isolates of Colletotrichum spp. associated with anthracnose of Andean blackberry on accessions from Valle del Cauca
Contributors:E. Álvarez, A. Arenas, and J. F. Mejía
Highlight:
Anthracnose of Andean blackberry crops evaluated in the Department of Valle del Cauca, Colombia, is caused by Colletotrichum.
Rationale
Anthracnose is an economically important disease that affects stems of 50% to 70% of Andean blackberry crops grown in Colombia (Tamayo, 2003, Boletín Técnico 20. CORPOICA–Regional 4, Rionegro, Department of Antioquia, Colombia. 40 pp). Incidence may even be as high as 100% in some crops (UNISARC and SENA 2006). Moreover, control of the disease is inefficient, despite the use of chemical products and cultural practices (Saldarriaga 2005. MSc Thesis. Faculty of Agricultural Sciences, Universidad de Caldas, Manizales, Colombia. 192 pp). Tools are needed to generate technological alternatives that will contribute to the integrated management of the disease ((Saldarriaga 2005. MSc Thesis. Faculty of Agricultural Sciences, Universidad de Caldas, Manizales, Colombia. 192 pp) This study assesses molecular characterization as a means of identifying pathogen species, and relating their variability and population composition to aspects of pathogenicity.
Materials and Methods
Sampling sites: Field sampling was conducted in 15 village districts and 29 farms of 10 municipalities of the Department of Valle del Cauca: Buga, Tuluá, Ginebra, Palmira, Cerrito, Bolívar, Guacarí, Trujillo, Jamundí, and Dagua (Figure 1.11.1). For most of the municipalities at least two farms were visited.
67 Figure 1.11.1 Location of sampling sites in Valle del Cauca, Colombia. Samples of Andean blackberry (Rubus glaucus), infected by Colletotrichum spp., were obtained according to coordinated geographic planes, using the program DivA-GIS (a geographic information system). This is a preliminary analysis of the location of points, as the exact locations of some sampled populations are yet to be refined.
Sampling: We collected 143 samples of tissues of Andean blackberry (Table 1.11.1), principally from young semi-woody stems, but also from fruit and petioles. Although most tissues showed symptoms of anthracnose, healthy ones were also sampled. We used pruning secateurs that were previously disinfected with hypochlorite at 2.5%. For each plant, 3 to 5 stakes (15 cm long) were placed inside a paper bag that was duly labeled. In the field, we also collected crop data on, or example, management, incidence, other phytosanitary problems, and geo-referencing (GPS). The samples were conserved in a cold room at 4°C until processing.
Monosporic culturing and storage: The samples were left to sporulate and morphologically identified as Colletotrichum spp. Then, for each sample, an aqueous suspension of spores was prepared with 500 mL of sterilized distilled water and placed in microcentrifugation tubes. Four drops were taken and added to a petri dish containing agar medium and water (18 g/L). About 15 h later, germinated spores were transferred, with the help of a dissection needle, to a petri dish containing PDA medium acidified with lactic acid at 25% to stimulate the development of individual colonies. The monosporic cultures were then stored on squares of filter paper previously colonized and dried.
68 Table 1.11.1. Samples of Andean blackberry collected mostly from stems, Department of Valle del Cauca, Colombia. Farms Collected Municipality Village district (no.) samples (no.) Name and number of clones collected Ginebra Portugal, Costa 3 18 Hartona Blanca (1), Hartona (2), Ranchona (2), Rica Castilla (11), Zarzona Amarilla (1), Silvestre (1) Palmira Arenillo 2 18 Hartona (9), Castilla (9) Dagua Jordán 1 17 Regional (17) Buga Miraflores 4 24 Castilla (3), Hartona (20), Regional (1) Unión Guacari La Magdalena 2 21 Hartona (2), Ranchona (2), Castilla (17) Tulua La Mansión, 4 10 Castilla (2), Hartona Negra (6), Hartona Mona (2) Piedritas Bolivar Cerro Azul, 3 7 Ecuatoriana (1), Ranchera (1), Ranchona (2), Buena Vista Hartona Negra (3) Trujillo La Siria, 6 10 Hartona Negra (6), San Antonio (1), Castilla (3) Chuscales Cerrito Regaderos 2 7 Castilla (7) Jamundí Nueva Aventura 2 11 Castilla (11)
DNA extraction: DNA was extracted from monosporic isolates, following Mahuku’s protocol (2004), with modifications by Álvarez (2005). The method involved inactivating proteins, using SDS/proteinase K, and precipitating polysaccharides in the presence of a high concentration of salts (Mahuku, 2004. Plant Molecular Biology Reporter 22: 71-81.) The quality of DNA was determined in agarose gel at 0.8% and quantified through fluorometry (Hoefer DyNA Quant™ 200 Fluorometer).
Amplifying the ITS region: To identify species from the Colletotrichum genus, we used the ITS4 universal primer in combination with primers specific to C. acutatum (CaInt2), C. gloeosporioides (CgInt), and Colletotrichum spp. (Col1) (Afanador et al. 2003 Phytopathology 93(5):579–587).
For each PCR reaction, we used 10X Taq buffer at a concentration of 1X M/µL (100 mM Tris-HCl, pH 8; 2.5 mM MgCl2; and 500 mM KCl), 0.2 mM of each of the dNTPs, 0.5 µM of each primer, 1.5 mM MgCl2, 2 ng/µL of DNA, HPLC water (0.22 µm), and 0.1 U/µL of Taq polymerase (Bioloine). The amplification protocol for the DNA was carried out in a PTC–100 thermal cycler (MJ Research, Inc., Watertown, MA, USA). Initial denaturation was at 95oC for 5 min; one denaturation per cycle at 95oC for 30 s; annealing at 55ºC for 30 s for Col1; and extension at 72oC for 90 s, with a total of 40 cycles of amplification from step 2. The final extension was at 72oC for 4 min, finishing at 4oC for 30 min.
Because bands were not specific at the temperature suggested in Álvarez’s PCR protocol (2005), temperatures for hybridization were tested at 55ºC, 60ºC, 62ºC, 64ºC, 65ºC, and 68ºC for primers CaInt2 and CgInt. Visualization of the bands was carried out on an agarose gel at 1.2%, with an electrophoretic current of 90 volts.
The 5.8S-ITS region of the rDNA was amplified, using the universal primers ITS1 and ITS4 (Álvarez 2005 Fitopatol Colomb 28:1–8.). The cocktail for the PCR was prepared with concentrations and quantities equal to those for the specific primers. Amplification was
69 programmed with an initial denaturation at 94oC for 2 min, one denaturation per cycle at 94oC for 30 s, hybridization at 55oC for 30 s, and extension at 72oC for 120 s, making a total of 40 cycles of amplification. The final extension was at 72oC for 240 s, finishing at 4oC for 30 min.
SSCP and electrophoresis in polyacrylamide gel: To find single-stranded conformational polymorphisms (SSCP) that would permit rapid identification of Colletotrichum species, we mixed 2 µL of individual PCR product with 8 µL denaturing buffer (formamide at 95%, 20 mM EDTA, 0.05% bromophenol blue, and 0.05% xylene cyanol blue). The mixture was then centrifuged at a low pulse, heated in the thermal cycler at 96ºC for 10 min, and finally conserved on ice for 15 min. The mixture was placed in a Mini-PROTEAN 3-Cell chamber (Bio-Rad Laboratories, Hercules, CA, USA) with 1X TBE buffer (89 mM Tris-borate and 2 mM EDTA, pH 8.0), and on a non-denaturing mini-gel with proportions of acrylamide to bis-acrylamide of 29:1 at 8%. Of the mixture, 10 µL were taken and the samples were run for 6 h at 15 mA (150– 200 V). We included 3 µL of a marker with a molecular weight of 1 kb (Invitrogen, CA, USA) in the extreme right and left lanes of the gel to facilitate comparisons with SSCP patterns (Kong et al. 2004. Appl Microbiol 38:433–439). Later, the bands were visualized with ethidium bromide (1 mg/mL of final concentration) for 5 min and any excess washed off in a tray of water for 10 min.
Results and Discussion
From the field samplings and cultures, we obtained 83 monosporic isolates of Colletotrichum spp. stored on filter paper. Two species in particular were found to associate with stem tissue; these were C. acutatum and C. gloeosporioides. When these were further analyzed with the specific primers CaInt2 and CgInt, C. acutatum appeared to be the more frequent (62%) species than C. gloeosporioides (38%).
By standardizing the PCR protocol to amplify the ITS region, we determined that the hybridization temperatures adequate for the specificity of bands were 64ºC and 65ºC for primers CaInt2 and CgInt, respectively. This study attempted to genotype 50 isolates, of which 40 were evaluated with the specific primers CaInt2, CgInt, and Col1 (Figure 1.11.2). We found that 21 isolates amplified for C. acutatum, 13 for C. gloeosporioides, none for Col1, and 6 did not amplify for any primer. Because these last isolates did not amplify, we analyzed them with primer Col1, varying the hybridization temperature.
70 M 1 2 3 4 5 6 7 8 9 10 11 12 13 14 (-) M
CaInt2
CgInt
Figure 1.11.2. Isolates of Colletotrichum species were amplified with the specific primers CaInt2 and CgInt, and visualized on agarose gel at 1.2%. Lane M = marker with a molecular weight of 100 bp; lane 1 = 20t V; lane 2 = 23f V; lane 3 = 23t V; lane 4 = 26 V; lane 5 = 28 V; lane 6 = 66 V; lane 7 = 81 V; lane 8 = 89 V; lane 9 = 35 V; lane 10 = 46C1 V; lane 11 = 46C2 V; lane 12 = 50 V; lane 13 = 51 V; lane 14 = 59V; lane 15 = negative control.
Currently, an analysis of single-stranded conformational polymorphisms (SSCP; Figure 1.11.3) is being carried out and the samples evaluated have presented an apparent correlation with the amplification of the specific primers. Figure 1 shows that the pattern for C. lindemuthianum is different to the others, presenting a double band and below it, the fastest migration, thus indicating a different conformation. Colletotrichum acutatum presents a double band and a one band above that of C. lindemuthianum and one band below that of C. gloeosporioides. This last fungus presented only one band, and the band with the slowest migration. Accordingly, we determined that the six samples analyzed had the same pattern as C. gloeosporioides—a result that is coherent with the analysis on the specific primers.
71 Figure 1.11.3. Electrophoresis of SSCP from Colletotrichum spp. on polyacrylamide gel. Lanes 1–6 = six isolates that amplified for C. gloeosporioides with the specific primers; lane 7 = C. gloeosporioides; lane 8 = C. acutatum; lane 9 = C. lindemuthianum; lane M = ladder with a molecular weight of 1 kb.
Conclusions
We consider that anthracnose of stems of Andean blackberry is caused mainly by C. acutatum. However, even though it is the major causal agent, it also appears to be part of a complex of Colletotrichum species attacking Andean blackberry. This hypothesis needs to be confirmed through further research.
Because the isolates have so far shown consistency with the genotyping, we believe SSCP analysis of the ITS region is probably an effective tool for identifying a Colletotrichum species. Again, further research is needed to confirm this finding.
Activity 1.12. Anthracnose of Andean blackberry (Rubus glaucus Benth.): variability in species and races of the causal agent and identification of sources of resistance to the disease
Contributors: L. Afanador Kafuri, E. Álvarez, and A. González
Rationale
Anthracnose is found in all regions producing Andean blackberry in Colombia, with incidence ranging between 50% and 73%. Given the importance of this disease in the crop’s principal production regions in the country, we need to initiate studies oriented towards a better understanding of its causal agents, and of the germplasm’s performance in the presence of pathogen populations. These aspects are indispensable for planning suitable strategies to manage and control the disease in the crop’s production regions. The correct and timely identification of the agents responsible for anthracnose of Andean blackberry and of the variability of their populations is indispensable for better understanding the epidemiology of this disease. Such
72 understanding constitutes the basis on which to develop genetic improvement programs for this species.
Materials and Methods
Collecting germplasm of Andean blackberry and Colletotrichum strains: The collection of Colletotrichum strains and germplasm of Andean blackberry was carried out in 29 municipalities of the Departments of Antioquia, Caldas, Cundinamarca, Huila, Quindío, Risaralda, Santander, and Valle del Cauca (Table 1.12.1). In each municipality, four farms were visited and, from each farm, four samples were taken of stems, branches, and/or fruits with typical symptoms of anthracnose.
Multiplying germplasm: The collected germplasm was propagated through germinated microstakes as described by Molina (Molina,1998. Microestacas pregerminadas, una nueva alternative de propagación de mora. Paper presented at the 2nd seminar on Frutales de Clima Frío Moderado,held at the Centro de Desarrollo Tecnológico de Frutales, Manizales, Colombia, August 12–14). This method consisted of first treating with carbendazim (5 g/L) or benomyl (0.5 g/L) for 5 min, and then treating with Hormonagro® in powder, ensuring the tissues were in contact with the product. The treated stakes were planted at an angle in trays containing sterilized sand. With this methodology, the stakes germinated in 25 to 30 days. We also evaluated in vitro propagation from cauline buds, using 4E culture medium (Roca et al., 1984. Procedures for recovering cassava clones distributed in vitro. CIAT, Cali, Colombia. 8 pp).
Table 1. 12.1. Germplasm of Rubus spp. collected from study areas in Colombia. Source Ecotype Entries (no.) Greenhouse In vitro Antioquia Germplasm bank 38 2 10 (CORPOICA) Caldas Castilla 2 2 0 Cundinamarca Castilla (sexual seed) 4 3 0 Huila Castilla 2 1 0 Quindío Sin Tuna, Castilla 3 1 2 Santander Castilla, wild blackberry, wild 8 5 0 raspberry Valle del Cauca Ecuatoriana, Castilla, Bejucuda, 20 14 2 Ranchona, Sin Tuna Nariño Castilla 2 2 Total 79 30 14
Isolating, identifying, and storing the fungus: Monoconidial isolates of the fungus were developed on PDA medium. The fungal colonies were identified, in a preliminary way, through microscopic observation (400X) of the reproductive structures such as acervuli, spore masses, presence or absence of the sexual stage, and presence or absence of setae; and the study of growth characteristics of the colonies on the culture medium. The cultures were stored at 4ºC on squares of filter paper colonized by the fungus’ mycelia and spores.
Evaluating inoculation methods: We first evaluated a method of inoculating leaves, fruits, and stems removed from Andean blackberry. To inoculate the stems, we followed the methodology described by Stewart et al. (Stewart et al., 2003. Horticultural Studies 2003, AAES Research
73 Series 520: 32-34), which consisted of cutting portions of stems 20 cm long and 1 cm wide. The two extremes were sealed with paraffin and then the surfaces disinfected. An incision was then made in the central part of the stem, removing the external layer of tissue. A block of agar with mycelia from the fungus was placed on the incision and then sealed to prevent dehydration.
For inoculum we used a monoconidial isolate of the fungus that had 12 days’ growth on PDA culture medium. As control, we used stems that were each inoculated with a block of water-agar with no fungus.
To inoculate leaves, we applied, on each side of the main leaf vein, 20-μL drops from an aqueous suspension of fungal spores, adjusted to a concentration of 1 × 106 spores/mL. Fruits were inoculated by adding to the center of each fruit one drop of the same suspension. Incubation was carried out under the same conditions as for the stems.
The inoculated tissues (stems, leaves, and fruits) were incubated at 22ºC, under 12 h of light and 12 h of darkness, in transparent plastic boxes with lids, and a plastic grid and film of sterilized distilled water on the bottom. Evaluation of each tissue’s reaction to the fungus began 2 days after inoculation and continued over 15 days.
Results and Discussion
Collecting blackberry germplasm and Colletotrichum strains: The fungus and Andean blackberry germplasm were collected in 10 departments, obtaining a total of 315 samples of tissues infected by anthracnose and 79 accessions of Rubus spp. Of these, 30 (38%) were established in the greenhouse, and 14 (18%) under in vitro conditions (Tables 1.12.1 and 1.12.2).
Table 1.12.2. Departments and municipalities in which sampling for anthracnose in Andean blackberry was conducted, together with a collection of Rubus germplasm. Village Department Municipalities districts Farms Ecotypes Antioquia 4 8 25 25 Caldas 1 1 1 1 Cauca 1 1 1 1 Cundinamarca 3 9 21 3 Huila 2 4 4 3 Nariño 2 2 3 – Quindío 2 2 4 3 Risaralda 2 4 6 2 Santander 4 9 21 3 Valle del Cauca 10 12 20 11
The propagation by stake system was not very effective as a high rate of plants died when transplanted to sacks. An in vitro propagation system was identified, together with a culture medium for growing the explants and developing the plantlets.
We isolated 232 strains of Colletotrichum spp., as well as other types of fungi such as Botrytis cinerea, Alternaria sp., Phomopsis sp., Mycosphaerella sp., Rosellinia sp., Kuehneola loeseneriana (rust), and two types of viruses (a potyvirus and CMV (Table 1.12.3).
74 Table 1.12.3. Monosporic isolates of Colletotrichum spp. collected in the Departments of Antioquia, Caldas, Cauca, Cundinamarca, Huila,Nariño, Quindío, Risaralda, and Santander, Colombia. Date Total no. of Sexual Source collected Ecotypes Symptoms isolates phase ANTIOQUIA 2003 2004 Pantanillo, Black fruit, 66 No Santa Elena, 2005 San Antonio, apical necrosis, Guarne, Bogotana, mummified La Ceja, San Rafael, Francesa, fruit Rionegro Guarne, Pantanillo, Germplasm bank at CORPOICA–La Selva CALDAS 2004 Not identified Black fruit 1 No Municipio Neira, Vereda La Mesa CAUCA 2006 Castilla Not identified 1 No Corinto CUNDINAMARCA 2006 Castilla, Black fruit, pale 46 Yes San Bernardo, hybrid stems, apical Arbeláez, necrosis Gachetá HUILA 2006 Regional, Castilla, Black fruit 22 No La Plata, Santana San José Isnos. NARIÑO 2006 Not identified Black fruit, 4 No San Pedro, mummified Cartago, fruit La Unión QUINDIO 2006 Castilla, Black fruit, pale 7 No Salento, San Antonio stems, apical Buenavista necrosis RISARALDA 2006 Sin Tuna, Castilla Black fruit, 11 Yes Santa Rosa, apical necrosis Desquebradas SANTANDER 2006 Castilla, Churca Black fruit, pale 74 Yes Piedecuesta, stems, apical Santa Bárbara, necrosis Charta, Floridablanca
Each isolate was given a preliminary morphological characterization, based on colony characteristics, morphological variants, and the presence or absence of the fungus’s sexual phase Figure 1.12.1).
Figure 1.12.1. Monosporic cultures of Colletotrichum spp. in which morphological variability occurs within strains (left), and the sexual phase is present (center and right).
75 Evaluating inoculation methods: In stems, the first symptoms began on Day 4 after inoculation as dark coffee-brown lesions around the site of inoculation. By Day 12, these lesions had expanded to completely cover the stem. Most present abundant sporulation of the fungus. In fruits, the first symptoms appeared on Day 5 after inoculation as depressed lesions that were dark coffee-brown in color. By day 10, the fruit was completely necrotic, and covered with mycelia of the fungus with abundant sporulation. In leaves, the first symptoms appeared on Day 9 after inoculation as necrosis of the central vein. It then expanded over most of the foliar blade (Figure 1.12.2).
Figure 1.12.2. Symptoms of anthracnose in extracted stems, leaves, and fruits of Andean blackberry. At left are leaves and fruits inoculated with aqueous suspensions of spores from Colletotrichum strain 7(1) from Valle del Cauca; at right, inoculated stems and controls.
Activity 1.13. Characterization and identification of phylotypes and sequevars of isolates of Ralstonia solanacearum obtained from plantain, banana, and Heliconia sp. in Colombia
Contributors: E. Álvarez and J. F. Mejía
Rationale
Characterization and knowledge of the genetic structure of pathogen populations have direct applications in disease management. This study therefore aimed to obtain information on the genetic diversity of a population of Ralstonia solanacearum race 2 from Colombia, causal agent of bacterial wilt, a major disease affecting crops of plantain, banana, and Heliconia sp.
Traditionally, Ralstonia solanacearum has been classified into five races according to differences in the range of hosts and into six biovars according to biochemical properties. Cook and Sequeira, 1994, Bacterial wilt: the disease and its causative agent, Pseudomonas solanacearum, 77-94), using restriction fragment length polymorphism (RFLP) analysis, showed that R. solanacearum could be classified into two divisions: 1, including biovars 3, 4, and 5, with isolates principally from Asia; and division 2, including biovars 1, 2, and N2, with isolates principally from the Americas. Other authors such as Taghavi (Taghavi et al., 1996, Int. J. Syst. Bacteriol. 46:10-15), using sequence analysis of the 16S rDNA region, also confirmed the existence of these two divisions. The sequencing of the ITS region (16S-23S rRNA gene intergenic spacer region), the polygalacturonase gene, and the endoglucanase gene also
76 corroborated the existence of these two divisions, but indicated the existence of another group of isolates originating from Indonesia (Fegan et al., 1998, Bacterial Wilt Disease, 19-33).
Poussier (Poussier et al., 2000, Syst. Appl. Microbiol. 23:479-486) conducted a phylogenetic analysis of the hrp gene region, using PCR-RFLP and complementing it with amplified fragment length polymorphism (AFLP) and sequencing of the 16S rRNA gene. They observed a new cluster of isolates from Africa—biovar 1. Phylogenetic analysis of the endoglucanase and hrpB genes confirmed the presence of this group in strains originating from Africa. Under this classification system, members of the R. solanacearum species complex can be subdivided into four phylotypes, corresponding to the four genetic groups identified via sequence analysis (phylotypes I, II, III, and IV).
The phylotype to which a strain belongs can be rapidly identified through multiplex PCR, based on sequence information from the ITS region. This PCR employs four forward primers: one specific one for each phylotype and a single reverse primer that is specific for the species. It also includes a primer pair described by Opina (Opina et al., 1997, Asia Pacific J. Mol. Biol. Biotech. 5:19-30). All were R. solanacearum. Blood disease bacterium (BDB; Pseudomonas syzygii) strains generate the 280-bp fragment that is specific to the R. solanacearum species complex (Allen et al., 2005, Bacterial Wilt Disease and the Ralstonia solanacearum Species Complex. 1- 510).
Isolates of R. solanacearum infecting Musa spp. (also known as race 2 strains) are a major menace for crops such as plantain, banana, and heliconias all over the world, including Colombia. French and Sequeira (1970, Phytopathology 70:506-512) defined five groups or ecotypes with strains of R. solanacearum race 2 that cause bacterial wilt of banana, plantain, and Heliconia sp. in Central and South America. The groups differ in virulence, where some are pathogenic to both plantain and banana (A, SFR, B, and D types) and others are pathogenic only to plantain (H). The groups also differ in transmission and aggressiveness.
Cook and Sequeira (1994, Bacterial Wilt: the disease and its causative, Pseudomonas solanacearum by molecular genetic methods, p. 77-94) then discovered, through RFLP analysis, that all strains of R. solanacearum race 2 are found in three multi-locus genotypes (MLGs), designated as MLGs 24, 25, and 28. Moreover, from this description, Allen (Allen et al., 2005, Bacterial Wilt Disease and the Ralstonia solanacearum Species Complex. 1-510) conducted a classification based on the phylogenetic analysis of sequences of the ITS region (16S-23S) and the endoglucanase gene (egl). Under this scheme, strains of R. solanacearum race 2 were classified into phylotype II, sequevars 3, 4, and 6. On the basis of these results and specific classification, genomic DNA fragments were used to develop a multiplex PCR-based molecular test for R. solanacearum race 2 (Allen et al., 2005, Bacterial Wilt Disease and the Ralstonia solanacearum Species Complex. American Phytopathological Society (APS), St. Paul, MN, USA. 510p.).
The main objective of our study was to determine the variability of R. solanacearum from Musa crops in different regions of Colombia. Our goal was to develop strategies to improve the acquisition of durable resistance to R. solanacearum.
Materials and Methods
77 Strains were chosen, based on studies of: 1. pathogenicity on the plantain hybrid ‘Africa 1’, 2. genetic diversity through RAM primers, and 3. the amplification of the pathogen’s 16S rRNA gene by Álvarez (Álvarez et al., 2005, Fitopat. Colom. 28(2): 71-75). Of the 58 strains from the collection at CIAT, originated from infected crops of plantain (37), banana (5), and heliconias (3). The degrees of pathogenicity in the area under the disease progress curve (AUDPC) were between 10 and 70. The strains were collected from the Departments of Magdalena, Valle del Cauca, Quindío, Antioquia, Caquetá, and Meta (Colombia). The remaining 13 strains were controls and came from plantain (1), Heliconia sp. (1), tobacco (6), eggplant (1), tomato (1), potato (1), arrowroot (1), and capsicum (1) from Kenya, Japan, Asia, USA, and Colombia. Five nonpathogenic strains of R. solanacearum were isolated from soil for comparative purposes (Table 1.13.1) [(Álvarez et al., 2005, Fitopat. Colom. 28: 71-75)].
Table 1. 13.1. Origin and pathogenicity of 58 strains of Ralstonia solanacearum race 2, causal agent of bacterial wilt, isolated from banana, plantain, and Heliconia sp. Phylotype No. Strain Region Host Tissue AUDPCa Sequevar I II III IV
1 1 S.A Quindío Plantain Rachis 18 4 +
2 3 Quindío Plantain Petioles 69.38 4 +
3 5 (Sunisa 8) Antioquia Banana Rhizome 38.75 4 + (Urabá) 4 6 Antioquia Banana Fruit 31.83 4 + (Urabá) 5 15 Quindío Soil 37.63 4 +
6 16b1 Quindío Soil Mucuna 0 – +
7 17 Valle (Jamundí) Soil 69.5 4 +
8 18 Valle Plantain Sucker 42.5 4 +
9 32 Caquetá Plantain Pseudostem 33.88 4 +
10 34 Caquetá Plantain Raceme 27.63 4 + rachis 11 38 Quindío Soil Coffee pulp 59.5 4 +
12 40 Quindío Soil Center of 15.75 4 + (Quimbaya) focus 13 41 Quindío Soil Center of 56.25 4 + (Quimbaya) focus 14 42 Meta Plantain Pseudostem 28 4 +
15 43 Meta Plantain Pseudostem 20.75 4 +
16 48 Quindío Plantain Fruit 37.13 4 + (Armenia) 17 54a Meta Plantain Pseudostem 36.25 4 + (Puente de Oro)
78 Table 1.13.1. continued Phylotype No. Strain Region Host Tissue AUDPCa Sequevar I II III IV 18 58-1R Meta Plantain Petioles 56.63 4 + (Puente de Oro) 19 59 Meta Plantain Pseudostem 0 4 + (Puente de Oro) 20 65 Meta Plantain Pseudostem 47.63 4 + (Granada) 21 67 Meta Plantain Pseudostem 41.63 4 + (Puente de Oro) 22 69-1 Meta Plantain Pseudostem 27 4 + (Granada) 23 70 Meta Plantain Pseudostem 5.75 4 + (Granada) 24 71aR Antioquia Plantain Rhizome 21.25 4 + (Urabá) 25 72b Antioquia Plantain Pseudostem 10.75 4 + (Urabá) 26 73a Antioquia Plantain Pseudostem 10.75 4 + (Urabá) 27 76 Quindío Plantain Pseudostem 61.88 4 + (Montenegro) 28 78 Quindío Plantain Rachis 73.38 4 + (Montenegro) 29 79 Quindío Plantain Rhizome 66.88 4 + (Montenegro) 30 80 Quindío Plantain Pseudostem 67.88 4 + (Montenegro) 31 81 Quindío Plantain Fruit 10.88 4 + (Montenegro) 32 83 Quindío Plantain Fruit 55 4 + (Calarca) 33 84 Quindío Plantain Pseudostem 61 4 + (Calarca) 34 85 Quindío Plantain Sucker 68.38 4 + (Calarca) 35 86 Quindío Plantain Rachis 59.75 4 + (Calarca) 36 88 Quindío Plantain Rhizome 61.75 4 + (La Tebaida) 37 89 Quindío Plantain Pseudostem 60.38 4 + (La Tebaida) 38 97 Quindío Plantain Rhizome 28.63 4 + (Quimbaya) 39 107 Quindío Plantain Fruit 68.25 4 + (Armenia) 40 110 Magdalena Banana Pseudostem 63.25 6 +
41 111 Magdalena Banana Rhizome 34.38 6 +
42 112 Magdalena Banana Sucker 29.5 6 +
43 113 Valle (Rozo) Heliconia Pseudostem 40.5 4 + wameiana 44 114 Valle (Rozo) Heliconia Rhizome 40.38 4 + wameiana
79 Table 1.13.1. continued Phylotype No. Strain Region Host Tissue AUDPCa Sequevar I II III IV 45 115 Valle (Rozo) Heliconia Rhizome 33.63 4 + catubea 46 G175 Kenya Egg plant CIAT – – + collection 47 G216 Japan Tobacco CIAT – – + collection 48 CIAT 1008 Colombia Plantain CIAT 65.13 4 + collection 49 CIAT 1001 Colombia Tobacco CIAT – – + collection 50 CIAT 1007 Florida (Quency) Tobacco CIAT – – + collection 51 CIAT 1013 North Carolina Tobacco CIAT – 4 + collection 52 G 177 Australia Potato CIAT – – + collection 53 CIAT 1017 Colombia Arrowroot CIAT – 4 + collection 54 CIAT 1077 North Carolina Tomato CIAT – – + collection 55 G 218 Philippines Capsicum CIAT – – + collection 56 G 217 Costa Rica Heliconia CIAT – 4 + collection 57 CIAT 1035 Colombia 37 Tobacco CIAT – 6 + variety collection 58 CIAT 1054 Colombia Tobacco CIAT – – + collection a. AUDPC = area under disease progress curve; data from Álvarez et al. (Álvarez et al., 2005, Fitopat. Colom. 28(2):71-75).
The selected strains were amplified by multiplex PCR, their classification being evaluated according to phylotype with primers Nmult 21:1F, Nmult 21:2F, Nmult 22:InF, Nmult 23:AF, Nmult 22:RR, 759, and 760 (Figure 1B); and to sequevars in Musas with primers Mus 20-F, Mus 20-R, Mus 35-F, Mus 35-R, Mus 06-F, Mus 06-R, Si28-F, and Si28-R. Amplification conditions were as according to the methodology described by Fegan and Prior (2005) and cited in Allen (Allen et al., 2005, Bacterial Wilt Disease and the Ralstonia solanacearum Species Complex. American Phytopathological Society (APS), St. Paul, MN, USA. 510p.).
80 (A) M 372 bp 500 bp 1 3 6 7 8 9 13 15 26 29 33 37 41 44
300 bp 46 47 200 bp 759/760 Phylotype II 144 bp Rs band 100 bp 280 bp Phylotype I 25 bp
M M 500 bp 48 49 50 51 52 53 54 55 56 57 58 C- 300 bp
200 bp Phylotype II 100 bp 91 bp
25 bp Phylotype III
Nmult:22:RR All phylotypes (B) 16S ITS 23S Nmult:21:2F Nmult:22:InF Nmult:21:1F Nmult:23:AF 372 bp 213 bp 144 bp 91 bp
Figure 1.13.1. (A) Evaluation of phylotypes by multiplex PCR for 58 isolates obtained from banana, Heliconia, plantain, and controls from the collection held at CIAT. (B) Location of primers for multiplex PCR (phylotypes) in the ITS region. Lane M = marker with molecular weight according to HyperLadder V (100 lanes).
81 Results and Discussion
All the isolates obtained from Colombia, regardless of geographic region, host, tissue, or pathogenicity, belonged to phylotype II. In contrast, the control strains were characterized as belonging to phylotypes I, II, and III. Specifically, those from eggplant (Kenya), tobacco (Japan), and capsicum (Asia) belonged to phylotype I; those from plantain, arrowroot, tobacco (Colombia), tobacco (Quency, FL, and North Carolina), potato (Australia), and tomato (North Carolina), to phylotype II; and the sole Heliconia isolate (Costa Rica) to phylotype III (Figure 1.13.1A; Table 1.13.1).
According to Fegan and Prior (2005), the species complex of R. solanacearum can be subdivided into four phylotypes corresponding to four genetic groups identified according to sequence analysis. A phylotype is defined as a monophyletic cluster of strains that is revealed by phylogenetic analysis of sequence data, in this case, the ITS region, hrpB gene, and endoglucanase gene. The four phylotypes are:
• Phylotype I is equivalent to division I, as defined by Cook (Cook et al., 1994, Bacterial Wilt, 77-94). The strains in this phylotype all belong to biovars 3, 4, and 5 and were isolated primarily from Asia.
• Phylotype II is equivalent to division 2, and the strains included belong to biovars 1, 2, and 2T and were isolated primarily from America. It also includes the R. solanacearum race 3 potato pathogen, which is distributed worldwide, and the race 2 banana pathogens.
• Phylotype III contains strains that belong to biovars 1 and 2T and were primarily isolated from Africa and nearby islands.
• Phylotype IV contains strains that had been isolated primarily from Indonesia and belong to biovars 1, 2, and 2T. These strains are also found in Australia and Japan. This phylotype includes the two close relatives of R. solanacearum: P. syzygii and the BDB.
In the sequevar analysis, we detected the multi-locus genotypes (MLGs) 25 and 28. Three isolates of banana from the Department of Magdalena, Colombia, were characterized as sequevar 6 (MLG 28), amplifying only one product of 220 bp with primers Si28-F/Si28R. The other isolates belonged to sequevar 4 (MLG 25), amplifying two products: one of 351 bp and the other of 167 bp for all the isolates with primers Mus20-F/Mus20-R and Mus06-F/Mus06-R, respectively. Isolates 3, 4, 24, 25, and 26 were absent from the fragment that amplified to 167 bp. Isolate 6 obtained from Mucuna-soil did not amplify for any sequevar, as likewise the nonpathogenic strains isolated from the soil. The 13 controls were characterized as follows:
• Sequevar 4 (with the presence of two bands) for isolates 48 from plantain (Colombia), 51 from tobacco (North Carolina) (data not shown), 53 from arrowroot (Colombia), and 56 from Heliconia (Costa Rica) (data not shown2);
• Sequevar 6 for isolate 57 from tobacco (Colombia); and
• The remaining 8 isolates did not amplify for any sequevar (Figure 1.13.2).
82 M M 500 bp NP NP 1 RS 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 300 bp 200 bp
100 bp Non pathogenicNonpathogenic SFR Non pathogenicSFR 25 bp on on Bananabanana bBananaanana
Sequevar 4 (MLG25)(MLG 25)
M M 500 bp 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 300 bp 200 bp 100 bp SFR SFR SFR SFR 25 bp Sequevar 6 (MLG 28)
Sequevar 4 (MLG25)(MLG 25) Sequevar 4 (MLG25)(MLG 25)
M M 500 bp 57 58 C-
300 bp 200 bp
100 bp
25 bp Sequevar 6 (MLG 28)
Figure 1.13.2. Evaluation of sequevars by multiplex PCR for 58 isolates obtained from banana, Heliconia, plantain, and controls from the collection held at CIAT. Lane M = marker with molecular weight according to HyperLadder V (100 lanes).
Based on Allen et al. classification (Allen et al., 2005, Bacterial Wilt Disease and the Ralstonia solanacearum Species Complex. American Phytopathological Society (APS), St. Paul, MN, USA. 510p.), strains identified as “SFR” (small, fluidal, round colony form, insect transmitted) are found in MLGs 25 and 28. Strains identified as “D” (causing leaf distortion and slow wilting of banana) belong to MLGs 24 and 25. In contrast, strains designated as “B” (large elliptical colony form, rapid wilt of banana, not commonly insect transmitted) belong to MLG 24 only, as do the strains classified as “H” (slightly pathogenic on plantain but not pathogenic on banana). The authors’ phylogenetic work showed that isolates belonging to MLGs 24 and 25 are closely related to each other, but are slightly more distant to MLG 28. Given that strains classified as SFR are present in MLGs 25 and 28, it is conceivable that these strains may have differing properties, including their capacity to survive in soil and host range (Figure 1.13.3A).
Comparing the band patterns for the different isolates from plantain, banana, and Heliconia spp.
83 with those of the race 2 strains described above, the isolates that characterized as SFR-type strains, sequevar 4 (MLG 25), were isolates 1, 5, 7–23, 27–39, 43–45, 48, 51, and 53; those that are SFR-type, nonpathogenic on banana, sequevar 4 (MLG 25) were 3, 4, and 24–26; and SFR- type, sequevar 6 (MLG 28), were 40–42 and 57 (Figure 1.13.2; Table 1.13.1).
The primers designed for sequevar 4 (MLG 25) were each developed separately, using strains isolated from Peru, Colombia, Costa Rica, Martinique, and Florida (USA). Their host plants were banana, plantain, Heliconia sp., pothos (Epipremnum aureum), and anthurium. Strains isolated from bacterial wilt-infected anthurium from Martinique in the French West Indies and from pothos in Florida were found to cluster with R. solanacearum strains belonging to sequevar 4. The strains from anthurium were nonpathogenic on banana. However, the strains from pothos caused wilt of banana. The pathogenic potential of these strains for banana needs to be confirmed (Allen et al., 2005, Bacterial Wilt Disease and the Ralstonia solanacearum Species Complex. American Phytopathological Society (APS), St. Paul, MN, USA. 510p).
Sequevar 1 (MLG 26/34)
Sequevar 2 (MLG 27) CIP10, Bv2T, MLG29 UW477, Bv2T CIP223, Bv2T, MLG32 NCPPB3987, Bv2T Sequevar 3 (MLG 24) 0.10 Sequevar 4 (MLG 25) Race 2 Sequevar 5
Sequevar 6 (MLG 28)
Sequevar 7 (MLG 1)
Phylotype IV
Phylotype I
Phylotype III
(A) Fegan and Prior (2005) (B) Fegan and Prior (2005)
Figure 1.13.3. (A) Musa-specific region from the subtracted sequences specific to phylotype II, sequevars 3, 4, and 6, and used in a multiplex PCR. (B) Phylogenetic tree of phylotype II based on partial endoglucanase gene sequences. The corresponding sequevars can be seen where strains of R. solanacearum race 2 are classified. (Taken from Fegan and Prior [2005]).
Strains belonging to sequevars 3 (MLG 24) and 4 (MLG 25) are closely related and form a branch, together with sequevars 1 and 2, which contain potato disease-causing strains belonging to race 3/biovar 2 (Figure 1.13..3B). All strains previously identified as belonging to MLG 28 fell in sequevar 6. Strains in this sequevar were isolated from host plants of banana, plantain, and Heliconia sp. in Honduras, Venezuela, Hawaii, and Australia (where the disease has been eradicated).
84 Sequevar 6 is phylogenetically distinct from strains of sequevar 3 (MLG 24) and 4 (MLG 25) in which other bacterial wilt-causing strains are found. Hence, the R. solanacearum race 2 strains are polyphylectic, which indicates a separate evolutionary origin for the two groups of strains. All strains of sequevar 6 were also found to belong to biotype 6 (Figure 1.13.3B) (Allen et al., 2005, Bacterial Wilt Disease and the Ralstonia solanacearum Species Complex. American Phytopathological Society (APS), St. Paul, MN, USA. 510p)
This finding is of vital importance, considering that strains isolated from banana in Magdalena, Colombia (Table 1.13.1), belong to sequevar 6 and are either moderately or highly pathogenic on plantain. The possibility of strains being introduced from Honduras or Venezuela exists and, hence, the danger of re-invasion of zones where the disease has been eradicated is constant.
During the course of this study, using primers specific to sequevars 3, 4, and 6 (MLGs 24, 25, and 28), we identified strains of R. solanacearum in different regions of Colombia. We observed a tomato crop naturally infected with sequevar 4 strains (MLG 25). This finding expanded the known host range of this organism and this study is the first report of tomato as a natural host of R. solanacearum race 2, biovar 1, in Colombia.
Conclusions
We used multiplex PCR to classify strains of R. solanacearum and confirmed that their current classification is composed of four genetic groups or phylotypes and, within these, subgroups or sequevars that corresponded to clusters or isolates with similar pathogenicity or isolates of common geographic origin. We could conclude that, to date (with about 40% of the collection at CIAT evaluated), 100% of strains isolated from Musas in Colombia belong to phylotype II, with 91% to sequevar 4 and 6.6% to sequevar 6.
The genetic and pathogenic characterization of R. solanacearum strains, although very important, must be complemented with information of the strains’ biological, ecological, and epidemiological properties. By incorporating these different components, we can define a taxonomic scheme for predicting the pathogenicity of strains and thus contribute towards controlling this disease.
For a disease such as bacterial wilt of plantain, the genetic analysis of the pathogen’s taxonomic structure as reported in this study will support the research so far carried out on the causal agent’s biology and ecology. By being able to predict the genetic and pathogenic properties of the R. solanacearum race 2 strains in Colombia, we can begin to bring this disease under control.
85 Output 2: Pest-and-disease management components and strategies developed for key crops.
Activity 2.1. Levels of resistance to important insect pests confirmed in bean progenies
Contributors: J. M. Bueno, J. F. Valor, C. Cardona, A. Mejía and M. Blair
Highlights:
Resistance to the bean weevil (Acanthoscelides obtectus) was identified in Phaseolus vulgaris x P. acutifolius hybrids
Progress obtained in yields by selecting tolerant lines for the Empoasca kraemeri
Rationale
A novel Double Congruity Backcross technique developed at CIAT has permitted the development of fertile interspecific Phaseolus vulgaris x P. acutifolius (common x tepary) bean hybrids. These crosses are made using the tepary genotype NI576 (a genotype competent to Agrobacterium-mediated genetic transformation). Some of these crosses involve the tepary accession G 40199, an excellent source of resistance to Acanthoscelides obtectus and Empoasca kraemeri. In 2002 and 2003 we identified several progenies containing both P. vulgaris and P. acutifolius cytoplasm with very high levels of antibiosis resistance to A. obtecetus. In 2004 and 2005, emphasis was placed on the reconfirmation of resistance in previously selected progenies.
Materials and Methods
Depending on the amount of seed available, previously selected genotypes were multiplied in the field or under greenhouse conditions. The seed was then utilized to screen the different nurseries for resistance to A. obtectus in the laboratory. Each test was evaluated in 5 repetitions. Infestation levels per variety were 2 to 3 mature eggs per seed. The percentage of emergence of adults and the days to emerge of adults were evaluated. In some cases, individual seeds were evaluated, using an infestation level of 2 ripe eggs per seed. Evaluations for resistance to E. kraemeri were done in the field under conditions of high levels of natural infestation. A randomized complete blocks design was used for this evaluation with 5 repetitions per genotype. The evaluation for resistance includes a damage score and bean production rating, insect counts, damage counts and in some cases, yield and yield components.
Results and Discussion
Acanthoscelides obtectus. In 2006, emphasis was placed upon the reconfirmation of resistance in previously selected progenies. Seeds of resistant hybrids were multiplied in
86 2005 in the greenhouse. These materials were then tested in nurseries with 10 repetitions. All the hybrids that had shown intermediate and high levels of resistance became susceptible, as can be seen in Table 2.1.1.
Table 2.1.1. Levels of resistance to Acanthoscelides obtectus in selected F6 – F8 hybrid progenies derived from interspecific Phaseolus vulgaris x P. acutifolius crosses.
Percentage Days to Code and generation Cross adult adult Rating emergence emergence Interspecific P. vulgaris x P. acutifolius hybrids with P. acutifolius cytoplasm
GNVAV 200A9 F8 {[(G40022 x NI576)x V5] x A3} x VS42-7 95.0 38.5 Susceptible
GNVAV 200H5 F8 {[(G40022 x NI576)x V5] x A3} x VS42-7 93.8 39.0 Susceptible
GVV 110G F8 {[(G40022 x NI576)x V5] x A3} x VS42-7 93.8 65.6 Susceptible
GVV 108 N F8 {[(G40022 x NI576)x V5] x A3} x VS42-7 93.9 40.2 Susceptible
BWG 1F7 F6 BW-1 FL x GKA-12 F3 FB 93.4 40.2 Susceptible
BWG 1F14 F6 BW-1 FL x GKA-12 F3 FB 83.5 40.3 Susceptible
BWG 1F18 F6 BW-1 FL x GKA-12 F3 FB 85.3 40.9 Susceptible
BWG 5N1 F6 BW-1 FL x GKA-12 F3 FB 89.1 39.6 Susceptible
BWG 5N4 F6 BW-1 FL x GKA-12 F3 FB 91.0 39.2 Susceptible
BWG 6Y6 F6 BW-1 FL x GKA-12 F3 FB 95.8 38.4 Susceptible Checks
G 40168 Susceptible Phaseolus acutifolius accession 88.1 39.4 Susceptible G 40199 Resistance Phaseolus acutifolius accession 7.2 68.1 Resistant
G 25410 Susceptible Phaseolus lunatus accession 91.2 42.6 Susceptible G 25042 Resistance Phaseolus lunatus accession 5.8 65.9 Resistant ICA Pijao Susceptible Phaseolus vulgaris cultivar 96.2 31.9 Susceptible
We evaluated 161 different progenies F3 – F4 obtained from interspecific crosses Phaseolus vulgaris x P. acutifolius with P. vulgaris cytoplasm.
In Table 2.1.2, 39 different genotypes are shown that have high levels of antibiosis to A. obtectus. The multiplication of seeds of the selected genotypes is in progress.
87 Table 2.1.2. Resistance to Acanthoscelides obtectus in pre-selected segregating F3-F4 hybrid progenies derived from interspecific Phaseolus vulgaris x P. acutifolius with P. vulgaris cytoplasm. Percentage Days to Code and Cross adult adult Rating generation emergence emergence Hybrids
[((((((G12922A x GNV10) x V5) x G25042) x DORSV1) x DV-3B F 47.7 53.2 Intermediate 3 TZTTZ-24I) x ZX99-15.2.14.A) x STR-6I) x RR-13L26Y] [((((((G12922A x GNV10) x V5) x G25042) x DORSV1) x DV-3C F 17.5 55.0 Resistant 3 TZTTZ-24I) x ZX99-15.2.14.A) x STR-6I) x RR-13L26Y] [((((((G12922A x GNV10) x V5) x G25042) x DORSV1) x DV-3D F 19.0 51.7 Resistant 3 TZTTZ-24I) x ZX99-15.2.14.A) x STR-6I) x RR-13L26Y] [((((((G12922A x GNV10) x V5) x G25042) x DORSV1) x DV-3G F 45.9 54.3 Intermediate 3 TZTTZ-24I) x ZX99-15.2.14.A) x STR-6I) x RR-13L26Y] [((((((G12922A x GNV10) x V5) x G25042) x DORSV1) x DV-44D F 29.2 41.6 Intermediate 3 TZTTZ-24I) x ZX99-15.2.14.A) x STR-5D) x STRR-4] [((((((G12922A x GNV10) x V5) x G25042) x DORSV1) x DV-45D F 30.3 47.0 Intermediate 3 TZTTZ-24I) x ZX99-15.2.14.A) x STR-5D) x RGRT-2Y] [((((((G12922A x GNV10) x V5) x G25042) x DORSV1) x DV-48G F 39.2 36.5 Intermediate 3 TZTTZ-24I) x ZX99-15.2.14.A) x STR-5D) x STRR-4] [((((((G12922A x GNV10) x V5) x G25042) x DORSV1) x DV-49 A F 45.6 34.7 Intermediate 3 TZTTZ-24I) x ZX99-15.2.14.A) x STR-5D) x RGRT-2Y] [((((((G12922A x GNV10) x V5) x G25042) x DORSV1) x DV-49E F 26.1 44.9 Intermediate 3 TZTTZ-24I) x ZX99-15.2.14.A) x STR-5D) x RGRT-2Y] [(((((((G12922A x GNV10) x V5) x G25042) x DORSV1) x DV-50B F 47.5 40.4 Intermediate 3 TZTTZ-24I) x ZX99-15.2.14.A) x STR-7N) x STRR-7] [(((((((G12922A x GNV10) x V5) x G25042) x DORSV1) x DV-54C F 32.6 47.3 Intermediate 3 TZTTZ-24I) x ZX99-15.2.14.A) x STR-7N) x STRR-7] [(((((((G12922A x GNV10) x V5) x G25042) x DORSV1) x DV-81C F 32.2 43.0 Intermediate 3 TZTTZ-24I) x ZX99-15.2.14.A) x STR-5D) x STRR-7] [(((((((G12922A x GNV10) x V5) x G25042) x DORSV1) x DV-81G F 37.8 44.0 Intermediate 3 TZTTZ-24I) x ZX99-15.2.14.A) x STR-5D) x STRR-7] [((((((G12922A x GNV10) x V5) x G25042) x DORSV1) x STZS-1A1 5.6 72.0 Resistant TZTTZ-24I) x ZX99-15.2.14.A) x STR-7N] [((((((G12922A x GNV10) x V5) x G25042) x DORSV1) x STZS-1B4 0.0 N.Ea. Resistant TZTTZ-24I) x ZX99-15.2.14.A) x STR-7N] [((((((G12922A x GNV10) x V5) x G25042) x DORSV1) x STZS-1B5 20.0 64.0 Resistant TZTTZ-24I) x ZX99-15.2.14.A) x STR-7N] [((((((G12922A x GNV10) x V5) x G25042) x DORSV1) x STZS-1C5 17.2 60.3 Resistant TZTTZ-24I) x ZX99-15.2.14.A) x STR-7N] [((((((G12922A x GNV10) x V5) x G25042) x DORSV1) x STZS-1C6 1.9 46.0 Resistant TZTTZ-24I) x ZX99-15.2.14.A) x STR-7N] [((((((G12922A x GNV10) x V5) x G25042) x DORSV1) x STZS-1G3 33.8 52.7 Intermediate TZTTZ-24I) x ZX99-15.2.14.A) x STR-7N] [((((((G12922A x GNV10) x V5) x G25042) x DORSV1) x STZS-1G4 1.4 52.0 Resistant TZTTZ-24I) x ZX99-15.2.14.A) x STR-7N] [((((((G12922A x GNV10) x V5) x G25042) x DORSV1) x STZS-1G5 16.7 50.8 Resistant TZTTZ-24I) x ZX99-15.2.14.A) x STR-7N] [((((((G12922A x GNV10) x V5) x G25042) x DORSV1) x STZS-1G6 0.0 N.E. Resistant TZTTZ-24I) x ZX99-15.2.14.A) x STR-7N] [((((G12922A x GNV10) x V5) x G25042) x DORSV1) x STZS-3B3 0.0 N.E. Resistant TZTTZ-24I) x ZX99-15.2.14.A) x STR-5D]
88 Table 2.1.2. (Continued) Percentage Days to Code and Cross adult adult Rating generation emergence emergence [((((G12922A x GNV10) x V5) x G25042) x DORSV1) x STZS-3B4 2.5 58.0 Resistant TZTTZ-24I) x ZX99-15.2.14.A) x STR-5D] [((((G12922A x GNV10) x V5) x G25042) x DORSV1) x STZS-3H1 10.7 59.3 Resistant TZTTZ-24I) x ZX99-15.2.14.A) x STR-5D] [((((G12922A x GNV10) x V5) x G25042) x DORSV1) x STZS-3H4 0.0 N.E. Resistant TZTTZ-24I) x ZX99-15.2.14.A) x STR-5D] [((((G12922A x GNV10) x V5) x G25042) x DORSV1) x STZS-3J2 5.0 54.0 Resistant TZTTZ-24I) x ZX99-15.2.14.A) x STR-5D] [((((G12922A x GNV10) x V5) x G25042) x DORSV1) x STZS-3K3 0.0 N.E. Resistant TZTTZ-24I) x ZX99-15.2.14.A) x STR-5D] [((((G12922A x GNV10) x V5) x G25042) x DORSV1) x STZS-3K4 0.0 N.E. Resistant TZTTZ-24I) x ZX99-15.2.14.A) x STR-5D] [((((G12922A x GNV10) x V5) x G25042) x DORSV1) x STZS-3K5 7.7 62.5 Resistant TZTTZ-24I) x ZX99-15.2.14.A) x STR-5D] [((((G12922A x GNV10) x V5) x G25042) x DORSV1) x STZS-3K6 11.5 56.7 Resistant TZTTZ-24I) x ZX99-15.2.14.A) x STR-5D] [((((G12922A x GNV10) x V5) x G25042) x DORSV1) x STZS-3M4 0.0 N.E. Resistant TZTTZ-24I) x ZX99-15.2.14.A) x STR-5D] [((((G12922A x GNV10) x V5) x G25042) x DORSV1) x STZS-3M6 18.3 54.0 Resistant TZTTZ-24I) x ZX99-15.2.14.A) x STR-5D] [((((G12922A x GNV10) x V5) x G25042) x DORSV1) x STZS-3Q3 5.3 76.0 Resistant TZTTZ-24I) x ZX99-15.2.14.A) x STR-5D] [((((G12922A x GNV10) x V5) x G25042) x DORSV1) x STZS-3Q4 11.0 51.0 Resistant TZTTZ-24I) x ZX99-15.2.14.A) x STR-5D] [((((G12922A x GNV10) x V5) x G25042) x DORSV1) x STZS-3Q5 6.4 46.0 Resistant TZTTZ-24I) x ZX99-15.2.14.A) x STR-5D] [((((G12922A x GNV10) x V5) x G25042) x DORSV1) x STZS-3S1 7.1 84.0 Resistant TZTTZ-24I) x ZX99-15.2.14.A) x STR-5D] [((((G12922A x GNV10) x V5) x G25042) x DORSV1) x STZS-3S2 17.8 44.8 Resistant TZTTZ-24I) x ZX99-15.2.14.A) x STR-5D] [((((G12922A x GNV10) x V5) x G25042) x DORSV1) x STZS-3S3 0.0 N.E. Resistant TZTTZ-24I) x ZX99-15.2.14.A) x STR-5D] [((((G12922A x GNV10) x V5) x G25042) x DORSV1) x STZS-3S6 0.0 N.E. Resistant TZTTZ-24I) x ZX99-15.2.14.A) x STR-5D] [((((G12922A x GNV10) x V5) x G25042) x DORSV1) x STZS-3U4 0.0 N.E. Resistant TZTTZ-24I) x ZX99-15.2.14.A) x STR-5D] [((((G12922A x GNV10) x V5) x G25042) x DORSV1) x STZS-3U5 0.0 N.E. Resistant TZTTZ-24I) x ZX99-15.2.14.A) x STR-5D] [((((G12922A x GNV10) x V5) x G25042) x DORSV1) x STZS-3V2 0.0 N.E. Resistant TZTTZ-24I) x ZX99-15.2.14.A) x STR-5D] [((((G12922A x GNV10) x V5) x G25042) x DORSV1) x STZS-3V6 0.0 N.E. Resistant TZTTZ-24I) x ZX99-15.2.14.A) x STR-5D] [((((G12922A x GNV10) x V5) x G25042) x DORSV1) x STZS-3Y4 0.0 N.E. Resistant TZTTZ-24I) x ZX99-15.2.14.A) x STR-5D] [((((G12922A x GNV10) x V5) x G25042) x DORSV1) x STZS-3Y5 0.0 N.E. Resistant TZTTZ-24I) x ZX99-15.2.14.A) x STR-5D] [((((G12922A x GNV10) x V5) x G25042) x DORSV1) x STZS-3Y6 0.0 N.E. Resistant TZTTZ-24I) x ZX99-15.2.14.A) x STR-5D] [((((G12922A x GNV10) x V5) x G25042) x DORSV1) x STZS-3Z3 11.9 66.5 Resistant TZTTZ-24I) x ZX99-15.2.14.A) x STR-5D] [((((G12922A x GNV10) x V5) x G25042) x DORSV1) x STZS-3Z4 15.0 53.3 Resistant TZTTZ-24I) x ZX99-15.2.14.A) x STR-5D]
89 Table 2.1.2. (Continued) Percentage Days to Code and Cross adult adult Rating generation emergence emergence [((((G12922A x GNV10) x V5) x G25042) x DORSV1) x STZS-3Z5 0.0 N.E. Resistant TZTTZ-24I) x ZX99-15.2.14.A) x STR-5D] [((((G12922A x GNV10) x V5) x G25042) x DORSV1) x STZS-3Z6 10.5 60.5 Resistant TZTTZ-24I) x ZX99-15.2.14.A) x STR-5D]
Checks
G 40168b 85.2 39.8 Susceptible
G 25410c 85.8 43.7 Susceptible
ICA Pijaod 96.8 31.0 Susceptible
G 40199e 7.8 69.3 Resistant
G 25042f 4.4 73.6 Resistant a N.E., no adult emergence from resistant seeds; b Susceptible P. acutifolius accession; c Susceptible P. lunatus accession; dSusceptible P. vulgaris cultivar; e Resistant P. acutifolius accession; f Resistant P. lunatus accession.
We also evaluated 55 different F3 – F4 obtained from interspecific crosses Phaseolus vulgaris x P. acutifolius with P. vulgaris cytoplasm. As shown in Table 2.1.3, 9 genotypes that have emergence levels similar to G40199, the original resistant parent and genotypes with intermediate resistance levels. Multiplication of selected genotype seeds are in progress.
90 Table 2.1.3. Resistance to Acanthoselides obtectus in pre-selected segregating F3-F4 hybrid progenies derived from interspecific Phaseolus vulgaris x P. acutifolius with P. acutifolius cytoplasm. Days to Code and % adult adult Cross emergence Rating generation emergence Hybrids
[(((((((((((((((G40065 x NI576) x V5) x A6) x NGPNMNG-1) x KBNKN-3) x X-2) x CWBB-18G33 F4 T7K-2F281)x GKAX-9B) x CTZ-18) x ZXTGX-2D) x TZTE-9B) x BWG-12M) x 49.4 45.1 Intermediate BWG-20A) x RS-2) x BWTZBB-15Q) x BWZ-2F11S) x BWTZBB-2W16] [(((((((((((((((G40065 x NI576) x V5) x A6) x NGPNMNG-1) x KBNKN-3) x X-2) x CWBBB-18C 8 F4 T7K-2F281)x GKAX-9B) x CTZ-18) x ZXTGX-2D) x TZTE-9B) x BWG-12M) x 37.5 47.7 Intermediate BWG-20A) x RS-2) x BWTZBB-15Q) x BWTZBB-2U22) x BB-57U] [((((((((((((((((G40065 x NI576) x V5) x A6) x NGPNMNG-1) x KBNKN-3) x X-2) x CWBBC-5D1 F4 T7K-2F281)x GKAX-9B) x CTZ-18) x ZXTGX-2D) x TZTE-9B) x BWG-12M) x 11.2 61.8 Resistant BWG-20A) x RS-2) x BWTZBB-15Q) x BB-58L) x BWTZBB-2W16) x CWB-32J3] [((((((((((((((((G40065 x NI576) x V5) x A6) x NGPNMNG-1) x KBNKN-3) x X-2) x CWBBG-2A F3 T7K-2F281)x GKAX-9B) x CTZ-18) x ZXTGX-2D) x TZTE-9B) x BWG-12M) x 32.1 48.5 Intermediate BWG-20A) x RS-2) x BWTZBB-15Q) x BB-58L) x BWTZBB-2W16) x GB-44N] [((((((((((((((((G40065 x NI576) x V5) x A6) x NGPNMNG-1) x KBNKN-3) x X-2) x CWBBG-2C F3 T7K-2F281)x GKAX-9B) x CTZ-18) x ZXTGX-2D) x TZTE-9B) x BWG-12M) x 15.3 49.8 Resistant BWG-20A) x RS-2) x BWTZBB-15Q) x BB-58L) x BWTZBB-2W16) x GB-44N] [((((((((((((((((G40065 x NI576) x V5) x A6) x NGPNMNG-1) x KBNKN-3) x X-2) x CWBBG-2D F3 T7K-2F281)x GKAX-9B) x CTZ-18) x ZXTGX-2D) x TZTE-9B) x BWG-12M) x 21.7 50.2 Intermediate BWG-20A) x RS-2) x BWTZBB-15Q) x BB-58L) x BWTZBB-2W16) x GB-44N] [((((((((((((((((G40065 x NI576) x V5) x A6) x NGPNMNG-1) x KBNKN-3) x X-2) x T7K-2F281)x GKAX-9B) x CTZ-18) x ZXTGX-2D) x TZTE-9B) x BWG-12M) x CWBBG-7N F3 BWG-20A) x RS-2) x BWTZBB-15Q) x BWTZBB-2W) x BWTZBB-2W14) x GB- 31.8 56.4 Intermediate 44K] [((((((((((((((((G40065 x NI576) x V5) x A6) x NGPNMNG-1) x KBNKN-3) x X-2) x T7K-2F281)x GKAX-9B) x CTZ-18) x ZXTGX-2D) x TZTE-9B) x BWG-12M) x CWBBG-22J 6 F4 BWG-20A) x RS-2) x BWTZBB-15Q) x BWTZBB-2W) x BWTZBB-2W14) x GB- 13.3 59.3 Resistant 44P] [((((((((((((G40065 x NI576) x V5) x A6) x NGPNMNG-1) x KBNKN-3) x X-2) x BBC-5D3 F4 T7K-2F281)x GKAX-9B) x UAC-3) x GKVZ-21B) x GKA-12F3) x BWTZBB-5) x 30.1 54.1 Intermediate CWBB-10]
[((((((G40065 x NI576) x V-5.4) x A-6) x NGPNMNG-1) x KBNKN-3) x X-2) x ZX99-15Z-14AF3 G400199ZS] 28.3 56.1 Intermediate
[((((((G40065 x NI576) x V-5.4) x A-6) x NGPNMNG-1) x KBNKN-3) x X-2) x ZX99-15Z-14B F3 G400199ZS] 24.6 53.0 Intermediate
[((((((G40065 x NI576) x V-5.4) x A-6) x NGPNMNG-1) x KBNKN-3) x X-2) x ZX99-15Z-14C F3 G400199ZS] 7.2 60.0 Resistant
[((((((G40065 x NI576) x V-5.4) x A-6) x NGPNMNG-1) x KBNKN-3) x X-2) x ZX99-15Z-14D F3 G400199ZS] 19.2 58.7 Resistant
[((((((G40065 x NI576) x V-5.4) x A-6) x NGPNMNG-1) x KBNKN-3) x Z99ZX-1B-13 F3 G400199ZS) x ZX-11] 5.7 63.5 Resistant
[((((((G40065 x NI576) x V-5.4) x A-6) x NGPNMNG-1) x KBNKN-3) x Z99ZX-6A F3 G400199ZS) x ZX-11] 26.7 55.5 Intermediate
[((((((G40065 x NI576) x V-5.4) x A-6) x NGPNMNG-1) x KBNKN-3) x Z99ZX-11C F3 G400199ZS) x ZX-11] 14.1 58.6 Resistant
[((((((G40065 x NI576) x V-5.4) x A-6) x NGPNMNG-1) x KBNKN-3) x Z99ZX-11D F3 G400199ZS) x ZX-11] 32.7 39.7 Intermediate
[((((((G40065 x NI576) x V-5.4) x A-6) x NGPNMNG-1) x KBNKN-3) x X-2) x ZX99-15-2-14 F3 G400199ZS] 2.8 62.0 Resistant
[((((((G40065 x NI576) x V-5.4) x A-6) x NGPNMNG-1) x KBNKN-3) x X-2) x ZX99-15-2-15 F3 G400199ZS] 3.7 60.0 Resistant
Checks G40168 Susceptible Phaseolus acutifolius accession 78.7 39.1 Susceptible G40199 Resistance Phaseolus acutifolius accession 6.2 65.9 Resistant G25410 Susceptible Phaseolus lunatus accession 91.7 41.8 Susceptible G25042 Resistance Phaseolus lunatus accession 1.8 79.0 Resistant ICA Pijao Susceptible Phaseolus vulgaris cultivar 95.9 30.7 Susceptible
91 We evaluated different progenies obtained from interspecific crosses done in P. lunatus. These progenies F4 – F5 were selected in 2005 due to their high resistance levels to A. obtectus. With the exception of 2 progenies, all the rest showed high resistance to bruchids (Table 2.1.4).
Table 2.1.4. Resistance to Acanthoscelides obtectus in selected Phaseolus lunatus progenies Days to Code and No. of seeds Percentage adult adult Rating generation tested emergence emergence Hybrids a V5 F4 300 0.0 N.E. Resistant V5 F4 300 53.0 54.9 Susceptible V5 F4 300 2.9 61.7 Resistant V5 F4 300 0.2 83.0 Resistant V5 F4 300 0.0 N.E. Resistant V5 F4 300 0.9 62.7 Resistant V5 F4 150 0.0 N.E. Resistant V5 F4 210 5.0 54.4 Resistant V5 F4 210 2.7 64.3 Resistant V5 F4 300 5.9 53.5 Resistant V5 F4 210 22.0 57.3 Intermediate A6F5 150 46.9 46.8 Intermediate A6F5 210 54.7 47.7 Susceptible Checks G 40168b 300 79.4 40.3 Susceptible G 25410c 300 93.3 43.1 Susceptible ICA Pijaod 300 93.2 30.9 Susceptible G 40199e 300 9.4 70.2 Resistant G 25042f 300 5.7 67.8 Resistant a N.E., no adult emergence from resistant seeds; b Susceptible P. acutifolius accession; c Susceptible P. lunatus accession; d Susceptible P. vulgaris cultivar; e Resistant P. acutifolius accession; f Resistant P. lunatus accession.
Zabrotes subfasciatus (Mexican bean weevil)
The improvement method using backcrosses that combine biochemical tests to confirm the presence of arcelin and insect feeding bioassays have had satisfactory results whenever the resistance in bean cultivars should want to be incorporated in the Mexican bean weevil (Z. subfasciatus). Preliminary observations (see Annual Report 2005) suggested that the incorporation of arcelin in bean genotypes to develop bruchid resistance affects the reduction of yields. To confirm this hypothesis, in different field tests under field conditions at CIAT’s headquarters, we conducted two trials with RAZ lines and one trial with families of Andean red mottled bush (with the presence or not of arcelin), and with their respective recurrent parents.
Table 2.1.5 shows that the incorporation of arcelin into RAZ lines has a negative effect on the yield. Most RAZ lines tested yielded less than their respective recurrent parents. Differences in most cases were not significant, however, not less important. A similar situation is shown in Table 2.1.6, where lines obtained from families derived from the
92 same recurrent parent (A36) suggest that the incorporation of arcelin does have a depressing effect on yields.
Table 2.1.5. Yields of two trials of RAZ lines and corresponding parents. RAZ lines are selected for the presence of arcelin and high levels of resistance to the Mexican bean weevil.
Difference respect to Significance Yield respect to Line or cultivar Recurrent parent recurrent parent (kg/ha) recurrent parent (Kg/ha) Percentage RAZ 153 ICA Pijao 2575 414 13.9 nsa RAZ 154 ICA Pijao 2532 457 15.3 ns RAZ 155 ICA Pijao 2536 453 15.2 ns RAZ 156 ICA Pijao 2503 486 16.3 ns RAZ 157 ICA Pijao 2657 332 11.1 ns RAZ 158 ICA Pijao 2549 440 14.7 ns RAZ 159 ICA Pijao 2665 324 10.8 ns RAZ 160 ICA Pijao 2791 198 6.6 ns RAZ 161 ICA Pijao 2603 386 12.9 ns RAZ 162 ICA Pijao 2706 283 9.5 ns RAZ 163 ICA Pijao 2750 239 8.0 ns RAZ 164 ICA Pijao 2263 726 24.3 * RAZ 165 ICA Pijao 3020 +31 1.0 ns RAZ 166 ICA Pijao 2735 254 8.5 ns Mean backcrosses to Pijao 2635 ICA Pijao 2989
RAZ 151 EMP 250 2566 21 0.8 ns EMP 250 2587
RAZ 190 TALAMANCA 2682 0 0 ns TALAMANCA 2682 a ns, not significant; *,significant at the 5% level by Dunnett's test. For comparing all treatment means with the mean of a control. CV = 16.1%.Rep = 8.
93 Table 2.1.6. Yield of Andean red mottled bush bean line families and corresponding recurrent parents. Families are selected for the presence (resistance) or absence (susceptibility) of arcelin to the Mexican bean weevil.
Difference respect to Significance Yield recurrent parent respect to Identification Crosses Rating (kg/ha) recurrent parent (Kg/ha) Percentage
A 36 x ( A 36 x (( RAZ 44 x ROYAL RED 3750-51 Resistant 2280 210 8.4 nsa )x( CATRACHITA x WILK 2 ))) A 36 x ( A 36 x (( RAZ 44 x ROYAL RED 3754-55 Resistant 2406 84 3.4 Ns )x( CATRACHITA x WILK 2 ))) A 36 x ( A 36 x (( RAZ 44 x ROYAL RED 3759-60 Resistant 2579 +89 3.6 Ns )x( CATRACHITA x WILK 2 ))) A 36 x ( A 36 x (( RAZ 44 x ROYAL RED 3771-72 Resistant 2415 75 3.0 Ns )x( CATRACHITA x WILK 2 ))) A 36 x ( A 36 x (( RAZ 44 x ROYAL RED 3775-76 Resistant 3311 +821 33.0 * )x( CATRACHITA x WILK 2 ))) A 36 x ( A 36 x (( RAZ 44 x ROYAL RED 3777-78 6MClar Resistant 2405 85 3.4 Ns )x( CATRACHITA x WILK 2 ))) A 36 x ( A 36 x (( RAZ 44 x ROYAL RED 3777-78 6MOsc Resistant 2582 +92 3.7 Ns )x( CATRACHITA x WILK 2 ))) A 36 x ( A 36 x (( RAZ 44 x ROYAL RED 3786-87 Resistant 2471 19 0.8 Ns )x( CATRACHITA x WILK 2 ))) A 36 x ( A 36 x (( RAZ 44 x ROYAL RED Susceptibl 3810-11 2543 +53 2.1 Ns )x( CATRACHITA x WILK 2 ))) e A 36 x ( A 36 x (( RAZ 44 x ROYAL RED Susceptibl 3814-15 2932 +442 17.8 Ns )x( CATRACHITA x WILK 2 ))) e A 36 x ( A 36 x (( RAZ 44 x ROYAL RED Susceptibl 3833-34 2196 294 11.8 Ns )x( CATRACHITA x WILK 2 ))) e A 36 x ( A 36 x (( RAZ 44 x ROYAL RED Susceptibl 3859-60 1931 559 22.4 Ns )x( CATRACHITA x WILK 2 ))) e A 36 x ( A 36 x (( RAZ 44 x ROYAL RED Susceptibl 3896-97 2203 287 11.5 Ns )x( CATRACHITA x WILK 2 ))) e A 36 x ( A 36 x (( RAZ 44 x ROYAL RED Susceptibl 3908- 2300 190 7.6 Ns )x( CATRACHITA x WILK 2 ))) e A 36 x ( A 36 x (( RAZ 44 x ROYAL RED Susceptibl 3911-12 2547 +57 2.3 Ns )x( CATRACHITA x WILK 2 ))) e A 36 x ( A 36 x (( RAZ 44 x ROYAL RED Susceptibl 3920-21 2550 +60 2.4 Ns )x( CATRACHITA x WILK 2 ))) e A 36 x ( A 36 x (( RAZ 44 x ROYAL RED Susceptibl 3929-30 2107 383 15.4 Ns )x( CATRACHITA x WILK 2 ))) e
Mean backcrosses to A 36 2456
Susceptibl A36 Checks (recurrent parents) 2490 e
RAZ 44 Check Resistant 2804 +314 12.6 Ns
Checks (no recurrent parents)
Susceptibl ROYAL RED 2260 230 9.2 Ns e Susceptibl CATRACHITA 3019 +529 21.2 Ns e Susceptibl WILK 2 1762 728 29.2 Ns e Susceptibl ICA Pijao Check 3392 +902 36.2 Ns e a ns, not significant; *,significant at the 5% level by Dunnett's test. For comparing all treatment means with the mean of a control. CV =7.3%, LSD = 730.5.
94 Another case to confirm the hypothesis of arcelin is when it is incorporated to a family without making a backcross to it (A483), as seen in the results on Table 2.1.7, where yields continue decreasing in an important way, although not statistically significant.
Table 2.1.7. Yield of Andean red mottled bush bean line families and corresponding parents. Families are selected for the presence (resistance) or absence (susceptible) of arcelin to Mexican bean weevil.
Difference respect to Significance Yield respect to Identify Crosses Rating recurrent parent (kg/ha) female parent (Kg/ha) Percentage
a 3795-96 A 483 x (( MAR 1 x RAZ 50 )x (PVA 9576-34-1 x G 17340 )) Resistant 2689 716 21.0 ns
3797-98 A 483 x (( MAR 1 x RAZ 50 )x (PVA 9576-34-1 x G 17340 )) Resistant 2799 606 17.8 Ns
3799-38 A 483 x (( MAR 1 x RAZ 50 )x (PVA 9576-34-1 x G 17340 )) Resistant 2814 591 17.4 Ns
3802-03 A 483 x (( MAR 1 x RAZ 50 )x (PVA 9576-34-1 x G 17340 )) Resistant 3542 +137 4.0 Ns
3808-09 A 483 x (( MAR 1 x RAZ 50 )x (PVA 9576-34-1 x G 17340 )) Resistant 2747 658 19.3 Ns
3793-94 A 483 x (( MAR 1 x RAZ 50 )x (PVA 9576-34-1 x G 17340 )) Susceptible 3225 180 5.3 Ns
Mean of crosses derivates of A 483 2969
A 483 Checks ( female parent) Susceptible 3405
RAZ 50 Check Resistant 3722 +317 9.3 Ns
Checks ( male of two simple cross parents)
MAR 1 Susceptible 3144 261 7.7 Ns
G 17340 Susceptible 2720 685 20.1 Ns
ICA Pijao Check Susceptible 3384 21 0.6 Ns a ns, not significant; *,significant at the 5% level by Dunnett's test. For comparing all treatment means with the mean of a control. CV = 6.6%, LSD = 913.9
Empoasca kraemeri (Leafhopper)
Yield tests were conducted using EMP resistant lines and old EMP lines with different seed color. These were compared with commercial varieties to evaluate if there was any change in relation to yield, throughout different recurrent selection cycles; EMP lines developed tolerance, which expresses the ability of the genotype to have better yields than a susceptible one at all infestation levels of the leafhopper.
Table 2.1.8 shows that the means of EMP lines, when are subject to high levels of Empoasca kraemeri (non-protected), they are significantly higher than the media of commercial lines, showing a better response and reproductive adaptation, having less loss percentage than the commercial varieties.
95 Table 2.1.8. Yields of selected EMP lines and commercial varieties tested for tolerance to Empoasca kraemeri. Reproductive Yield (kg/ha) Line or Seed Damage % yield Susceptibility a adaptation Non- c variety color score b Protected loss index scores protected EMP 103 Yellow 7.3 4.6 1695 1226 27.7 0.91 EMP 209 Cream 6.0 6.2 1896 1315 30.6 0.92 EMP 226 Red 6.4 6.0 1782 1325 25.6 0.87 EMP 231A Red 6.5 4.4 1571 1066 32.1 1.04 EMP 253 Red 7.6 2.6 923 462 49.9 1.68 EMP 270 Red 8.0 2.0 748 397 46.9 1.82 EMP 279 Cream 7.6 5.6 1696 1301 23.3 0.83 EMP 316 White 6.5 6.8 1570 1357 13.6 0.70 EMP 406 Carioca 6.1 6.4 2227 1398 37.2 0.98 EMP 409 Carioca 5.8 6.8 2063 1387 32.8 0.93 EMP 413 Carioca 5.9 7.6 2341 1627 30.5 0.85 EMP 436 Carioca 6.4 6.4 1614 1243 23.0 0.85 EMP 443 Carioca 6.6 7.2 2011 1397 30.5 0.90 EMP 449 Carioca 6.2 7.8 1849 1365 26.2 0.85 EMP 486 Red 5.9 6.6 2213 1454 34.3 0.94 EMP 514 Carioca 6.6 6.2 2252 1311 41.8 1.07 EMP 515 Carioca 6.5 7.0 1762 1527 13.3 0.65 EMP 537 Red 7.4 5.6 1783 921 48.3 1.26 EMP 541 Red 6.0 5.8 2011 1215 39.6 1.04 EMP 571 Cream 5.9 6.6 2168 1507 30.5 0.87 EMP 585 Carioca 6.3 6.8 1994 1284 35.6 0.99 EMP 588 Red 6.4 5.8 2311 1662 28.1 0.81 Mean EMP lines 6.5 5.9 1840 bc 1261 a 31.5 c - Commercial varieties checks Carioca Carioca 7.2 5.0 2000 1142 42.9 1.12 Exrico 23 White 8.0 5.4 1915 1034 46.0 1.21 BiBri Red 7.9 4.4 1539 951 38.2 1.15 FEB 115 Cream 7.0 5.4 1984 1015 48.8 1.23 Mean commercial varieties 7.5 5.1 1860 b 1036 b 44.3 b - ICA Pijao Black 6.7 6.4 2191 a 1434 a 34.6 bc 0.93 BAT 41d Red 8.8 2.8 1609 c 641 c 60.2 a 1.52 CV(%) 5.7 9.5 13.8 14.3 - - LSD% 0.5 0.7 319 218 - - a On a 1-9 visual scale (1, no damage; 9, severe damage); b On a 1-9 visual scale (1, no yield, no pod formation; 9, excellent pod formation and filling, excellent yield); c Calculated with respect to the mean of the trial and the mean Pijao, the tolerant check; d Susceptible check. Mean within a column followed by different letters are significantly different, separation by Schaffé’s F method of significance testing for arbitrary linear contrasts with 139 df (P < 0.05).
96 Activity 2.2. Screening for sources of resistance to major insect pests
Contributors: J. M. Bueno, J. F. Valor and C. Cardona.
Highlight:
New accessions and lines with insect resistance were identified
Rationale
Identification of sources of resistance to major insect pests of beans is a continuous activity. Additional work is conducted trying to identify and characterize the mechanisms of resistance to specific major pests.
Materials and Methods
Bruchids nurseries are tested in the laboratory simulating normal storage conditions (20ºC. 80% R.H. and 14% seed humidity). Genotypes are tested using 3-5 replications of 50 seeds per genotype. Evaluation units (replicates) are infested with seven couples of Z. subfasciatus per each 50 seeds or two eggs per seed in the case of A. obtectus. T. palmi, leafhopper and pod weevil nurseries are planted in the field under high levels of natural infestation, usually with 3-4 replicates per genotype in randomized complete block designs. Evaluations for resistance include damage score and bean production ratings, insect counts, damage counts and in some cases, yield components and yields.
Results and Discussion
Acanthoscelides obtectus (Storage weevils)
The search for sources of resistance to A. obtectus continued in 2006. No useful sources of resistance to A. obtectus were found among 25 wild P. vulgaris and 20 P. acutifolius accessions tested.
Empoasca kraemeri (Leafhopper)
No useful sources of resistance to the leafhopper were found among about 200 accessions of bean germplasm evaluated in 2006. In trials done under field conditions in CIAT’s headquarters, mesoamerican parents with different resistance sources were evaluated with 378 lines in replicate nurseries. From these, 28 were selected to be evaluated again and confirm their resistance in 2007.
97 Activity 2.3. Screening for virus resistance transmitted by Bemisia tabaci biotype B in snap beans
Contributors: P. Sotelo, J. M. Bueno, C. Cardona, M. Castaño, F. Morales and S. Beebe
Highlight:
Conducted successful screening for sources of resistance to the new virus disease affecting snap beans
Rationale
In Colombia’s Cauca Valley region, the area planted with beans and snap beans has been drastically reduced. This is caused by the bean-leaf crumple virus, a Begomovirus transmitted by Bemisia tabaci biotype B. It is urgent to develop varieties of snap beans that resist the virus to replace the “Blue Lake” variety that is preferred in the zone. It is also necessary to know the inheritance mechanism of this virus in order to develop an improvement method.
Materials and Methods
With the cooperation of the Bean Improvement Section and the Virology Unit, 148 genotypes were evaluated. These genotypes are backcrosses derived from families G17723 x EAP9510-77 and G17723 x TIO CANELA 75 with snap bean characteristics of resistance to the new virus. The nurseries were planted in the “La Tupia” and “Pradera” zones with a high incidence of virus and high natural levels of Bemisia tabaci biotype B. In addition, in this zone we study the inheritance of the resistance to the new Begomovirus in snap beans in the Cauca Valley. For this study, we obtained simple crosses of a susceptible parent (Blue Lake) with a resistant parent (Porrillo Sintético). We also obtained populations (F1, F2 and backcrosses with susceptible and resistant parents) to be evaluated in a randomized complete block design in 3 repetitions. Evaluations were done to each plant on the 30th and 50th day after planting. The symptoms of the virus were evaluated using a visual scale from 1 to 5 (1 = no apparent damage; 5 = severe damage), dwarfism (stunts) and pod deformation.
Results and Discussion
At first in generation F2, we evaluated all the obtained genotypes from families G17723 x EAP951077 and G17723 x TIO CANELA 75. We selected and harvested 8 genotypes from the crosses G17723 x EAP951077 and 32 genotypes from the cross with the TIO CANELA 75 parent. They were planted again in F3 and 9 individual selections were done in 4 genotypes derived from the cross with the TIO CANELA 75 parent. These materials will continue being evaluated. In the inheritance study, the analysis of variance
98 and media separation for each evaluated characteristic showed that the scores for resistant and susceptible parents are highly contrasting and that the backcrosses show a tendency to score in a similar way to the parents that had been backcrossed (Table 2.3.1).
Table 2.3.1. Media differences in population derived from the Blue Lake x Porrillo Sintético cross for each evaluated characteristic. No. Leaf Pod Generation Mosaica Dwarfismc plants deformationb deformationd L.A. (S) 122 4.20 ae 4.10 a 3.54 a 4.73 a
L.A.x (L.A.xP.S.)F1 253 3.13 b 3.04 b 2.89 b 4.51 b
L.A.x P.S. F1 148 3.09 b 2.86 b 2.57 c 3.60 c
L.A.x P.S. F2 243 2.52 c 2.14 c 1.84 d 3.48 c
P.S.x (L.A.xP.S.)F1 323 2.19 d 1.55 d 1.38 e 2.96 d P.S.(R) 150 2.09 d 1.27 e 1.22 e 2.57 e The evaluation scores are as follows; a1= no presence of mosaic, 9 = mosaic in all the plant; b1 = No evident damage, 9 = deformation of all the leaves; c1 = normal development of the plant, 9 = severe stunting; d1 = Undamaged pods, 9 = severe deformation of most of the pods; emeans within a column followed by the same letter are not significantly different df= 1152, (P<0.05).
A genetic analysis was also done with the media and generational variances method by the means of the statistical program Genes, calculating the phenotypic and genotypic environment variances as well as the inheritance in an ample and narrow meaning, which is very useful information to improvers (Table 2.3.2).
Table 2.3.2. Genetic parameters of F2 variances derived from the Blue Lake x Porrillo Sintético cross for each evaluated characteristic. Leaf Parameter Mosaic Dwarfism Pod deformation deformation Phenotypic variance 0.589 1.289 1.32 1.102 Environmental variance 0.628 0.698 0.548 0.500 Genotypic variance -0.039 0.592 0.585 0.602 Additive variance 0.439 1.053 0.832 1.293 Ample inheritability (%) -6.578 45.89 51.622 54.652 Narrow inheritability (%) 74.569 81.65 73.438 117.33 Amount of genes 2.560 1.90 2.504 1.546
The analysis estimated the amount of genes involved in the expression of resistance to the virus.
In addition to the study, 7 individual selections were done in F1, 18 in F2, 3 in backcrosses towards the susceptible parent and 32 in backcrosses towards the resistant
99 parent. These materials will continue being evaluated and backcrossed again if necessary.
Activity 2.4. Evaluation of Brachiaria hybrids for resistance to Rhizoctonia solani under field conditions in Caqueta
Contributors: G. Segura, W.Mera, X. Bonilla, J. Miles, S. Kelemu
Rationale
Rhizoctonia foliar blight, caused by Rhizoctonia solani Kühn, is an important disease on a wide range of crops around the globe. The disease can be very destructive when environmental conditions are particularly conducive (high relative humidity, dense foliar growth, high nitrogen fertilization, and extended wet periods).
R. solani is a basidiomycete fungus that does not produce any asexual spores (called conidia). In nature, the fungus reproduces mainly asexually and exists as vegetative mycelia and/or dense sclerotia. In the absence of a susceptible host, these sclerotia, that are irregular-shaped, brown to black structures, can survive in soil and on plant debris for several years. The fungus can also survive as mycelia by colonizing soil organic matter as a saprophyte. When a susceptible host is available, sclerotia can germinate and produce hyphae that can infect host plants. The fungus is a very common soil-borne pathogen that primarily infects below ground plant parts in a great diversity of plant species, but can also infect above ground plant parts such as pods, fruits, and leaves and stems as is the case with Brachiaria. In Brachiaria, infected leaves first appear water-soaked, then darken, and finally turn to a light brown color. As symptoms progress, lesions may coalesce quickly during periods of prolonged leaf wetness and temperatures between 21 and 32 C.
Disease management through the use of host resistance, when available, remains to be the most practical and environmentally friendly strategy. A number of constitutive factors including cell wall calcium content, and cuticle thickness may contribute to resistance. Other factors expressed after infection also play a role in resistance. These components of resistance may also be influenced by factors such as age and maturity of the plant as well as other external factors such as plant nutrition and environmental conditions (e.g. field vs controlled environmental growth conditions). Differences in reaction to R. solani exist in genotypes of Brachiaria. The ability to uniformly induce disease and measure resistance accurately is crucial in a breeding program for developing resistant cultivars. Measurement of resistance is based on quantification of disease symptoms or the growth and expansion of the pathogen on its host. The objectives of this study are to: 1) artificially inoculate and induce uniform disease development in selected Brachiaria genotypes generated by CIAT’s tropical forages project, 2) accurately measure resistance and identify resistant materials among these Brachiaria genotypes.
100 Materials and Methods
Plant materials: Two-hundred nine Brachiaria genotypes (127 with BR05 series and 82 with RZ 05 series) provided by the breeding program were planted in the field at Macagual ICA/CORPOICA Research Station in Florencia, Caquetá. CIAT 16320, CIAT 36061 and CIAT 36087 were included as controls. The field location is highly conducive to the development of the disease, with mean annual relative humidity of 84 %, an average temperature of 25oC and an annual rainfall of 3793 mm.
Field layout, artificial inoculations and disease evaluations: Twelve plants (that were generated from the same mother plant) of each of the Brachiaria genotypes were transplanted from a CIAT glasshouse to the field site in Caquetá. The space between plants was 80 cm, and 2 m between blocks. The entries were replicated 4 times in a randomized complete block design. Plants were inoculated one month after transplanting by placing 0.7 g dry sclerotia of R. solani isolate 36061 on the soil surface at the base of each plant. Plants were evaluated for disease reaction 15, 25, 35, 45, 55 and 65 days after inoculations, using the 0 – 5 (0 = no visible infection; 5 = 20 -100% of the aerial portion of the plant infected) scale that we developed earlier and reported in the 2004 Annual Report.
Results and Discussion
Disease symptoms developed in susceptible genotypes 10-15 days after inoculations. There was a high degree of correlation in disease evaluation data among the various evaluation dates.
The resistant control CIAT 16320 was consistently evaluated at scale less than 2. Ten genotypes, RZ05/3635, BR05/0262, RZ05/2721, RZ05/3551, RZ05/3634, RZ05/3738, RZ05/2738, RZ05/2919, RZ05/3394, and RZ05/3575 were evaluated at an average between 2.0 and 2.5. Eighty-one others, R05/0048, BR05/0377, BR05/0555, BR05/0591, BR05/1482, CIAT 36087, BR05/0753, BR05/0760, BR05/0777, BR05/1359, RZ05/2699, RZ05/2816, RZ05/2842, RZ05/3021, RZ05/3362, RZ05/3397, RZ05/3405, BR05/0156, BR05/0537, RZ05/3063, BR05/0114, BR05/0115, BR05/0118, BR05/0379, BR05/0629, BR05/0714, BR05/0744, BR05/0913, BR05/0914, BR05/1455, RZ05/2682, RZ05/2764, RZ05/2942, RZ05/3173, BR05/0071, BR05/0092, BR05/0408, BR05/0549, BR05/0586, BR05/0701, BR05/1352, RZ05/3226, RZ05/3343, RZ05/3472, RZ05/3524, RZ05/3579, BR05/0731, BR05/0746, RZ05/3361, RZ05/3645, BR05/0303, RZ05/0462, RZ05/3158, RZ05/3541, RZ05/3576, RZ05/3434, BR05/0605, BR05/0707, BR05/1467, BR05/1717, RZ05/2838, BR05/0830, BR05/1433, BR05/1434, BR05/1469, BR05/1494, BR05/1865, BR05/1872, RZ05/2786, RZ05/3106, RZ05/3262, RZ05/3335, RZ05/3452, RZ05/3483, RZ05/3539, BR05/0150, BR05/1149, RZ05/2937, RZ05/3630, BR05/0475, BR05/0561 scored with an average rating scale of 2.6-2.9. All remaining 118 materials, BR05/1830, BR05/0637, BR05/0642, BR05/0933, BR05/1440, BR05/1609, BR05/0406, BR05/0733, BR05/1449, BR05/0265, BR05/1401, RZ05/2938, RZ05/2985, BR05/1853, RZ05/3101, RZ05/3332, BR05/1879, RZ05/3371, RZ05/3528, RZ05/3608, RZ05/3333, RZ05/3590, BR05/1426, BR05/1462, BR05/1611, RZ05/2932, BR05/0508, BR05/0545, BR05/0671,
101 BR05/0708, BR05/1460, RZ05/2801, RZ05/2847, RZ05/3107, RZ05/3355, RZ05/3574, BR05/0120, BR05/0284, BR05/0351, BR05/1574, BR05/1706, RZ05/3128, RZ05/3312, RZ05/3495, BR05/0117, BR05/0334, BR05/0609, BR05/0931, BR05/1464, RZ05/3244, RZ05/3466, BR05/0702, BR05/1302, RZ05/2802, RZ05/3485, RZ05/2992, BR05/0990, BR05/1520, BR05/1857, RZ05/3365, BR05/0354, BR05/0743, BR05/1173, BR05/1308, BR05/1402, BR05/1447, BR05/1623, RZ05/3589, BR05/1249, BR05/1586), BR05/0577, BR05/0627, BR05/0995, BR05/1344, BR05/1435, BR05/1444, BR05/1475, BR05/1738, RZ05/2831, RZ05/3311, BR05/0563, BR05/1361, BR05/1420, BR05/1479, BR05/1835, BR05/0244, BR05/0267, BR05/0891, BR05/1019, BR05/1429, BR05/1826, BR05/1493, BR05/1702, RZ05/3377, BR05/1376, BR05/0020, BR05/0159, BR05/0293, BR05/1040, BR05/1480, RZ05/3359, BR05/0209, BR05/1490, RZ05/2668, RZ05/2873, RZ05/3253, BR05/1331, BR05/1610, BR05/1883, RZ05/3398, CIAT 36061, RZ05/2641, RZ05/3378, RZ05/3391, RZ05/3367, RZ05/3629, BR05/1059, BR05/1647, RZ05/3585, RZ05/3616 scored between 3.0-5.0. Figure 2.3.1 shows a graphical representation of the results using data from representative genotypes from each of these groups.
6.00
5.00
4.00
3.00
2.00
1.00
0.00 RZ05/3635 RZ05/2721 RZ05/3551 RZ05/3634 RZ05/3738 RZ05/2738 RZ05/2919 RZ05/3394 RZ05/3575 RZ05/3585 RZ05/3616 BR05/0262 BR05/0048 BR05/0753 BR05/0577 BR05/0627 CIAT 16320 CIAT 36087 CIAT 36061
Figure 2.4.1. Ratings of Brachiaria genotypes for foliar blight disease reaction on a 1-5 scale 65 days after inoculations with sclerotia of Rhizoctonia solani under field conditions, Caquetá, Colombia. Bars indicate standard deviation.
The disease evaluation data taken 65 days after inoculations represented well-developed disease symptoms that correlated well with data taken at various dates.
102 Activity 2. 5. Bacterial endophytes in Brachiaria
Contributors: J. Abello, P. Fory and S. Kelemu
Rationale
Bacterial endophytes are known to reside in plant tissues without doing harm to their host. These bacteria are often isolated either from surface-sterilized tissues or extracted from internal plant parts. They can enter plants mainly through the root zone, although other plant parts such as stems, flowers and cotyledons can also be entry points. In general, many of the entry points for pathogenic bacteria can serve the same purpose for the endophytic ones. Several different endophytic bacteria may reside within a single plant. These endophytes may either remain localized at their entry points or spread in other parts of the plant. Various bacterial endophytes have been reported to live within cells, in the intercellular spaces or in the vascular system of various plants. Although variations in the endophyte populations have been reported in various plants depending on a number of factors, generally bacterial populations are higher in roots and decrease in stems and leaves.
Several endophytic bacteria have been reported to enhance growth and improve plant health in general (Sharma and Novak, 1998. Can. J. Microbiol. 44:528-536; Stoltzfus et al., 1998. Plant Soil 194:25-36). Many plant-growth-promoting bacteria (PGPB) that include a diverse group of soil bacteria are thought to stimulate plant growth by various mechanisms such as plant protection against pathogens, providing plants with fixed nitrogen, plant hormones, or solubilized iron from the soil.
Endophytic bacteria that reside in plant tissues without causing any visible harm to the plant have been isolated from surface-sterilized Brachiaria tissues. Three bacterial isolates 01-36062-R2, 02-36062-H4, and 03-36062-V2 were isolated from Brachiaria CIAT 36062 in roots, leaves and stems, respectively, that tested positive for sequences of the nifH gene (the gene that encodes nitrogenase reductase) [IP-5 Annual Reports 2003, 2004]. Because nitrogen fixation is performed by diverse groups of prokaryotic organisms, detection of a marker gene that is unique and is required for nitrogen fixation may be useful to conduct our studies. The nifH gene has been used with a number of PCR primers that amplify the gene from microbes and other samples by a number of researchers.
The green fluorescent protein (GFP) gene, isolated from the jellyfish Aequorea Victoria, or its derivatives have been expressed in a wide array of organisms including plants and microbes. This work describes the establishment of a transformation protocol and expression of the green fluorescent protein (GFP) gene in an isolate of a bacterial endophyte associated with species of Brachiaria. The purpose of this study is to evaluate the use of GFP in host-parasite interactions.
103 Materials and Methods
Bacterial isolate and growth conditions: a bacterial isolate designated as CIAT 36062R2 (PE 1 Annual Report 2005), isolated from roots of Brachiaria hybrid CIAT 36062, was marked for antibiotic resistance (rifampicin, rifr). This isolate tested positive for nifH gene (the gene that encodes nitrogenase reductase) sequences (IP-5 Annual Report 2005; Kelemu et al., 2006, Phytopathology 96:S59) Bacterial cells were collected from a single colony and cultured on Luria agar medium containing rifampicin (LB; tryptone 10 g/l, NaCl 5g/l, yeast extract 5 g/l and agar 15 g/l; rifampicin 50 g/ml) and incubated at 28 oC for 24 hours in darkness.
Plasmid: Plasmid pGT-Kan was kindly provided by Dr. Steve Lindow of the University of California, Berkeley. pGT-kan was constructed using plasmido pPROBE-GT (Miller et al., 2000, Molecular Plant-Microbe Interactions 13: 1243-1250) as a base and it contains gfp under the promoter nptII and confers resistance to Kanamycin as well as gentamycin.
Transformation of the bacterial endophyte CIAT 36062R2: E. coli strain DH5α was electrotransformed with the plasmid pGT-kan for maintenance of the plasmid. CIAT 36062R2/rifr was electrotransformed using a protocol described by Dulk-Ras and Hooykaas (1995, Methods Molecular Biology. 55: 63-72) with some modifications. To prepare competent bacterial cells, the cells were grown in LB medium at 28oC with shaking at 250 rpm for 16 hours till a growth density of OD600= 0.5. The cells were collected after centrifugation at 4,000 rpm, 4oC for 15 minutes. The cells were rinsed three times with 20 ml solution of 10% glycerol and 1mM HEPES (pH: 7.0). They were then resuspended in 3 ml of 10% glycerol, 200 l aliquots were made and stored at -80oC for subsequent use. Electroporation was conducted using a BIO-RAD® gene pulser at 12,5 Kv/cm, 200 of resistance and 25 F of capacity. Forty l of competent cells were mixed with 100ng/l of plasmid pGT-kan and electric pulse was applied to the mixture. The cells were then transferred to a 1 ml LB medium and incubated for 3 hours at 28oC. One hundred l of this culture was plated on Luria agar plates containing 50 g/ml rifampicin and 15 g/ml of gentamycin for selection of transformants. Putative transformants appeared on the selection plates after 48 hours of incubation.
PCR analysis of bacterial transformants: Genomic DNA was isolated from putative transformants using a protocol described by Cheng et al. (2006, Biotechnology Letters. 28: 55-59.). Identification of GFPmut1 gene in transformants was conducted using specific primers T14GFP5´ (5´ATTCCCTAACTAATAA- TGATTAACTTTATAAGGAGGAAAAAC 3´) and T1GFP3´ (5´ GATGCCTGGA- ATTAATTCCTATTTGTATAGTTCATCC 3´) (Miller et al., 2000, Molecular Plant- Microbe Interactions. 13: 1243-1250). Amplifications were carried out in a Programmable Thermal Controller (MJ Research, Inc) programmed to 30 cycles comprised of I minute denaturation step at 95oC (3 minutes for the first cycle), followed by 2 min at 50oC, and primer extension for 3 minutes (10 minutes in the final cycle) at
104 72oC. The amplification products were separated by electrophoresis in a 1.0% agarose gel (Bio-Rad Laboratories), stained with ethidium bromide, and photographed under UV lighting.
Plant inoculation: Tillers of about a month old were prepared from a single mother plant of Brachiaria hybrid CIAT 36061 (cv. Mulato), their roots washed with sterile distilled water and made ready for inoculations. The roots of these tillers were immersed in a beaker containing 200 ml of bacterial (transformant 36062R2/gfp) suspensions. All plants were kept immersed for 48 hours, after which they were removed and rinsed 3 times with sterile distilled water. They were then each transplanted to pots containing sterile sand and soil in 3:1 proportion and maintained in the greenhouse under natural daylight and at temperatures between 19 and 30°C. At 1, 2 3 and 5 months after inoculations, tissue samples were taken and examined under the microscope.
Test for stability of bacterial transformants: Transformant colonies were isolated and plated on Luria agar media without selection antibiotics and subsequently transferred for several cycles on media without selection pressure. These colonies were then examined for expression of GFP.
Microscope examination: The putative GFP-expressing transformants were examined under a LEICA fluorescence microscope fitted with a Leica D filter with an excitation range between 355 and 425 nm, and an H3 filter with an excitation range between 420 and 490 nm. For observations of GFP expressions inside plant tissues, young roots and leaves were sectioned with diameters of approximately 0.5-1.5 mm
Results and Discussion
Transformation of endophytic bacterium CIAT 36062R2/rifr: Putative transformants appeared on selection plates after 48 hours of incubation. Colonies with a diameter of approximately 1-mm were isolated for analysis. Bacterial cells grown to an optical density (OD600) = 1.0 were examined for green fluorescence. All cells examined demonstrated strong fluorescence indicating successful expression of gfp. Control colonies showed no fluorescence. The GFP protein (27 kDa) is a spontaneously fluorescent protein that absorbs light at maxima of 395 and 475 nm and emits at a maximum of 508 nm. This protein is a success as a reporter because it requires only UV or blue light and oxygen, but requires no cofactors or substrates as many other reporters do for visualization.
PCR analysis of putative transformants: The putative bacterial transformants selected on the selection media were further examined using fluorescence microscope, and PCR analysis. DNA isolated from these transformants was examined for gfp sequences using PCR analysis. Transformants that contain gfp gene sequences produced an amplified DNA product of 750 bp-size, confirming successful transformation of endophytic bacterial cells with gfp. Negative controls produced no amplified product. The PCR method allowed us to quickly examine and further confirm putative transformants that have been selected on antibiotic selection media.
105 Test for stability of transformants: Selected bacterial transformants were cultured sequentially 15 times on media without selection antibiotics. Although stable in expression of gfp, the fluorescence intensity declined after the 9th transfer on media without the selection pressure for some of the transformants. This indicates that the gene of interest was not incorporated with the bacterial genome in some of these colonies that showed a decline in fluorescence intensity when maintained on media without antibiotic selection.
Microscopic examination: Microscopic examinations of selected bacterial transformants demonstrated strong expression of gfp as evidenced by the intense fluorescence emission at a range of wavelength (Figure 2.5.1; Figure 2.5.2) he strongest emission was observed at a 355-425 nm range with Leica D filter. The emission intensity was somewhat lower when a filter Leica H3 was used with a 420-490 nm range.
Root and leaf tissues from Brachiaria plants inoculated with endophytic bacterial cells transformed with gfp were examined under the microscope at 1, 2, 3 and 5 months after inoculations. Bacterial cells were localized in intercellular spaces. No fluorescent bacteria were observed in young leaves during the period of evaluations. It is possible that the transformed bacteria largely remained localized in the root zone within the period of the evaluations.
Although the transformation protocol functioned well for the endophytic bacteria, the recombination of the introduced gene to that of the bacterial genome was not evident, as the transformed bacteria lost their green fluorescence with time. Preliminary data showed that Brachiaria tissues taken from plants inoculated with GFP-transformed bacterial endophytes expressed fluorescence emission (Figure 2.5.1) This will allow us to study the endophyte-Brachiaria interaction, endophyte distribution within the plant tissue, and the correlation of endophytic bacterial colonization with Brachiaria plant growth and other related benefits.
Although various transformation systems have been developed and reported for many microbes, successful application of the technology is still not routine in many species. Furthermore, developing an efficient transformation system for a previously untransformed microbe can be a technical obstacle. This work describes the transformation and expression of the GFP-encoding gene in an isolate of an endophytic plant growth promoting bacterium associated with species of Brachiaria. To the best of our knowledge, this is the first report on transformation of this endophytic bacterium. This is also the first report of a plant growth promoting endophytic bacterium associated with Brachiaria that contains nif-gene sequences.
106 a. b.b. c.
Figure 2.5.1. Brachiaria tissues from plants inoculated with bacterial endophyte transformed with green fluorescent protein gene egfp). a) fluorescence emission under UV light with Leica H3 filter, b) under normal lighting, c) fluorescence emission under UV light with Leica D filter.
0.5μm
a. b.
Figure 2.5.2. Endophytic bacterial cells transformed with a gfp gene. a) initial colonization of Brachairia roots inoculated with transformed bacterial cells one month after inoculation; b) a single bacterial cell (average length of 2,5 μm). Photographed with Leica D filter.
107 Activity 2. 6. Endophytic plant growth promoting bacteria associated with Brachiaria
Contributors: P. Fory, X. Bonilla, S. Kelemu, J. Ricaurte, R. Garcia and I. Rao
Rationale
In both managed and natural ecosystems, plant-associated bacteria play key roles in host adaptation to changing environments. These interactions between plants and beneficial bacteria can have significant effect on general plant health and soil quality. Associative nitrogen-fixing bacteria may provide benefits to their hosts as nitrogen biofertilizers and plant growth promoters. Several endophytic bacteria have been reported to enhance growth and improve plant health in general (Sharma and Novak, 1998. Can. J. Microbiol. 44:528-536; Stoltzfus et al., 1998. Plant Soil 194:25-36). Many plant-growth-promoting bacteria (PGPB) that include a diverse group of soil bacteria are thought to stimulate plant growth by various mechanisms such as plant protection against pathogens, providing plants with fixed nitrogen, plant hormones, or solubilized iron from the soil.
Brachiaria grasses of African savannahs have supported millions of African herbivores over thousands of years. Some of these Brachiaria species have many desirable agronomic traits. For example, they are persistent and can grow in a variety of habitats ranging from waterlogged areas to semi-desert. These grasses that are often grown under low-input conditions are likely to harbour unique populations of nitrogen-fixing or plant growth promoting bacteria. The aim of our study is to examine the effects of endophytic bacteria that were isolated from species of Brachiaria on plant development.
In 2005 Annual Report, we demonstrated the effect of endophytic bacteria on the growth of Brachiaria hybrid CIAT 36061 (cv. Mulato). Brachiaria hybrid CIAT 36061 had indigenous endophytic bacteria that are difficult to eliminate. Because of the difficulty to eliminate these indigenous bacteria, we set out to introduce three different strains of bacteria, originally isolated from Brachiaria hybrid CIAT 36062, into CIAT 36061, in addition to the indigenous bacteria that this hybrid already has. In general, the introduction of these bacteria had a positive effect on plant growth and development in the recipient plant CIAT. More tiller and root development were observed in artificially inoculated CIAT 36061 plants than plants containing only indigenous endophytic bacteria.
In nitrogen- and other nutrient-deficient conditions, Brachiaria plants inoculated with the three bacterial strains had significantly higher average values in all evaluated parameters (with the exception of soluble proteins in leaves) than those control plants containing just indigenous bacteria (PE-1 Annual Report 2005).
Analysis of variance showed that the total biomass production (leaf, stem and root) collected from control Brachiaria CIAT 36061 plants was significantly (P< 0.05) less than that from inoculated ones (PE -1 Annual Report 2005). The data presented indicate that a close and beneficial interaction existed between the introduced as well as
108 indigenous endophytic bacteria and Brachiaria hybrid CIAT 36061, resulting possibly in nitrogen fixation and enhancement of plant growth.
In this study, we artificially introduced strains of endophytic bacteria into Brachiaria brizantha CIAT 6294 cultivar Marandu and examined the effect on plant growth.
Materials and Methods
Plant materials: Twelve Brachiaria brizantha CIAT 6294 (cv. Marandu) that are approximately one month old were used for inoculation. These plants were selected after examining with nested PCR, and showed no amplified products for sequences of nifH (the gene that encodes nitrogenase reductase) gene, indicating the absence of endophytic bacteria containing these sequences.
Bacterial inoculum preparation: Three endophytic bacterial isolates 01-36062-R2, 02- 36062-H4, and 03-36062-V2 that were originally isolated from Brachiaria CIAT 36062 in roots, leaves and stems, respectively, and that tested positive for sequences of the nifH gene (the gene that encodes nitrogenase reductase) are maintained at -80°C in 20% glycerol. Bacterial cells were removed from each of the stored samples, plated on nutrient agar medium (Difco, Detroit, MI) and incubated for 24 h at 28°C. The cells from each of the bacterial strains were collected from the plates, suspended in sterile distilled water and adjusted to a concentration of optical density (OD600) = 1.0 with a spectrophotometer. Plant inoculation: Twelve tillers of Brachiaria brizantha CIAT 6294 that are about a month old were prepared, their roots washed with sterile distilled water and made ready for inoculations. The roots of six of these tillers were immersed in a beaker containing a mixture of equal volumes (50-ml each) of the three strains of endophytic bacterial suspension described above. The remaining six plants were immersed in a beaker containing the same volume of sterile distilled water. All plants were kept immersed for 48 hours, after which they were removed and rinsed 3 times with sterile distilled water. They were then each transplanted to pots containing sterile sand (95%) and soil (5%) and maintained in the greenhouse under natural day light and at temperatures between 19 and 30°C. No nutrients were applied.
Plant evaluations: Sixty days after inoculations of B. brizantha CIAT 6294, the following measurements were taken in control and treated plants: 1) plant growth and development such as plant height, number of tillers, number of leaves, leaf area model LI-300 (LI- COR, inc., Lincoln, NE), 2) leaf chlorophyll content 3) nitrogen content, and 4) soluble protein content in leaves.
Plant height was measured in centimeters from stem base to the highest part of the plant. Number of leaves per plant and the number of tillers were determined. Leaf area was determined in cm2/plant and measured using a LI-300 leaf area meter (LI-COR, inc., Lincoln, NE). In addition, dry matter distribution among leaves, stems and roots was determined after drying each tissue separately in an oven at 70ºC for 48 hours. Leaf chlorophyll content was measured with a chlorophyll meter SPAD 502 (Minolta), taken across the third fully developed leaf as an average of 6 measurements. Soluble leaf
109 protein was measured as described by Rao and Terry (Plant Physiol 90: 814-819). Nitrogen content in leaves and stems was determined using methods described by Salinas and García (1985, CIAT, Working document 83 p).
Bacterial population in the roots: Approximately 1 g of root samples was taken from each individual plant Brachiaria brizantha CIAT 6294, surface sterilized (in 1% NaOCl solution for 2 min, in 70% ethanol for one min, then rinsed 3 times in sterile distilled water) and macerated in mortar and pestle in 1 ml of sterile distilled water. One hundred- μl of this macerated sample was taken and a dilution series performed. These were plated on nutrient agar medium and incubated for 24 h at 28°C to determine bacterial colony growth, and calculate the number of bacterial cell per gram of root weight.
Experimental design and statistical analysis: The experiment had two treatments (with and without artificial inoculations) each with 6 plants (6 repetitions) and arranged in a completely randomized design. Analysis of variance was determined using Statistics Analysis System (SAS). A t-test was conducted.
Results and Discussion
B. brizantha CIAT 6294 had no indigenous endophytic bacteria that have nifH gene sequences. We introduced three strains of bacteria, originally isolated from Brachiaria hybrid CIAT 36062, into CIAT 6294. In general, the introduction of these bacteria had a positive effect on plant growth and development in the recipient plant CIAT 6294. There was more tiller and root development in artificially inoculated CIAT 6294 plants than control plants.
Analysis of variance showed that the total biomass production (leaf, stem and root) collected from control Brachiaria CIAT 6294 plants was significantly (P< 0.05) less than that from inoculated ones (Figure 2.6.1). The data presented indicate that a close and beneficial interaction existed between the introduced bacteria and B. brizantha CIAT 6294, resulting possibly in nitrogen fixation and enhancement of plant growth. These results are consistent with the results reported in PE 1 Annual Report 2005 with Brachiaria hybrid CIAT 36061 (cv. Mulato)
In nitrogen- and other nutrient-deficient conditions, Brachiaria plants inoculated with the three bacterial strains had significantly higher average values in all evaluated parameters, plant height, number of tillers, number of leaves, and leaf area than those control plants (Figure 2.6.2).
Analysis of variance showed that the chlorophyll content (SPAD units) collected from control Brachiaria CIAT 6294 plants (43.4 SPAD units) was significantly (P< 0.05) less than that from inoculated ones (50.34 SPAD units).
These data strongly suggest that endophytic bacteria have a direct beneficial effect on plant growth and development, and possibly on associated nitrogen fixation in Brachiaria. The possibility that this plant growth is through associated nitrogen fixation
110 is further corroborated by the endophytic bacteria sequence data described in the report in section IV.
40 Leaf dry weight Stem dry weight b Root dry weight 30
20 a
Total biomass (g/plant) 10
0 Control plants Inoculated plants
Figure 2.6.1. Total tissue biomass production in Brachiaria brizantha CIAT 6294 control plants, and inoculated with a mixture of 3 bacterial strains 01-36062-R2, 02- 36062-H4, and 03-36062-V2 (originally isolated from Brachiaria CIAT 36062), 60 days after inoculations and maintained under greenhouse conditions with no nutrients. Values are average of 6 plants per treatment.
111 control inoculated
180 b 60 b 150 a 120 40 a
90
60 20 Plant height (cm) # of leaves/plant 30
0 0
10 1800 b b
8 1500 ) 2 1200 6 a a 900 4
Leaf area (cm 600 # of tillers /plant
2 300
0 0
Figure 2.6.2. Effect of bacterial isolates (a mixture of 3 bacterial strains 01-36062-R2, 02-36062-H4, and 03-36062-V2 (originally isolated from Brachiaria CIAT 36062) on the growth of Brachiaria brizantha CIAT 6294 60 days after inoculations and maintained under greenhouse conditions with no nutrients. Values are average of 6 plants per treatment.
112 Activity 2.7. Characterization and comparison of partial sequence of nifH gene in four strains of endophytic bacteria associated with Brachiaria genotypes.
Contributors: P. Fory and S. Kelemu
Rationale
A number of prokaryotes are known to be involved in nitrogen fixation as well as enhancement of plant growth. Nif genes which encode the nitrogenase complex (encoded by approximately 20 different nif genes) and other enzymes involved in nitrogen fixation has consensus sequences identical from one nitrogen fixing bacteria to another, but while the structure of the nif genes is similar, the regulation of the nif genes varies between different nitrogen fixing organisms.
We have reported the isolation of three strains of bacteria from Brachiaria hybrid CIAT 36062 (BR97-1371) from roots, leaves and stems that were designated 01-36062-R2, 02- 36062-H4, and 03-36062-V2, respectively. Using nested PCR and three primers designed for the amplification of the nifH gene sequences, amplified products were generated with template DNA from these bacterial strains. We have also reported previously (IP-5 Annual Report 2004) that fatty acid analysis conducted on these 3 strains resulted in matching them with various bacteria that are known to be nitrogen fixers and/or plant growth promoters (for example with Flavimonas oryzihabitans).
We reported (IP-5 Annual Report 2005) the cloning and sequencing of a 371 bp nested PCR amplified product (with nifH gene specific primers) isolated from an endophytic bacterium strain 01-36062-R2 associated with Brachiaria hybrid CIAT 36062. Using this sequence data, specific primers were designed and synthesized in order to develop a simple diagnostic tool that enables us to do one step PCR analysis and avoiding nested PCR methods, that will eventually allow us to detect, evaluate and select Brachiaria genotypes that harbor nifH gene containing endophytic bacteria (PE 1 Annual Report 2005). In this study, we continued to clone and analyze the sequences of nifH gene in other native strains of endophytic bacteria associated with Brachiaria genotypes.
Materials and Methods
Bacterial isolates: For cloning and sequence analysis, endophytic bacterial strains isolated from roots, leaves and stems of Brachiaria hybrids CIAT 36062 (designated 01- 36062-R2, 02-36062-H4, 03-36062-V2) and a strain isolated from Brachiaria hybrid CIAT 3061 were used for this study.
Bacterial DNA extractions: DNA extraction was conducted using a modified protocol based on combinations of standard methods, which includes growing bacterial cells in liquid media LB (tryptone 10g, yeast extract 5g, NaCl 10g, 10 ml of 20% glucose in 1 L of distilled water), treatment of cells with a mixture of lysozyme (10 mg.ml in 25 mM Tris-Hcl, ph 8.0) and RNase A solution, and extraction of DNA with STEP (0.5% SDS, 50 mM Tris-HCl 7.5, 40 mM EDTA, proteinase K to a final concentration of 2 mg/ml
113 added just before use. The method involves cleaning with phenol-chloroform and chloroform/isoamyl alcohol and precipitation with ethanol. The quality of DNA was checked on 1 % agarose gel.
Nested PCR Amplification: Three primers were used, which were originally designed by Zehr and McReynolds (1989, Appl. Environ. Microbiol. 55: 2522-2526) and Ueda, et al. (1995, J. Bacteriol. 177: 1414-1417), to amplify fragments of nifH genes. Amplification steps described by Widmer et al (1999, Applied and Environmental Microbiology 65:374-380) were adopted. The final product of the nested PCR amplification is about 370 bp in size.
Amplification of DNA inserts for sequencing: PCR reactions (25-l) contained 20 ng/l plasmid DNA, 1 X PCR buffer, 1.5 mM MgCl2, 0.1 mM dNTPs, primers T7 (5'- GTAATACGACTCACTATAGGGC-3') and Sp6 (5' –TATTTAGGTGACACTATAG-3') each at 0.1 M concentration, 0-5U Taq polymerase and amplified in a programmable thermal controller (MJ Research, Inc, MA) programmed with 35 cycles of a 30 sec (2 min for the first cycle) denaturation step at 94°C, annealing for 30 sec at 50°C, and primer extension for 1 min (4 min in the final cycle) at 72°C. Samples of amplified products were separated on a 2% agarose gel by electrophoresis for further confirmation of the expected size insert.
Cloning and digestion of amplified DNA fragments: Amplified products were eluted from agarose gel using Wizard é PCR Preps DNA Purification System (Promega) according to instructions supplied by the manufacturer. The purified fragments (size 320-322 bp) were ligated to the cloning vector PCR ® 2.1 (Invitrogen, Carlsbad, CA, USA) [see Figure 2.7.1] and used to transform E. coli DH5α.using standard procedures (Sambrook et al., 1989. Molecular Cloning: a laboratory manual. 2nd ed. Cold spring harbor laboratory, USA)
Transformed colonies of E. coli DH5α were selected on Luria agar supplemented with n 1- mM of Isopropyl β-D-1-thiogalactopyranoside (IPTG) and 40-µg of X-Gal. Plasmids were extracted from transformed E. coli DH5α cells using a Wizardé Plus Mini-preps DNA Purification System (Promega) using the protocol supplied by the manufacturer. To confirm whether the transformants contained the desired size of insert, the plasmid DNA was digested to completion with the restriction enzyme EcoRI (Gibco/BRL). The digested products were separated by electrophoresis on a 1% agarose gel (Bio-Rad, NJ), stained with ethidium bromide and photographed under UV light. . The ABI prism BigDye terminator Cycle sequencing kit was used to further prepare the samples for sequencing. Sequencing was conducted using ABI PRISMTM 377 DNA sequencer. The sequence data were compared with sequences in databases using the program BLAST version 2.0 or 2.1 (http://www.ncbi.nlm.nih.gov/BLAST/-). The program compares nucleotide sequences to databases and calculates the statistical significance of matches.
Phylogenetic anaysis: Phylogenetic analysis of the nucleotide sequences was conducted using Neighbor-Joining (NJ) method applying the parameters described in the program MEGA 3.1 (Kumar et al., 2004, Brief Bioinform 5:150-163). Bootstrap resampling test with 1.000 replications was applied.
114 Figure 2.7.1. Cloning vector PCR ® 2.1. The vector has genes for resistance to the antibiotics ampicillin (Ampr), kanamycin (Kmr), and lacZ.
Results and Discussion
Nucleotide similarity comparison: The sequences corresponding to nifH gene sequence were edited, cleaned and assembled using the program Sequencher v 3.0 (Sequencher 3.0 User Manual, 1995). The fragments that showed homology were aligned using the program Clustal version W (1.8). The sequences that correspond to strains designated as 01-36062-R2; 02-36062-H4 and 03-36062-V2, isolated from roots, leaves and stems, respectively, were identical to each other.
The sequence analysis demonstrated the presence of nifH gene sequences in these sequenced clones, with a similarity of 89% in 283 bp with the nifH gene sequence of Klebsiella pneumoniae with a GenBank as AF303353.1. Further more the sequences had an 88% similarity with Klebsiella sp. Y83 (DQ821727.1) and Enterobacter spp. (Y79DQ821726.1) The clone from the endophytic bacterium isolated from Brachiaria hybrid CIAT 36061 had a 97% sequence similarity in 290 bp with three accessions registered in the GenBank, designated as DQ982313.1, DQ982300, and DQ982299.1. These sequences correspond to clones isolated from uncultured diazotrophes (nitrogen fixing organisms) isolated from roots and stems of maize plants. Nif genes that encode the nitrogenase complex and other enzymes involved in nitrogen fixation have consensus sequences identical in various nitrogen-fixing bacteria
Sequence comparison: The strains 01-36062-R2; 02-36062-H4, 03-36062-V2, and 36061 were compared with 16 nucleotide sequences that were selected with a maximum
115 identity, Score and E-value, registered in the GenBank (Table 2.7.1). Furthermore, 18 nucleotide sequences of nitrogen-fixing organisms used in the studies by Franke et al., (1998, Lett. Appl. Microbiol. 26:12-16). Bacteria with other characteristics were also included in these comparisons. Figure 2.7.2 clearly shows the sequences analyzed are phylogenetically grouped in three groups, A, B, and C, with high bootstrap values of 80, 82, 100 %, respectively. Group A contained 20 accessions, 8 of these belonging to protobacteria, one actinobacteria, one unidentified bacterium, 6 clones from uncultured organisms, and the four endophytic bacterial strains used in this study.
The three sequences from the endophytic bacteria isolated from Brachiaria CIAT 36062, designated 01-36062-R2; 02-36062-H4, and 03-36062-V2, are closely related to Klebsiella, Enterobacter and Micrococcus. Microorganisms in these three genera are known to be nitrogen-fixers. These results are in agreement with biochemical analysis (fatty acid analysis) of the isolate 01-36062-R2 conducted in earlier studies that showed a match with Leclercia adecarboxylata, Klebsiella pneumoniae, and Enterobacter cloacae, at 0.879, 0.841, and 0.820 similarity index, respectively (IP-5 Annual Reports 2003/4). The sequence of the endophytic bacterial strain isolated from Brachiaria hybrid CIAT 36061 grouped 100% with three clones coded as DQ982313.1, DQ982300, and DQ982299.1, and 87 % with the rest in Group A (Figure 2.7.2).
Klebsiella pneumoniae is a member of the Enterobacteriaceae that has the ability to fix nitrogen, and possesses a total of 20 nif genes that are clustered in a 24 kb region of the chromosome and responsible in nitrogenase synthesis and its regulation. Three of these genes, nifHDK, code for the three structural nitrogenase subunits. K. pnuemoniae has been reported as an endophytic bacterium associated with various plants and involved in nitrogen fixation, including maize (Chelius and Triplett 2001, Microb. Ecol. 41: 252– 263), wheat (Iniguez et al., 2004, Molecular Plant-Microbe Interactions 17: 1078–1085) and rice (Dong et al., 2003, Plant Soil 257:49-59).
Group B consists of 15 accessions subdivided into three subgroups B-1, B-2, B-3. The sub-group B-1 contains 2 species of Frankia (a soil-inhabiting nitrogen-fixing bacterium) and one betaprotobacteria. The subgroup B-2 consists of three accessions that belong to the genus Azotobacter. Sub-group B-3 consists of 9 accessions. The group C consists of 2 species of the genus Clostridium
For a better understanding of the endophytic microbial diversity and identity associated with species of Brachiaria, it is important to extend the work to include more enophytic bacterial isolates from a number of Brachiaria hybrids. This work further complements the results reported in IP-5 Annual Report 2005 on the role of these bacterial endophytes in Brachiaria plant growth possibly through nitrogen-fixation.
116 99 4)* AJ716260.1 Uncultured bacterium 78 7)* AJ716254.1 Uncultured bacterium 68 3)* DQ821726.1 Enterobacter sp. 2)* DQ821727.1 Klebsiella sp. Y83 71 98 16)* DQ821721.1 Klebsiella ... protobacteria 100 12)* 113208336 Enterobacter cloacae 1)* AF303353 Klebsiella pneumoniae
77 5)* AB270759.1 Uncultured bacterium 57 98 6)* AB270758 Pantoea agglomerans protobacteria
81 8)* DQ821720.1 Bacterium 99 9)* DQ821719.1 Enterobacter sp. protobacteria 10)* DQ821725.1 Micrococcus sp. Actinibacteria 87 17) CIAT 36061 62 13)* DQ982313.1 Uncultured bacterium ... 100 14)* DQ982300.1 Uncultured bacterium ... 99 15)* DQ982299.1 Uncultured bacterium ... 80 A 36) 02-36062-H4 35) 01-36062-R2 100 37) 03-36062-V2 11)* AY221827.1 Klebsiella oxytoca protobacteria 25)** M21132.1 Frankia B1 100 Gram positive 43 28)*** X57006.1 Frankia sp. High G+C 37 29)*** AF200742 Azoarcus sp. protobacteria 31)*** X51756.1 Azotobacter chroococcum B2 53 30)*** M73020.1 Azotobacter chroococcum 100 protobacteria B 82 32)*** M11579.1 Azotobacter vinelandii 23)** M15270.1 Rhodobacter capsulatus protobacteria B3 22)** M15238.1 Acidithiobacillus ferr... 48 21)** M16710.1 Rhizobium protobacteria 23 27)*** AF389768.1 Uncultured bacteriu... 23 53 18)** ADAF001432 Acetobacter diazotro... 31 26)*** X51500.1 Azospirillum brasilense protobacteria 6 24)** M10587.1 Rhizobium phaseoli
44 19)** K00487.1 Rhizobium sp. C 99 20)** K01620.1 Rhizobium japonicum 33)*** X07473.1 Clostridium pasteurianum Gram positive 100 34)*** X07472.1 Clostridium pasteurianum Low G+C
0.05
Figure 2.7.2. Phylogenetic tree generated for nucleotide sequences evaluated using Neighbor Joining analysis. The values represent 1,000 replications in bootstrap method.
117 Table 2.7.1. Nucleotide sequences and values generated using GenBank data for four endophytic bacterial isolates associated with Brachiaria hybrids in relation to other microbes.
E No Accession Description bp Organism Score Max Identity (%) value
1 DQ982300.1* uncultured bacterium 322 Bacteria; environmental samples 531 5e-148 97 2 DQ982313* uncultured bacterium 518 Bacteria; environmental samples 531 5e-148 97
Bacteria; environmental samples -148 3 DQ982299.1* uncultured bacterium 322 531 5e 97 Bacteria; Proteobacteria; Gammaproteobacteria 4 DQ821721* Klebsiella pneumoniae 322 385 7e-104 90 Enterobacteriales; Enterobacteriaceae; Klebsiella Bacteria; Proteobacteria; Gammaproteobacteria 5 AF303353 Klebsiella pneumoniae 518 365 7e-98 89 Enterobacteriales; Enterobacteriaceae; Klebsiella Bacteria; Proteobacteria; Gammaproteobacteria 6 DQ821727 Klebsiella sp. Y83 322 377 1e-89 88 Enterobacteriales; Enterobacteriaceae; Klebsiella Bacteria; Proteobacteria; Gammaproteobacteria; 7 DQ821726 Enterobacter sp. Y79 322 377 1e-89 88 Enterobacteriales; Enterobacteriaceae; Enterobacter 8 AJ716260 uncultured bacterium 360 Bacteria; environmental samples 325 6e-86 87
9 AB270759.1 uncultured bacterium 360 Bacteria; environmental samples 321 9e-85 88 Bacteria; Proteobacteria; Gammaproteobacteria 10 AB270758 Pantoea agglomerans 360 321 9e-85 88 Enterobacteriales; Enterobacteriaceae; Patoea 11 AJ716254 uncultured bacterium 360 Bacteria; environmental samples 317 1e-83 87
12 DQ821720 Bacterium Y41 322 Bacterium Y41 313 2e-82 87 Bacteria; Proteobacteria; Gammaproteobacteria; 13 DQ821719.1 Enterobacter sp. Y11 322 305 5e-80 87 Enterobacteriales; Enterobacteriaceae; Enterobacter Bacteria; Actinobacteria;Actinobacteridae;Actinomycetales 14 DQ821725.1 Micrococcus sp. Y70 322 297 1e-77 87 Micrococcineae; Micrococcaceae; Micrococcus. Bacteria; Proteobacteria; Gammaproteobacteria 15 AY221827.1 Klebsiella oxytoca 327 293 2e-76 86 Enterobacteriales; Enterobacteriaceae; Klebsiella Bacteria; Proteobacteria; Gammaproteobacteria; -73 16 AB270754 Enterobacter cloacae 359 281 8e 86 Note: The first 4 accessions noted with * correspond to the endophytic bacterial strain isolated from Brachiaria hybrid CIAT 36061
118 Activity 2.8. Validation of thermotherapy of stem cuttings, plant extract and Trichoderma to manage cassava diseases in the Eastern Plains region and in Cauca (Colombia).
Contributors:E. Álvarez, G. Llano, J. Loke, J.F. Mejía, V. Montaña, J. Jaramillo (Petrotesting Colombia S.A.), and B. Muñoz (CORFOCIAL, Cauca)
Highlight:
Cassava root rots were successfully reduced under field conditions by using Trichoderma viride and Trichoderma harzianum as biocontrol agents.
Rationale
Bacterial blight, Phytophthora root rots, and superelongation disease are widespread and cause high losses in important cassava-producing regions in Colombia. Several ecological control practices, like the use of biocontrol agents, have been evaluated recently for managing root rots in cassava. In this report, we discuss the progress made towards the objective: with farmer participation, to adjust and validate strategies of integrated management of the constraining diseases found in each region.
Materials and Methods
With farmer participation, to adjust and validate strategies of integrated management of the constraining diseases found in each region: Six commercial plots of cassava were established in five municipalities, two in each of the Departments of Cauca and Meta, and one in Casanare. The aims were:
• To evaluate the performance of several promising cassava varieties under the conditions of two agroecological areas: the Eastern Plains and Andean Region
• To validate the effect of treating stakes with Lonlife®, a product of low toxicity and derived from seeds of citrus fruits
• To validate the performance of the fungi Trichoderma viride Persoon and T. harzianum, which attack soil pathogens and have shown to control several species of Phytophthora, causal agents of root rots
Eastern Plains: Two semicommercial plots were established on the farms “La Vega” (Yopal, Casanare) and “Cantaclaro” (Puerto López, Meta), to evaluate the performance of four promising cassava varieties and the effect of treating stakes with Lonlife and of inoculating them with T. viride and T. harzianum.
Cantaclaro (Pto. López, Meta: We planted 0.5 ha with the varieties La Reina, Vergara, and CM 4574-7, and treated the stakes and soil as described below. For comparison, 9 ha were also planted with the same varieties under farmer management. Planting was on the
119 furrow ridges.
Treatments: Good quality stakes were selected from productive healthy plants. They were treated as follows:
a. Stakes were immersed for 10 min in a solution with Lonlife and the insecticide Roxion® (dimethoate), each at 2 cc/L.
b. Farmers immersed stakes for 10 min in a solution of copper oxychloride (at 3 g/L) and Roxion (at 2 cc/L). This treatment was used as check.
CIAT-14PDA-4 is a strain of the fungus T. viride, and an antagonist and plant growth stimulator. It was applied directly to the soil around planted cassava stakes, once at 1 month after planting and again at 3 months. The product AgroGuard® (containing T. harzianum) was added at 0.5 g/L. For the fungus, this was the equivalent of 2.5 × 108 spores/L. The farmer also used the product Bioderma® (containing T. harzianum, Biotropical).
Results and Discussion
Germination was similar in both stake treatments. Evaluations of incidence of disease were conducted by the technicians handling the crop. These evaluations will serve to define crop management practices, which are urgently needed as the area planted to the crop expands in response to demand for fuel-bioethanol production from cassava.
Variety CM 4574-7 showed no symptoms of either superelongation disease (SED) or cassava bacterial blight (CBB), while La Reina was the most affected by both diseases. The technicians regard CM 4574-7 as the variety that so far shows the best performance.
At harvest, significant differences were observed between yields of varieties, with Vergara and CM 4574-7 being the best. However, the latter variety was the most affected by rots at 20% when the AgroGuard strain of T. harzianum was used.
Except for variety Vergara, no significant differences were observed among yields after strains of the antagonistic Trichoderma fungus were applied. For Vergara, yields were highest after treatment with the strains CIAT-14PDA-4 and AgroGuard.
In terms of dry matter content, CM 4574-7 and La Reina had the highest values (30.8% and 29.2%, respectively). After treatment with the strains, dry matter increased with the Bioderma strain, enabling the highest value (30.9%).
Figure 2.8.1 shows the effect of the three Trichoderma strains evaluated for yield and percentage of root rots. Yield with the CIAT strain was more than 10 t/ha higher than the other two in varieties Vergara and La Reina, whereas in variety CM 4574-7, the Bioderma strain surpassed the AgroGuard strain by more than 5 t/ha, which itself surpassed the CIAT strain by almost 9 t/ha.
120 60 60
50 50 Strain ) 40 40 AgroGuard CIAT 14PDA-4 30 30 Bioderma
Yield (T/ha 20 20 Root rot(T/ha) 10 10
0 0 Yield Rot Yield Rot Yield Rot
Vergara La Reina CM4574-7 Variety
Figure 2.8.1. Effect of three Trichoderma strains on the yield of three cassava varieties, Cantaclaro Farm, Puerto López, Meta.
La Vega (Yopal, Casanare): Two cassava varieties, La Reina and ICA Catumare, were planted on 0.35 ha and the following stake and soil treatments were carried out:
Treatments: Good quality stakes were selected from productive and healthy plants.
a. Stakes were immersed in a solution of Lonlife at 2 cc/L for 10 min.
b. Stakes were immersed for 10 min in a solution of copper oxychloride (at 3 g/L) and Lorsban® (at 3 cc/L).
c. Stakes received no treatment.
d. Two applications of each fungal strain were used to inoculate the soil around the plants at 1 and 3 months after planting. The inoculum was either the fungus T. viride strain CIAT-14PDA-4 or the product AgroGuard (T. harzianum), each at 0.5 g/L, which was equivalent to 2.5 × 108 spores/L.
Results and Discussion
The germination rate of the two varieties was more than 96%, except for La Reina without treatment, when germination was 84.19%. Some of the seed treated with Lonlife (no Trichoderma) germinated at a rate of 88.36% because the soil had not been adequately prepared. Inoculation with Trichoderma had no relationship with germination because it was applied 30 days after planting.
We observed that the overall average yield of the two varieties was very similar, with
121 31.6 t/ha for Catumare and 31.8 t/ha for La Reina, whereas root rots were 2.46% and 3.73%, respectively. Yield for Catumare stakes treated with Lonlife was 31.7 t/ha and with chemicals, 34.6 t/ha, whereas the percentage of root rots was 4.09% and 1.66%, respectively.
On applying the AgroGuard strain of T. harzianum to variety Catumare, we obtained 40.5 t/ha of cassava, with 2.92% of roots rotting. In contrast, with the CIAT strain (T. viride), yield was 31.1 t/ha, but the percentage of rot was much lower (1.85%). For its part, the check with no applications of Trichoderma spp. yielded only 25.9 t/ha. That is, 14.6 t/ha less than the treatment with AgroGuard and 5.2 t/ha less than the treatment with the CIAT strain. Rot in the check reached 2.58%.
For variety La Reina, yield of plants whose stakes were treated with Lonlife was 33.5 t/ha and with chemical treatment was 31.6 t/ha. Root rot was 1.58% and 4.57% for the Lonlife and chemical treatments, respectively (Figure2.8.2).
50 40 Strain CIAT 14 PDA-4 30 AgroGuard 20 Control 10
Yield (T/ha) 0 Lonlife Chemical Control Lonlife Chemical Control Catumare La Reina Variety and stake treatments
Figure 2.8.2. Effect of treating stakes with Lonlife® or a chemical, together with strains of Trichoderma harzianum (AgroGuard®) and T. viride (CIAT) on the yield of two cassava varieties, Yopal, Casanare.
In terms of yield obtained with the applications of Trichoderma spp., the highest yield was achieved with AgroGuard (32.7 t/ha), followed by the check with no application (32.0 t/ha) and the CIAT strain (30.5 t/ha). However, with the latter strain, root rots were lower (0.84%) than for AgroGuard (3.47%) or the check with no applications (5.84%).
Figure 2.8.2 shows that, for variety Catumare, treatment with AgroGuard was found to range between 35 and 44 t/ha, depending on the product used to treat the stakes, with the chemical treatment being the higher. With the CIAT strain, yield was about 30 t/ha, whereas the check with no Trichoderma spp. reached 28 t/ha. The check for which stakes were not treated nor received applications of Trichoderma spp. only barely surpassed 20 t/ha.
122 For variety La Reina, yields were very similar, with or without applications of Trichoderma spp. When stakes were treated with Lonlife, yield was only slightly higher than the treatment with the CIAT strain (36 t/ha). When stakes were treated chemically, no reaction was observed to applications of Trichoderma spp. The effect of the Trichoderma applications apparently depended on variety.
Figure 2.8.3 shows that cassava rots declined considerably with the application of Trichoderma spp., the effect being most marked when the CIAT strain was used. According to sampling data from the Yopal plots, AgroGuard was not very effective in reducing rots, probably because the roots conserved a greater quantity of water when the AgroGuard strain was used (i.e., dry matter was 32.9% with the CIAT strain and 31.7% with AgroGuard for La Reina and 34.8% with the CIAT strain and 32.7% with AgroGuard for Catumare). It should be pointed out that rots occur in foci, which would explain why the disease was less in some checks.
9 8 7 Strain 6 CIAT 14PDA-4 5 AgroGuard 4 3 Control
Root rot (%) 2 1 0 Lonlife Chemical Control Lonlife Chemical Control Catumare La Reina Variety and stake treatments
Figure 2.8.3. Effect of treating stakes with Lonlife® or a chemical, together with strains of Trichoderma harzianum (AgroGuard®) and T. viride (CIAT) on root rots in two cassava varieties, Yopal, Casanare.
Department of Cauca: We conducted two trials with the collaboration of the Local Agricultural Research Committee (CIAL, its Spanish acronym) “La María”, in the Municipality of Piendamó, and a farmers’ group in Cabuyal, Municipality of Caldono. The goal was to evaluate the performance of three promising cassava varieties and the effect of treating stakes with Lonlife and of inoculating the soil with T. viride and T. harzianum. Evaluations were made with the active participation of the farmers forming the CIAL.
La María (Piendamó): Varieties, Three elite clones were evaluated: SM 707-17, SM 1498-4, and SM 1495-5.
123 Treatments: Good quality stakes were selected from productive and healthy plants.
a. Stakes were immersed for 10 min in a solution of Lonlife at 2 cc/L.
b. Stakes were immersed for 10 min in a solution of Trichoderma strain AgroGuard (Live Systems Technology S.A.) or of strain CIAT (0.5 g/L, equivalent to 2.5 × 108 spores/L).
c. Stakes received no treatment.
d. One application of each fungal strain was used to inoculate the soil around the plants at 2 months after planting. The inoculum was either the fungus T. viride strain CIAT-14PDA-4 or the product AgroGuard (containing T. harzianum) at 0.5 g/L each.
Results and Discussion
Stakes treated with Lonlife had higher germination rates and greater vigor.
When the AgroGuard strain of T. harzianum was used, yield of clone SM 1495-5 reached 31.6 t/ha, surpassing that of SM 1498-4 and SM 707-17. With strain CIAT 14PDA-4 of T. viride, a yield of 37.5 t/ha was obtained with variety SM 1498-4, whereas SM 1495-5 yielded only 9.9 t/ha, indicating a strain × variety interaction. Treatment with Trichoderma spp. permitted an increase in yield of more than 20% than that of the control. For both strains, yields increased slightly when the stakes were also treated with an extract of citric seeds (i.e., Lonlife) at planting. The differences, however, were not significant (Figure 2.8.4). No root rots appeared in this trial.
AgroGuard 40
) 30 CIAT 14PDA-4
20 Lonlife without Trichoderma spp Yield (T/ha 10 Lonlife + CIAT strain 0 Lonlife + SM1495-5 SM1498-4 SM707-17 AgroGuard Variety and treatment Control
Figure 2.8.4. Effect of treating stakes with Lonlife® and strains of Trichoderma harzianum (AgroGuard®) and T. viride (CIAT) on The yield of three elite cassava clones, Piendamó, Cauca.
124 Cabuyal (Caldono): With the same objective as for the trial at La María, another trial was established in the village district of Cabuyal, Municipality of Caldono, Cauca.
Varieties: Three elite clones were evaluated: SM 1707-41, SM 1834-20, and SM 1992-1.
Results and Discussion
Stakes treated with Lonlife had higher germination rates.
The highest cassava yields were obtained when T. harzianum (AgroGuard) was used, with or without treating stakes with Lonlife, reaching 52 t/ha with clone SM 1834-20. This finding corroborates the results obtained in Piendamó. In contrast, the effect of strain CIAT 14PDA-4 of T. viride was not effective. The treatment of stakes with Lonlife and no applications of Trichoderma spp. gave yields of more than 50 t/ha, probably because of the site, which had been chosen at random. Yields of the controls fluctuated between 7.2 and 23 t/ha (Figure 2.8.5).
60 AgroGuard 50 CIAT 14PDA-4 ) 40
30 Lonlife without Trichoderma spp.
Yi el d (T/ ha 20 Lonlife + CIAT strain
10 Lonlife + AgroGuard
0 Control SM 1707-41 SM 1834-20 SM 1992-1 Variety and stake treatment
. Figure 2.8.5. Effect of treating stakes with Lonlife® and strains of Trichoderma harzianum (AgroGuard®) and T. viride (CIAT) on yields of three elite cassava clones, Caldono, Cauca.
Figure 2.8.6 indicates that clone SM 1707-41 was least affected by root rots, showing higher resistance than the other two clones evaluated. For this clone, all treatments surpassed the control, which had 11.6% of roots with rots. With Lonlife + AgroGuard, only 2.4% of roots had rot; with Lonlife only, 1.1%; and with the CIAT 14PDA-4 strain of T. viride, 1.2%. The other treatments were not affected by rots.
125 60 AgroGuard 50 CIAT 14PDA-4 40 Lonlife without Trichoderma 30 spp.
Root rot (%) rot Root 20 Lonlife + CIAT strain
10 Lonlife + AgroGuard 0 Control SM 1707-41 SM 1834-20 SM 1992-1 Variety and Stake treatment
FigureFor clones 2.8.6. SM Effect 1992-1 of treatingand SM stakes1834-2 with0, the Lonlife® AgroGuard and strainstrains of of T. Trichoderma harzianum reduced rots harzianumto 0.2% and (AgroGuard®) 3.4%, respectively. and T. In viride contrast, (CIAT) with on strain the control CIAT 14PDA-4,of root rots 40% in three of roots elite of cassavaS1834-20 clones, rotted, Caldono, largely becauseCauca. the soil in which this treatment was planted was poorly
Apparently, the soil and environmental conditions affect the Trichoderma strains evaluated. In Yopal (Casanare), strain CIAT 14PDA-4 was more effective in reducing rots but, in Caldono (Cauca), the AgroGuard strain of T. harzianum was more effective. Lonlife, although it encouraged better germination of the stakes, did not much influence cassva yields.
In a culinary and tasting test carried out by a group of seven farmers, clone SM 1834-20 was the most accepted. However, clones SM 1707-41 and SM 1992-1 surpassed it in terms of dry matter content, a characteristic preferred by farmers in Cauca, who produce most of their crop for the starch industry.
Activity 2.9. Improving Nutritional Management for the Preventive Control of Downy Mildew of Roses (Peronospora sparsa)
Contributors: E. Álvarez, E. Gómez, G. Llano, and F. Castillo
Rationale
Downy mildew is the principal phytosanitary problem of roses in Colombia. It affects plant productivity, product export quality, and production costs. The extra costs caused by this disease lie in the increase in the number of applications of fungicides, use of specific products that are more expensive than those used to control other phytopathogens, and cultural management of this disease.
126 The search for new alternatives of pest-and-disease management in commercial crops contributes to friendly agricultural production by improving product quality and reducing toxins, and thus protecting the environment. Plant nutrition has a significant impact on the predisposition of plants to be affected by pests and diseases. In this sense, plant nutrition can contribute as much to the increase or reduction of resistance and/or tolerance of downy mildew, affecting growth patterns, anatomy and morphology, and particularly chemical composition.
Strengthening the host through adequate nutrition is a common preventive practice to manage disease and so eventually make the plants less susceptible to the pathogen. However, the relationships between specific associated nutrients and resistance of rose plants to Peronospora sparsa are currently unknown. Some nutritional elements such as nitrogen, potassium, calcium, boron, and silicon, and the N-to-K ratio are believed to be important for inducing resistance to obligate parasites. Hence, one objective of this study is to improve the nutritional balance of the rose crop to prevent downy mildew. This study evaluates, under hydroponic conditions, the effect the elements N, K, Ca, Bo, Si, and Mn would have on roses and on the incidence and severity of downy mildew.
Materials and Methods
We first established rose plants of the varieties Charlotte and Classy, which are susceptible to downy mildew, and Malibu, which is considered to have an intermediate reaction to the disease. For the optimal development of these activities, we identified the best environmental conditions for the expression of symptoms of the disease, improved the efficiency in producing inoculum, and adapted a scale for evaluating disease severity.
Sites. The activities and trials were conducted in laboratories and greenhouses, under controlled conditions of temperature and relative humidity.
Establishing different environmental conditions for disease development: Spray inoculation. Inoculation was carried out by spraying sporangia, using a DeVilbiss spray connected to a compressor. Both the upper and lower surfaces of all the leaves of the plants were sprayed from a distance of 40 cm. Thus, we could ensure that the leaflets were covered by a film of free water. Inoculum was obtained from rose leaves with typical symptoms of the disease and from sporangia of the pseudofungus, obtained from rose plants grown under the conditions of the Bogotá Sabana on flower farms where no previous treatments with fungicides had been applied for 1 week. Young leaflets with signs of sporulation on their back surfaces were collected from the upper third of the plants. They were then placed and agitated for 20 min in containers carrying a solution of 0.1% Tween 80 prepared with sterilized deionized water. They were later examined under an optical light microscope at 10X. The concentration of sporangia was calculated in a hemacytometer to later adjust the suspension to a concentration of 3 × 104 sporangia/mL. Plants were inoculated by spraying with an aqueous suspension of
127 sporangia on the upper and lower leaf surfaces, using an atomizer at a distance of about 40 cm from the leaves to ensure the presence of a film of free water on each foliar.
Encouraging the development of downy mildew under different environmental conditions: The inoculated plants were incubated under different conditions of humidity and temperature to identify the best conditions for producing inoculum and developing the disease. The environments evaluated were:
1. Petri dishes in which the pseudofungus was inoculated onto healthy leaflets and incubated under the conditions of a humid chamber.
2. Growth room with permanent humidification to maintain relative humidity between 27% and 95% and temperatures between 14°C and 25°C.
3. Humid chamber, which was 1 m high, 1.50 m wide, and 1 m deep. Temperatures fluctuated from 35°C during the day to 19°C at night. Relative humidity ranged between 31% and 98%, using an electric humidifier for 6 hours continuously between 9 a.m. and 3 p.m. for 3 days and then four times a day for 30 min each time.
4. Once inoculated, the plants were placed inside a humid chamber, which had a stable relative humidity of more than 95%, obtained by using an electric humidifier.
5. Greenhouse with a relative humidity ranging between 64% and 97%, obtained by using microsprays that functioned for 1 min at 0, 4, 8, 11, 13, 16, and 19 h. Temperatures were between 34.4°C during the day and 22.2°C at night.
Designing the evaluation scale: The disease was evaluated according to a scale of severity developed by Gómez (Gómez, 2004, Determinación de componentes de la biología de Peronospora sparsa Berkeley, y caracterización de la respuesta de tres variedades de rosa a la infección del patógeno bajo condiciones de laboratorio e invernadero. Universidad Nacional de Colombia, Bogotá, 72 pp.) with some modifications. The scale had four levels, where 0 corresponded to leaflets with mild crinkling; 1 to leaflets with pronounced crinkling, sporulation, and presence of chlorotic mottling; 2 to leaflets that presented green islands, chlorosis, and initial necrosis; and 3 to leaflets that showed advanced necrosis and the presence of purple or brown spots.
Establishing the nutrition trial: Rose plants of the varieties Charlotte, Classy, and Malibu were transplanted, without removing the peat, to flowerpots with 5-inch diameters and placed in a screen house (Figure 2.9.1). The substrate used was 1100 g of washed quartz sand that was sterilized and hydrated with distilled water. The peat was kept so not to damage the plant’s root system on transplanting. To evaluate the effect of changes in nutrition with six elements (N, K, B, Ca, Mn, and Si), nutritive solutions were adjusted, following the recommendations of Raúl Cabrera, Associate Professor, Department of
128 Horticultural Sciences, Texas A&M University (Appendix 1). The pH of the solutions was maintained between 5.5 and 6.5.
Figure 2.9.1. Establishing rose plants for the nutrition trial in the screen house. The roses are planted in sterilized sand. We first observed and calculated evapotranspiration rates and measured surface tension with a tensiometer to measure water retention. From these data, we determined when to initiate watering the plants with the respective nutritive solution for each treatment. Plants were watered with 50 mL of nutritive solution in the morning and afternoon.
To maintain uniformity in the number of leaves for evaluating incidence and severity, we pruned the plants on initiating applications of nutritive solutions.
The experimental unit was eight inoculated plants for each of the 14 treatments, four uninoculated check plants, and four uninoculated check plants with fungicides applied. The 14 treatments comprised modifications of a standard solution that complied with nutritional requirements for roses (Table 2.9.1), and were as follows: K as 50% and 150% of the standard solution, Ca as 50% and 150%, B as 50% and 150%, N as 50% and 150%, Mn as 50% and 150%, the standard solution itself, and Si as 50% and 150% of a concentration of 100 ppm, which was established according to previous studies on the integrated management of pests in gerberas and roses (Parrella, 2006, Forum on innovation in Colombian flower culture and demonstration of technologies for efficiency, Bogotá, Colombia). This concentration was also used for a treatment.
Table 2.9.1. Concentration of macroelements and microelements for the standard nutrient solution for roses. Cations (meq/L) Anions (meq/L) Microelements (ppm) Mg K Ca NH4 NO3 H2PO4 SO4 Fe B Mn Zn Cu Mo 24 137 80 14 112 15.5 32 1 0.25 0.25 0.025 0.01 0.005 Source: Raúl Cabrera, Associate Professor, Department of Horticultural Sciences, Texas A&M University.
129 Results and Discussion
Encouraging the development of downy mildew under different environmental conditions: We succeeded in producing inoculum under laboratory conditions by inoculating individual leaves from the upper third of the plant and incubating them under humid chamber conditions in petri dishes. However, the best production of inoculum was from complete inoculated plants in a humid chamber in the greenhouse with alternative periods of humidity, and on whose leaves was maintained a film of water that favored the germination of sporangia, infection, and later sporulation of the pathogen. For the first 2 days, the plants were under conditions of continuous humidity for 6 h and then exposed to four daily applications of 30 min each. The plants in the growth room, where temperatures were lower, developed typical symptoms of the disease, with its characteristic purple to brown, or black spots, irregular in shape. Under these conditions, the plants also presented symptoms of green islands on the leaflets that were as large as 1 cm in diameter, followed by yellowing and premature defoliation. The plants presented white mycelial masses on the stems, which then suffered necrosis and fissuring. These symptoms were so drastic that they affected the evaluation of disease severity and incidence in the plants. We could not determine differences among plants treated with Agrifos® and its effect on disease development. The plants incubated under greenhouse conditions with microspraying showed effective levels of disease, with symptoms appearing quickly. This allowed us to evaluate more clearly the severity found for each treatment.
Designing an evaluation scale: A severity scale was designed on the basis of expression of foliar symptoms, taken as the percentage of foliar area of young leaves affected in the upper stratum of the plant (Figure 2.9.2) and of mature leaves in the middle stratum (Figure 2.9.3).
4% 12% 22% 35%
Figure 2.9.2. Scale of severity of downy mildew in leaves of rose variety Charlotte taken from the plant’s upper stratum. Severity was expressed as a percentage of foliar area affected by the disease.
130 2% 4% 12% 20% 45%
Figure 2.9.3. Scale of severity of downy mildew in leaves of rose variety Charlotte taken from the plant’s middle stratum. Severity was expressed as a percentage of foliar area affected by the disease.
Appendix 1: Preparing nutritive solutions (according to recommendations made by Raúl Cabrera, Associate Professor, Department of Horticultural Sciences, Texas A&M University)
1. Use as sources: ammonium nitrate, phosphate of ammonia, nitric acid, phosphoric acid, potassium nitrate, caustic potash, calcium nitrate, magnesium sulfate, copper sulfate, manganese sulfate, ferrous sulfate, zinc sulfate, boric acid, and ammonium molybdate.
2. Prepare a 20-L solution for each source of nutrient.
3. When preparing a solution, use a 1000-mL beaker in which 500 mL of deionized water has been added and shake constantly with a magneto.
4. Then add the quantity of ammonium nitrate, phosphate of ammonia, phosphoric acid, and caustic potash to make 20 L.
5. For 20 L, separately prepare a stock of copper sulfate, zinc sulfate, and ammonium molybdate.
6. For the minor elements Mn, Fe, and B, use manganese sulfate, ferrous sulfate, and boric acid, measuring the respective quantities, which are then added to the beaker.
7. Then heat the potassium nitrate to improve solubility and add to the beaker.
8. Finally, add the calcium nitrate to the solution in the beaker and leave, agitating, for 5 min. Then add the magnesium sulfate without forming precipitates.
9. To prepare the solution with Si, carry out the same procedure, adding the potassium silicate immediately before the potassium nitrate and magnesium sulfate, thus preventing the formation of precipitates.
131 Activity 2.10. Resistance induction in roses to reduce severity of downy mildew by applying potassium phosphate.
Contributors:E. Álvarez, E.Gómez, G. Llano, and J. Loke
Rationale
Previous studies seeking new alternatives for controlling powdery mildews have demonstrated the effectiveness of salts of phosphorous acid (mono- and di-potassium phosphites) on reducing the incidence of these diseases of flower crops (Álvarez et al. 2001, Rev Asocolflores 62:31–40) and mango (Reuveni et al. 1998, Eur J Plant Pathol 104:853–860). The salts also control downy mildew of grapevines (Reuveni 1997, J Small Fruit & Viticult 5:27–38). The phosphites, derived from phosphoric acid, improve crop nutrition and stimulate the plant’s natural defense mechanisms into producing phytoalexins, as has been observed for cucumber and fruit plants (Reuveni et al. 2000, Crop Prot 19:355–361). Moreover, they act as fungistats; the fungi cannot metabolize the phosphites. Hence, mycelial growth and the formation of reproductive structures are inhibited. Our study aimed to determine the effectiveness of potassium phosphites for controlling downy mildew of roses.
Matherials and Methods
Activities and trials were conducted in the laboratories and greenhouses of the Cassava Pathology Program at the Centro Internacional de Agricultura Tropical (CIAT), in Palmira, Valle del Cauca. We used plants of the rose varieties Charlotte and Malibu, which are susceptible to the disease but are of interest to flower growers. The plants were kept in greenhouses in sacks containing a mixture of sand, clayey loam, and sterilized rice husks at a rate of 6:4:1. Relative humidity ranged from 64% to 98% during watering and temperatures were between 22°C at night and 34.4°C during the day.
To evaluate the effectiveness of potassium phosphites for controlling downy mildew of roses, we established a trial, using a randomized complete block design with five treatments for the rose varieties Charlotte and Malibu. Three treatments involved inoculations with the causal agent of downy mildew. Two foliar applications per week were conducted with Agrifos® (mono- and di-potassium phosphites, equivalent to 400 g of phosphorous acid per liter) in doses of 0.5% mixed with the coadjuvant 0.1% INEX-A in deionized water.
The study also included a rotation of commercial foliar fungicides mixed with the coadjuvant 0.1% INEX-A in deionized water (Table 2.10.1) and a rotation of fungicides and phosphites in the concentrations already mentioned in two applications per week. Checks were uninoculated plants that were (1) treated with 0.5% phosphites and (2) not treated. These plants were isolated from the other treatments by plastic separators.
132 Table 2.10.1. Rotation of the fungicides used to evaluate the effect of phosphites on the incidence and severity of downy mildew of roses. Day Fungicide Active ingredient Concentration in water (g/L) Before inoculation 1 Aliette® Fosetyl-al 1.5 4 Invento® Propineb 13.0 8 Forum® Dimethomorph 0.6 11 Previcur® Propamocarb 1.25
15 Inoculation 18 Mildex® Fenamidone 1.0 22 Sandofan-M® Oxadixyl 1.6 25 Invento® Propineb 13.0 29 Previcur® Propamocarb 1.25 32 Mildex® Fenamidone 1.0
Applications of Agrifos® began 2 weeks before the plants were inoculated and continued two times a week for the 34 days of the experiment. Inoculation involved applying suspensions of the pathogen at a concentration of 3 × 104 sporangia/mL under greenhouse conditions, as described previously. Disease incidence was evaluated throughout the experiment, using a scale of severity that was based on the expression of foliar symptoms. That is, the percentage of infected foliar area was determined in young leaves from the upper stratum of the plant and in mature leaves from the middle stratum.
The experimental unit for each variety was six plants for each of the treatments with phosphites (4 replications) and without phosphites (3 reps), and four for each of the treatments (a) rotation of fungicides (2 reps), (b) rotation of Agrifos® and fungicides (4 reps), (c) uninoculated check with Agrifos® (2 reps), and (d) absolute check with absence of pathogen and no fungicide (2 reps).
Results and Discussion
Applying potassium phosphites two times a week until the end of the experiment effectively controlled the disease. By day 34, when the evaluations were finalized for variety Charlotte, incidence had increased from the day of inoculation by 8.9% under the phosphite treatments and 20.1% under the fungicides. Plants that had not been treated with phosphites showed an increase of 51.0%. The lowest incidence, at 11.5%, was observed for the check with Agrifos®. The absolute check showed an incidence of 34.0% (Table 2.10.2). In inoculated plants, severity increased by 0.8% (phosphites), 1.4% (fungicides), and 45.6% (no phosphites or fungicides) (Table 2.10.3).
133 Table 2.10.2. Effectiveness of two foliar applications of phosphites per week on the incidence (%) of downy mildew of roses in variety Charlotte. Day Treatment 1 4 10 16 20 25 34 Phosphites 0.0 0.0 1.7 4.0 17.9 12.3 8.9 No phosphates 0.0 2.8 0.0 40.4 41.8 48.4 51.0 Fungicidesa 0.0 1.3 0.0 12.3 12.1 17.3 20.1 Phosphites + fungicidesa 0.0 7.1 12.618.5 12.8 26.020.8 Check (uninoculated plants) + phosphites 0.0 4.9 10.8 12.9 7.7 17.5 11.5 Check (uninoculated plants), no applications 0.0 2.1 14.2 19.3 34.0 29.8 34.0 a. Mildex®, Aliette®, Invento®, Sandofan-M®, Forum®, and Previcur®.
Table 2.10.3. Effectiveness of two foliar applications of phosphites per week on the severity (% of foliar area infected) of downy mildew of roses in variety Charlotte. Day Treatment 1 4 10 16 20 25 34 Phosphites 0.0 0.0 0.9 1.9 5.0 1.3 0.8 No phosphites 0.0 3.4 5.7 14.7 16.6 17.6 19.4 Fungicidesa 0.0 1.9 1.9 3.9 1.8 2.8 3.3 Phosphites + fungicidesa 0.0 2.1 6.6 8.1 5.2 7.7 7.0 Check (uninoculated plants) + phosphites 0.0 2.2 4.5 4.5 2.6 4.9 2.6 Check (uninoculated plants), no applications 0.0 0.9 2.8 2.8 9.8 7.5 9.7 a. Mildex®, Aliette®, Invento®, Sandofan-M®, Forum®, and Previcur®.
In variety Malibu, the effect of potassium phosphites on incidence (38.9%) was not as marked as for variety Charlotte. Incidence with fungicide treatment was 38.0%, and for plants without phosphites, the increase was 38.5%. In check plants with absence of the pathogen, the lowest incidence observed was for the treatment with phosphites (Table 2.10.4). The least increase in severity was observed for plants of the Malibu variety inoculated with phosphites (4.1%) and the highest values were for plants with fungicides (6.8%) and no phosphites (9.3%) (Table 2.10.5).
134 Table 2.10.4. Effectiveness of foliar application of phosphites on the percentage of incidence of downy mildew of roses in variety Malibu. Day Treatment 1 4 10 16 20 25 34 Phosphites 0.0 2.4 17.2 26.7 24.6 41.7 38.9 No phosphites 0.0 2.9 4.1 30.2 29.8 61.5 38.5 Fungicidesa 0.0 6.8 3.3 33.2 58.5 34.3 38.0 Phosphites + fungicidesa 0.0 2.9 3.0 8.6 12.1 19.3 44.4 Check + phosphites 0.0 0.0 11.6 15.3 14.6 40.8 41.2 Check 0.0 0.0 2.2 13.7 24.7 52.5 52.5 a. Mildex®, Aliette®, Invento®, Sandofan-M®, Forum®, and Previcur®.
Table 2.10.5. Effectiveness of foliar application of phosphites on the severity of downy mildew of roses in variety Malibu. Day Treatment 1 4 10 16 20 25 34 Phosphites 0.0 1.6 4.1 4.7 6.3 6.6 4.1 No phosphites 0.0 0.3 2.5 12.2 11.3 14.9 9.3 Fungicidesa 0.0 2.7 1.2 10.1 14.2 7.0 6.8 Phosphites + fungicidesa 0.0 1.2 5.5 3.1 3.1 4.8 1.4 Check + phosphites 0.0 0.0 0.0 7.8 3.9 7.1 6.3 Check 0.0 0.0 0.6 5.0 8.8 4.7 3.9 a. Mildex®, Aliette®, Invento®, Sandofan-M®, Forum®, and Previcur®.
Potassium phosphites (mono- and di-potassium phosphites) reduced the incidence of downy mildew of roses by 42.1% and severity by 18.6% in variety Charlotte, compared with the treatment without phosphites. In variety Malibu, severity was reduced by 5.2%, compared with the treatment without phosphites. Severity of disease observed in varieties Charlotte and Malibu gradually increased over time. However, the treatment with phosphites on inoculated plants was observed to reduce the progress of the disease, compared with the treatments of fungicides alone and fungicides with phosphites, demonstrating that phosphites have an inhibitory effect on downy mildew of roses. Foliar treatment with phosphites of rose plants of the variety Charlotte before exposure to the pathogen reduced incidence and severity of downy mildew to a greater extent than did rotations with fungicides and rotations of phosphites with fungicides. Likewise, potassium phosphites had previously been shown to control downy mildew of grapevines (Plasmopara viticola), preventing sporulation of the fungus and colonization of leaves (Reuveni 1997, J Small Fruit & Viticult 5(2):27–38).
135 Activity 2.11. Microbiological and physicochemical evaluation of lixiviates from decomposing plantain rachises and pseudostems and their effectiveness in managing bacterial wilt
Contributors:E. Álvarez, L. A. Mesa, V. H. Triviño, G.Llano, and J. Loke
Rationale
The plantain crop is affected by the vascular disease moko or bacterial wilt, caused by Ralstonia solanacearum. Currently, this disease is causing significant losses in Colombia, but it has not been successfully controlled because of a lack of effective management technologies and the nonexistence of resistant plantain varieties. Hence, research is needed to discover efficient alternatives that can be applied at low cost within an integrated management program, while generating a favorable impact on the environment. Preventive management of bacterial wilt of plantain is an excellent approach towards controlling the pathogen. This approach involves the use of natural substances extracted from organic residues such as lixiviate of compost of plantain rachises, pseudostems, and fruit.
Activity 2.11.1. Identifying microorganisms present in lixiviate from decomposing plantain rachises and pseudostems
Highlight:
Lixiviates from decomposing plantain rachises and pseudostems contain bacteria that are useful for releasing nutrients and for acting as possible antagonists of pathogens.
Materials and Methods
Samples, from which the bacterial strains under study were obtained, came from the plantain variety Dominico Hartón, grown on seven farms located in the Department of Quindío, Colombia.
Isolating the bacteria:To isolate the microorganisms present in samples of lixiviates, we used a nutrient agar culture medium. The organisms were incubated for 24 h at 28ºC, after which different colonies were selected according to their morphology. The potassium hydroxide test was conducted on the various isolates to differentiate between Gram-negative and Gram-positive microorganisms.
Morphology of the bacteria assessed: To identify the type of microorganisms found in the lixiviate samples, we planted them in different culture media that were specific to different types of microorganisms (Table 2.11.1.1).
136 Table 2.11.1.1. Culture media used to characterize microorganisms in lixiviate from compost of plantain rachises and pseudostems and in a mixture of lixiviate from compost of plantain rachis, phosphoric rock, and french marigold.
Culture medium Specific to: Yeast extract, dextrose, and calcium carbonate (YDC) Xanthomonas, Erwinia Medium B of King et al. (KB) Pseudomonas fluorescens Casein agar and glucose (CAG) Bacillus Nystatin, polymyxin, penicillin, cycloheximide (NPPC) Streptomyces Salmonella–Shigella agar (SS) Salmonella, Shigella MacConkey Enterobacteriaceae
Pure strains grown on nutrient agar with 24 h of incubation were planted on different culture media to observe their growth and later conduct biochemical tests to identify each microorganism.
Results and Discussion
We obtained 22 bacterial isolates, of which 8 were Gram-negative and 14 Gram-positive, according to the KOH test. Table 2.11.1.2 presents the results of the microbiological analyses conducted on samples of lixiviate from the decomposition of various plantain parts. The largest number of bacteria were isolated from lixiviate of rachis.
Table 2.11.1.2. Presumed identification of bacteria present in four sources of lixiviates of plantain compost. Rachis Pseudostem Mixturea Fruit Bacillus Bacillus Bacillus Listeria Klebsiella oxytoca Streptococcus Staphylococcus Actinobacillus Acinetobacter Eikenella Pseudomonas Proteus vulgaris a. Lixiviate of rachis, phosphoric rock, and french marigold.
We did not identify the bacteria Escherichia coli or Salmonella spp., corroborating the results obtained by Larco (2004. Desarrollo y evaluación de lixiviados de compost y lombricompost para el manejo de sigatoka negra (Mycosphaerella fijiensis Morelet), en plátano. Master of Science Thesis. Program of Education for Development and Conservation, Centro Agronómico Tropical de Investigación y Enseñanza (CATIE), Turrialba, Costa Rica), who reported the absence of Salmonella in lixiviate from banana and plantain compost. Through biochemical tests, we identified Pseudomonas bacteria,
137 which are ecologically important microorganisms found in the soil and probably responsible for the degradation of many soluble compounds that derive from the monomeric rupture of plant materials in oxygenated habitats. These organisms are typically aerobic and contribute to the decomposition and discharge of nutrients, attacking the organic substrate, including humic acids and synthetic pesticides (Bess VH. 1998. BBC Laboratories, Inc.). Proteus bacteria were found because they habituate soils, residual waters, and manure.
Conclusions
The lixiviates, being products generated by organic decomposition, presented different types of microorganisms according to their origin. Notable among them were beneficial bacteria, responsible for the initial and final stages of decomposition. To ascertain its innocuousness, a more specific microbiological characterization of lixiviate of plantain compost must be made.
Through this study, we identified the bacteria present in samples of plantain lixiviates and demonstrated that the variety of microorganisms changed according to the source of lixiviate.
Activity 2.12. Physicochemical characterization of lixiviates from Decomposing rachises, pseudostems, and fruit of plantain
Contributors:E. Álvarez, L. A. Mesa, V. H.Triviño, G. Llano, and J.Loke
Highlight:
Lixiviates from decomposing plantain rachises, pseudostems, and fruit are ideal ecological resources for use in managing the disease moko or bacterial wilt. These lixiviates contain various nutrients and minerals, in particular, high levels of potassium and manganese, which help reduce the disease.
Materials and Methods
To determine the characteristics of lixiviates and thereby recommend suitable use in both their management and application, we conducted various analyses. We used molecular spectrophotometry to identify nitrogen, phosphorus, nitric nitrogen, ammoniac nitrogen, sulfur, boron, and carbon. To identify potassium, we used atomic absorption spectrophotometry (AAS), and the atomic absorption technique for calcium, magnesium, copper, zinc, manganese, and iron (García MN. 2005. Manual de métodos de análisis del laboratorio de servicios analíticos (LSD) CIAT, Cali, Colombia)
To physically characterize the 10 sources of lixiviates from plantain compost collected from seven farms, we visually determined the color of each sample.
138 Results and Discussion
Lixiviate from fruit was black, whereas lixiviates from other plant parts were either light or dark brown. Lixiviates from rachises also differed among themselves in color (Table 2.12.1). These results on color characteristics agree with those reported by Paúl and Clark (Paúl EA; Clark FE. 1996. Soil microbiology and biochemistry, 2nd ed. Academy Press) when they described a commercially acceptable compost.
Table 2.12.1. Colors of 10 lixiviates from decomposing plantain rachises, pseudostems, and fruit collected from seven farms, Colombia. Origin Source of lixiviate Color La Yalta Farm, Armenia Rachis Dark coffee brown La Guaira Farm, Montenegro Rachis Light coffee brown Las Américas Farm, Quimbaya Rachis Dark coffee brown Las Américas Farm, Quimbaya Fruit Black Guadualito Farm, Montenegro Rachis Dark coffee brown Santa Elena Farm, Armenia Rachis Dark coffee brown La Diana Farm, Armenia Rachis Dark coffee brown La Diana Farm, Armenia Pseudostem Light coffee brown La Diana Farm, Armenia Mixturea Light coffee brown La Manigua Farm, Armenia Rachis Light coffee brown a. Mixture of lixiviate from decomposing rachis and phosphoric rock.
Table 2.12.2 shows the results of chemical analyses of lixiviate from decomposing rachises and pseudostems of plantain and a mixture (phosphoric rock, french marigold, and lixiviate of rachis) obtained from different farms in the Department of Quindío. Differences clearly existed among macroelements, according to the source and origin of lixiviates from compost analyzed in this study.
The largest percentage of phosphorus in lixiviate was found at Guadualito Farm with 404.93 mL/L. The smallest quantity (11.91 mL/L) of phosphorus was found at La Manigua Farm. Except for copper, the overall contents of elements in lixiviate of pseudostem was 10 times less than for lixiviate of rachis. The values for most elements were higher for fruit than for rachises and pseudostems. The average pH value ranged from 8 to 9, except for a pH 3.9 for lixiviate prepared from fruit at Las Américas Farm.
The chemical analyses of lixiviate indicated high concentrations of potassium in most samples. This element tends to be associated with inducing resistance to some diseases (Grajales CX; Villegas J. 2002. Control de Sphaerotheca pannosa var. rosae en rosas mediante la utilización de lixiviado de compost de rachis de plátano. Faculty of Agroindustrial Engineering, Universidad de San Buenaventura, Santiago de Cali, Colombia). For iron, values were higher than those reported. The lowest value (4.35 mg/L) for ammoniac nitrogen was found at La Manigua Farm and the highest (212.91 mg/L) was for lixiviate from fruit.
139 The correlation between disease progress of bacterial wilt (expressed as the area under the wilt progress curve over 7 weeks or AUWPC) in trials conducted in the greenhouse and the chemical composition of five lixiviates showed values of -0.77 for potassium content and -0.75 for manganese content. These values indicated that these two elements helped reduce the disease’s advance.
The chemical analyses of different sources of lixiviate showed that most presented high values for phosphorus, possibly because of the high quantity of residues (rachises, leaves, pseudostems, and corms) generated in each harvest of banana and plantain. These results agree with those reported by Muñoz (2003. Efecto de los lixiviados producto del proceso de descomposición del rachis del plátano sobre la actividad y biomasa microbiana en épocas de floración y cosecha del tomate Lycopersicum sculentum Miller. Faculty of Agricultural Sciences, Universidad Nacional de Colombia, Palmira, Colombia.).
Lixiviates are an ideal resource for use in managing bacterial wilt, as the quantity of nutrients and minerals released is high, especially of potassium and manganese. Another important aspect is the quantity of water present in these residues, as it facilitates rapid decomposition and transformation into organic matter (Mojica E. 1994. Atlas agropecuario de Costa Rica: Suelos de Costa Rica, 1st ed. Edited by G. Cortés. Universidad Estatal a Distancia, San José, Cost Rica. p 29–30). Moreover, lixiviates can be applied in the field or greenhouse to manage diseases or as fertilizer.
Conclusions
Lixiviates produced from decomposing plantain rachises and fruit contain high concentrations of potassium. The chemical composition of lixiviates shows that a relationship exists between the quantities of potassium and manganese in lixiviates and reduced severity of the disease.
The chemical analysis of sources of lixiviate showed that most lixiviates were high in phosphorus.
140 Table 2.12.2. Chemical composition of samples of lixiviate from decomposing rachises, fruit, and pseudostems of plantain from seven farms in the Department of Quindío and one farm in Ariari (Meta), Colombia.
pH C N P K Ca Mg S B Na Fe Mn Cu Zn N (NH4) N (NO3) Sa Source (farm and tissue) (null) (mg/L) (mg/L) (mg/L) (mg/L) (mg/L) (mg/L) (mg/L) (mg/L) (mg/L) (mg/L) (mg/L) (mg/L) (mg/L) (mg/L) (mg/L)
1 Las Américas, rachis 8.67 2780.00 420.09 157.95 18,185.42 82.92 38.66 111.52 0.83 12.55 2.67 1.25 0.16 0.29 6.98 0.00
2 Las Américas, fruit 3.91 11,680.00 1781.61 375.68 11,343.41 5137.17 824.74 197.37 6.61 22.34 2949.81 23.32 0.11 10.33 212.91 4.52
3 La Diana, rachis 8.38 1640.00 278.55 317.16 16,332.48 74.75 51.68 149.93 0.86 7.51 2.94 1.39 0.00 0.31 19.20 0.01
4 Santa Elena, rachis 9.28 1565.00 249.30 212.00 20,937.91 41.37 34.77 183.82 0.67 28.54 1.75 1.01 0.16 0.53 6.27 0.00
5 Ariari (Meta), rachis 9.36 2690.00 466.58 311.05 26,680.96 51.77 51.62 398.46 2.38 6.77 3.82 4.12 0.00 23.36 7.44 0.00
6 Guadualito, rachis 9.34 2996.07 893.38 404.93 28,838.90 69.11 31.30 206.50 0.56 6.05 3.05 1.91 0.04 0.60 144.64 0.00
7 La Guaira, rachis 8.58 2160.06 205.10 187.88 15,588.58 64.58 43.37 55.72 0.12 6.13 0.50 0.51 0.00 0.06 47.21 0.00
8 La Manigua, rachis 8.54 408.95 45.76 11.91 324.83 5.54 2.04 0.00 0.00 4.91 1.62 0.41 0.00 0.27 4.35 2.88 9 Mixtureb 8.89 2.67 283.63 367.40 18,391.39 379.76 59.82 86.75 2.19 5.40 40.14 0.00 0.00 0.82 32.65 0.00
10 La Diana, pseudostem 8.43 1.29 70.03 66.89 4,458.62 44.91 22.65 21.46 0.98 1.46 0.88 0.00 2.23 0.01 24.97 0.00
11 La Yalta, rachis 8.97 2.84 217.82 161.59 12,749.92 46.89 24.45 87.60 1.16 5.62 0.69 1.11 0.11 0.28 73.24 0.00 a. S = sample. b. Mixture of phosphoric rock, french marigold, and lixiviate of rachis.
141 Activity 2.13. Detecting Ralstonia solanacearum in lixiviates from decomposing rachises and pseudostems of plantain.
Contributors: E. Álvarez, L. A. Mesa, V. Triviño, J. Loke, and G. Llano
Rationale
Moko, maduraviche, or ereke is a bacterial wilt of plantain and banana caused by Ralstonia solanacearum. It is the most important bacterial disease of these crops in Colombia, affecting 125,000 families who depend directly on them for their livelihoods. The use of lixiviate from decomposing plantain rachis has been effective as a practice for managing the disease. The presence of R. solanacearum in samples of lixiviate from decomposing plantain residues is a phytosanitary risk if it is applied directly to the crop without first verifying if the pathogen is absent. In this study, we determined whether R. solanacearum is present in lixiviates.
Materials and Methods
The pseudostems of 6-week-old plantain seedlings, variety Dominico Hartón, were inoculated with 0.5 mL of lixiviate obtained from plantain harvest residues from the Department of Quindío, specifically from the farms of La Guaira, La Manigua, Santa Elena, Guadualito (rachises only), Las Américas (fruit and rachises), La Diana (rachises; pseudostems; and mixture of lixiviate of rachis, phosphoric rock, and french marigold or Tagetes patula), and La Yalta (rachises). We used a randomized complete block design, with five replications and an experimental unit of two plants. We evaluated the effect of different sources of lixiviate, using the R. solanacearum strain CIAT No. 78 as a positive check and sterilized deionized water as the negative check. The inoculated plants were kept for 3 days under constant wetting and later microsprayed every 24 h for 26 days.
Evaluations of severity were conducted daily, taking into account the development of symptoms of wilt between Days 5 and 30 and recording the appearance of symptoms such as flaccidity in leaves and wilt. To measure disease development, a scale of 0 to 6 was generated, where: 0 = absence of symptoms 1 = leaves presenting flaccidity 2 = leaves showing a slight but noticeable wilt, not only in their shape but also in the loss of their intense green color 3 = leaves showing a highly noticeable flaccidity and, in some cases, yellowing 4 = leaves showing yellowing with necrosis in some sites and highly advanced flaccidity, losing their shape 5 = advanced necrosis and leaves have totally lost their turgidity 6 = plants are entirely dead
142 In addition to the experiment described above, the SMSA medium was added to two petri dishes and, in each dish, a 0.1-mL sample of each lixiviate was suspended. Incubation was carried out at 28C. The dishes were examined every day for the pathogen’s presence. Possible colonies were purified and incubated for 2 weeks. The samples were evaluated three times during the experimental period.
Results and Discussion
Healthy plants that had been inoculated with 10 different sources of lixiviate showed no symptoms of the disease. The positive check inoculated with R. solanacearum showed typical symptoms of the disease. Some plantain seedlings injected with lixiviate of fruit presented leaves showing some small burns. When these tissues showing burns were cultured on SMSA medium, no R. solanacearum isolates were obtained. This symptom was probably caused by a phototoxic substance in the lixiviate or low pH.
Lixiviates planted in SMSA medium did not show colony growths typical of R. solanacearum, thus confirming the results obtained in the greenhouse trial.
The absence of R. solanacearum in the lixiviate samples collected from the seven farms therefore ascertains the innocuousness of lixiviates for plantain crops for either managing bacterial wilt and sigatoka or using as biofertilizer (García E; Apezteguia H. 2001. Estudio del lixiviado de compost y su efecto sobre el control de sigatoka negra (Mycosphaerella fijiensis Morelet) y el crecimiento del cultivo de banano (Musa AAA). Thesis in Agronomy. EARTH, Guácimo, Costa Rica; Larco E. 2004. Desarrollo y evaluación de lixiviados de compost y lombricompost para el manejo de sigatoka negra (Mycosphaerella fijiensis morelet), en plátano. MSc thesis. Program of Education for Development and Conservation, Centro Agronómico Tropical de Investigación y Enseñanza (CATIE), Turrialba, Costa Rica).
Conclusions
The different sources of lixiviate evaluated were considered not to contain R. solanacearum because the plantain plants inoculated with the lixiviates did not develop symptoms of the disease after 30 days of evaluations under greenhouse conditions. The absence of R. solanacearum from the lixiviate samples evaluated demonstrated that applications of lixiviate of plantain compost do not cause either residual or pathogenic effects on plantain plants, thus indicating its suitability for use in this type of crop.
143 Activity 2.14. Identifying live and dead cells of Ralstonia solanacearum exposed to lixiviates from plantain residues, phosphoric rock, and french marigold
Contributors: E. Álvarez, L. A. Mesa, V. Triviño, and J. Loke
Rationale
Laboratory trials on culture medium and in the greenhouse showed that lixiviate of plantain rachis and pseudostem inhibits the R. solanacearum bacterium. One limitation of these tests is that nobody knows the effect lixiviates have on the viability of the pathogen’s inhibited cells. The bacterial cells could live without multiplying and thus continue to be a phytosanitary risk.
Materials and Methods
Bacterial viability is determined by using the fluorescence kit LIVE/DEAD® L-13152 (Molecular Probes, Leiden, Netherlands), which contains two nucleic acid markers. The fluorochrome Syto9 is a small molecule that can penetrate bacteria that possess an intact plasmatic membrane, giving off a green fluorescence when observed under a Zeiss Axiolab epifluorescent microscope. The fluorochrome propidium iodide (PI) penetrates damaged membranes, which are therefore not viable, giving off a red fluorescence (Defives et al. 1999). The bacterial strain used was CIAT No. 78, isolated from plantain rachis from Montenegro (Quindío, Colombia). Treatments were:
1. Cumbre® (gentamicin sulfate at 10.7% and oxytetracycline hydrochloride at 32.3%) 2. Lixiviate from decomposing rachis of plantain variety Dominico Hartón from La Guaira Farm 3. Lixiviate of rachis from Las Américas Farm 4. Lixiviate from decomposing pseudostem from La Diana Farm with phosphoric rock (29% P2O5) 5. French marigold (Tagetes patula) 6. Mixture of lixiviate of rachis compost from La Diana Farm with phosphoric rock and french marigold
As checks, we used:
1. Components A (Syto9) and B (propidium iodide) from the kit LIVE/DEAD® without R. solanacearum 2. Components A and B with the bacterium 3. Sterilized deionized water 4. Sterilized deionized water with the bacterium 5. Ethanol at 70% (Molecular Probes, 2004) 6. Ethanol at 70% with the bacterium
144 The treatments were filtered twice with a vacuum pump using Whatman No. 1 filter paper and once through a 0.2-µm Millipore filter (Whatman). They were then stored in sterilized, BD Falcon™, centrifuge tubes of 50 mL. They were kept sealed with Parafilm® and conserved at -80oC. From each solution, 2 mL were placed per microcentrifuge Eppendorf tube, sterilized twice at 121oC and under 20-lb pressure for 20 to 30 min.
Preparing inoculum: A bacterial suspensión was prepared in sterilized deionized water. Under aseptic conditions, the concentration of the suspensión was determined in a Turner spectrophotometer, model 390, with a wavelength of 600 nm, using Fisher cells (ref. Spectronic 20). The concentration was adjusted by diluting with sterilized deionized water until a 0.3 absorbance was obtained, corresponding to about 1 × 106 colony- forming units per milliliter (He et al. 1983).
Observing R. solanacearum cells tinted with LIVE/DEAD® L-13152 with the epifluorescent microscop: We took 100 µL of R. solanacearum and added them to the Eppendorf tubes that contained the treatments and vortexed. In another 0.5-mL tube, we mixed the Syto9 coloring (component A) with 0.75 mL of propidium iodide dye (component B). The tube with the mixture of colorings was wrapped in aluminum foil to keep out light and conserved at -20ºC. We took 0.25 µL from each Eppendorf tube containing a treatment with the bacteria and placed them on one microscope slide per treatment. Immediately, 0.25 µL of the mixture of colorings were also added. The mixture was gently moved about with the point of a micropipette and a cover slip placed over it. The slides were kept in darkness for 15 min, after which time, the sample was examined under an epifluorescent microscope with a wavelength of 490 nm to determine the percentage of live (green) and dead bacterial cells (red) in the sample.
Results and Discussion
The total count of the bacterial population was obtained by counting the percentages of green (viable) and red (dead) cells that were observed in the field of the epifluorescent microscope. Observation over time allowed us to determine the number of days needed for each product analyzed to act on the R. solanacearum cells. On Day 2, we observed that the mixture of phosphoric rock, french marigold, and lixiviate of plantain rachis from the La Diana Farm destroyed 80% of the pathogen’s cells (Table 2.14.1).
145 Table 2.14.1. Microscopic observations conducted with the kit LIVE/DEAD® backlight L-13152 to determine the effect of different types of lixiviate on Ralstonia solanacearum cells. Red cells (dead) of R. solanacearum (%) Inocul. with at days after experiment begins Treatment R. solanac. 1 2 5 7 14 21 24 Checks 1 Components A (Syto9) + B (PI) from the kit No 0 0 0 0 0 0 0 2 Components A (Syto9) + B (PI) from the kit Si 0a 0a 0a 0a 0a 0a 0a 3 Sterilized water No 0 0 0 0 0 0 0 4 Ethanol at 70% No 0 0 0 0 0 0 0 5 Sterilized water Yes 0a 0a 0a 0a 0a 0a 0a 6 Ethanol at 70% Yes 100 100 100 100 100 99.9 100
Products 1 Gentamicin and tetracyclineb Yes 0a 0a 0a 0a 0a 0a 0a 2 Lixiviatec of plantain rachis Yes 0a 0a 25 25 50 90 99.9 (La Guaira Farm, Montenegro) 3 Pure lixiviatec of plantain rachis Yes 0a 0a 10 0a 0a 99 99.9 (Las Américas Farm, Quimbaya) 4 Lixiviatec of plantain pseudostem Yes 0a 0a 0a 20 20 20 50 (La Diana Farm, Armenia) 5 Phosphoric rockd Yes 0a 0a 40 20 10 20 40 6 French marigolde Yes 0a 0a 2 60 90 90 99.9 7 Lixiviatec of plantain rachis, with Yes 0a 80 90 90 90 100 100 phosphoric rockd and french marigolde (La Diana Farm, Armenia) a. Green. b. Cumbre® (gentamicin sulfate at 10.7% and oxytetracycline hydrochloride at 32.3%). c. At a pure concentration, with no water added. d. Concentration at 30 g/50 mL. e. Concentration at 10 g/50 mL.
Conclusions
Through epifluorescent microscopy, exposure to the mixture of lixiviate from decomposing plantain rachis, phosphoric rock, and french marigold was shown to kill all the cells of the pathogenic bacterium R. solanacearum. Lixiviates without disinfection by phosphoric rock and french marigold killed most of the cells, but with a small quantity still viable.
This is the first study that demonstrated through microscopy the effect of different types of lixiviates on the viability of the R. solanacearum bacterium.
Activity 2. 15. Determining the Control of Bacterial Wilt in Plantain Seedlings by Different Types of Lixiviate
Contributors:E. Álvarez, L. A. Mesa, V. Triviño, J. Loke, and G.Llano
146 Rationale
Different greenhouse trials were conducted to discover the effect on plantain seedlings of applying lixiviates of rachis and pseudostem to the soil. The idea was to evaluate the potential of lixiviates as an ecological practice for controlling the disease.
Trial 1: Inoculating plantain plants with Ralstonia solanacearum at different concentrations
Materials and Methods
We aimed to determine (1) the time between inoculation with R. solanacearum and expression of symptoms of bacterial wilt, and (2) the minimum concentration of inoculum needed to produce symptoms. We used the R. solanacearum strain No. 78 from the collection held at CIAT, first growing it for 24 h in nutritive agar. We then prepared three suspensions of the strain in sterilized deionized water at different concentrations. Under aseptic conditions, the concentration of each suspension was determined by reading the absorbance in a Turner spectrophotometer, model 390, with a wavelength of 600 nm, using Fisher cells (ref. Spectronic 20). The concentrations were as follows:
Absorbance 0.5 = 1 × 108 colony-forming units (cfu)/mL Absorbance 0.3 = 1 × 106 cfu/mL Absorbance 0.1 = 1 × 103 cfu/mL (He et al. 1983)
The inoculation method used was injection with sterilized 1-mL syringes and needle size 27G × 1/2". For each suspension, 0.5 mL was inoculated into the pseudostem of each of eight plantain plants at a height of 2 cm from the soil surface. Another eight plants were used as the negative control and were injected with sterilized deionized water. The 32 inoculated plants were then placed in three randomized complete blocks and left to incubate in a humid chamber for 3 days before being microsprayed for 30 days. The plants were evaluated daily between Days 5 and 30 after inoculation.
Results and Discussion
After inoculating plantain seedlings with R. solanacearum, the disease’s progress was observed under controlled conditions to determine the speed at which the pathogen infected the plants. Of the three concentrations tested, those seedlings receiving 1 × 108 cfu/mL had symptoms by Day 7, and by Day 18 they were dead. The disease was also observed to advance by the vascular system, as described by Gómez (Gómez E. 2005. Aislamiento, identificación y caracterización del agente causal del moko del plátano, Ralstonia solanacearum raza 2, proveniente de plantaciones afectadas en Colombia. Faculty of Sciences, Pontificia Universidad Javeriana, Bogotá, DC, Colombia), beginning at the site of inoculation and advancing along the stems to the leaves. The trial showed that the more concentrated the inoculum, the more quickly the disease was expressed and the more severe the symptoms (Table 2.15.1).
147 Table 2.15.1. Development of bacterial wilt in plantain seedlings inoculated with different concentrations of Ralstonia solanacearum and evaluated for 3 weeks under greenhouse conditions. Treatment (concentration of R. Disease progress at day of evaluationa solanacearum at cfu/mL) 7 14 21 1 Water 0 0 0 2 1 × 103 0.8 1.5 4.0 3 1 × 106 2.2 3.0 5.0 4 1 × 108 2.5 3.5 6.0 a. Scale of 0 to 6, where 0 is absence of disease and 6 is plant death.
Conclusions
Through this trial we showed that the three concentrations of inoculum of R. solanacearum caused plant death within 3 weeks. By using different concentrations of inoculum of the pathogen, we could better assess the lixiviates’ capacity to reduce the damage caused by bacterial wilt.
Trial 2: Inoculating sterilized soil with Ralstonia solanacearum
Materials and Methods
The goal was to identify the minimum bacterial concentration detectable in inoculated sterilized soil. We used dilution methodology to determine concentrations and indicator plants to establish disease progress. We first grew the R. solanacearum strain CIAT No. 78 for 24 h in nutritive agar and then prepared suspensions of it in sterilized deionized water. Under aseptic conditions, each suspension’s concentration was determined by reading its absorbance from the spectrophotometer. The concentration of each bacterial suspension was adjusted with dilutions in sterilized deionized water starting with absorbance 0.3. We added 1 mL in a test tube, completing to 100 mL with sterilized deionized water. From this solution, 1 mL was taken and completed to 100 mL with sterilized deionized water in a test tube. For the last tube, the same procedure was carried out to obtain the fourth concentration. The concentrations of the bacterial suspension were as follows:
Treatment no. 1 = 1 × 108 colony-forming units per milliliter (cfu/mL) Treatment no. 2 = 1 × 106 (cfu/mL) Treatment no. 3 = 1 × 104 (cfu/mL) Treatment no. 4 = 1 × 102 (cfu/mL) Negative check = Inoculation with sterilized deionized water
For each concentration, 30 mL of bacterial solution was placed in flowerpots containing soil previously sterilized at 121°C under 20 lb of pressure for 30 min. Later, 9-week-old plantain plants were planted into each pot. After inoculating the soil, the plants were incubated in a humid chamber (90% RH) for 3 days. The plants were then transferred to a
148 greenhouse and microsprayed at intervals of 1 min throughout the day. On Day 7 after inoculation, evaluations were begun, continuing for 1 month.
We inoculated 50 plants, distributed across 5 treatments, with 5 replications and a negative check. The experimental unit was 2 plants in a randomized complete block distribution. Evaluations were carried out every day for 30 days, checking all leaves on each plant to determine wilt. If a leaf presented symptoms of the disease, a tissue sample was taken from the infected plant and cultured onto the semi-selective SMSA medium and again inoculated onto other healthy plantain plants.
Results and Discussion
The healthy plants planted into soil inoculated with R. solanacearum presented typical symptoms of the disease, starting from Day 10 (Table 2.15.2).
Table 2.15.2. Reaction of healthy plants to applications of different concentrations of Ralstonia solanacearum to the soil. Treatment (concentration of R. Disease progressa at day after inoculation solanacearum at cfu/mL) 7 14 21 28 1 Water 0 0 0 0 2 1 × 102 0 0.2 0.5 1.2 3 1 × 104 0 0.3 0.7 1.6 4 1 × 106 0 0.8 1.2 2.0 5 1 × 108 0 0.8 2.2 4.3 a. Scale of 0 to 6, where 0 is absence of disease and 6 is plant death.
Table 2.15.2 shows that, at higher bacterial concentrations, symptoms of the disease were expressed in the plantain plants in less time and with greater severity. The table also shows that when the bacterium is inoculated into the soil, symptoms take longer to manifest in the plants (10 days) than when it is directly inoculated into plants (7 days). The disease appeared even at concentrations of 1 × 102 cfu/mL, which is the equivalent to 3000 colonies per flowerpot.
Trial 3: Applying lixiviate before and after inoculating seedlings with Ralstonia solanacearum
Materials and Methods
To evaluate the effectiveness of lixiviate of plantain in managing bacterial wilt, 30 mL of pure lixiviate was applied to the soil before or after inoculating with the pathogen. Lixiviate was obtained from plantain compost from the following farms: Las Américas, La Guaira, La Manigua, Santa Elena (all rachises), and La Diana (pseudostem and a mixture of lixiviate of rachis, phosphoric rock, and french marigold). All the farms were located in the Department of Quindío, Colombia.
149 In the greenhouse, 6-week-old plantain plants were planted in polypropylene sacks with a 1-kg capacity and containing a mixture of sterilized sand and soil at a rate of 3:2. One set of 168 plants were inoculated on Day 15 after planting, using sterilized 1-mL syringes. Their pseudostems were inoculated at a height of 2 cm from the soil surface with a concentration of absorbance 0.1, determined as previously described for preparing inoculum for plantain plants. Each plant received 0.2 mL of the suspension. After inoculation, 30 mL of lixiviate from different sources (rachises, pseudostems, and fruit) was applied at 100% to the soil of each of the 168 plants. Another set of 168 plants received lixiviate before they were inoculated with R. solanacearum.
We established 46 treatments, the experimental unit being 3 plants. The experimental design was split-plot in different blocks separated by treatment, with 4 replications. The main plot was the time of applying lixiviate (before or after inoculation) and the subplot was the source of lixiviate. Lixiviate was applied at Days 3, 7, and 15 before inoculation and at Days 3, 5, and 7 after inoculation.
To establish the positive check, 72 plants were inoculated with the R. solanacearum strain CIAT No. 78. The negative check comprised another 72 plants that were inoculated with sterilized deionized water and also received the antibiotic Cumbre® (gentamicin sulfate at 10.7% and oxytetracycline hydrochloride at 32.3%) at 8 g/L, injecting 0.5 mL into the stem and 1 mL to the soil for each plant.
The inoculated plants were kept for 3 days under constant humidification and then given 7 lots of microspraying at 1 min per day of 24 h for 30 days. Evaluations were made daily between Days 5 and 30, examining leaf by leaf in each plant for the appearance of symptoms of wilt such as flaccidity and yellowing. The area under the disease progress curve (AUDPC) was calculated for the variable of severity, according to a graded scale of severity of disease and, through the statistical program Statistix 8.0, an analysis of variance was conducted for the AUDPC.
To determine differences between treatments in terms of their effectiveness in controlling bacterial wilt on Days 7, 14, 21, 28, 35, 42, and 49, an analysis of variance was conducted, together with tests on the separation of means (Tukey’s; α = 5%).
Results and Discussion
On average, 10 days after inoculation, leaves showed the first symptoms, presenting flaccidity on touch (grade 1). After about 18 days, the leaves showed some wilting and began losing their intense green color (grade 2). After 4 weeks, the leaves were noticeably flaccid and, in some cases, yellow (grade 3). For grade 4, 40 days after inoculation, the leaves were yellow, necrotic, and very flaccid, having lost their shape.
These findings contrast with those of Gómez (Gómez E. 2005. Aislamiento, identificación y caracterización del agente causal del moko del plátano, Ralstonia solanacearum raza 2, proveniente de plantaciones afectadas en Colombia. Faculty of Sciences, Pontificia Universidad Javeriana, Bogotá, DC, Colombia), who reported that,
150 by Day 5, symptoms of the disease such as flaccidity and/or wilt in the leaves can appear. Possibly, the size and origin of the seedlings influence the disease’s progress.
Only those plants inoculated with bacteria and treated with water presented grade 5 on the disease scale, showing the most severe symptoms of advanced necrosis and loss of shape in the leaves. The other treatments did not present this grade of disease until the seventh evaluation (i.e., 49 days after inoculation). The symptoms observed and the re- isolation demonstrated that the symptoms are caused by R. solanacearum. Uninoculated plants and treated only with water did not show wilt during the experiment. At 3 weeks after inoculation, no significant differences were observed between treatments, using Tukey’s test at 5%.
By the fourth week, significant differences were observed between products and the positive check. During the fourth and fifth weeks, the lixiviate from Las Américas Farm in Quimbaya (Quindío) significantly reduced the disease’s progress. At the end of the trial, all the products had a similar effect on the wilt’s progress with an average grade of 4.2, as expressed according to the severity scale, where the leaves presented yellowing with necrosis and advanced flaccidity, losing their shape (Table 2.15.3).
The inoculated plants treated only with water suffered grade 6.0, that is, they died (Figure 2.15.1). With respect to the four replications, two had a greater concentration of inoculated pathogen than the other two. Highly significant differences (Tukey, 5%) occurred between replications 1 and 2 and replications 3 and 4, with symptoms appearing much more quickly in replications 1 and 2 than for replications 3 and 4.
Table 2.15.3. Analysis (Tukey, 5%) to compare the effect of time between the application of products and day of inoculation with Ralstonia solanacearum on disease progress in plantain seedlings established in the greenhouse. Values in the table refer to scores on a disease scale of 0 to 6, where 0 is absence of disease and 6 is plant death. Time between Evaluation on day after inoculation product application and 7 14 21 28 35 42 49 inoculation of seedlings
Days before inoculation
15 0.49 bc 1.02 c 1.59 c 2.20 b 3.01 b 3.27 b 3.45 b
7 1.44 a 2.38 a 3.01 ab 3.35 ab 3.84 ab 4.31 ab 4.60 ab
3 0.97 ab 2.08 ab 3.11 ab 3.62 a 4.05 ab 4.42 ab 4.66 a
Days after inoculation
3 0.26 c 1.43 abc 2.54 abc 3.04 ab 3.53 ab 4.06 ab 4.40 ab
5 0.29 c 1.41 bc 2.31 bc 3.11 ab 3.44 ab 3.88 ab 4.33 ab
7 0.28 c 2.18 ab 3.49 a 4.11 a 4.39 a 4.81 a 5.17 a
151 Conclusions
The mixture of the two antibiotics gentamicin and tetracycline was effective in inhibiting the bacterium R. solanacearum from infecting plantain seedlings. This finding is similar to that reported, where Cumbre® was shown to be effective in controlling this pathogen in tomato. Taking into account that the lixiviates used in this study are as equally effective as the antibiotics, we do not recommend the use of Cumbre®. On observing the effect of the lixiviates on disease progress, we recommend that plantain farms apply this ecological alternative every 2 weeks to reduce disease incidence and expression of wilt symptoms and as a preventive to protect the crop from infection. Of the three lixiviates obtained from plantain rachises, that collected from Las Américas Farm was the most effective in reducing the wilt’s progress over time.
152 Water, no R. solanacearum
b 6 With R. solanacearum: b 5 b Water, AUDPC 1 = 204.77 4 b ab a ab Lixiviate from Las Américas, AUDPC = 135.33 a a 3 a a Gentamicin and tetracycline, AUDPC = 152.48 a 2 Lixiviate from La Guaira, AUDPC = 154.13
Scale of wilt a
1 Lixiviate from La Manigua, AUDPC = 162.45
0 Lixiviate from La Diana, french marigold and phosphoric rock, AUDPC = 150.86 0714 21 28 35 42 49 1
Lixiviate of pseudostem, AUDPC = 158.17 Tukey 5% Time (days) 1AUDPC = area under the disease progress curve
Figure 2.15.1. Effect of lixiviates from decomposing residues of plantain on the progress of bacterial wilt in plantain seedlings growing in the greenhouse over 7 weeks.
153 Activity 2.16. Effect of lixiviates on controlling bacterial wilt in soil under field conditions at the Santa Elena farm, municipality of Armenia, Quindío
Contributors:E. Álvarez, L. A. Mesa, V. Triviño, J. Loke, and G. Llano
Rationale
Bacterial wilt of plantain is disseminated not only by work tools but also through survival in the soil and dissemination through water. Plantain producers do not have access to practices for disinfecting or inhibiting the multiplication of the pathogen in the soil. This study aims to evaluate the effect of three sources of lixiviates of plantain rachis, phosphoric rock, and french marigold for managing, in the soil, foci of bacterial wilt of plantain at the Santa Elena Farm, Municipality of Armenia, Quindío.
Materials and Methods
We identified 14 foci on the Santa Elena Farm where plants presented typical symptoms of bacterial wilt. The farm is located in the village district of La Pradera, corregimiento El Caimo, Municipality of Armenia in Quindío, Colombia. The foci are managed by surrounding the area with polypropylene fiber and guadua or building bamboo to prevent workers from disseminating the disease. Then, for each focus, infected plants and surrounding healthy plants are pulled up and chopped on the site. All tools that had been used in the foci are disinfected with sodium hypochlorite at 2.25% (hypochlorite for pools at 15%, using 600 mL per gallon of water, or Patojito® at half a gallon to half a gallon of water).
Selecting treatments for managing wilt in the field: To evaluate the effectiveness of lixiviate of rachis compost in the ecological management of wilt, we selected at random the treatments described in Table 2.16.1.
The lixiviates were applied only to the site where the diseased plants had been eradicated in each focus. In May, french marigold was chopped up and mixed with the lixiviate 2 days before applying, partly to allow a release of metabolites that inhibit bacteria and partly to facilitate the infiltration of these metabolites, together with the lixiviate, in the area where the roots of the eradicated infected plants are found.
154 Table 2.16.1. Distribution of soil treatments, number of applications, and plantain plants infected by bacterial wilt on the Santa Elena Farm, Municipality of Armenia, Quindío. The field trial was established in November 2005a and evaluated over 13 months. Soil treatment Unit Lixiviate of plantain rachis from Las Américas Farm 1 7 9 12 15 18 applied to plot no.: Number of plants in that plot infected by 5 2 6 3 3 10 bacterial wilt at start of trial, Feb. 2006 Months in 2006 when lixiviate applied March, March, March March, March March April, April, April, May May May
Lixiviate of plantain rachis from La Guaira Farm 3 5 6 8 11 14 applied to plot no.: Number of plants in that plot infected by 3 1 1 3 1 10 bacterial wilt at start of trial Months in 2006 when lixiviate applied March, March March, March, March March April, April, April, May May May
Lixiviate of plantain rachis from Santa Elena Farm 13 17 applied to plot no.: Number of plants in that plot infected by 2 2 bacterial wilt at start of trial Months in 2006 when lixiviate applied March March, April, May a. Plots 1, 7, 9, 12, 15, and 18 received applications of phosphoric rock, extract of french marigold, and lixiviate of plantain rachis.
Treatments established in foci of bacterial wilt: Inside the focus, we applied, over the material of diseased plants that had been eradicated and chopped as described previously, the following products:
• Leaves, stems, and flowers of french marigold (fresh weight) at 1 kg/m2 • Phosphoric rock at 25 kg (Bolivariana de Minerales Ltda., Bogotá, Colombia; active ingredients = total phosphorus 29%) • Efficient Microbes (EM), which comprised the principal groups of beneficial microorganisms (phototrophic bacteria, lactic acid bacteria, yeasts, and fungi) at 0.5 L for 20 L of lixiviate • Lixiviate of plantain rachis at 20 L per site
Each focus was numbered and labeled with the treatment applied. It was kept free of weeds by applying glyphosate and manually eradicating any appearance of plantain shoots. The entrance into each focus was defined by a stake, where a tray containing sodium hypochlorite at 2.25% was set down to disinfect shoes on entering and leaving the focus. The precaution was also taken to shake the earth off the shoes before wetting them with the disinfectant.
155 Detecting Ralstonia solanacearum in soil and tissue samples taken from foci infected by bacterial wilt: The soil and plant tissue samples were obtained to determine the presence of bacteria in the plots, designated as foci, where wilt-infected plants were eradicated. Samples were taken every 30 days and processed at the Cassava Pathology Laboratory, CIAT.
Processing soil samples: Soil samples were collected from wilt-infected foci at a depth of 20 to 35 cm, placed in 1-lb polypropylene bags that were duly marked, and conserved in a styroform ice-box for transport from the farm to CIAT. In the laboratory, 3.3 g of soil was weighed from each sample and mixed with 30 mL of sterilized deionized water by vortexing. Serial dilutions were conducted in TE buffer at pH 7.6, taking 1 mL of the mother solution for a 10-1 dilution and, from this, 100 µL for a 10-2 dilution. The diluted solutions were then planted in petri dishes containing semi-selective SMSA medium and incubated at 28ºC for 7 days. As a comparative reference for typical colony growth, we used strain CIAT No. 78 of R. solanacearum race 2 from the collection held at the Cassava Pathology Laboratory, CIAT.
After incubation, we selected those colonies whose growth in the SMSA medium presented morphological characteristics that were similar to those of the reference strain. The selected colonies were re-chopped and planted in drop form on nutritive agar (NA) to obtain individual colonies. After 24 h of culturing in NA, a suspension was prepared in sterilized deionized water. Under aseptic conditions, the concentration of the suspension was determined by reading the absorbance from a spectrophotometer (Turner, model 390) with a wavelength of 600 nm, using Fisher cells (ref. Spectronic 20). The concentration was adjusted by diluting with sterilized deionized water until an absorbance of 0.3 was obtained, corresponding to about 1 × 10-6 colony-forming units per milliliter (He et al. 1983).
The colonies were inoculated onto 45-day-old plantain plants of the variety Dominico Hartón, produced by Silverio González in thermic chambers located in the Municipality of La Tebaida, Quindío. The plants, with naked roots, were transported in carton boxes to the CIAT greenhouses, where they were planted in plastic 1-kg bags containing a sterilized mixture of sand and soil at a rate of 3:2. The plants were not watered for 24 h before inoculation (EPPO 1990).
The inoculation method used was injection with sterilized 1-mL syringes and needle size 27G × 1/2". Of the bacterial suspension, 0.5 mL were inoculated into the pseudostem of each plant at a height of 2 cm from the soil surface. After inoculation, the plants were incubated for 3 days in a humid chamber to guarantee optimal development of the pathogen. They were then placed in the greenhouse under controlled conditions with temperatures between 24º and 29ºC (minimum night and maximum day, respectively), relative humidity between 91% and 80% (maximum night and minimum day, respectively), and light at about 13 h.
Processing plant tissue samples: Samples of different types of infected plant tissues (corms, pseudostems, and leaves) were selected from plantain plants that presented
156 typical symptoms of the disease such as reddish streaks on the pseudostem, and wilt, flaccidity, and yellowing of leaves. These had been ascertained from evaluations conducted during visits to the farm to determine the presence of the pathogen.
Fragments of infected tissue were washed with deionized water for 30 min, disinfected in sodium hypochlorite at 1% for 30 s, then submerged in ethanol at 50% for 1 min, and finally rinsed twice with sterilized deionized water for 10 s to remove residues of the disinfectants. This procedure was conducted in a laminar flow chamber under aseptic conditions, using materials sterilized at 121ºC under 20 lb of pressure for 20 to 30 min. To isolate the bacteria present in the tissue, the disinfected fragments were macerated in a mortar sterilized at 121ºC under 20 lb of pressure with a TE buffer solution (10 mM Tris- HCl and 1 mM EDTA, with a pH 7.6).
The resulting suspension was planted, using a sterilized microspade, in petri dishes containing semi-selective SMSA medium (10 g/L peptone, 5 mL/L glycerol, 1 g/L casaminoacids, and 18 g /L agar). Antibiotics were added under aseptic conditions when the temperature of the SMSA medium was 50ºC. This stock was added as follows: 100 mg/L (600,000 U) polymyxin β-sulfate; 25 mg/L bacitracin (source: 36 mg/L Baneocin®); 0.5 mg/L (82.5 U) penicillin; 5 mg/L chloramphenicol; 50 mg/L 2,3,5 chlorotriphenyltetrazole; and 5 mg/L crystal violet. ( Martins, 2000. Polymerase chain reaction in the diagnosis of bacterial wilt, caused by Ralstonia solanacearum (smith) Yabuchi et al. Thesis ( Doctor of Agricultural Sciences). Georg-August University, Faculty of Agricultural Science, Gottingen, DE. 127 p). The solution of antibiotics was sterilized by filtering, using Millipore filters with pore size of 0.22 µm, and adjusted for use in syringes.
The dishes that were planted with the suspension were incubated for 5 to 7 days at 28ºC. Colony growth was compared with that of strain CIAT No. 78 of R. solanacearum race 2, itself isolated from samples of plantain rachis from Montenegro, Quindío.
The procedure for samples from colonies isolated in SMSA medium was the same as for the soil samples.
Decomposition of materials from infected plants: To accelerate the decomposition of materials chopped up from infected plants, we prepared 12.5 g of Trichoderma harzianum or T. viride (1 × 1010 conidia/g) in 20 L. Four applications were made every 15 days. The two strains were alternated every 15 days. To compare the plots where the product was applied, we had to take into account the appearances of new cases of plantain plants infected by wilt where the material was chopped. In all the treated foci and 10 others, plants infected with wilt and surrounding healthy plants were chopped up, including corms. Each infected plant received an application of 4 L of a mixture of 200 L of water, 10 kg of molasses, 20 L organic matter decomposer facilitated by Sanoplant (Palmira, Valle del Cauca), 200 g of a mixture of T. harzianum, T. viride, and T. koningii (concentration at 1 × 1012 conidia/g), and 200 g of Paecilomyces lilacinus (concentration at 1 × 1012 spores/g). The application was repeated 30 days later.
157 Results and Discussion
From the soil samples taken from foci infected with wilt, we found that, of 172 samples analyzed, only 3 were positive. This finding ratified the difficulty in isolating and identifying viable cells of R. solanacearum in the soil, where the percentage of detection of this pathogen in this study was low (1.7%), confirming findings by Gómez (Gómez E. 2005. Aislamiento, identificación y caracterización del agente causal del moko del plátano, Ralstonia solanacearum raza 2, proveniente de plantaciones afectadas en Colombia. Faculty of Sciences, Pontificia Universidad Javeriana, Bogotá, DC, Colombia), who detected only 8% in soil samples.
The mechanisms of R. solanacearum for surviving in the soil are complicated and little studied. One reason that the pathogen was not readily detected in the soil samples is perhaps that populations decay progressively over time to an undetectable level. This finding contrasts with that reported by Martins (Martins, 2000. Polymerase chain reaction in the diagnosis of bacterial wilt, caused by Ralstonia solanacearum (smith) Yabuchi et al. Thesis ( Doctor of Agricultural Sciences). Georg-August University, Faculty of Agricultural Science, Gottingen, DE. 127 p), who suggested that the bacterium can persist in many soils under different crops, with diverse conditions of management. The bacterium’s survival is linked directly with the presence of water. The soils of most of the farms in Quindío had good drainage, which made it difficult for the pathogen to stay in the soil.
Other tools exist for detecting the bacterium, such as those based on molecular markers, which are more sensitive and specific to the cells of the bacterium in the soil. For example, Álvarez et al. (Alvarez et al., 2006. Diseño y estandarización de una sonda TaqMan para la detección específica de Ralstonia solanacearum Raza 2, en plátano mediante PCR en tiempo real. XLVI Annual Meeting Phytopathological Society (APS) Caribbean Division – XXVII Congreso ASCOLFI, Cartagena, Colombia. Sept. 12-16, 2006) used a TaqMan® probe that is specific to R. solanacearum race 2 in plantain, using real-time PCR. They detected only pathogenic strains of the bacterium isolated from plantain.
In this study, the bacterium was not detected between November 2005 and March 2006 in any of the foci. The pathogen was isolated only in April and October 2006 (Table 2.16.2). In August and September 2006, no samples were taken because seedling indicator plants had been planted to improve the detection of R. solanacearum in the different experimental plots. Indicator plants were planted at 3 per plantain plant infected with bacterial wilt.
Throughout the experiment, we also processed 24 samples of plant tissues from new cases of plants infected with bacterial wilt around the treated foci. Results were positive, thus confirming the presence of the bacterium around the foci being treated.
158 Table 2.16.2. Detection of Ralstonia solanacearum in soil and plant tissue samples, using SMSA culture medium to determine the effect of a mixture of lixiviate from decomposing plantain rachis, phosphoric rock, and french marigold applied to the soil of foci infected by bacterial wilt at the Santa Elena Farm, Quindío, Colombia. Eight samplings were conducted over 13 months. Soil samples Plant tissue samples Month and year in which Positive for R. Positive for R. samples were taken (no.) solanacearum (no.) (no.) solanacearum (no.) 1 Nov, 2005 21 0 15 1 2 March, 2006 21 0 7 1 3 April, 2006 23 2 3 0 4 May, 2006 23 0 0a 0 5 June, 2006 23 0 0a 0 6 July, 2006 23 0 0a 0 7 Oct, 2006 18 1 0a 0 8 Nov, 2006 20 0 0a 0
Total of samples 172 3 25 2
Efficiency of detection of 1.7 8.0 R. solanacearum (%) a. The sampling of plant tissue could not continue because of the chopping up of infected plants. The gradual decomposition of plant tissue made sampling impossible.
Visits to the farm allowed us to monitor the area around the treated plots and so identify the pathogen’s dissemination by the appearance of new cases. We saw an increase in August, noting that new cases of infected plants consistently appeared very close to the old foci, probably because of deficient eradication of healthy plants around the infected plants at the beginning of the experiment. To create soil conditions more conducive to pathogen development, we planted indicator plants in plastic bags and placed them inside the experimental plots. The bags were placed below soil level, thereby permitting the accumulation of moisture in each bag for lack of drainage. In each of the 18 plots, 3 indicator plants were planted. However, none of these plants became diseased with this method of detection.
Of 145 plantain indicator plants planted in July 2006 in 15 experimental plots, none were diseased 4 months later. Nor, in October 2006, was R. solanacearum detected in 16 plants processed in the laboratory, using SMSA culture medium.
The two products applied to the pseudostems, leaves, and corms chopped up from destroyed plants were compared with untreated residues for speed of decomposition. The two products decomposed more quickly than the untreated residues. Because this research theme was not an objective of this study, we recommend that tests be conducted in different farms, evaluating residues in cloth bags, with and without treatment, and monitoring weight loss over time.
159 Conclusions
A very low (1.7%) efficiency of detection of R. solanacearum was observed for soil samples from the experimental plots, using SMSA medium. For future studies, we recommend using molecular markers and real-time PCR to detect the pathogen in the soil and plant tissues. During the frequent visits made to the farm, we went through fields recording the appearance of plants newly infected with bacterial wilt. In the site occupied by each infected plant in each focus, we planted three plantain plants after the last application of lixiviate to discover the efficacy of the treatments established. On Day 60, a sampling of soil and plant tissues was conducted to detect the presence of R. solanacearum in the soil and living materials of plantain plants.
Over 9 months, we watched 54 new plants become diseased with bacterial wilt. We concluded that the disease spread in this farm largely because inadequate management practices were used such as the use of tools (e.g., machete and hacking knife) without disinfecting them, lack of early detection and eradication of foci, and not marking infected areas. We did not find evidence dissemination of the disease through the soil. After 2 months, we saw that the 48 plants planted in plastic bags did not become diseased, even with the rainy conditions of the zone. We conclude that the pathogen was not found in plot soil. Because R. solanacearum was absent from the soil, we could not determine the effect control practices had over bacterial wilt. We recommend that plans be established to prevent losses in crops and, hence, drastic applications of chemical products. Likewise, we suggest the use of integrated management packages to control this disease.
160 Output 3: Strengthened capacity of NARS to design and execute IPM R&D, to apply molecular tools for pathogen and pest detection, diagnosis, diversity studies and to device novel disease and pest management strategies
Activity 3.1. Developing integrated pest management strategies for whiteflies
Contributors: J. M. Bueno, I. Rodríguez, X. Tapia, V. Lino and C. Cardona
Highlight:
Continued and expanded diffusion of technology activities within the DFID- funded project on Sustainable Management of Whiteflies
Rationale
Whiteflies have become the target of excessive pesticide use by snap bean and dry bean farmers in the Andean zone. A management system for whiteflies that contribute to reduce pesticide use has been developed and tested with farmers in Colombia and Ecuador (see 2002-2004 Annual Reports). In 2006 we continued and expanded diffusion of technology activities at both sites in Colombia, Ecuador and Bolivia.
Materials and Methods
Following the renewal of the DFID project, diffusion activities were planned and contacts with collaborating partners were made. Preparation of technical and extension bulletins was continued. A large-scale demonstration trial was conducted in the Tenerife area of Colombia. Farmers Schools activities in the Chota region of Ecuador and Tenerife region of Colombia have continued to be developed. Two nurseries for the reconfirmation of the validation trials conducted in Bolivia were carried out. Treatments were disposed in a 3 x 3 Latin square. Whitefly populations were monitored and recorded every week. Yields and economic returns were analyzed.
Results and Discussion
Plots with areas ranging between 1500 and 2300 square meters, each one treated as described before in CIAT’s 2004 Annual Report (CIAT’s proposal and farmers’ traditional method), have supplied us the necessary information in order to guarantee that the whitefly Trialeurodes vaporariorum can be managed with a significant reduction in the use of pesticides, in consequence validating with the obtained results, the technology that CIAT had previously developed years before.
As seen in previous trials and comparing the farmers’ managing practices with the method proposed by CIAT (seed treatment and foliar applications based on the action
161 threshold) results in yields obtained with CIAT’s proposal do not differ with those obtained by farmers with traditional calendar application practices (Table 3.1.1. Colombia: 3 trials; Table 3.1.2. Ecuador: 4 trials). We have been able to demonstrate that with the use of an efficient systemic insecticide as a treatment to the seed and foliar applications at the appropriate time (action threshold) in combination with proper cultural practices, farmers can obtain higher benefit/cost ratios with a reduction of up to a 75% in the amount of applications made per cropping cycle. Table 3.1.1. Yields (Ton/ha) and economic returns obtained with two approaches for control of the greenhouse whitefly Trialeurodes vaporariorum in Tenerife, three of the reference trials in Colombia. Non-replicated demonstrative trial. No statistical analysis performed. Treatment No. of Yield Costs (US$/ha) Benefits (US$/ha) Benefit/cost insecticide (Ton/ha) ratio applications Variable Total Total Net 2005B Farmers practicesa 7 7.9 383 1676 3333 1657 1.9 CIAT’s proposalb 3 9.3 258 1552 3886 2335 2.5 2006A Farmers practices 7 15.5 148 1441 6773 5332 4.7 CIAT’s proposal 2 16.3 258 1552 7316 5764 4.7 2006B Farmers practices 8 11.7 504 1797 3071 1275 1.7 CIAT’s proposal 2 12.8 151 1444 3360 1916 2.3 a 7-8 foliar applications of conventional insecticides b Seed treatment with imidacloprid followed by two foliar applications of conventional insecticides at pre-established action thresholds.
Table 3.1.2. Yields (Ton/ha) and economic returns obtained with two approaches for control of the greenhouse whitefly Trialeurodes vaporariorum in San Rafael phase I and phase II, Yascón and Pimampiro, two of the reference sites in Ecuador. Non-replicated demonstrative trial. No statistical analysis performed. No. of Yield Costs (US$/ha) Benefits (US$/ha) Benefit/cost Treatment insecticide (Ton/ha) ratio applications Variable Total Total Net San Rafael Fase I Farmers practicesa 4 1.5 105.9 744.7 1660 915.2 2.2 CIAT’s proposalb 3 2.0 71.9 710.7 2279 1568.2 3.2 Yascon Farmers practices 3 1.1 45.2 613.5 1012 398 1.6 CIAT’s proposal 1 1.0 18.2 586.5 966 379 1.6 Pimampiro Farmers practices 5 1.3 133.4 749.3 1153.7 404.4 1.5 CIAT’s proposal 3 1.4 77.06 693 1282.2 589.2 1.9 San Rafael Fase II Farmers practices 3 0.93 63.3 687.7 825 137.3 1.2
CIAT’s proposal 2 0.97 48.9 673.2 862 188.7 1.3 a 3-7 foliar applications of conventional insecticides; b Seed treatment with imidacloprid followed by two foliar applications of conventional insecticides at pre-established action thresholds.
162 As in previous trials, and as compared with farmers’ practices, alternative management strategies based on seed dressing and judicious timing of applications based on action thresholds resulted in yields that did not differ from those obtained by farmers with their traditional management approaches (Table 3.1.3). These initial trials clearly demonstrated that technology developed in Colombia and Ecuador also works in Bolivia.
Table 3.1.3. Yields (Kg/ha) and economic returns obtained with three approaches for control of the greenhouse whitefly Trialeurodes vaporariorum in tow sites of Comarapa (San Isidro Valley I and San Isidro Valley II), one of the reference sites in Bolivia. No. of Costs (US$/ha) Benefits (US$/ha) Yield Benefit/cost Treatment insecticide (Kg/ha) ratio applications Variable Total Total Net San Isidro I CIAT’s proposal 1a 2 13.1a 71.6 957.8 1965 1007 2.05 CIAT’s proposal 2b 3 14.5a 175.0 1088.0 2160 1072 1.98 Farmers practicesc 5 15.7a 219.9 1157.9 2355 1197 2.03 San Isidro II CIAT’s proposal 1 1 13.1a 23.1 982.4 2489 1506 2.53 CIAT’s proposal 2 1 10.7a 60.8 964.0 2033 1069 2.11 Farmers practices 6 13.8a 219.9 1228.4 2622 1393 2.13 a Seed treatment with imidacloprid followed by 1-2 foliar application of a conventional insecticide at pre-established action thresholds; b Drench application of imidacloprid followed by 1-3 foliar applications of conventional insecticides at pre-established action thresholds; c 5-6 foliar applications of conventional insecticides. Means within a column followed by the same letter are not significantly different at the 5% level by LSD. C.V. for yields = 16.5%.
Other activities were:
1. Quantification of the impact that both management strategies had on the parasitism of T. vaporariorum nymphs by Amitus fuscipennis (Figure 3.1.1). 2. Reinitiating of Farmers Schools activities in the Chota region of Ecuador and the Cundinamarca or Rio Negro regions of Colombia. 3. Initiation of Farmers schools activities in the San Isidro region of Bolivia 4. Initial impact evaluation in the target region. 5. Diffusion through electronic systems of technical and extension bulletins for Colombia, Ecuador and Bolivia (in Link to web page of CIAT, PDF version) Figure 3.1.2.
163 100 Farmer’s practices CIAT Proporsal 80
60
40 Percentage parasitism
20
0 Tenerife 2005B Tenerife 2006B Figure 3.1.1. Impact in two reference sites in Colombia of two whitefly management strategies on parasitism of Trialeurodes vaporariorum nymphs by Amitus fuscipennis.
New Publications Managing the Whitefly Trialeurodes vaporariorum in String and Field Beans The biology and management of the whitefly Trialeurodes vaporariorum in string and field beans: a technical manual is now available for agronomists and technicians in Latin America. Likewise, three primers on this worldwide, persistent pest, written for farmers in Bolivia, Ecuador, and Colombia, have also just been published.
The publications are part of a strategy to disseminate research results from the project on the Sustainable integrated management of whiteflies as pests and vectors of plant viruses in the tropics, financed by the British Department for International Development (DFID). Coordinated by CIAT, the project is executed by CIAT's Bean Entomology (Colombia), the Corporación Grupo Randi Randi (Ecuador), and the PROINPA Foundation (Bolivia).
For queries on electronic copies of the publications, contact Isaura Rodriguez at [email protected] Figure 3.1.2. Printing of CIAT WEB page http://www.ciat.cgiar.org/beans/index.htm
164 Activity 3.2. Socializing research results on managing bacterial wilt of plantain
Contributors: E. Álvarez, L. A. Mesa, V. Treviño, and J. Loke
Rationale
Bacterial wilt has spread widely because of poor practices in prevention and management such as using infected suckers and contaminated tools and clothes, and lack of early detection and eradication. This activity aims to diffuse information on the integrated management of bacterial wilt to farm owners and workers, technicians, and agronomists in the Municipality of Armenia, Department of Quindío, Colombia.
Materials and Methods
To emphasize the importance of this disease, explain its management, and describe research advances, we programmed two meetings directed by CIAT functionaries and students from the Universidad de Quindío.
Results and Discussion
The first meeting was held on 26 June 2006 at the Santa Elena Farm, Armenia (Quindío), to which 42 persons attended, including farm owners and workers, technicians, and agronomists. At this meeting, the importance of bacterial wilt was discussed, together with possible causes of its dissemination. Management of this problem was explained, and research advances described.
The second socialization was conducted on 31 August 2006 at the La Yalta Farm, which had successfully adopted and adjusted management practices for bacterial wilt. At this meeting, 20 people actively participated, clearing their doubts and discussing recommendations on managing the disease.
165 Activity 3.3. Capacity Building
Table 3.3.1. List of students supervised in 2006.
Ph D. Thesis
Name Supervisor University Title Claire Mukankusi Robin Buruchara University of Breeding beans (phaseolus (Sep 2003 – Aug 2007) Kwazulu-Natal, vulgaris L.) for resistance South Africa to Fusarium root rot (Fusarium solani f. sp. Phaseoli) and large seed size in Uganda Virginia Gichuru Robin Buruchara Makerere Symptomatology and (Sept 2005 – Aug. 2006) University, characterization of Uganda Phythium spp. of major crops in a bean based cropping system in sout- western Uganda Lucia Afanador Kafuri Elizabeth Alvarez Universidad Anthracnosis of Castilla’s (July 2006 – July 2009) Nacional blackberry – variability in Medellin - the species, races of the Colombia casual agent and identification of resistance sources.
MSc Thesis
Name Supervisor University Title Juan Fernando Mejia Elizabeth Alvarez Universidad Evaluation of DArT (Oct. 2005 – Oct. 2007) Nacional, technology as a selection Palmira - marker in genotypes Colombia resistant to frogskin in cassava varieties Alberto Rojas Elizabeth Alvarez Universidad de Identification of (Feb 2006- April 2007) Caldas - anthracnose management Colombia strategies in soursop (Annona muricata) with emphasis in resistance and biofungicide use in the departments of Valle del Cauca and Huila Jose Moderafa Magia Fernando Correa Universidad Inheritance of resistance to (Jan 2005 – Jan 2007) Nacional, Pyricularia grisea in Palmira - different rice cultivars Colombia
166 Table 3.3.1. List of students supervised in 2006 (continued) Name Supervisor University Title Francisco Lopez Cesar Cardona Universidad del Characterization of Machado Valle, Cali- tolerance to damage caused (Aug.2005 - Dec 2006) Colombia by the adults of Aeneolamia varia (F.) as a component of resistance in the genotypes of Brachiaria spp. Maria Elena Cuellar Francisco Morales Universidad del Bean leaf crumple virus: Jimenez Valle, Cali - Transmisión by whiteflies (Feb 2004 - March 2006) Colombia (Gennadius) (Homoptera: Aleyrodidae), search for sources of resistance in Phaselous vulgaris L. and epidemiology. Natalia Villareal Lee Calvert Centro Nacional Protein expression of the Juan Antonio Garcia de Biotecnología Cassava Frog skin virus (March 2006-June 2007) Madrid, Spain (FSV) in bacterial systems (E. coli) Ulises Castro Cesar Cardona Universidad de Mechanisms of resistance Chapingo, to Aeneolamia Albofasciata Mexico and Prosapia simulans in Brachiaria spp. Natalia Labrin Lee Calvert CATIE, Costa Ecological Agriculture in (June 2005 – Jan 2007) Rica the area of genetics to resistance in Venezuelan rice varieties (Orytza Sativa) to the white leaf virus Alejandro Pabon Cesar Cardona Universidad de Mechanisms of resistance (Jul 2004 – March 2006) Viçosa, Brazil to Deois incompleta, D. Schah and Notozulia entreriana in Brachiaria spp. Paola Sotelo Cesar Cardona Universidad Inheritance study of a new (Jan 2005 – Dec 2006) Nacional, begomovirus in snap beans Palmira - (Phaseolus vulgaris) in the Colombia Cauca Valley
Ana Karine Martinez Francisco Morales Universidad Characterization of (Junio 2005 – Junio Nacional, begomovirus and 2007) Palmira – evaluation of tomato lines Colombia for resistance to begomovirus in the Cauca Valley
167 Table 3.3.1. List of students supervised in 2006 (continued) Name Supervisor University Title Maritza Cuervo Lee Calvert Universidad Molecular characterization (Jan 2005 – Sept 2006) Nacional, of isolates of the virus Palmira – associated with cassava Colombia frogskin disease collected from production zones in Colombia Adriana Maria Sanabria Segenet Kelemu Universidad Genetic diversity among Moreno Nacional , isolates of the anthracnose (Dec 2006 – Dec 2007) Bogota – pathogen infecting tropical Colombia fruits Linda Jeimmy Rincon George Mahuku Universidad Virulence and Molecular Rivera Nacional, characterization of Bogota - Colletotrichum Colombia lindemuthianum isolates from different bean production zones of Colombia
BSc Thesis
Name Supervisor University Title Luz Adriana Meza Elizabeth Alvarez Universidad del Microbiological, chemical Becerra Valle, Cali - and Physical evaluation of (Feb 2005 – Dec. 2006) Colombia sources of lixiviate residues of plantain and its effects in the management of bacterial wilt (Finca La Florida) Eliana del Pilar Macea Anthony Bellotti Universidad del Identification of molecular (Aug 2005 – Aug 2006) Valle, Cali - markers associated with Colombia resistance to green mites in cassava Gabriel A Torres Anthony Bellotti Universidad de Evaluation of sogatella Londoño Caldas, Colombia kolophon (kirkaldy) and (Oct 2005 – Oct 2006) Empohasca bispinata (Davidson & Delong) as possible vectors of cassava frogskin disease. Victor Hugo Treviño Elizabeth Alvarez Universidad del Microbiological, chemical Henao Quindio, and Physical evaluation of (Oct 2005 – Oct 2006) Colombia sources of lixiviate residues of plantain and its effects in the management of bacterial wilt (Finca la Manigua)
168 Table 3.3.1. List of students supervised in 2006 (continued) Name Supervisor University Title Marcelo Vargas Elizabeth Alvarez Universidad de Evaluation of ecological (Feb 2005 – Feb 2006) Caldas, Colombia practices of soil management and its effect on moko disease of plantain caused by Ralstonia solanacearum (Finca La Guaira, Dep. Quindio) Omar Zuluaga Elizabeth Alvarez Universidad de Evaluation of ecological (Feb 2005 – Feb 2006) Caldas, Colombia practices of soil management and its effect on moko disease of plantain caused by Ralstonia solanacearum (Finca La Cataluña, Dep. Quindio) Sandra Jimena Cesar Cardona Universidad Sub – lethal effects of Valencia Nacional, antibiosis on the (March 2005 -March Palmira – demography of Zabrotes 2006) Colombia subfasciatus and Acanthoscelides obtectus, storage pests of beans. Anyimilehidi Mazo Anthony Bellotti Universidad del Effect of cotton Bollgard® Vargas Valle, Cali - (Bt) on the diversity and Colombia abundance of soil arthropods in Cauca Valley. Laureano Alberto George Mahuku Universidad Biological control of bean Hernandez Goroy Nacional, diseases: Investigating the (Aug 2006- Aug. 2007) Bogota – potential biocontrol / plant Colombia growth promoting aspect of bacteria isolated from Morinda citrifolia. Angela Iglesias Garcia George Mahuku Universidad del Identifying and developing (Aug. 2006 – Sept. 2007) Valle, Cali - molecular markers linked to Colombia ALS resistance genes in the Andean genotype, G 5686 Andres Jenver Matta George Mahuku Universidad del Identification and (Aug. 2006 – Sept. 2007) Valle, Cali - development of molecular Colombia markers linked to Pythium root rot resistance in common bean genotypes MLB 49-89A and AND 1062 Carlos Fernando Elizabeth Alvarez Universidad de Improvement of nutritional Castillo Londoño Caldas – management for the (Aug. 2006 – Aug. 2007) Manizales preventive control of rose mildew.
169 Table 3.3.1. List of students supervised in 2006 (continued) Name Supervisor University Title Adriana Arenas Elizabeth Alvarez Universidad del Search of resistance sources (June 2006 – June 2007) Valle, Cali - to blackberry anthracnose Colombia in accessions of the Cauca Valley through molecular characterization of isolates of Colletotrichum spp. and its host Rubus glaucus Monica Fernandez de Lee Calvert Universidad del Molecular characterization Soto Valle, Cali - of resistant and susceptible (Dec 2006- Dec 2007) Colombia varieties to the white leaf virus through the use of micro satellite molecular markers. Alba Rocio Corrales Francisco Morales Universidad del Characterization of (Jan 2006- Feb 2007) Tolima begomovirus transmitted through whitefly (belmicia tabaci) in tomato crops (lycupersicum esculento) in the Andean zone departments of Cundinamarca and Tolima
170 Activity 3.4. Training and Consultancy services offered during 2006
Contributors: Members of PE-1
Organizer/ Event Date Place Participants Received by Field Day –Biology and May 5 CIAT-Bean 76 Farmers and management of Trialeurodes entomology / technicians South vaporariorum in beans and Pradera, Valle Valle snap beans Field Day –Biology and March CIAT-Bean 54 Farmers and management of Trialeurodes 22 entomology technicians –South vaporariorum in beans and /Tenerife Valle snap beans (Cerrito, Valle Field Day –Biology and July CIAT-Bean 92 Farmers in South management of Trialeurodes 22 entomology Valle and North vaporariorum in beans and /Tenerife Cauca snap beans (Cerrito, Valle) Pest identification techniques Oct CIAT- cassava 1 Staff -Chiclayo Entomology – SENASA Peru. Foro Internacional sobre Dec 6 CIAT- Palmira 32 Professors, innovación y alianzas para el Agronatura- students, desarrollo del cultivo de Cassava technicians, plátano pathology farmers Curso sistemas modernos de CIAT-MAGFOR 4 MAGFOR staff producción procesamiento y offcials Ricardo utilización de la yuca Valerio, Marlin Torres Picado, Fanor Guerrero Nuñez, Manuel Davila Villegas. Sampling insects, biology of March CIAT – Bean 15 Students whiteflies 17 Entomology Universidad del Valle Cali, Colombia Management of Whiteflies June CIAT – Bean 100 Farmers in 16 Entomology Cáqueza and Fómeque (Cundinamarca)
171 Activity 3.4. Training and consultancy services offered 2006 (continued) Organizer/ Event Date Place Participants Received by Management of whiteflies July 28 CIAT – Bean 50 Professionals, Entomology professors, students, technicians and farmers in XXXII Congress SOCOLEN Manizales Management of pest in Aug 27 CIAT – Bean 43 Farmers associated beans Entomology to FENALCE in Tolima Management of whiteflies Aug 28 CIAT – Bean 53 Flower’s Entomology technicians in Antioquia Whiteflies identification Sept 6 CIAT – Bean 2 Tito Anzoategui, Entomology Angel Fernando Copa Universidad Autonoma Gabriel Rene Moreno - Bolivia Management of pest in Nov 15 CIAT – Bean 31 Professors, and beans Entomology students Nariño University Management of pest in Nov 27 CIAT – Bean 5 CGIAR Directing beans Entomology Board Management of whiteflies Nov 20 CIAT – Bean 101 Students, Entomology technicians and farmers in Seminar Potato good management practices in East Antioquia. Management of whiteflies Feb- CIAT – Bean 1 Patricio Gallegos March Entomology INIAP Ecuador Reconocimiento de March CIAT –Palmira 1 Elias Espindola enfermedades de yuca cassava Distraves - pathology Barrancabermeja
172 Activity 3.4. Training and consultancy services offered 2006 (continued) Organizer/ Event Date Place Participants Received by Reconocimiento y manejo April CIAT –Palmira 1 Antonio Uset, de enfermedades de yuca cassava Instituto Nacional pathology de Tecnología agropecuaria (INTA) Argentina Capacitación en July- CIAT – Palmira 1 Godwin Ameorphe diagnostico de Oct cassava Internacional enfermedades y evaluación pathology Atomic Energy de resistencia Agency, IAEA enfermedades en yuca Ghana Field Day: Manejo de June 23 CIAT – Palmira 50 Farmers and Moko en plátano cassava technicians Finca pathology Santa Elena, Armenia Field Day: Manejo de Ago 31 CIAT – Palmira 15 Farmers and Moko en plátano cassava technicians finca pathology La Yalta, Armenia Field Day: Manejo de Dec 15 CIAT – Palmira Farmers and moko en plátano cassava Technicians, Tulúa. pathology
173 Activity 3.5. Conferences, workshops, meetings attended by one or more staff of PE-1 project Staff Member Date Place Event Segenet Kelemu 4-8 Sept Nairobi, Kenya CIAT- African Meeting 23 March Bogotá, Three party meeting with CORPOICA – Colombia CIAT-CEISA 29 July – 2 Quebec City, American Phytopathological Society Aug Canada meeting 23 Sept – 3 Beijing, China CATAS – Keynote Lecture Oct Friendship Award ceremony offered by the State Administration of Foreign Experts Affairs -CHINA 11-15 Sept Cartagena, XLVI APS – Caribbean Chapter - XXVII Colombia ASCOLFI - III UMNG International Phytopathology Workshop 14-16 Nov Palmira, 2nd International course on Phytosanitary Colombia risks for Colombian Agriculture Marcela Cadavid Oct - Nov Montevideo, EMBO course - Uruguay Elizabeth 17 Feb Armenia I National course on integrated Alvarez Colombia management of plantain crops 18-19 May CIAT – International workshop: Strategic alliances Palmira of the palm sector Colombia 24-25 May Bogotá, Innovation Forum: Technologies for Colombia efficiency, ASOCOLFLORES- Ceniflores 31 May-2 CIAT – IV International congress of Biological June Palmira Control Colombia 19-23 June Bali, Indonesia International Oil Palm Conference 28 Aug. – 2 Manizales, II International seminar on production, Sept. Colombia commercialization and industrialization of plantain 12-16 Sept Cartagena XLVI APS – Caribbean Chapter - XXVII Colombia ASCOLFI - III UMNG International Phytopathology Workshop 14 – 16 Nov CIAT – 2nd International course on Phytosanitary Palmira, risks for Colombian Agriculture Colombia 6 Dec CIAT - International forum: Innovations and Palmira, alliances for the development of plantain Colombia crops. German Llano 11 Nov- 12 Haikou City, Chinese Academy of Tropical Agricultural Dec Hainan Sciences (CATAS) Training course on new Province, technology for Tropical Agriculture for CHINA Developing Countries. 28 Aug. – 2 Manizales, II International seminar on production, Sept. Colombia commercialization and industrialization of plantain
174 Activity 3.5. Conferences, workshops (continued) Staff Member Date Place Event John Loke 6 Dec CIAT – International forum about innovations and Palmira, alliances for the development of plantain Colombia crops 17 Feb Armenia I National course on integrated Colombia management of plantain crops 28 Aug. – 2 Manizales, II International seminar on production, Sept. Colombia commercialization and industrialization of plantain George 29 July – 4 Quebec City American Phytopathological Society Mahuku Aug. meeting Sept 12-15 Cartagena, XLVI APS – Caribbean Chapter - XXVII Colombia ASCOLFI - III UMNG International Phytopathology Workshop. Oct 14-22 Kumming, Yunnan Academy of Agricultural Sciences China in the Yunnan province of the People’s Republic of China Francisco 4 - Feb New Delhi, Visit to whitefly project site in Bangalore Morales Bangalore, Visit and invited lecturer to Virology Hyderabad lectures at ICRISAT in Hyderabad Visit with officials of the Ministry of Agriculture of India Fernando 29-30 Aug. Los Baños, Rice Blast Workshop IRRI-JIRCAS. IRRI, Correa Philippines. 29-30 June San José, Costa Segundo Congreso Arrocero. Rica. 26 – 28 April Brasilia, Brazil VIII Reunión Nacional de Pesquisa de Arroz. 10-14 April Nanjing, China Second Research Coordination Meeting.
26 Feb – 1 The 31st Rice Technical Working Group March Woodlands, Meeting. Texas, U.S.A. Lee Calvert 29 July – 4 Quebec City American Phytopathological Society Aug. meeting Sept 12-15 Cartagena, XLVI APS – Caribbean Chapter - XXVII Colombia ASCOLFI - III UMNG International Phytopathology Workshop. Juan Miguel November Chota , Visit whitefly management field site Bueno Ecuador November Cochabamba, Visit whitefly management field site Bolivia
175 Activity 3.6. List of visitors to the various research activities of PE-1 project.
CIAT – Palmira, Colombia
Name Institution Date Dr Jaime Cárdenas Coordinador de Riesgos April 6/Mayo 15 Fitosanitarios - ICA Dr. Alfredo Quintero Funcionario del Grupo de Analisis May 11 de Riesgos del ICA Dr. Jairo Osorio Coordinador MIP -CORPOICA March 15/July 14
Dr. Enrique Torres CCER Panelist- U. Nacional de May 6-18 Colombia Dr. Achim Doberman CCER Panelist - University of May 6-18 Kansas Dr. Diane Rocheleau CCER Panelist- Clark University May 6-18
Dr. Ricardo E. Quiroga CCER Panelist – Senior May 6-18 Economist IADB Dr. Jan Leach APS President Sept 11
Dr. Hari C Sharma ICRISAT – Entomologist Sept -25-28
Dr. Juan Manuel Alvarez Assistant professor University of Oct 10-12 Idaho Dr. Miguel Serrano Supervisor TD& S Monsanto Oct 17-19
Mr.Pedro Zapata Comité Cafeteros Valle, Colombia Nov. – Dec
Mr. Matthew Levin Ambassador, Embassy of Canada, Nov. 3 Colombia Mrs. Rosalba Levin Embassy of Canada, Colombia Nov. 3
Mr. Stewart Wheeler Political Counselor, Embassy of Nov. 3 Canada, Colombia Ms. Diana Muñoz Candian International Nov.3 Development Agency, CIDA Mr. Brian Armstrong Canadian International Nov. 3 Development Agency, CIDA Dr. Louise Fortman CIAT Board of Trustees Nov.9
Dr. Ken Giller CIAT Board of Trustees Nov.9
Dr. Claudio Wernli CIAT Board of Trustees Nov.9
176 Activity 3.6. List of visitors ( Continued) Name Institution Date
Dr. Andrés Valencia Gerente General ICA, Colombia Nov. 14 Pinzón Dr. Javier Diaz Molina President, ANALDEX, Colombia Nov. 14
Dr. Tod Drenan USDA Nov. 14
Dr. Ramiro Tafur President, SAG Nov.14
Mr. Carlos Escobar Productora de Jugos S.A., Nov. – Dec. Colombia Ms. Catherine Mgendi CGIAR Media Specialist based in Nov. 29 ILRI Nairobi Mr. Silverio González FEDEPLATANO, Colombia Dec. 6 Mr. Over Naranjo Finca La Guaira, Colombia Dec. 6 Mr. Marino Montoya Finca Las Américas, Colombia Dec. 6 Dr. Thierry Lescot CIRAD, Francia Dec. 6 Mr. Jon Jairo Mira AUGURA, Colombia Dec. 6 Mr.Greicy Sarria ICA – Palmira, Colombia Dec. 6 Mr.Carlos Ospina Alcaldía de Buenavista, Colombia Dec. 6 Dr. Jairo Castaño Universidad de Caldas, Colombia Dec. 6 Mr. Alberto Diaz Universidad del Valle, Colombia Dec. 6 Dr. Lorenzo Peláez Corpoica – Nataima, Colombia Dec. 6 Mr. Titus Galema Univ. Larestain, The Netherlands Dec. 6 Dr. Ana Armijos Salazar CIBE-ESPOL, Ecuador Dec. 6
177 Activity 3.7. List of awards to staff in the project PE – 1
- L.E. Romero, I. Lozano Potes and N. Villareal (third place) Semilleros DNA Agro-Bio 2006. Identification of microsatellite molecular markers in rice for resistance to Tagosodes orizicolus". Bogotá, November 2006.
- F.J Correa Victoria, F. Escobar, G. Prado, G. Aricapa, M.C. Duque, and J.L. Fuentes. National Prize of Phytopathology "Rafael Obregón" "Identification of microsatellite markers linked to Pyricularia grisea resistance genes in rice". XXVI Congress of the Colombian Society of Phytopathology and related sciences (ASCOLFI), Cartagena, 12-16 September 2006.
- Segenet Kelemu. Friendship Award 2006 by the State Administration of Foreign Experts Affairs, authorized by the State Council of the People's Republic of China. Beijing, China, September 27, 2006. Most outstanding award for contribution to the economic and social development of the people’s Republic of China.
- Award of Recognition for scientific contribution in rice, Consejo Municipal de General Saavedra, Bolivia 2006.
178 Activity 3.8. List of ongoing special projects 2006
Amount available in 2006 US$ Total project Participating budget Project Title Donor Participating Institutions CIAT Institution (lead scientist) (lead scientist) US$ Precision agriculture and COLCIENCIAS Corporación 406,248 425,564.00 construction of models for Agencia Colombiana de BIOTEC (Elizabeth Alvarez) (Myriam Sánchez) tropical fruit crops Cooperación (2005 – 2007) Internacional (ACCI) MADR Colombia Dynamics of sources of COLCIENCIAS, CORPOICA (Segenet Kelemu) (Jairo Osorio) 219,046.00 inoculum and analysis of the Colombia 46,459 anthracnose pathogen population infecting tropical fruits (2005 – 2007) Evaluation of cross protection COLCIENCIAS, CORPOICA 35,500.00 as a strategy for the control of Colombia (Lee Calvert) (Jorge Gómez) tristeza virus in citrus (2005 – 2007) Development and Ministry of Agriculture CORPOICA, ICA , Corpoica; ICA 118,820 implementation of and Profrutales Ltda. (Lee Calvert) (Jorge Gómez, (approved) phytosanitary certification Rural Development Jorge E. Angel) program for citrus. (MADR), 261,114.00 (total (2006 – 2008) Colombia project cost)
179 Activity 3.8. List of ongoing special projects in 2006 (continued) Amount available in 2006 US$ Total project Participating budget Project Title Donor Participating Institutions CIAT Institution US$ (lead scientist) (lead scientist) Utilization of resistant varieties Ministry of Agriculture Corporación para 7,241 11,340 53,000.00 for the control of cassava and Estudios (Lee Calvert) [Roger de Jesús frogskin disease in the Atlantic Rural Development Interdisciplinarios y Ramos (ANPPY), coast and Cauca zones (MADR)-IICA Accesoria Técnica Alberto Rodríguez (2005-2008) (CETEC), (CETEC)] Asociación Nacional de Productores y Procesadores de Yuca (ANPPY) Increasing Cassava Productivity Inter-American Institute Live Systems 42,213 83, 246.00 through Integrated Pest for Cooperation on Technology (LST), (Andreas Gaigl) (Esperanza Morales) Management Agriculture (IICA), S.A., Bogotá , (2005 – 2007) Colombia Colombia Lulo with aggregated value: Ministry of Agriculture CORPOICA La 148,689 (all two 53,433 202,122 New alternatives for the small and Selva, years) (Mario Lobo) holder Rural Development Universidad de (Alonso Gonzalez, (2006 – 2008). (MADR), Antioquia Zaida Lentini, Colombia Elizabeth Alvarez)
180 Activity 3.8. List of ongoing special projects in 2006 (continued)
Amount available in 2006 US$ Total project Participating Project Title Donor Participating budget Institutions CIAT Institution US$ (lead scientist) (lead scientist) Pest and Disease Resistance, The Generation Challenge EMBRAPA- 894,906.00 Drought Tolerance and Programme, CGIAR CNPMF, Brazil (Elizabeth (Alfredo Alves, Increased Shelf Life Genes Namulonge Alvarez, Anton Bua, from Wild Relatives of Cassava Agricultural and Anthony Bellotti , Titus Alicia, and the Development of Low- Animal Production Hernan Ceballos, Elizabeth Okai, cost Technologies to Pyramid Research Institute Martin Fregene) Chiedozie Egesi) them into Elite Progenitors (NAARI) (2005 – 2007) Crop Research Institute (CRI) National Root Crop Research Institute (NRCRI) Integrated disease management Ministerio de Agricultura Live Systems 41,935 (Esperanza Morales, 89,180.00 in cassava. y Desarrollo Rural de Technology (LST) (Elizabeth Jaime Jaramillo) (2005 – 2007) Colombia (MADR) and S.A., Colombia Alvarez) Inter-American Institute for Cooperation on Agriculture (IICA), Colombia
181 Activity 3.8. List of ongoing special projects in 2006 (continued) Amount available in 2006 US$ Total project Participating Project Title Donor budget Institutions CIAT Participating (lead scientist) Institution US$ (lead scientist) Evaluation of the Effectiveness SIDA SAREC, Sweden NARS Universities 30,000.00 of Biorationals Used in the and research (Eliaineny Minja) (Mabel Imbuga, Management of Bruchid Pests programs in Kenya Paul Tarus, on Beans (Phaseolus vulgaris) and Tanzania Absolom Munyasi, by Small-Scale Farmers in the John Ogecha, Lake Victoria Basin Phanice Namungu, (2004 – 2007) Hashim Barongo, Goodluck Kimaro) Integrated management of Department for IITA 301,557 449,076 2,613,071.00 whiteflies in the tropics – Phase International Development AVRDC (Francisco (James Legg, III (DFID), UK CIP Morales, Cesar Peter Hanson, (2005 – 2008) CABI Cardona, Anthony Isabel Carballal) NRI Bellotti, Glenn Hyman) Improvement of nutrient COLCIENCIAS, CENIFLORES 19,011 7,387 75,969.00 management for the control of Colombia ASOCOLFLORES (Elizabeth (Rebeca Lee) mildew disease in roses, caused Alvarez) by the fungal pathogen 60,702 (total) Peronospora sparsa (2006 – 2007)
182 Activity 3.8. List of ongoing special projects in 2006 (continued)
Amount available in 2006 US$ Total project Participating Project Title Donor budget Institutions CIAT Participating US$ (lead scientist) Institution (lead scientist) Promotion of Integrated Pest DFID, United Kingdom NARS in Uganda, 113,118.00 Management Strategies for Kenya, Tanzania (Eliaineny Minja, (Michael Ugen, Fina Major Insect Pests of Phaseolus and Malawi Robin Buruchara, Opio, John Ogecha, Beans in Hillsides Systems in Kwasi Ampofo) Felister Makini, Eastern and Southern Africa Catherine Madata, (2005 – 2006) David Kabungo, Patrick Mviha, B. Chibambo) Pesticide use reduction and FONTAGRO INIA, Venezuela 41,000 34,000 224,000.00 development of resistance to FEDEARROZ, (Fernando Correa, (Reinaldo Cardona, pesticides in rice and beans in Colombia César Cardona) Miguel Diago, Colombia, Venezuela and INIAP, Ecuador Sandra Garcés) Ecuador (2005 – 2008) Studies in epidemiology and COLCIENCIAS CORPOICA 70,250.00 control of the anthracnose (Segenet Kelemu) (Jairo Osorio) disease of mango 35,000 payment (2006-2008) still pending
183 Activity 3.8. List of ongoing special projects in 2006 (continued) Amount available in 2006 US$ Total project Participating Project Title Donor budget Institutions CIAT Participating US$ (lead scientist) Institution (lead scientist) Combating the Hidden Hunger CIDA MADR, in Latin America: Biofortified Universidad de (Elizabeth Jairo Castaño crops with improved vitamin A, Caldas Alvarez) Jaime Jaramillo essential minerals and quality Petrotesting José Restrepo project FIDAR (Joe Tohme, (2005 - 2010) Anthony Bellotti, Bernardo Ospina) Collection, characterization, Ministry of Agriculture CORPOICA, 194,705.00 and clonal multiplication of and PROFRUTALES (Elizabeth (Juan Jaramillo, avocado with emphasis on Rural Development Alvarez) Danilo Rios) identification of lines tolerant to (MADR), Phytophthora spp. Colombia (Alvaro Mejia, (2006-2008) Alonso Gonzalez, Joe Tohme) Understanding the Mechanism United States Department USDA 61,146.00 of Plant Resistance to of Agriculture (USDA) (Anthony Bellotti) (Stephen Lapointe) (103,146 total Whiteflies budget) (2004 – 2008)
184 Activity 3.8. List of ongoing special projects in 2006 (continued)
Amount available in 2006 US$ Total project Participating Project Title Donor budget Institutions CIAT Participating Institution US$ (lead scientist) (lead scientist) Implementación de modernas Centro Internacional de la (Lee Calvert) 20,000 tecnicas de diagnostico Papa - CIAT (Elizabeth molecular de virus, viroides Alvarez) y fitoplasmas en frutales y hortalizas de costa, sierra y selva del Perú (2006-2008)
185 Activity 3.9. List of project proposals and concept notes developed with partners
Donor/Title Lead Researcher/ Total Budget Principal Contact US$ FONTAGRO – Bioplaguicidas como alternativas S. Kelemu/ C.Cardona/ 490,000 verdes de control de plagas y enfermedades para G. Mahuku aumentar la competitividad de pequeños agricultores Andinos. Sent 03/22/06 FONTAGRO - Caracterización y manejo de la F. Correa 298,000 antracnosis (Colletotricum spp) del mango, aguacate y guanábana en Colombia, Ecuador y Perú. Sent 04/03/06 FONTAGRO - Fortalecimiento de cadenas de valor E. Alvarez 250,000 de plátano: innovaciones tecnológicas para reducir Approved sept 2006 agroquímicos FONTAGRO - Productores de lulo y mora A.Gonzalez/ E. Alvarez/ 486,000 competitivos mediante selección participativa de A. Gaigl/ Z.Lentini/M. clones élite, manejo integrado del cultivo y Gottret fortalecimiento de cadenas de valor. Approved Sept 2006 Rural Sector Support Programme – World Bank R. Kirkby/ Clifford S. 299,610 funded Bilateral programme – Gold, Visitng Scientist Empowering farmers and strengthening research through capacity building to improve banana productivity in Rwanda: Linking scientist training with farmer participatory research CIP – L.Calvert/ E. Alvarez 20,000 Implementación de modernas tecnicas de diagnostico molecular de virus, viroides y fitoplasmas en frutales y Approved hortalizas de costa, sierra y selva del Perú SENA –BPA E. Alvarez/John Loke 89,376 Producir plátano con estándares internacionales de calidad, en fresco y procesadoa través de la implementación de buenas practicas agrícolas BPA, en cinco municipios del departamento del Quindío. Fondo Nacional Hortifruticula – ASOHFRUCOL Elizabeth Alvarez/ John 89,955 Producir plátano con estándares internacionales de Loke/German Llano calidad, en fresco y procesado a través de la implementación de buenas practicas agrícolas BPA, en seis (6) municipios del departamento del Quindío.
186 Activity 3.9. List of project proposals (continued) Donor/Title Lead Researcher/ Total Budget Principal Contact US$ Grupo Agroindustrial La Fabril – John Loke 95,865 Identificación del agente causal y el manejo de una enfermedad destructiva de Palma de Aceite en Ecuador Fondo latinoamericano de innovación en palma Elizabeth Alvarez /John 603,456 africana (FLIPA) – Loke identificación del agente causal y el manejo de una enfermedad destructiva de palma africana en Colombia y Ecuador MADR - Fortalecimiento de la cadena productiva de E.Alvarez 337,952 mora, mediante manejo integrado de enfermedades y selección de clones élite. MADR - Ajuste y validación de innovaciones E. Alvarez 260,870 tecnológicas para reducir agroquímicos en plátano Sub-Saharan Africa Challenge Program – G. Mahuku 1,000,000 Increasing the productivity, stability, sustainability and Approved profitability of smallholder agriculture in vulnerable production systems through more effcient use of water and nutrients. SPII, Karaj, Iran – Improvement of Chitti bean in G. Mahuku 224,000 Iran; Approved Rockefeller Foundation – G. Mahuku 322,230 Enhancing Crop Productivity: Exploiting the molecular basis of host-pathogen interaction to develop durable disease resistance in African crops, using Angular Leaf Spot disease of bean as a model FONTAGRO - Habichuelas (vainitas) G. Mahuku 490,000 verdaderamente verdes: Una alternativa limpia para generar empleo e ingreso para pequeños agricultores. Sub- Saharan Africa Challenge Program – G Mahuku 2,000,000 Improving potato-bean-sweet-potato (PBS) based rural livelihood systems through integrated soil ecosystem management (ISEM), market development and nutritional innovation in the highlands of Lake Kivu area. Federal Ministry of Finance (BMF), Austria – G. Mahuku 709,000€ Improving fruit and vegetable product quality from smallholder systems: Optimizing soil-crop-pest management for economically viable, socially acceptable and ecologically sustainable production. Bilateral Project for Belgium – G Mahuku 3,000,000€ Improving rural livelihoods in Rwanda: Promoting integrated crop, diseases, and pest management 9ICDPM) strategies for intensification and diversification of agricultural systems
187 Activity 3.10. List of Publications
Refereed journal articles
Abello, J. F., Kelemu, S. 2006. Hongos endofitos: Ventajas adaptativas que habitan al interior de las plantas. Revista Corpoica Ciencia y Tecnología Agropecuaria (in press).
Alvarez, E., Mejia, J.F. 2006. DNA Sequence Analysis of the 16SrRNA region of Phytoplasma associated with lethal wilt in oil palm. Fitopatología Colombiana 29(1):39-44
Alvarez, E., Mejia, J.F., Loke, J., Llano, G. 2006. Detection and characterization of a phytoplasma associated with cassava frogskin disease Fitopatología Colombiana 29(2):69-76
Blair, M. W., Muñoz, C., Garza, R., Cardona, C. 2006. Molecular mapping for resistance to the bean pod weevil (Apion godmani Wagner) in common bean. Theoretical and Applied Genetics 112(5): 913-923.
Blair, M.W., Rodriguez, L.M., Pedraza, F., Morales, F.J., Beebe, S. 2007. Genetic mapping of the bean golden yellow mosaic geminivirus resistance gene bgm-1 and linkage with potyvirus resistance in common bean (Phaseolus vulgaris L.).Theoretical Applied Genetics 114: 261-271.
Fuentes, J.L., Correa-Victoria, F.J., Escobar, F., Prado, G., Aricapa, G., Duque, M.C., Tohme, J. 2006. Microsatellite markers linked to the blast resistance gene Pi-1 in rice for use in marker assisted selection. Euphytica (accepted)
Jia, Y., Correa-Victoria, F.J., McClung, A., Zhu, L., Wamishe, Y., Xie, J., Marchetti, M., Pinson, S., Rutger, N., Correll. J. 2006. Rapid determination of rice cultivar responses to the sheath blight pathogen Rhizoctonia solani using a micro-chamber screening method. Plant Disease (accepted)
Holguin, C.M., A. Carabali, A.C. Bellotti. 2006. Tasa intrínseca de crecimiento de la población de Aleurotrachelus socialis Bondar en Yuca Manihot esculenta Crantz. Revista Colombiana de Entomolgia (32)2: 140-144.
Lopez-Gerena, J., Correa-Victoria, F.J., Prado, G., Tohme, J., Zeigler, R., Hulbert, S. 2006. Mapping QTL affecting partial resistance and identification of new blast resistance genes in rice (Oryza sativa). Theor. Appli. Genet. (submitted)
Morales, F.J. 2006. History and current distribution of begomoviruses in Latin America. Advances in Virus Research 67: 127-162.
Morales, F.J. 2007. Tropical Whitefly IPM Project. Advances in Virus Research 69: 249-311.
Velten, G., Rott, A., Cardona, C., Dorn, S. 2006. Effects of the plant resistance factor arcelin on parasitism f the common bean bruchid Acanthoscelides obtectus (Coleoptera: Bruchidae) by its natural enemy Dinarmus basalis (Hymenoptera: Pteromalidae). Biological Control (Submitted).
188 Velten, G., Rott, A., Cardona, C., Dorn, S. 2006. The inhibitory effect of arcelin on the development of Acanthoscelides obtectus. Journal of Stored Products Research (Accepted January 19 - 2007). Velten, G., Rott, A., Conde Petit, B., Cardona, C., Dorn, S. 2006. Influence of dry beans seed traits on tritrophic interactions. Biological Control (Submitted).
Non-refereed Journals:
Blair, M. W., Cardona, C., Garza, R., Weeden, N., Singh, S.P. 2006. Development of a SCAR marker for common bean resistance to the bean pod weevil (Apion godmani Wagner). Annual Report of the Bean Improvement Cooperative 49: 181-182.
Books and Book Chapters
Calvert, L.A. 2007. Tenuiviruses affecting wheat. “Compendium of Wheat Diseases and Insects (Third Edition)” Editor Bill Bockus. (In press)
Calvert, L.A., Lentini, Z. 2007. Rice hoja blanca virus. “Characterization, Diagnosis & Management of Plant Viruses Vol. 4” Eds. Rao, G.P., Bragard, C. and Lebas, B.S.M. (In press) pp. 85-98.
Melo, E.L., Ortega, C.A., Gaigl, A., Koppenhöfer, A., Bellotti, A.C. 2006. Evaluación de patogenicidad e infección de la nueva especie Steinernema scarabaei Stock & Koppenhöfer (Rhabditida: Steinernematidae) sobre la chisa rizófaga Phyllophaga pos. Bicolor. In: Nematodos entomoparásitos: Experiencia y perspectivas. Eds. J.C. Parada, J.E. Luquez Z, W de J. Piedrahita C. Universidad Nacional de Colombia. Conciencias, Colombia. pp. 127-136.
Melo, E.L., Ortega, C.A., Gaigl, A., Bellotti, A.C. 2006. Evaluación de cinco aislamientos de nematodos entomoparásitos, nativos e introducidos, para el manejo de chisas rizófagas (Coleoptera: Melolonthidae) de tercer instar. In: Nematodos entomoparásitos: Experiencia y perspectivas. Eds. J.C. Parada, J.E. Luquez Z, W de J. Piedrahita C. Universidad Nacional de Colombia. Conciencias, Colombia. pp. 156-165.
Melo, E.L., Ortega, C.A., Gaigl, A., Ehlers, R., Bellotti, A.C. 2006. Parasitismo de dos cepas de entomonematodos, una nativa (Steinernema feltiae, cepa Colombia) y otra introducida (Heterorhabditis bacteriophora cepa E-Nema®), sobre los seis estados de desarrollo de Cyrtomenus bergi Froeschner (Heteroptera: Cydnidae) en condiciones de laboratorio. In: Nematodos entomoparásitos: Experiencia y perspectivas. Eds. J.C. Parada, J.E. Luquez Z, W de J. Piedrahita C. Universidad Nacional de Colombia. Conciencias, Colombia. pp. 175-183.
Melo, E.L., Ortega, C.A., Gaigl, A., Bellotti, A.C. 2006. Evaluación de concentraciones de Heterorhabditis bacteriophora (Italia) sobre larvas de segundo instar de Phyllophaga menetriese (Coleoptera: Melolonthidae). In: Nematodos entomoparásitos: Experiencia y perspectivas. Eds. J.C. Parada, J.E. Luquez Z, W de J. Piedrahita C. Universidad Nacional de Colombia. Conciencias, Colombia. pp. 184-191.
189 Rejane Nunez Farias, A., Bellotti, A.C. 2006. Pragas e Sece controle. In: Aspectos socioeconômicos e agronômicos da mandioca. Eds. L.S. Souza, A. Rejane N. F., P.L.P. de Mattos, W.M. G. Fukuda. EMBRAPA, Mandioca e Fruticultura Tropical. Cruz das Almas, BA, Brazil, 2006. pp. 591-671.
Conference/Workshop Presentations
Alvarez, E. 2006. DNA sequence analysis of the 16s rRNA region of phytoplasma associated with lethal wilt in oil palm. International Oil Palm Conference. Nusa Dua- Bali, Indonesia. June 19 -23, 2006.
Alvarez, E. 2006. Pudriciones radiculares en cultivos tropicales: Pudrición de raíz en yuca (Manihot esculenta Krantz) causada por Phytopthora spp. In : Memorias II Curso Internacional de Riesgos fitosanitarios para la agricultura colombiana. Palmira ,Colombia, Nov. 14-16, 2006. pp. 159 -167.
Alvarez, E., Mejia, J.F., Gómez, E. 2006. Diseño y estandarización de una sonda TaqMan para la detección especifica de Ralstonia solanacearum Raza 2, en plátano mediante PCR en tiempo real. XLVI Annual Meeting American Phytopathology society (APS) Caribbean Division - XXVII Congreso ASCOLFI, Cartagena, Colombia, Sept. 12-16, 2006.
Alvarez, E., Llano, G., Loke, J.B. 2006. Efecto de dos especies de Trichoderm sobre el rendimiento y control de pudrición de raíces de yuca. XLVI Annual Meeting American Phytopathology society (APS) Caribbean Division - XXVII Congreso ASCOLFI , Cartagena, Colombia, Sept., 12-16, 2006.
Bellotti, A.C., Fregene, M. 2006. Low-cost Technologies for pyramiding useful genes from wild relatives of cassava into elite progenitors. Generation Challenge Program 2006 Annual Research Meeting. Sao Paulo, Brazil, Sept. 12-16, 2006.
Bueno, J. M. 2006. Situación de la mosca blanca en Colombia y su manejo integrado. Seminario Buenas Prácticas Agrícolas en cultivos hortofrutícolas con énfasis en la papa y su incidencia en los problemas fitosanitarios. Medellín, Colombia, Nov. 20, 2006.
Bueno, J. M., Jara, C. 2006. Manejo de mosca blanca en habichuela. Seminario Tecnológico de Mosca Blancas. Corpoica, Centro de Investigación Nataima, Espinal, Tolima, Colombia. Nov. 2004.
Caicedo, A.M., Valencia, A., Montoya-Lerma, J., Bellotti, A.C. 2006. Respuesta inmune de Cyrtomenus bergi Froeschner (Hemiptera: Cydnidade) en presencia de Trypanosomatidae en órganos y hemocelo. Resúmenes XXXIII Congreso Sociedad Colombiana de Entomología, SOCOLEN. Manizales, Colombia. July 26-28, 2006. p. 37.
190 Correa-Victoria, F.J. 2006. Improving Blast Resistance for Upland Rice in Colombia: a Challenging Task. 31st Rice Technical Working Group Meeting. The Woodlands, Texas, USA. Feb. 26 - March 1, 2006.
Correa-Victoria, F.J. 2006. Identification of molecular markers for pyramiding rice blast resistance genes. Second Research Coordination Meeting. Nanjing, China. April 10-14, 2006.
Correa-Victoria, F.J. 2006. Avances en la investigación en enfermedades del arroz: Pyricularia grisea. II Congreso Brasilero de la Cadena Productiva del Arroz. VIII Reunión Nacional de Pesquisa de Arroz. EMBRAPA, Brasilia, Brasil. April 26-28, 2006.
Correa-Victoria, F.J. 2006. Situación del complejo acaro-hongo-bacteria en el arroz. Segundo Congreso Arrocero. San José, Costa Rica, June 29-30, 2006.
Correa-Victoria, F.J. 2006. Using rice differentials with known blast resistance genes for pathogen characterization and improving rice cultivars in Latin America. Rice Blast Workshop IRRI- JIRCAS. IRRI, Los Baños, Philippines, August 29-30, 2006.
Rodríguez, I., Bueno, J. M., Cardona, C. 2006. Validación de una alternativa para el manejo racional de Trialeurodes vaporariorum en habichuela. XXXIII Congreso de la Sociedad Colombiana de Entomología (SOCOLEN), Manizales, Colombia. Julio 26 - 28 2006.
Carabali, A., Bellotti, A.C., Montoya-Lerma, J. 2006. Potencial demográfico del biotipo B de Hemisia Tabaco (Homoptera: Aleyrodidae) sobre genotipos Africanos de Manihot Esculenta Crantz. Resúmenes XXXIII Congreso Sociedad Colombiana de Entomología, (SOCOLEN0. Manizales, Colombia. Julio 26-28, p.32.
Holguin, C.M., Herrera, C.J., Bellotti, A.C. 2006. Diagnóstico de Moscas Blancas (Homoptera: Aleyrodidade) en Yuca Manihot Esculenta de la zona cafetera de Colombia. Resúmenes XXXIII Congreso Sociedad Colombiana de Entomología, (SOCOLEN). Manizales, Colombia. Julio 26- 28, p.125.
Kelemu, S. 2006. Endophytic life in economically important tropical forage Brachiaria grasses. APS Annual Meeting- Caribbean Division/ASCOLFI, Cartagena, Colombia. Sept. 12-16, 2006.
Kelemu, S., Abello, J., Garcia, C. 2006. Agrobacterium-mediated transformation of Acremonium implicatum with green fluorescent protein (GFP) gene. (abstract). Phytopathology 96:S 59.
Kelemu, S., Fory, P., Rao, I., Lascano, C. 2006. Endophytic bacteria promote plant growth in tropical forage brachiariagrasses (abstract). Phytopathology 96:S 59.
Raigosa-Flores, N. E., Peraza-Echeverria, L., Kelemu, S., James-Kay, A. 2006. A biocidal protein isolated from seeds of Clitoria ternatea inhibits the growth of Mycosphaerella fijiensis, the causal agent of black Sigatoka disease. VIII Congreso
191 Internacional/XXXIII Congreso Nacional de la Sociedad Mexicana de Fitopatologia, A.C., Manzanillo, Colima, Mexico. July17-20, 2006.
Extension bulletins and brochures (other publications)
Cardona, C., Rodríguez, I., Bueno, J. 2005. Manejo de la mosca blanca o palomilla en los cultivos de habichuela y fríjol. Centro Internacional de Agricultura Tropical (CIAT); Department for Internacional Development (DFID); Instituto Colombiano Agropecuario (ICA), Cali, CO. 28 p. (Documento de Trabajo no. 347 cartilla no. 1)
Cardona, C., Rodríguez, I., Bueno, J., Tapia, X. (eds). 2005. Manejo de la mosca blanca o palomilla en los cultivos de fréjol y vainita. Centro Internacional de Agricultura Tropical (CIAT); Department for Internacional Development (DFID); Corporación Grupo Randi Randi, Cali, CO. 28 p. (Documento de Trabajo no. 347 cartilla no. 2)
Cardona, C., Rodríguez, I., Bueno, J., Lino, V., Barea, O. (eds). 2005. Manejo de la mosca blanca o palomilla en los cultivos de vainita y frejol. Centro Internacional de Agricultura Tropical (CIAT); Department for International Development (DFID); Fundación PROIMPA, Cali, CO. 28 p. (Documento de Trabajo no. 347 cartilla no. 3)
Morales, F., Cardona, C., Bueno, J., Rodríguez, I. 2006. Manejo integrado de enfermedades de plantas causados por virus transmitidos por moscas blancas. Centro Internacional de Agricultura Tropical (CIAT); Department for International Development (DFID); Tropical Whitefly IPM Program, Cali, CO. 43 p. (Working document no. 351)
Newspaper and other articles
El tiempo: Investigacion del CIAT en busca de agricultura limpia: Plantas, fuente de plaguicidas, 18 february, 2006. [on line] [cited February 2006] Available in : http://eltiempo.terra.com.co/hist_imp/HISTORICO_IMPRESO/tier_hist/2006-02- 18/index_HISTORICO.html
Moorhead, A. 2006. Finotin, a promising new biopesticide. New Agriculturist, UK. [on line] [ cited January 2006] available in : http://www.new-agri.co.uk/06-/focuson/focuson3.html
News clip on bioethanol - T.V. National News– January2007
Article on bioethanol – Newspaper El Tiempo. February 24, 2007.
Voice of America two hour interview with Segenet Kelemu – Amharic program –October 2006.
192 Activity 3.11. List of Partners/ collaborators
Australia Cooperative Research Center for Tropical Plant Protection University of Queensland
Brazil Alfredo Alves, EMBRAPA-CNPMF Instituto Agronómico de Campinas (IAC)
Belgium Jean-Pierre Busogoro, Agricultural University of Gembloux
Canada Andre Levesque, Agiculture and Agri-Food, Ottawa
Colombia
Adriana Arenas, Universidad del Valle Agrobiológicos SAFE , Laboratory “Natural Control”, Medellín Alberto Soto, Universidad de Caldas Ana Luisa Díaz, ICA Aníbal Tapiero, CORPOICA BIOCARIBE S.A., Medellín Bolívar Muñoz, CORFOCIAL Carlos Aníbal Montoya, ICA CENICAFE, Chinchiná Cenicaña CIAL “La María”, Piendamó, Cauca CIAL “San Bosco”, Mondomo, Cauca, Consejo Regional Indígena del Vaupés (CRIVA) CORPOICA, Nataima, C.I. La Libertad, "La Libertad", Villavicencio, Palmira CORPOICA Rionegro, Antioquia Ing. Gloria Esperanza Santana Corporación para el Desarrollo Sostenible del Norte y Oriente Amazónico (CDA), Vaupés Cristina Aristizabal, ICA Diana López, Universidad del Valle Diego López, Universidad del Valle Edgar Burbano, ICA Esperanza Morales, Life Systems Technology (LST) S.A. Ester Jaramillo, farmer form Quindío Eusebio Ortega, Development Pole–Córdoba and Sucre Germán Hoyos, Syngenta Gloria Esparanza Santana, CORPOICA, Rionegro, Antoquia Grajales S.A. Henry Hamman, Agrovelez, Jamundí, Valle Henry Toro, Universidad de Caldas Hover Naranjo, farmer from Quindío Instituto Colombiano Agropecuario (ICA), Quindío and Valle Instituto Tecnológico de Roldanillo Jaime Jaramillo, Life Systems Technology (LST) S.A. Jairo Castaño, Universidad de Caldas
193 Jairo Osorio, CORPOICA, Bogota James Montoya, Universidad del Valle Jorge E. Angel, Profrutales Ltda. Jorge García, Barpen International S.A. Jorge Gómez, CORPOICA, ICA Luis Enrique Cheverry, farmer form Quindío Luis F. Vallejo, Universidad de Caldas Luz Adriana Meza, Universidad del Quindío Marcelo Vargas, Universidad de Caldas Mario Lobo, CORPOICA La Selva Marleny Salazar, Univesidad del Quindio Martha Londoño, CORPOICA, Rionegro Mayor’s Office of Aguazul, Casanare Mayor’s Office of Armenia, Quindío Miguel Diago, FEDEARROZ Miguel Serrano, Universidad Nacional de Colombia- Bogotá Myriam Sánchez, Corporación BIOTEC Octavio Vargas, Mitsui de Colombia, S.A. Omar Zuluaga, Universidad de Caldas Palmar del Oriente Palmas de Casanare Petrotesting Colombia S.A., Puerto López, Meta. Rebeca Lee, CENIFLORES, ASOCOLFLORES S González, FEDEPLATANO Secretaría de Agricultura del Vaupés, Mitú Silverio González, CORPOICA UMATAs (Mitú, Santander de Quilichao, Buenos Aires, Caicedonia, La Tebaida, and Montenegro) Unidades Municipales de Asistencia Técnica Agropecuaria UMATAs UNIPALMA Universidad Católica de Manizales Universidad de la Amazonía Universidad de los Andes, Bogotá Universidad de los Llanos Universidad de Sucre Víctor Hugo Treviño, Universidad del Quindío Víctor Montaña, Cassava Development Pole, Casanare,
China Zhide Geng, Yunnan Academy of Agricultural Sciences, YAAS
Costa Rica Carlos Manuel Araya, National University, Heredia.
Cuba Instituto de Investigaciones de Viandas Tropicales (INIVIT) Instituto de Investigaciones del Arroz (IIA)
Denmark The Royal Veterinary and Agricultural University (KVL)
194 Ecuador Sandra Garcés, Instituto Nacional Autónomo de Investigaciones Agropecuarias. INIAP Escuela Politécnica del Ejército (ESPE)
France Institut National de Recherche Agronomique (INRA) - Institut National des Sciences Appliquées (INSA), Laboratoire de Biologie Appliquée, Villeurbanne Institute of Research for Development (IRD)
Germany Christian Borgemeister, Institut für Pflanzenkrankheiten und Pflanzenschutz,Fachbereich Gartenbau, Universität Hannover Ralf-Udo Ehlers, Agrar- undErnährungswissenschaftliche Fakultät, Universität Kiel Gisbert Zimmerman, BBA, Federal Biological Research Centre for Agriculture and Forestry (BBA)
Ghana Elizabeth Okai, Crop Research Institute, CRI
Kenya Community Mobilisation Against Desertification in Western Kenya Local Chiefs and religious leaders Ministry of Agriculture Ministry of Education Ministry of Health Paul Calatayud, IRD/ International Centre of Insect Physiology and Ecology ICIPE Reuben Otsyula, KARI SIMLOW UCCIP University of Nairobi
Malawi Chitedze Agric. Res. Station Concern Universal Dedza District Extension Office Local leaders Ministry of Agriculture and Irrigation PLAN International
Niger Chiedozie Egesi, Nacional Root Crop Research Institute, NRCRI
Nigeria James Legg, IITA National Root Crop Research Institute (NRCRI)
Peru International Potato Center (CIP)
Rwanda Gerardine Mukeshimana , UNR
195 Institut des Sciences Agronomiques du Rwanda (ISAR)
South Africa Merion Liebenberg, ARC R. Melis, University of Kwa-Zulu-Natal W. de Milliano, University of Kwa-Zulu-Natal
Switzerland Federal Institute of Technology Development (ETH)
Taiwán Peter Hanson, Asian Vegetable Research and Development Center, AVRDC
Tanzania ADRA- Adventist Development and Relief Agency AHI- African Highlands Ecoregional Programme Anglican Church of Tanzania, Mara Diocese Catherine Madata, Agricultural Research Institute ELCT- Evangelical Lutheran Church of Tanzania Farm Africa FIPS Farm Inputs Promotion Africa HEM- Himo Environmental Management Local government and religious leaders Ministry of Agric.-Armyworm project Minjingu Mines & Fertilizer Ltd. SARI Bean research programme World Vision
Uganda A. Namayanja, National Agricultural Research Organization, NARO AAMP- Area-Based Agricultural Modernisaion programme Africare AHI – African Highlands Ecoregional Programme Antón Bua, Namulonge Agricultural and Animal Production Research Institute, NAARI Ecotrust Fina Opio, NARO Geoffrey Tusiime, Makerere University ISAMI ( CARE/KADFA) Kigesi Diosece Local Government and religious leaders M.A. Ugen, NARO Michael Ugen, NARO NAADS- Uganda National Agricultural Advisory services NEMA – National Environment Management Authority P. Okori, Makerere University PMA- Plan for the Modernisation of Agriculture Titus Alicia, NAARI
United Kingdom Commonwealth Agricultural Bureaux International (CABI) Horticulture Research International (HRI)
196 Isabel Carballal, NRI N. Spence, UK Government Department for Environment Food and Rural Affairs. Scottish Crop Research Institute (SCRI)
United States Chris Schardl, University of Kentucky Daniel Peck, Cornell University Iowa State University John E. Losey, Cornell University Kansas State University Leslie L. Allee, Cornell University Michigan State University Ron Walcott, University of Georgia Stephen Lapointe, United States Department of Agriculture (USDA) Texas A&M University University of California Davis University of Florida
Venezuela Reinaldo Cardona, Instituto Nacional de Investigación Agrícola INIA
Zimbabwe Walter Manyangarirwa, Africa University
197 Output 4. Global IPM networks (Integrated Whitefly Management Technology) and knowledge systems developed.
Activity 4.1. Dissemination of validated IPM Technology in developing countries affected by whitefly pests and whitefly - transmitted viruses that hinder food production and socio-economic development in the Tropics.
Goal: To promote sustainable agriculture and socio-economic growth in resource-poor farming communities possessing mixed cropping systems affected by whitefly pests and whitefly-transmitted viruses in Sub-Saharan Africa (SSA), India, South East Asia and Latin America.
Objectives
1. To provide technical assistance to small- (< 3 ha) and medium-scale (3-8 ha) farmers on the biology, dissemination, and integrated management of whiteflies and whitefly-transmitted viruses affecting major food and cash crops, based on previous diagnostic work and validation of suitable IPM practices.
2. To educate farmers about the multiple negative consequences of insecticide abuse for the control of whitefly pests and whitefly-transmitted viruses, emphasizing the need to reduce production costs, environmental and food contamination, human health risks, and the gradual development of resistance to insecticides in whitefly populations.
3. To establish sustainable mixed cropping systems in order to promote food security and economic growth in small and medium-scale farming communities seeking to diversify their traditional food staples with high-value horticultural crops.
Project Leader and Organization: Dr. Francisco J. Morales, CIAT.
Sub-project Leaders/Collaborators and Organizations: Dr. James Legg, IITA-NRI Dr. Richard Gibson, NRI Dr. John Colvin, NRI Dr. Ian Barker, CIP Dr. Segundo Fuentes, CIP Dr. Oscar Ortiz, CIP Dr. Vyju Lopez, CABI Dr. Francisco Morales, CIAT Dr. Cesar Cardona, CIAT Dr. Anthony Bellotti, CIAT Dr. Peter Hanson, AVRDC
198 Subprojects
1. Whiteflies as vectors of viruses in cassava and sweet potato in sub-Saharan Africa.
2. Whiteflies as vectors of viruses in mixed cropping systems in the lowlands and mid-altitude valleys of Mexico, Central America, and the Caribbean.
3. Whiteflies as pests in the tropical highlands of South America.
4. Whiteflies as vectors of viruses in tomato-based mixed cropping systems in India and S.E. Asia.
5. Whiteflies as pests of cassava in South America and Africa.
Introduction
Phase III of the Tropical Whitefly IPM Project (TWFP) emphasizes the transfer of IPM information and improved germplasm to small-scale farmers affected by whitefly pests and viruses transmitted by whiteflies in the Tropics. The lack of improved germplasm possessing pest and disease resistance, and insufficient technical assistance to small-scale farmers, have been identified as the main constraints hindering the management of whitefly and whitefly-borne viruses that affect food production of major staples, such as cassava and common bean, and the adoption of high value crops, such as tomato, peppers and cucurbits, by small-scale farmers seeking to maximize the income derived from their limited landholdings. Therefore, it is necessary to disseminate information and train agronomists and agricultural technicians on the most effective IPM practices available to control these pests. In the absence of technical assistance and relevant information, pesticides become the pest control method of choice, leading to pesticide abuse, higher production costs, environmental contamination, contamination of agricultural food products, and health problems in rural communities.
Whiteflies as vectors of viruses in cassava and sweet potato in sub-Saharan Africa.
The sub-Saharan Africa project continues to train farmers and disseminate information and resistant cassava and sweet potato varieties in their target areas, primarily in Tanzania, Uganda and Nigeria. Emphasis on the education of farmers and adoption of phytosanitation practices is also important in this sub-project, as many farmers do not understand basic concepts of virus/vector epidemiology, such as the use of virus-infected vs. virus-free planting material; the role of infected plants as virus sources in the field; virus symptomatology; and the role of whiteflies as pests and virus vectors. This knowledge is critical to promote the adoption of virus-resistant cassava and sweet potato varieties in this region. The TWFP has linked the crop improvement activities of international centers, namely IITA (in the case of cassava) and CIP (for sweet potato) to its own IPM technology dissemination activities in order to assure the sustainability of
199 the improved cassava and sweet potato germplasm released in sub-Saharan Africa by these two international centers.
Whiteflies as vectors of viruses in mixed cropping systems in the lowlands and mid- altitude valleys of Mexico, Central America, and the Caribbean.
In Central America, the distribution of common bean varieties possessing resistance to whitefly-borne viruses continues at a fast pace, together with the dissemination of information on the rational use of selective insecticides. Fortunately, the USAID-funded CRSP Project based in Honduras (Zamorano) has maintained a steady output of improved common bean materials possessing excellent levels of resistance to whitefly-borne viruses, and good commercial characteristics. The TWFP is helping the national agricultural research program of El Salvador to multiply seed of these improved varieties for distribution to small-scale farmers, together with an IPM package designed to reduce pesticide inputs.
In the case of tomato, seed of the virus-resistant genotypes identified by the TWFP is being distributed to national programs for use in their breeding programs. Linking of these national breeding activities to the tomato/pepper crop improvement activities of advanced international institutions, such as AVRDC and the University of Wisconsin, is also a major concern of the TWFP. Cuba has made considerable progress in the development of tomato genotypes possessing resistance to whitefly-transmitted viruses. Work is underway to develop the capacity to detect different genes responsible for the resistance to these viruses in Latin America. The molecular markers available could be used to select tomato hybrids and/or varieties bred in North America or the Old World, for resistance to neo-tropical whitefly-borne viruses. Some of these materials have been identified in South America.
In the absence of genetic resistance, the use of physical protection measures is the only alternative for horticultural zones affected by high whitefly populations. This strategy is being promoted and further evaluated as a biologically and economically viable practice to grow these crops under minimum insecticide protection despite high disease pressure. The entire region is now moving towards the concept of ‘Protected Agriculture’.
Whiteflies as pests in the tropical highlands of South America.
In the Andean region, the farmer field schools and complementary farmer participatory approaches have been very successful in increasing common bean yields and reducing pesticide applications in pilot sites of Colombia and Ecuador. This experience is being replicated in Bolivia, where farmers are currently struggling with whitefly pests in their meso-thermic valleys where traditional food crops have been diversified with high value horticultural crops to increase farm income. In these regions, we can find mixed cropping systems that include basic crops, such as maize, beans and potatoes, and high-value crops, such as tomato and peppers. In these environments, whiteflies act mainly as direct pests and, consequently, the project has been promoting the implementation of ‘economic
200 or action thresholds’ that tell farmers when to apply in order to minimize production costs and maximize yields.
Whiteflies as vectors of viruses in tomato-based mixed cropping systems in India and S.E. Asia.
In Asia and particularly India, the deployment of improved tomato lines possessing resistance to whitefly-borne viruses has been very successful. These lines are being constantly improved for other agronomic traits in order to increase their market value and levels of adoption of these varieties by small-scale farmers. In this sub-project, the private sector is being involved with a view to facilitating seed production and distribution of these valuable materials in India.
Whiteflies as pests of cassava in South America and Africa.
Resistance to whiteflies as pests has also been identified and transferred to commercial cassava cultivars in South America. Crosses with African cassava cultivars have already been made in hopes of transferring the resistance identified in South America, to African cultivars affected by different whitefly species in sub-Saharan Africa. However, the South American-based sub-project in charge of these activities, is also promoting other IPM measures to further increase the yields of whitefly-susceptible varieties.
Other support activities
Farmer participatory, Impact assessment and Policy guidelines have also been developed by the TWFP to scale out the IPM technology promoted by the project.
Coordination: State of the Project
The socio-economic importance of whiteflies as pests and vectors of plant viruses has not diminished in most developing countries of the world, even though these patho-systems are actively investigated by a relatively large number of researchers, both in developed and developing nations around the world. The fact is that whitefly and whitefly-borne virus outbreaks continue to cause significant crop losses, even in agricultural regions not previously affected by these pests. For instance, the sub-tropical regions of South America (e.g. Uruguay and Peru) have been experiencing alarming problems in legume and horticultural crops, induced by whitefly-transmitted viruses, in recent years (Figure 4.1.1).
201 Figure 4.1.1.
This region had been free from whitefly-borne viruses affecting legumes and tomatoes until recently. The emergence of yet another whitefly pest, Bemisia afer, in Peru, further complicates the agricultural situation of this country. Recent experiments financed by the TWFP in Peru, showed that this species has the ability to transmit Sweet potato chlorotic stunt virus, a major viral pathogen (Crinivirus) of sweet potato in different regions of the world, including sub-Saharan Africa, where B. afer is also present. A second crinivirus, Potato yellow vein virus, transmitted by the whitefly Trialeurodes vaporariorum, is also causing significant yield losses in potato producing regions (Figure 4.1.2), particularly in the Andean regions of Colombia, Ecuador and Peru. This virus was recently detected in the highlands of Colombia infecting tomato (Figure 4.1.3).
Figure 4.1.2. Figure 4.1.3.
Whitefly-transmitted geminiviruses (begomoviruses) are also spreading in Mexico, Central America and the Caribbean, aided by the continuing dissemination of the B biotype of B. tabaci. This biotype has displaced the A biotype of B. tabaci from the lowlands and mid-altitude agricultural regions, as well as T. vaporariorum from higher agricultural areas, where the A biotype of B. tabaci could not thrive in the past. The B
202 biotype of B. tabaci is now transmitting viruses not present before in inter-Andean valleys. In the Cauca Valley of Colombia, snap bean (Figure 4.1.4) and tomato (Figure 4.1.5) production have been practically abandoned due to these problems
Figure 4.1.4. Figure 4.1.5.
Whitefly-transmitted viruses continue to disseminate and affect many different crops in Asia and the Americas. In Africa, new variants of African cassava mosaic virus are likely to emerge in the future and cause severe yield losses, as in the recent case of the Ugandan variant of East African cassava mosaic virus (Figure 4.1.6).
Figure 4.1.6.
Several begomoviruses affect food and industrial crops in Asia, particularly in India. Tomato leaf curl, for instance, is widely distributed in India (Figure 4.1.7), where a number of pathogenic variants of this virus, are known to exist.
203 Figure 4.1.7. What are the factors driving whitefly and whitefly-transmitted virus epidemics?
There are different factors associated with the continuous spread of whiteflies and whitefly-borne viruses in developing countries around the world:
1) The lack of technical assistance to small-scale farmers. As funds for international and national agricultural research become increasingly scarce, or are devoted to socio-environmental issues devoid of any food production component, resource-poor farmers must resort to highly toxic and ineffective insecticides to protect their crops (Figure 4.1.8). Insecticide abuse eliminates natural whitefly-control agents, giving rise to higher than normal whitefly populations that cause significant direct and indirect damage. On the other hand, the increasing demand for pesticides has allowed agro-chemical companies to increase the number of employees promoting their pesticides in all agricultural regions of the world. 2) Integrated Pest Management (IPM) requires adequate knowledge of the biological and physical factors that condition pest and disease outbreaks. Figure 4.1.8. This knowledge is only partially available at the professional and technical level, and practically non-existent at the farmer level. More important, there are some basic IPM practices that must be in place before
204 other control methods can be successfully applied. For instance, genetic resistance or tolerance to plant viruses is required before other IPM strategies can be deployed. Trying to implement IPM practices, such as biological control agents, sticky yellow traps (Figure 4.1.9), live barriers, etc., before a significantly disturbed (high pesticide use) agricultural system has been stabilized, or in the absence of genetic resistance or more drastic IPM measures (e.g. physical barriers, legal measures), is a waste of time, resources and, more important, a total loss of credibility in farming communities that are instructed to implement ineffective IPM methods. Finally, the application of pesticides is a traditional practice that farmers are very familiar with, whereas IPM methods usually require previous training of farmers and their benefits are not always apparent in the short term.
Figure 4.1.9.
How is the Tropical Whitefly IPM Project addressing these constraints?
It is quite evident that one of the main obstacles in the implementation of IPM ‘packages’ in developing countries, is the incomplete understanding of the biological factors that play a critical role in the emergence of whitefly pests and whitefly-transmitted viruses. Unfortunately, this lack of understanding often affects the entire agricultural sector, from professionals to farmers. Thus, the objectives of Phase III of the TWFP become particularly relevant: “to disseminate information on the most sustainable and effective IPM measures available and validated to manage whitefly pests and whitefly-borne viruses”. The main strategy of the TWFP has been the training of trainers (Figure 4.1.10); education of farmers (Figure 4.1.11); and distribution of technical literature (Figure 4.1.12) through different channels and collaborating national institutions. In this respect, the extension services and farmer participatory research activities play an important but limited role due to the economic situation of most national programs in developing countries, and the magnitude of the task, respectively.
205 Figure 4.1.10. Figure 4.1.11.
Figure 4.1.12
The downsizing of national and international agricultural research institutions in developing countries, and particularly their commodity-oriented programs, has drastically diminished the probability of making a measurable contribution to the alleviation of hunger and poverty in developing countries. The replacement of crop production specialists and conventional plant breeders by molecular biologists and social scientists (instead of achieving the integration of crop production and social scientists), has resulted in a significant reduction in the availability of improved germplasm to resource-poor farmers. The importance of maintaining a constant supply of improved germplasm possessing resistance to the main biotic and abiotic constraints, has been clearly demonstrated by the TWFP in the case of the severe pandemic of African cassava mosaic disease in Uganda and neighboring countries, and in the case of tomato leaf curl in India. The deployment of begomovirus-resistant varieties by IITA and AVRDC with the help of NRI, not only averted a serious famine in the case of Africa, but also contributed to improving the livelihood of many tomato farmers in India (Figure 4.1.13).
206 Figure 4.1.13.
The past common bean improvement efforts of CIAT, to develop varieties resistant to whitefly-borne viruses, prevented the collapse of millions of common bean farmers throughout Latin America in the 1980s and 1990s. Unfortunately, CIAT’s common bean improvement activities have been drastically reduced to less than 10% of the original output due to the disintegration of its original multidisciplinary, commodity-oriented research teams. In the absence of virus - resistant varieties, and considering the gradual deterioration of the genetic resistance incorporated in the old varieties, most IPM programs are bound to collapse in agricultural regions affected by whitefly pests and associated diseases.
The TWFP has identified pesticide abuse as one of the main causes driving whitefly pests and whitefly-borne virus epidemics in the tropics and sub-tropics of the world. Unfortunately, in the absence of technical assistance and availability of resistant germplasm, farmers do not have any other choice to protect their crops. Thus, the condemnation of the ‘green revolution’ by environmentalist groups, has actually contributed to an unprecedented increase in the use of highly noxious pesticides by farmers, in a desperate attempt to protect their crops against an ever evolving population of pests (e.g. biotype B of B. tabaci) and pathogens (e.g. new begomoviruses). Pesticide abuse also prevents the use of environmentally friendly IPM strategies, such as the use of biological control agents, and causes major damage to the flora, fauna and human communities exposed to these noxious and often lethal chemicals (Figure 4.1.14).
207 Figure 4.1.14.
The TWFP has thus emphasized the need to decrease the number of insecticide applications in order to reduce production costs and recover the biological equilibrium of the affected agro-ecosystems. The main strategy to reduce pesticide applications has been the use of varieties possessing resistance not only against whitefly-borne viruses (e.g. cassava, common bean, tomato), but against the whitefly pests as well (e.g. the development of whitefly-resistant cassava varieties in Latin America and sub-Saharan Africa). Another strategy has been the identification of ‘action thresholds’ for most cropping systems where whiteflies act only as a direct pest (not as vectors of plant viruses). This strategy has been successfully demonstrated in the Andean sub-project in Colombia, Ecuador and Bolivia. However, in the case of the whitefly pests of cassava in South America, it has been shown that chemical protection of the planting material for the initial stages of plant growth, has a significant positive impact in the final yield. Thus, the TWFP is actively disseminating information on the most effective and environmentally friendly insecticides available to farmers for all susceptible crops, at the lower possible cost or for use in the most cost-effective way. The TWFP has also been contacted by commercial companies to test new organic products against whitefly pests, as well as by representatives of the main agrochemical companies (e.g. CropLife) interested in the safe use of their products.
Last but not least, the constant feeding of information and active participation of national program scientists in developing countries (Figure 4.1.15), maintains a relatively small but important group of scientists and institutions active in the fight against these important pests. Many scientists have been trained or informed about the most effective and economically viable strategies available around the world to control whitefly pests and whitefly-transmitted viruses. This is a critical activity in developing countries already exposed to the pressures exerted by a globalized economy, particularly considering the dependence developing countries have on agricultural commodities in the international market.
208 Figure 4.1.15.
The way ahead
The success of the TWFP depends on the amount of technology dissemination achieved and potential beneficiaries reached at the end of the project. The weakest component of the IPM measures promoted by the TWFP, is the lack of virus-resistant varieties possessing desirable agronomic, cooking quality, and commercial traits sought by farmers (Figure 4.1.16). Unfortunately, crop improvement is the kind of research activity that has suffered the most drastic reductions at national and international agricultural research institutions, in response to the continuous economic crises that have already caused the financial collapse of some of these institutions. Diverting research funds into unproductive social studies; and false expectations created by novel research techniques, such as molecular marker assisted selection, are at the root of the problem. However, there is no sign in the CG System that crop improvement will become again the highly productive activity it used to be when IARCs had multidisciplinary research teams in charge of providing small-scale farmers with cultivars that did not require costly and noxious inputs. The TWFP can only expect that a significant reduction in pesticide use will help affected agro- ecosystems recover their biological control agents in detriment of whitefly pest populations. Once this is achieved, various other IPM measures could further contribute to the management of whitefly related problems in the tropics.
Figure 4.1.16.
209 Activity 4.2. Integrated management of whiteflies (homoptera:aleyrodidae) on cassava.
Contributors: C.J. Herrera, C. Holguin, A. Muñoz & A. C. Bellotti
Highlights:
Whitefly control in cassava in the coffee growing region of Colombia based on the judicious use of pesticides increased yield from 16.2 to 38.8 tons per hectare, more than doubling yields.
The successful management of whitefly populations in cassava depends on effective control practices that can be implemented early in the crop cycle and/or whitefly attack. These tactics include stake treatment or early application with an effective chemical and/or biopesticide product.
Rationale
In recent years whitefly populations have increased dramatically in certain regions of Colombia. Two whitefly species predominate, Aleurotrachelus socialis and Trialeurodes variabilis. These species are colonizing areas such as the coffee growing region of Colombia, where previously, they did not occur in high populations, nor cause economic damage to the cassava crop. Both aforementioned species are causing a considerable reduction in cassava root yield in this region and farmers are unaware of effective management practices.
This scenario has led to the implementation of an IPM project to generate alternatives for whitefly control in the coffee growing region. Chemical pesticide applications in the region are on the rise and this is increasing production costs as well as the potential to cause outbreaks of secondary pests. Whiteflies are difficult to control with agrochemicals and this often leads to more frequent applications (on a calendar basis), a build up to pest resistance to chemical pesticides, and eventually environmental contamination.
The general objective of this project is to establish a whitefly pest management program that will provide cassava producers with an adequate, opportune, economical and sustainable alternative that will reduce pesticide applications and provide high yields.
Specific objectives include: 1. Obtain information on the present whitefly situation on cassava and in the Colombian coffee growing region. 2. Determine current farmer practices being used to control whiteflies. 3. Determine doses and timing of application of appropriate pesticide use. 4. Provide cassava producers with information and training in integrated pest management and provide alternative techniques, such as biological control and host plant resistance, to reduce pesticide use.
210 Materials and Methods
Cassava Whitefly Diagnostic Survey:. A diagnostic survey was conducted in the target region in order to obtain information on pest distribution, crop damage levels and present farmer practices being employed to control whiteflies. Sixty two cassava farmers were interviewed in the regions, including the Department of Quindio, Risaralda, Caldas and Norte del Valle. Cassava fields were surveyed by selecting 10 plants at random and determining whitefly populations and damage with visual scales previously established in research trials. These 1 to 6 scales aid in determining the whitefly infestation levels in the region (Table 4.2.1 and 4.2.2).
A survey questionnaire was designed for use during farm visits. These visits and interviews were designed to obtain information on the actual situation confronting cassava producers in the field, the severity of phytosanitary problems and farmer needs and priorities. In addition, meetings were held with farmer groups, students, technicians and agronomists in the regions, providing them with information on pest biology and behavior and introducing some whitefly management practices.
Chemical Control. Farmer surveys show that cassava producers are trying to control whitefly outbreaks with numerous indiscriminate chemical pesticide applications. This misuse of agrochemicals indicated the need to develop an effective strategy for the rational use of pesticides, including the evaluation of new products and best dosage, and methods and timing of applications.
Pesticides evaluations were carried out in farmers’ fields in the Department of Quindio during the 2005-06 growing season. Products with new active ingredients were evaluated, using the cassava variety ICA Armenia (HMC 1). The experimental design was completely randomized blocks with 7 treatments, four repetitions per treatment and an absolute control (Table 4.2.3). Evaluations of whitefly populations were initiated fifteen days after planting and continued until plants reached six months. Whitefly eggs nymphs and adults were recorded based on the populations scale (Table 4.2.1). Insecticide applications were made when whitefly populations reached level 3.0 on the 1.0 to 6.0 scale.
In treatments 1 and 2, the first foliar application was with Actara (Thiametoxam at a dose of 0.5 g/l of water). This rotated with a wettable powder (Diafentiuron, doses 2.5cc/l of water). In treatments 4, 5, and 6 a wettable powder combination (Imidacloprid-Beta- cyflutrina, doses: 4cc/l of water) and Opportune (buprofezin, doses of 3cc/l of water) for foliar applications. For the remaining treatments the same insecticide was used for all applications.
At harvest, cassava yields were recorded from the central plant rows for each treatment, and results analyzed (AOV). Cassava root commercial market prices were recorded at harvest. All costs incurred for each treatment, including manual labor and the product value, were registered. These data allowed for a cost-benefit analysis In each treatment
211 the following parameters were calculated: variable costs, total costs, total benefit, net benefit and cost-benefit relationship.
Table 4.2.1. Population scale for the cassava whitefly Aleurotrachelus socialis Bondar. GRADE ADULTS –EGGS NYMPHS-PUPAS 1 NO NO 2 1 – 50 1 –200 3 51 – 200 201 –500 4 201 – 500 501 – 2000 5 501 – 1000 2001 – 4000 6 >1000 >4000
Table 4.2.2. Damage scale of Aleurotrachelus socialis Bondar in cassava. Grade Symptoms
1 Leaves with no damage 2 Young leaves green in color but slightly flaccid 3 Some distortion of young leaves, with slight curling 4 Upper leaves distorted, considerable leaf curling, yellow green mottled appearance As in # 4, but lower leaves with sooty mold and leaf yellowing 5 Considerable leaf necrosis and defoliation, sooty mold on mid and lower leaves and 6 young stems
Table 4.2.3. Doses and methods of application for pesticide treatments of cassava whiteflies. Product Doses/ ha Method of Application Thiamethoxam 25 WG 0.450 Kg Drench at germination Thiamethoxam 25 WG 0.2 Kg Stake dip Etofenprox 10 EC 1 lt Drench at planting Imidacloprid WG70 0.3 Kg Drench at germination Imidacloprid-Beta-cyflutrina SC Imidacloprid 0.8 litros Stake dip (stahe) 0.3 litros Foliar Comercial Control 0.06 Kg Absolute Control * Application at base of plant
Farmer Training: More than 300 persons, including students, farmers, technicians and other professionals have received training in the coffee growing region. Training methods concentrate on seminars and field days and include information on whitefly behavior, damage, natural enemies and pest management practices, especially biological control and judicious pesticides use.
The diagnostic survey described in this report was presented at the Colombian Entomological Congress (SOCOLEN) during 2006.
212 Results and Discussion
Cassava Whitefly Diagnostic Survey, Coffee Region:. The diagnostic survey was carried out with the assistance of the National Coffee Federation in each department, and CORPOICA and ICA (Regional Quindio). Surveys with cassava farmers were done between 1100 and 2900 m.a.s.l. The number of surveys in each department was determined according to the cassava hectares planted (Table4.2.4). The department of Quindio with the greatest area sown had the highest number of farmer surveys (41).
Numerous cassava pests were recorded during these surveys: Whiteflies were the most important and predominant, and recorded on 76% of the farms surveyed. This was followed by two additional pests, traditional in the region, fruitflies (Anastrepha sp) and the cassava hornworm (Erinnyis ello), both at 32% (Figure 4.2.1). These results show that whiteflies, previously a secondary pest in the regions, has displaced the more traditional pests, and have become a major pest causing yield losses.
Two whitefly species predominate: Trialeurodes variabilis was collected from 50% of the fields surveyed and A. socialis from 13%. T. variabilis predominated in all Departments while A. socialis was observed only in Risaralda (Figure 4.2.2). Sixty seven percent of the cassava fields surveyed presented whitefly populations. Fifty five percent of these with a rating of 2.0 (1-50 adults/eggs and 1-200 nymphs and pupae). Eleven percent had an intermediate to high level (grades 3, 4 and 5) and only 1% a grade level 6(>1000 adults and eggs; > 4000 nymphs and pupae per leaf) (Figure 4.2.3). Damage levels in general, remained low with the highest damage and population levels occurring in Quindio Department (Figures 4.2.3 and 4.2.4).
100 90 80 70 60 50 % 40 30 20 10 0 Mosca Mosca Acaros G. Chisa Trips Chinche Hormiga No Blanca Cogollo cachon
Figure 4.2.1. Arthropod pest presen in casavva field in four departments of the Colombian coffee region (2005-2006)
213 10 0 T. variabilis 90 A. socialis 80 Ambas 70
60 No
% 50
40
30
20
10
0 Quindio Risaralda Caldas Norte Valle Depatments
Figure 4.2.2. Whitefly species collected from casavva fields in the Colombian coffee region (2005-2006)
1 2 3 4 5 6 123456 3% 1% 4% 4% 2% 3% 1% 33% 4% 2%
88% 55%
A B
Figure 4.2.3. Population (a) and damage (b) grades caused by whiteflies on cassava in the Colombian coffee region (2005-2006)
214 100 90 123456 80 70 60 % 50 40 30 20 10 0 Quindio Risaralda Caldas Norte Valle
Figure 4.2.4. Whitefly population levels determined in cassava fields in four Colombian departments (2005-2006)
Survey results also revealed that cassava farmers in the regions had minimal knowledge about whiteflies, especially pertaining to their behavior, biology, ecology and management or control. This lack of knowledge resulted in the indiscriminate use of chemical pesticides (34.3% of the farmers surveyed), mostly without any technical advise (Figure 4.2.5). This system has not functioned, as none of the pesticides applied have given adequate control. More than 52% of the farmers have not employed any whitefly control, and only 4.6% have used biological products such as entomopathogenic fungi (Beauveria bassiana and Lecanicillium lecanii) and the generalist predator, Chrysopa sp.
Chemical Biological Non conventional w/o control
34%
52%
9% 5%
Figure 4.2.5. Whitefly control methods employed by cassava farmers in the Colombian coffee region.
Numerous chemical pesticides have been applied by cassava farmers for whitefly control. Dimethoate (Systemin) was the most frequently applied (34% of farmers) (Table 4.2.2). Active ingredients such as Thiametoxan (Actara), Etofenprox (Trebon) and Imidacloprid (Confidor) usually result in effective whitefly control; however applications of these pesticides by farmers have frequently not given good control due to inappropriate timing
215 of applications and inefficient methods of control. This is often due to the lack of knowledge of the whitefly biology, especially of the immature stages (the presence of eggs and early instars nymphs). Farmers normally can only recognize the adult stages and pesticide applications are not timed properly to control immature stages, those most vulnerable to pesticide application.
Chemical Control:. All treatments resulted in significant differences of control on the three pest stages, when compared to the check treatment (Table 4.2.5). In general, all treatments retarded the appearance of the whitefly by 30 days (Figure4.2.6). The number of applications varied for each treatment (Table 4.2.5). When Imidacloprid WP was applied at planting (drench) and followed by foliar applications (Imidachoprid-Beta- Cyflutrina) only 3 applications were required for effective control. The Actara (Thiametoxam) treatment as a stake dip, followed by foliar applications of Actara and Diafentiuron required the most applications, five. The remaining treatments required four applications to adequately reduce whitefly populations (Table 4.2.5).
Nymphal stages provide the best indication of pesticide efficacy. All treatments reduced nymphal populations compared with the check (Figure 4.2.6). However, when Actara (Thiametoxam) and Confidor (Imidacloprid) were used as a stake (stem cutting) dip, low whitefly populations were observed up to 60 days after planting (Figure 4.2.6). This indicates that this type of stake treatment is efficient for maintaining low whitefly populations during the initial stage of crop development. These stake treatments were followed by three to five foliar applications. Over the duration of crop growth lowest whitefly populations were maintained with Imidacloprid as a drench at germination followed by foliar applications of a Imidacloprid-Beta-Cyflutrina combination (Figure 4.2.6).
Cassava root yields were higher in all pesticide treatments than in the check (no treatment), plot, where whitefly populations were highest. Yields were highest in the Imidacloprid WG 70–RE and Imidacloprid-Beta-Cyflutrina – F treatments with 38.8 and 37.0 T/ha respectively (Table 4.2.6), while yield in the control plot was 16.2 T/ha. These results show that yields were more than doubled when effective whitefly control was implemented. Treatments with Etotenprox-F and Imidacloprid (stake dip)-1E also resulted in doubling cassava yields.
These results demonstrate the damage that whitefly populations can cause to cassava and the need for efficient control methods.
Cost-benefit relationship was above 1.0 in all of the treatments including the check (Table 4.2.6). This indicates that farmers will turn a profit, although minimal, even when whiteflies are not adequately controlled. The greatest economic benefit occurred in the Etofenprox (Trebon) foliar treatment (3.38 to l), followed by the Imidacloprid-Beta- cyflutrina-F (3.14 to l) and Imidacloprid WG70–RE (3.10 to l) treatments.
216 Table 4.2.4. Chemical pesticide usage (in percent) for whitefly control by cassava farmers in the Colombian coffee region. (2005-2006). Commercial Product Active Ingredient %
Sistemin Dimetoato 34 Nudrin/Lannate Methomyl 10 Evisect Thiocyclam 3 Troxin Troxin 3 Actara Thiamethoxan 31 Thionil Endosulfan 7 Trebon Etoferprox 3 Confidor Imidacropid 3 Karate Landacyhalotrina 3 Several I.A.. (mixtures) 3
Table 4.2.5. The effect of different insecticide applied for cassava whitefly (on eggs, nymphs and adults) control in the Colombian coffee region. Treatment Doses/ha #Foliar Adults Eggs Nymphs applications Thiamethoxam – RE* 0.450 Kg 4 2.90 bc 2.82 c 2.81 bc Thiamethoxam – IE 0.2 Kg 5 3.04 bc 3.03 bc 2.98 bc Etofenprox - F 1 L 4 3.29 bc 3.29 bc 2.74 bc Imidacloprid WG70 - RE 0.3 Kg 3 2.88 c 2.88 bc 2.73 bc Imidacloprid-Beta-cyflutrina - F 0.8 L 4 3.33 bc 3.29 bc 2.98 bc Imidacloprid (semilla) - IE 0.3 L 4 3.04 bc 2.84 bc 2.58 c Thiamethoxam - F 0.06 Kg 5 3.43 b 3.34 b 3.17 b Control 4.1 a 4.22 a 4.24 a
1. Duncan test: numbers followed by the same letter are not significantly different at the 5% level. 2. Based on population scale, 1= no presence; 2= 1-200 individuals per leaf; 3= 201-500 per leaf; 4= 501-2000 per leaf; 5= 2001-5000 per leaf; 6= > 4000 per leaf. RS= Drench Application; IE= Stake Dip; F= Foliar Application; RE= Drench at germination
217 6 Thia. - RE.
n 5 Thia. - IE. Etofen. - F. 4 Imi. - RE. ImiBcy. - F. 3 Imi. - IE. Thia. - F. 2 Control
Nymphal populatio 1 0 32 47 60 75 89 111 124 137 151 days after planting
Figure 4.2.6. The effect of diverse insecticide applications on nymphal population of whiteflies on cassava
Table 4.2.6. Cassava fields and cost-benefit ratio (based on a price of 260 pesos Col. per root) resulting from different pesticide applications for whitefly control in the Quindio department in Colombia (2005-2006). Treatment yield. Total Total Net. Ton/ha Cost Benefit Benefit Ratio c/b Thiamethoxam – RE* 26.16 2969 6801.4 3832.3 2.29 Thiamethoxam – IE 26.60 2941 6915.7 3974.6 2.35 Etofenprox - F 34.39 2647 8942.6 6295.6 3.38 Imidacloprid WG70 - RE 38.83 3257 10095.2 6838.4 3.10 Imidacloprid-Beta-cyflutrina - F 37.01 3068 9622.3 6553.9 3.14 Imidacloprid (semilla) - IE 31.68 3267 8236.8 4969.5 2.52 Thiamethoxam - F 25.35 2622 6590.7 3969.2 2.51 Control 16.20 2415 4212.4 1797.4 1.74
Results and Discussion
The continual and frequent use of pesticides in cassava for control of arthropod pest is not considered as a long term solution. The results from this research indicate that whiteflies will significantly reduce cassava yields when populations are not managed adequately. Previous results have demonstrated that the continual use of chemical pesticides by small farmers is uneconomical. These results indicate that pesticides, when
218 properly and efficiently applied can greatly increase yields and farmer profits. Timing and mode of application are very important criteria to reduce pesticide applications to a minimum.
The initial application in the farm of a drench at stake germination appears to greatly retard the early build up of the whitefly population. It is currently considered that the follow-up chemical pesticide applications, that proved effective in the trial, can be replaced with biopesticide applications and achieve equal results. Two entomopathogenic isolates of Lecanicillium lecanii and Beauveria bassiana, have given very positive results for whitefly control in cassava in preliminary trials. Field trials are already underway to evaluate the effectiveness of these biopesticide as components of a cassava whitefly IPM program.
It is hypothesized that by limiting or controlling the initial build up of whitefly population that the natural biological control will be more effective in maintaining whitefly populations below economic injury levels. This hypothesis will also be tested in the field. A survey of whitefly parasitoids populations on cassava in the Colombian coffee region has been initiated. Five parasitoids have been identified parasitizing the two whitefly species. The highest percent parasitism on T. variabilis was by Encarsia nigricephala, while on A. socialis, Amitus macgowni was the predominant species. A more complete analysis will be presented in future reports.
Future evaluations in the region will also include the use of the whitefly resistant cassava variety, Nataima 31. This resistant variety developed by CIAT and CORPOICA scientists is being multiplied and released to cassava farmers. Its role is an integrated whitefly management strategy will be determined.
The results presented here and other research and observations strongly indicate that whitefly populations have to be controlled early in the crop cycle. Once whitefly populations begin to increase they are very difficult to suppress, even with chemical pesticide applications. It is for this reason that the initial, early pesticide application may be an important component in an IPM strategy.
We acknowledge the contribution and collaboration of the following institutions in these studies: SENA – Quindio; Secretaria de Agricultura (Quindio, Caldas and Risaralda); Umattas; Comite de Cafeteros; ICA Quindio and Cassava farmers .
219 Annexes
5.1. List of Staff
Principal Staff
Alvarez, Elizabeth, (0.25) Pathologist, headquarters Bellotti, Anthony, (0.0) Entomologist, headquarters Buruchara, Robin A. (0.35) Pathologist, outposted, Uganda Calvert, Lee, (0.30) Virologist, headquarters Cardona, César, (0.0) Entomologist, headquarters Correa, Fernando, (0.10) Pathologist, headquarters Gaigl, Andreas, (1.0) Entomologist, headquarters (Left in July, 2006) Kelemu, Segenet, (0.50) Pathologist and Project Manager, headquarters Mahuku, George, (0.20) Pathologist, headquarters Minja, Eliaineny, (0.80) IPM Specialist, outposted, Tanzania (Left in 2006) Morales, Francisco, (0.70) Virologist and Whitefly Project Coordinator
Research Associates
Arias, Bernardo, Agronomist Llano Rodriguez, Germán Alberto, Agronomist Loke, John Bernard, Agronomist Mukankusi, Clare, Biologist-Breeding, Africa
Visiting Scientists
Ortega-Ojeda, Carlos Alberto Guillaume Cortade Godwin Ameorphe Titus Galema
Research Support Staff
Buah, Stephen, Research Assistant, Pathology/Biotechnology Lab., Africa Cadavid, Marcela, Biologist Cuervo, Maritza, Agronomist/Biotechnology Guerrero, José María, Agricultural Technologist (Acarologist) Hernández, María del Pilar, Biologist-Entomologist Holguín, Claudia María, Agronomist Kananura, Patrick, Research Assistant, Africa Male, Allan, Research Assistant, Biotechnology Lab., Africa Martínez, Ana Karine, Biologist Mejía, Juan Fernando, Agronomist Melo, Elsa L., Biologist Munera, Diego F., Agronomist Mziray, Hendry A., Research Assistant (Agronomy) - Africa Ospina, Claudia M., Agronomist (Springtails Taxonomy)
220 Rodríguez, Jairo, Agronomist Villareal, Natalia, Biologist
Office Staff
Baguma, Athanasio, Administrative Assistant, Africa Escobar, Francisco Social Communicator TWP Garzón de Leal, María Claudia, Secretary Nassozi, Sarah, A.C.I.S., Regional Finance and Administration Officer, Africa Tibalikwana, Mabel, Administrative Secretary, Africa Zamora, Zulma Lorena C., Secretary García, Melissa, Administrative Assistant
Technicians
Acam, Catherine, Africa Rengifo, Herney Zuñiga, Rodrigo
Field Workers
Musoke, Steven, Screen House, Africa Riascos, Romulo Suleiman, Ssebuliba, Breeding, Africa Tamayo, Jose Yela, Oscar
221 5.2. List of Donors
Australia Australian Centre for International Agricultural Research (ACIAR)
Colombia Asocolflores Hacienda San José, Palmira Instituto Colombiano para el Desarrollo de la Ciencia y la Tecnología - Colciencias Levapan Ltda, Tuluá Ministry of Agriculture and Rural Development (MADR) Palmar del Oriente Pronatta Universidad Nacional de Colombia, Sede Palmira (DINAIN, DIPAL) Alcaldia de Armenia Compañía Agrícola Colombiana (COACOL)
Denmark Danish International Development Assistance (Danida)
France Institute of Research for Development (IRD) Ministry of Education Ministry of Foreign Affairs
Germany Federal Ministry for Economic Co-operation and Development (BMZ)
Japan Ministry of Foreign Affairs
New Zealand New Zealand Agency for International Development (NZAID)
Regional Regional Fund for Agricultural Technology (FONTAGRO) Inter American Institute for Cooperation on Agriculture (IICA)
Sweden Swedish International Development Agency (SIDA)/Department for Research Cooperation (SAREC)
United Kingdom Department for International Development (DFID)
United States of America United States Agency for International Development (USAID) United States Department of Agriculture (USDA)
222