DOCSLIB.ORG

Downregulation of Mir-335 Exhibited an Oncogenic Effect Via Promoting KDM3A/YAP1 Networks in Clear Cell Renal Cell Carcinoma

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Downregulation of Mir-335 Exhibited an Oncogenic Effect Via Promoting KDM3A/YAP1 Networks in Clear Cell Renal Cell Carcinoma Cancer Gene Therapy https://doi.org/10.1038/s41417-021-00335-3 ARTICLE Downregulation of miR-335 exhibited an oncogenic effect via promoting KDM3A/YAP1 networks in clear cell renal cell carcinoma 1 1 1 1 1 1 1 Wenqiang Zhang ● Ruiyu Liu ● Lin Zhang ● Chao Wang ● Ziyan Dong ● Jiasheng Feng ● Mayao Luo ● 1 1 1 1 Yifan Zhang ● Zhuofan Xu ● Shidong Lv ● Qiang Wei Received: 23 December 2020 / Revised: 3 March 2021 / Accepted: 26 March 2021 © The Author(s) 2021. This article is published with open access Abstract Clear cell renal cell carcinoma (ccRCC) is the most common type of renal cancer affecting many people worldwide. Although the 5-year survival rate is 65% in localized disease, after metastasis, the survival rate is <10%. Emerging evidence has shown that microRNAs (miRNAs) play a crucial regulatory role in the progression of ccRCC. Here, we show that miR- 335, an anti-onco-miRNA, is downregulation in tumor tissue and inhibited ccRCC cell proliferation, invasion, and migration. Our studies further identify the H3K9me1/2 histone demethylase KDM3A as a new miR-335-regulated gene. We show that KDM3A is overexpressed in ccRCC, and its upregulation contributes to the carcinogenesis and metastasis of fi 1234567890();,: 1234567890();,: ccRCC. Moreover, with the overexpression of KDM3A, YAP1 was increased and identi ed as a direct downstream target of KDM3A. Enrichment of KDM3A demethylase on YAP1 promoter was confirmed by CHIP-qPCR and YAP1 was also found involved in the cell growth and metastasis inhibitory of miR-335. Together, our study establishes a new miR-335/ KDM3A/YAP1 regulation axis, which provided new insight and potential targeting of the metastasized ccRCC. Introduction ccRCC is insensitive to chemotherapy and radiation ther- apy, and surgery remains the primary choice for patients Renal cell cancer (RCC) is one of the most common with ccRCC [4]. Currently, due to the understanding of malignancies worldwide. Based on global cancer mechanisms involved in the development and progression 2018 statistics, more than 400,000 patients were newly of ccRCC, the vascular endothelial growth factor tyrosine diagnosed, while more than 170,000 deaths were due to kinase inhibitor or rapamycin inhibitor was developed and RCC each year [1]. Among all types of RCC, clear cell approved to serve as a first-line treatment for ccRCC [5], renal cell carcinoma (ccRCC, also called KIRC) is the highlighting the need to explore ccRCC therapies at the most common subtype that accounts for 65–70% of all molecular level. renal cancers [1, 2]. The 5-year survival rate of localized MicroRNAs (miRNAs) are epigenetic regulators of gene ccRCC is 65%, however, once the tumor has metastasized, expression that contribute to multiple cellular processes, the 5-year survival rate is <10% [3]. This occurs because including proliferation, cell fate, and differentiation [5]. MiRNAs regulate gene expression in a sequence-specific manner. Following incorporation into the ribonucleoprotein These authors contributed equally: Wenqiang Zhang, Ruiyu Liu (RNP) complex RISC (RNA induced silencing complex), ′ Supplementary information The online version contains miRNAs bind mRNA primarily at their 3 UTRs and impair supplementary material available at https://doi.org/10.1038/s41417- the translation and/or stability of the target mRNA [6, 7]. 021-00335-3. Recently, the functional correlation between miRNAs and cancer has been widely reported. A large number of miR- * Shidong Lv [email protected] NAs are found to act as onco-miRNAs or anti-onco- * Qiang Wei miRNAs in human cancer [6, 7]. In ccRCC, several miR- [email protected] NAs are identified with altered expression. miR-28, miR- 185, miR-27, and let-7f-2 are upregulated in tumor tissue 1 Department of Urology, Nanfang Hospital, Southern Medical from patients with ccRCC [8], while miR-141 and miR- University, Guangzhou, Guangdong, China 200c are downregulated [9]. Altered expressions of W. Zhang et al. miRNAs are related to poor cancer-specific survival after Patient enrollment and tissue collection tumor excision. Thus, miRNAs are a suitable prognostic and predictive marker to determine survival of ccRCC A total of 62 patients (27 men and 35 women) pathologi- patients [10]. More importantly, research has shown that cally diagnosed with ccRCC were selected from Nanfang these miRNAs contribute to the ccRCC phenotype [11]. In Hospital between 2018 and 2020. All patients had under- one report, increased expression of miR-28–5p could pro- gone radical or partial nephrectomy. All tumor tissues were mote chromosome instability by inhibiting mitotic check- stored in liquid nitrogen. Patients were classified according point protein Mad2 in VHL inactivated ccRCC [12]. The to the World Health Organization tumor-lymph node- decreased expression of miR-141 could promote ccRCC metastasis classification system. This study followed The proliferation and metastasis by controlling EphA2 [13]. Helsinki Declaration and was approved by the Ethics These studies emphasize the importance of miRNAs in Committee of Nanfang Hospital (NFEC-201910-K2). All ccRCC carcinogenesis. However, due to the complexity of patients’ clinical information is shown in Table S1. the miRNA regulatory network, pathophysiological func- tions and downstream targets of miRNAs in ccRCC require Cell culture and transfection further investigation. In the present study, we identified that miR-335, a Renal cancer cell lines 786-O, Caki-1, and Caki-2 were miRNA significantly downregulated in ccRCC, inhibits purchased from the American Tissue Culture Collection proliferation, migration, and invasion in a ccRCC cell line. (ATCC). 786-O cells were cultured with RP1640 medium Moreover, we found that the H3K9me1/2 histone deme- (Hyclone, Beijing, China). Caki-1 and Caki-2 were cultured thylase KDM3A is a novel miR-335 downstream target. with McCoy’s 5 A medium (Gibco, Waltham, MA, USA). KDM3A is overexpressed in ccRCC and may promote HK2 cells (kidney proximal tubule epithelial cells) were tumor growth and metastasis by activating yes-associated cultured in DMEM/F-12 medium (Hyclone). 293T cells protein 1 (YAP1) expression through epigenetic mechan- were purchased from the Chinese Academy of Sciences cell isms, thus establishing a miR-335/KDM3A/YAP1 regula- bank and cultured with DMEM medium (Hyclone). All tion axis. Taken together, our study reveals a new miRNA- cells were cultured in a medium supplemented with 10% regulated, epigenetic, tumor-promotional pathway in fetal bovine serum (FBS; Hyclone) and 1% penicillin/ ccRCC, which provides new insight and potential targeting streptomycin (Invitrogen, Waltham, MA, USA) in a 5% of metastasized ccRCC. CO2 incubator at 37 °C. miR-335 mimics (UCAAGAGCAAUAACGAAAAA UGU) and NC-mimics (CUACAAAGCAAUAACGGGGG Materials and methods AUG) were synthesized by RiboBio (Guangzhou, Guang- dong, China). Overexpression pcDNA3.1 (+)vectorwas Bioinformatics analysis purchased from Invitrogen. KDM3A shRNA (shKDM3A-1: GGAGAAGAUUUUAGAGAUA; shKDM3A-2: UGUCAA The GEO database (https://www.ncbi.nlm.nih.gov/geo/) AGGUGUUCGAGAA), YAP1 shRNA (shYAP1: GGUCA was used to search and obtain the human ccRCC miRNA GAGAUACUUCUUAA), and negative control scramble- expression dataset GSE12105, GSE16441, and GSE37989, shRNA (shNC: AUUUCGACCAAGGGCAGUA) were pur- and mRNA expression dataset GSE53757. Differential chased from (Sigma, St. Louis, MO, USA). shRNA, over- expression of miRNA and mRNA between ccRCC samples expression plasmid, and miRNA mimics were all transfected and controls were determined using the “limma” package in using LIPO2000 reagent. R language, with | logFC| > 1 and p < 0.05 as the threshold. A “pheatmap” package in R language was used to construct Antibodies and reagents a differential miRNA and mRNA expression heatmap. Three microarray differential miRNA datasets were ana- KDM3A (ab91252, Abcam, Cambridge, MA, USA), Ki67 lyzed using Venn maps (http://bioinformatics.psb.ugent. (ab16667, Abcam, Cambridge, MA, USA), E-cadherin be/webtools/Venn/). starBase (http://starbase.sysu.edu.cn/ (CST, #3195, Cell Signaling Technology, Danvers, MA, index.php) was used to predict downstream mRNA targets USA), Vimentin (CST, #5741, Cell Signaling Technology, of miR-335. The first 45 mRNAs that were significantly Danvers, MA, USA), Hippo pathway antibody sampler kit upregulated in ccRCC mRNA dataset GSE53757 were (CST 8579, Cell Signaling Technology, Danvers, MA, included in the analysis. Finally, GEPIA (http://gepia.ca USA), including LATS1, MST1, MST2, YAP1, TAZ, and ncer-pku.cn/index.html) database was used to verify target GAPDH (sc-365062, Santa Cruz, CA, USA) were used in mRNA expression in ccRCC samples. this study. H3K9m2 inhibitor Bix01294, UNC0631, Hippo Downregulation of miR-335 exhibited an oncogenic effect via promoting KDM3A/YAP1 networks in clear cell. pathway inhibitor verteporfin were purchased from Selleck transfection for a total of 48 h, the medium was discarded. (Houston, TX, USA). Cells were washed with 100 μl PBS. The remaining PBS was blotted when the 96-well plate was tilted. Diluted 1× protein mRNA expression determined using qRT-PCR lysis buffer (50 μl) was added to each well and shaken for 15 min at room temperature. The lysed mixture (10 μl) was Cells or tissues were lysed using a Trizol kit (Invitrogen). added to each well in a white opaque 96-well microtiter plate. Total RNA was extracted using the RNeasy Mini Kit (Qia- Premixed LARII (100 μl) was added. Luciferase intensity gen, Valencia, CA, USA). cDNA was synthesized using the was measured after
Load more

Recommended publications
  • Systematic Knockdown of Epigenetic Enzymes Identifies a Novel Histone Demethylase PHF8 Overexpressed in Prostate Cancer with An
    Oncogene (2012) 31, 3444–3456 & 2012 Macmillan Publishers Limited All rights reserved 0950-9232/12 www.nature.com/onc ORIGINAL ARTICLE Systematic knockdown of epigenetic enzymes identifies a novel histone demethylase PHF8 overexpressed in prostate cancer with an impact on cell proliferation, migration and invasion M Bjo¨rkman1,PO¨stling1,2,VHa¨rma¨1, J Virtanen1, J-P Mpindi1,2, J Rantala1,4, T Mirtti2, T Vesterinen2, M Lundin2, A Sankila2, A Rannikko3, E Kaivanto1, P Kohonen1, O Kallioniemi1,2,5 and M Nees1,5 1Medical Biotechnology, VTT Technical Research Centre of Finland, and Center for Biotechnology, University of Turku and A˚bo Akademi University, Turku, Finland; 2Institute for Molecular Medicine Finland (FIMM), University of Helsinki, Helsinki, Finland and 3HUSLAB, Department of Urology, University of Helsinki, Helsinki, Finland Our understanding of key epigenetic regulators involved in finger proteins like PHF8, are activated in subsets of specific biological processes and cancers is still incom- PrCa’s and promote cancer relevant phenotypes. plete, despite great progress in genome-wide studies of the Oncogene (2012) 31, 3444–3456; doi:10.1038/onc.2011.512; epigenome. Here, we carried out a systematic, genome- published online 28 November 2011 wide analysis of the functional significance of 615 epigenetic proteins in prostate cancer (PrCa) cells. We Keywords: prostate cancer; epigenetics; histone used the high-content cell-spot microarray technology and demethylase; migration; invasion; PHF8 siRNA silencing of PrCa cell lines for functional screening of cell proliferation, survival, androgen receptor (AR) expression, histone methylation and acetylation. Our study highlights subsets of epigenetic enzymes influencing different cancer cell phenotypes.
    [Show full text]
  • Identification of Multiple Risk Loci and Regulatory Mechanisms Influencing Susceptibility to Multiple Myeloma
    Corrected: Author correction ARTICLE DOI: 10.1038/s41467-018-04989-w OPEN Identification of multiple risk loci and regulatory mechanisms influencing susceptibility to multiple myeloma Molly Went1, Amit Sud 1, Asta Försti2,3, Britt-Marie Halvarsson4, Niels Weinhold et al.# Genome-wide association studies (GWAS) have transformed our understanding of susceptibility to multiple myeloma (MM), but much of the heritability remains unexplained. 1234567890():,; We report a new GWAS, a meta-analysis with previous GWAS and a replication series, totalling 9974 MM cases and 247,556 controls of European ancestry. Collectively, these data provide evidence for six new MM risk loci, bringing the total number to 23. Integration of information from gene expression, epigenetic profiling and in situ Hi-C data for the 23 risk loci implicate disruption of developmental transcriptional regulators as a basis of MM susceptibility, compatible with altered B-cell differentiation as a key mechanism. Dysregu- lation of autophagy/apoptosis and cell cycle signalling feature as recurrently perturbed pathways. Our findings provide further insight into the biological basis of MM. Correspondence and requests for materials should be addressed to K.H. (email: [email protected]) or to B.N. (email: [email protected]) or to R.S.H. (email: [email protected]). #A full list of authors and their affliations appears at the end of the paper. NATURE COMMUNICATIONS | (2018) 9:3707 | DOI: 10.1038/s41467-018-04989-w | www.nature.com/naturecommunications 1 ARTICLE NATURE COMMUNICATIONS | DOI: 10.1038/s41467-018-04989-w ultiple myeloma (MM) is a malignancy of plasma cells consistent OR across all GWAS data sets, by genotyping an Mprimarily located within the bone marrow.
    [Show full text]
  • A Silent Exonic SNP in Kdm3a Affects Nucleic Acids Structure but Does Not Regulate Experimental Autoimmune Encephalomyelitis
    A Silent Exonic SNP in Kdm3a Affects Nucleic Acids Structure but Does Not Regulate Experimental Autoimmune Encephalomyelitis Alan Gillett1, Petra Bergman1, Roham Parsa1, Andreas Bremges2, Robert Giegerich2, Maja Jagodic1* 1 Department of Clinical Neuroscience, Centre for Molecular Medicine, Karolinska Institutet, Stockholm, Sweden, 2 Center for Biotechnology and Faculty of Technology, Bielefeld University, Bielefeld, Germany Abstract Defining genetic variants that predispose for diseases is an important initiative that can improve biological understanding and focus therapeutic development. Genetic mapping in humans and animal models has defined genomic regions controlling a variety of phenotypes known as quantitative trait loci (QTL). Causative disease determinants, including single nucleotide polymorphisms (SNPs), lie within these regions and can often be identified through effects on gene expression. We previously identified a QTL on rat chromosome 4 regulating macrophage phenotypes and immune-mediated diseases including experimental autoimmune encephalomyelitis (EAE). Gene analysis and a literature search identified lysine-specific demethylase 3A (Kdm3a) as a potential regulator of these phenotypes. Genomic sequencing determined only two synonymous SNPs in Kdm3a. The silent synonymous SNP in exon 15 of Kdm3a caused problems with quantitative PCR detection in the susceptible strain through reduced amplification efficiency due to altered secondary cDNA structure. Shape Probability Shift analysis predicted that the SNP often affects RNA folding; thus, it may impact protein translation. Despite these differences in rats, genetic knockout of Kdm3a in mice resulted in no dramatic effect on immune system development and activation or EAE susceptibility and severity. These results provide support for tools that analyze causative SNPs that impact nucleic acid structures. Citation: Gillett A, Bergman P, Parsa R, Bremges A, Giegerich R, et al.
    [Show full text]
  • Histone Methylation Regulation in Neurodegenerative Disorders
    International Journal of Molecular Sciences Review Histone Methylation Regulation in Neurodegenerative Disorders Balapal S. Basavarajappa 1,2,3,4,* and Shivakumar Subbanna 1 1 Division of Analytical Psychopharmacology, Nathan Kline Institute for Psychiatric Research, Orangeburg, NY 10962, USA; [email protected] 2 New York State Psychiatric Institute, New York, NY 10032, USA 3 Department of Psychiatry, College of Physicians & Surgeons, Columbia University, New York, NY 10032, USA 4 New York University Langone Medical Center, Department of Psychiatry, New York, NY 10016, USA * Correspondence: [email protected]; Tel.: +1-845-398-3234; Fax: +1-845-398-5451 Abstract: Advances achieved with molecular biology and genomics technologies have permitted investigators to discover epigenetic mechanisms, such as DNA methylation and histone posttransla- tional modifications, which are critical for gene expression in almost all tissues and in brain health and disease. These advances have influenced much interest in understanding the dysregulation of epigenetic mechanisms in neurodegenerative disorders. Although these disorders diverge in their fundamental causes and pathophysiology, several involve the dysregulation of histone methylation- mediated gene expression. Interestingly, epigenetic remodeling via histone methylation in specific brain regions has been suggested to play a critical function in the neurobiology of psychiatric disor- ders, including that related to neurodegenerative diseases. Prominently, epigenetic dysregulation currently brings considerable interest as an essential player in neurodegenerative disorders, such as Alzheimer’s disease (AD), Parkinson’s disease (PD), Huntington’s disease (HD), Amyotrophic lateral sclerosis (ALS) and drugs of abuse, including alcohol abuse disorder, where it may facilitate connections between genetic and environmental risk factors or directly influence disease-specific Citation: Basavarajappa, B.S.; Subbanna, S.
    [Show full text]
  • The Emerging Role of Histone Lysine Demethylases in Prostate Cancer
    Crea et al. Molecular Cancer 2012, 11:52 http://www.molecular-cancer.com/content/11/1/52 REVIEW Open Access The emerging role of histone lysine demethylases in prostate cancer Francesco Crea1*, Lei Sun3, Antonello Mai4, Yan Ting Chiang1, William L Farrar3, Romano Danesi2 and Cheryl D Helgason1,5* Abstract Early prostate cancer (PCa) is generally treatable and associated with good prognosis. After a variable time, PCa evolves into a highly metastatic and treatment-refractory disease: castration-resistant PCa (CRPC). Currently, few prognostic factors are available to predict the emergence of CRPC, and no curative option is available. Epigenetic gene regulation has been shown to trigger PCa metastasis and androgen-independence. Most epigenetic studies have focused on DNA and histone methyltransferases. While DNA methylation leads to gene silencing, histone methylation can trigger gene activation or inactivation, depending on the target amino acid residues and the extent of methylation (me1, me2, or me3). Interestingly, some histone modifiers are essential for PCa tumor- initiating cell (TIC) self-renewal. TICs are considered the seeds responsible for metastatic spreading and androgen- independence. Histone Lysine Demethylases (KDMs) are a novel class of epigenetic enzymes which can remove both repressive and activating histone marks. KDMs are currently grouped into 7 major classes, each one targeting a specific methylation site. Since their discovery, KDM expression has been found to be deregulated in several neoplasms. In PCa, KDMs may act as either tumor suppressors or oncogenes, depending on their gene regulatory function. For example, KDM1A and KDM4C are essential for PCa androgen-dependent proliferation, while PHF8 is involved in PCa migration and invasion.
    [Show full text]
  • Content Based Search in Gene Expression Databases and a Meta-Analysis of Host Responses to Infection
    Content Based Search in Gene Expression Databases and a Meta-analysis of Host Responses to Infection A Thesis Submitted to the Faculty of Drexel University by Francis X. Bell in partial fulfillment of the requirements for the degree of Doctor of Philosophy November 2015 c Copyright 2015 Francis X. Bell. All Rights Reserved. ii Acknowledgments I would like to acknowledge and thank my advisor, Dr. Ahmet Sacan. Without his advice, support, and patience I would not have been able to accomplish all that I have. I would also like to thank my committee members and the Biomed Faculty that have guided me. I would like to give a special thanks for the members of the bioinformatics lab, in particular the members of the Sacan lab: Rehman Qureshi, Daisy Heng Yang, April Chunyu Zhao, and Yiqian Zhou. Thank you for creating a pleasant and friendly environment in the lab. I give the members of my family my sincerest gratitude for all that they have done for me. I cannot begin to repay my parents for their sacrifices. I am eternally grateful for everything they have done. The support of my sisters and their encouragement gave me the strength to persevere to the end. iii Table of Contents LIST OF TABLES.......................................................................... vii LIST OF FIGURES ........................................................................ xiv ABSTRACT ................................................................................ xvii 1. A BRIEF INTRODUCTION TO GENE EXPRESSION............................. 1 1.1 Central Dogma of Molecular Biology........................................... 1 1.1.1 Basic Transfers .......................................................... 1 1.1.2 Uncommon Transfers ................................................... 3 1.2 Gene Expression ................................................................. 4 1.2.1 Estimating Gene Expression ............................................ 4 1.2.2 DNA Microarrays ......................................................
    [Show full text]
  • A Network Inference Approach to Understanding Musculoskeletal
    A NETWORK INFERENCE APPROACH TO UNDERSTANDING MUSCULOSKELETAL DISORDERS by NIL TURAN A thesis submitted to The University of Birmingham for the degree of Doctor of Philosophy College of Life and Environmental Sciences School of Biosciences The University of Birmingham June 2013 University of Birmingham Research Archive e-theses repository This unpublished thesis/dissertation is copyright of the author and/or third parties. The intellectual property rights of the author or third parties in respect of this work are as defined by The Copyright Designs and Patents Act 1988 or as modified by any successor legislation. Any use made of information contained in this thesis/dissertation must be in accordance with that legislation and must be properly acknowledged. Further distribution or reproduction in any format is prohibited without the permission of the copyright holder. ABSTRACT Musculoskeletal disorders are among the most important health problem affecting the quality of life and contributing to a high burden on healthcare systems worldwide. Understanding the molecular mechanisms underlying these disorders is crucial for the development of efficient treatments. In this thesis, musculoskeletal disorders including muscle wasting, bone loss and cartilage deformation have been studied using systems biology approaches. Muscle wasting occurring as a systemic effect in COPD patients has been investigated with an integrative network inference approach. This work has lead to a model describing the relationship between muscle molecular and physiological response to training and systemic inflammatory mediators. This model has shown for the first time that oxygen dependent changes in the expression of epigenetic modifiers and not chronic inflammation may be causally linked to muscle dysfunction.
    [Show full text]
  • The Histone Demethylase KDM3A Regulates the Transcriptional Program of the Androgen Receptor in Prostate Cancer Cells
    www.impactjournals.com/oncotarget/ Oncotarget, 2017, Vol. 8, (No. 18), pp: 30328-30343 Research Paper The histone demethylase KDM3A regulates the transcriptional program of the androgen receptor in prostate cancer cells Stephen Wilson1, Lingling Fan2, Natasha Sahgal3, Jianfei Qi2, Fabian V. Filipp1 1Systems Biology and Cancer Metabolism, Program for Quantitative Systems Biology, University of California Merced, Merced, CA, USA 2Department of Biochemistry and Molecular Biology, Marlene and Stewart Greenebaum Comprehensive Cancer Center, University of Maryland School of Medicine, Baltimore, MD, USA 3Centre for Molecular Oncology, Barts Cancer Institute, Queen Mary University of London, London, United Kingdom Correspondence to: Fabian V. Filipp, email: [email protected] Keywords: cancer systems biology, epigenomics, ChIP-Seq, oncogene, prostate cancer Received: July 18, 2016 Accepted: September 09, 2016 Published: March 03, 2017 Copyright: Wilson et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC-BY), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. ABSTRACT The lysine demethylase 3A (KDM3A, JMJD1A or JHDM2A) controls transcriptional networks in a variety of biological processes such as spermatogenesis, metabolism, stem cell activity, and tumor progression. We matched transcriptomic and ChIP- Seq profiles to decipher a genome-wide regulatory network of epigenetic control by KDM3A in prostate cancer cells. ChIP-Seq experiments monitoring histone 3 lysine 9 (H3K9) methylation marks show global histone demethylation effects of KDM3A. Combined assessment of histone demethylation events and gene expression changes presented major transcriptional activation suggesting that distinct oncogenic regulators may synergize with the epigenetic patterns by KDM3A.
    [Show full text]
  • The Histone H3K9 Demethylase KDM3A Promotes Anoikis by Transcriptionally Activating Pro-Apoptotic Genes BNIP3 and BNIP3L
    University of Massachusetts Medical School eScholarship@UMMS Open Access Articles Open Access Publications by UMMS Authors 2016-07-29 The histone H3K9 demethylase KDM3A promotes anoikis by transcriptionally activating pro-apoptotic genes BNIP3 and BNIP3L Victoria E. Pedanou University of Massachusetts Medical School Et al. Let us know how access to this document benefits ou.y Follow this and additional works at: https://escholarship.umassmed.edu/oapubs Part of the Bioinformatics Commons, Cancer Biology Commons, and the Cell Biology Commons Repository Citation Pedanou VE, Gobeil S, Tabaries S, Simone TM, Zhu LJ, Siegel PM, Green MR. (2016). The histone H3K9 demethylase KDM3A promotes anoikis by transcriptionally activating pro-apoptotic genes BNIP3 and BNIP3L. Open Access Articles. https://doi.org/10.7554/eLife.16844. Retrieved from https://escholarship.umassmed.edu/oapubs/2779 Creative Commons License This work is licensed under a Creative Commons Attribution 4.0 License. This material is brought to you by eScholarship@UMMS. It has been accepted for inclusion in Open Access Articles by an authorized administrator of eScholarship@UMMS. For more information, please contact [email protected]. 1 2 The histone H3K9 demethylase KDM3A promotes anoikis by transcriptionally activating 3 pro-apoptotic genes BNIP3 and BNIP3L 4 5 6 Victoria E. Pedanou1,2, Stéphane Gobeil3, Sébastien Tabariès4, Tessa M. Simone1,2, Lihua Julie 7 Zhu1,5, Peter M. Siegel4 and Michael R. Green1,2* 8 9 1Department of Molecular, Cell and Cancer Biology, University of Massachusetts Medical 10 School, Worcester, United States; 2Howard Hughes Medical Institute, Chevy Chase, United 11 States; 3Department of Molecular Medicine, Université Laval, Quebec City, Canada and Centre 12 de recherche du CHU de Québec, CHUL, Québec PQ, Canada; 4Department of Medicine, 13 Goodman Cancer Research Centre, McGill University, Montreal, Canada; 5Programs in 14 Molecular Medicine and Bioinformatics and Integrative Biology, University of Massachusetts 15 Medical School, Worcester, United States.
    [Show full text]
  • Genetic Investigation in Non-Obstructive Azoospermia: from the X Chromosome to The
    DOTTORATO DI RICERCA IN SCIENZE BIOMEDICHE CICLO XXIX COORDINATORE Prof. Persio dello Sbarba Genetic investigation in non-obstructive azoospermia: from the X chromosome to the whole exome Settore Scientifico Disciplinare MED/13 Dottorando Tutore Dott. Antoni Riera-Escamilla Prof. Csilla Gabriella Krausz _______________________________ _____________________________ (firma) (firma) Coordinatore Prof. Carlo Maria Rotella _______________________________ (firma) Anni 2014/2016 A la meva família Agraïments El resultat d’aquesta tesis és fruit d’un esforç i treball continu però no hauria estat el mateix sense la col·laboració i l’ajuda de molta gent. Segurament em deixaré molta gent a qui donar les gràcies però aquest són els que em venen a la ment ara mateix. En primer lloc voldria agrair a la Dra. Csilla Krausz por haberme acogido con los brazos abiertos desde el primer día que llegué a Florencia, por enseñarme, por su incansable ayuda y por contagiarme de esta pasión por la investigación que nunca se le apaga. Voldria agrair també al Dr. Rafael Oliva per haver fet possible el REPROTRAIN, per haver-me ensenyat moltíssim durant l’època del màster i per acceptar revisar aquesta tesis. Alhora voldria agrair a la Dra. Willy Baarends, thank you for your priceless help and for reviewing this thesis. També voldria donar les gràcies a la Dra. Elisabet Ars per acollir-me al seu laboratori a Barcelona, per ajudar-me sempre que en tot el què li he demanat i fer-me tocar de peus a terra. Ringrazio a tutto il gruppo di Firenze, che dal primo giorno mi sono trovato come a casa.
    [Show full text]
  • Rare Genetic Variants in the Gene Encoding Histone Lysine
    Kato et al. Translational Psychiatry (2020) 10:421 https://doi.org/10.1038/s41398-020-01107-7 Translational Psychiatry ARTICLE Open Access Rare genetic variants in the gene encoding histone lysine demethylase 4C (KDM4C)andtheir contributions to susceptibility to schizophrenia and autism spectrum disorder Hidekazu Kato 1,ItaruKushima 1,2,DaisukeMori 1,3,AkiraYoshimi4, Branko Aleksic 1, Yoshihiro Nawa 1, Miho Toyama1, Sho Furuta1, Yanjie Yu1, Kanako Ishizuka 1, Hiroki Kimura1,YukoArioka 1,5, Keita Tsujimura 1,6, Mako Morikawa1, Takashi Okada1,ToshiyaInada1, Masahiro Nakatochi 7, Keiko Shinjo8, Yutaka Kondo 8, Kozo Kaibuchi9, Yasuko Funabiki10,RyoKimura11,ToshimitsuSuzuki 12,13, Kazuhiro Yamakawa12,13, Masashi Ikeda 14, Nakao Iwata 14, Tsutomu Takahashi15,16,MichioSuzuki15,16,YukoOkahisa17, Manabu Takaki 17,JunEgawa18, Toshiyuki Someya18 and Norio Ozaki 1 Abstract Dysregulation of epigenetic processes involving histone methylation induces neurodevelopmental impairments and has been implicated in schizophrenia (SCZ) and autism spectrum disorder (ASD). Variants in the gene encoding lysine demethylase 4C (KDM4C) have been suggested to confer a risk for such disorders. However, rare genetic variants in KDM4C have not been fully evaluated, and the functional impact of the variants has not been studied using patient- derived cells. In this study, we conducted copy number variant (CNV) analysis in a Japanese sample set (2605 SCZ and 1234567890():,; 1234567890():,; 1234567890():,; 1234567890():,; 1141 ASD cases, and 2310 controls). We found evidence for significant associations between CNVs in KDM4C and SCZ (p = 0.003) and ASD (p = 0.04). We also observed a significant association between deletions in KDM4C and SCZ (corrected p = 0.04). Next, to explore the contribution of single nucleotide variants in KDM4C, we sequenced the coding exons in a second sample set (370 SCZ and 192 ASD cases) and detected 18 rare missense variants, including p.D160N within the JmjC domain of KDM4C.
    [Show full text]
  • Asparaginase Treatment Side-Effects May Be Due to Genes with Homopolymeric Asn Codons (Review-Hypothesis)
    INTERNATIONAL JOURNAL OF MOLECULAR MEDICINE 36: 607-626, 2015 Asparaginase treatment side-effects may be due to genes with homopolymeric Asn codons (Review-Hypothesis) JULIAN BANERJI Center for Computational and Integrative Biology, MGH, Simches Research Center, Boston, MA 02114, USA Received April 15, 2015; Accepted July 15, 2015 DOI: 10.3892/ijmm.2015.2285 Abstract. The present treatment of childhood T-cell 1. Foundation of the hypothesis leukemias involves the systemic administration of prokary- otic L-asparaginase (ASNase), which depletes plasma Core hypothesis: translocation rates, poly Asparagine (Asn); Asparagine (Asn) and inhibits protein synthesis. The mecha- insulin-receptor-substrate 2 (IRS2) and diabetes; hypothesis nism of therapeutic action of ASNase is poorly understood, tests, poly glutamine (Gln) HTT and ataxias. Despite similar as are the etiologies of the side-effects incurred by treatment. Asn codon usage, ~4%/gene, from plants to humans (1), Protein expression from genes bearing Asn homopolymeric mammals are distinguished by a paucity of genes with a long coding regions (N-hCR) may be particularly susceptible to Asn homopolymeric coding region (N-hCR) (2). The 17 human Asn level fluctuation. In mammals, N-hCR are rare, short and genes with the longest N-hCR (ranging from five to eight conserved. In humans, misfunctions of genes encoding N-hCR consecutive Asn codons) are listed in Fig. 1; Table I lists genes are associated with a cluster of disorders that mimic ASNase with N-hCR greater than three. IRS2, encoding an insulin therapy side-effects which include impaired glycemic control, signal transducer, is the gene at the top of the list in Fig.
    [Show full text]