Functional Roles of 3 0-Terminal Structures of Template RNA During

Nucleic Acids Research, 2005, Vol. 33, No. 6 1993–2002 doi:10.1093/nar/gki347 Functional roles of 30-terminal structures of template RNA during in vivo retrotransposition of non-LTR retrotransposon, R1Bm Tomohiro Anzai, Mizuko Osanai, Mitsuhiro Hamada and Haruhiko Fujiwara* Department of Integrated Biosciences, Graduate School of Frontier Sciences, University of Tokyo, Bioscience Building 501, Kashiwa, 277-8562, Japan Received as resubmission March 3, 2005; Revised March 9, 2005; Accepted March 21, 2005 ABSTRACT elements. LINEs have been identified in all major groups of eukaryotes, with the exception of the bdelloid rotifers (1). In R1Bm is a non-LTR retrotransposon found specific- humans, up to 21% of the genome is comprised of LINEs (2), ally within 28S rRNA genes of the silkworm. Different and the involvement of LINEs in the gene evolution and gen- from other non-LTR retrotransposons encoding ome reconstruction had been proposed (3–5). two open reading frames (ORFs), R1Bm structurally LINEs can be classified into two subtypes based on their lacks a poly (A) tract at its 30 end. To study how R1Bm structures and modes of retrotransposition (6). The early- initiates reverse transcription from the poly (A)-less branched subtype, such as R2 element specifically integrated template RNA, we established an in vivo retrotrans- in 28S rDNA of arthropods, comprises a single open reading position system using recombinant baculovirus, and frame (ORF) that encodes reverse transcriptase (RT) in the characterized retrotransposition activities of R1Bm. middle and a restriction enzyme-like endonuclease (EN) near Target-primed reverse transcription (TPRT) of R1Bm its C-terminal end (7,8). Biochemical analyses of R2Bm of the silkworm led to the current model for LINE retrotransposition. occurred from the cleavage site generated by endo- 0 0 R2Bm protein first recognizes the 3 UTR sequence of R2 nuclease (EN). The 147 bp of 3 -untranslated region RNA, and makes a specific nick on the target DNA by its 0 (3 UTR) was essential for efficient retrotransposition endonuclease (9,10). Then, the exposed 30 hydroxyl is utilized of R1Bm. Even using the complete R1Bm element, to initiate reverse transcription of the RNA template (11). however, reverse transcription started from various Thus, the processes of nicking, reverse transcription and integ- sites of the template RNA mostly with 50-UG-30 or ration are basically coupled, which are termed target-primed 50-UGU-30 at their 30 ends, which are presumably reverse transcription (TPRT). It is suggested that the rare base-paired with 30 end of the EN-digested 28S rDNA transcript of R2 element is provided by co-transcription target sequence, 50-AGTAGATAGGGACA-30. When with the 28S rDNA target (12,13), and an additional 28S the downstream sequence of 28S rDNA target was rRNA sequence downstream of the R2 sequence reduced added to the 30 end of R1 unit, reverse transcription the efficiency of the reaction, but increased the rate of accurate junctions seen in vivo (14). started exactly from the 30 end of 30UTR and retro- The recently-branched subtype of LINEs has two ORFs: transposition efficiency increased. These results ORF1 and ORF2. The ORF2 encodes catalytic domains 0 indicate that 3 -terminal structure of template RNA responsible for LINE retrotransposition; apurinic/apyrimidinic including read-through region interacts with its tar- endonucleases (APE)-like endonuclease at the N-terminus (15) get rDNA sequences of R1Bm, which plays important and reverse transcriptase at the central region. Retrotransposi- roles in initial process of TPRT in vivo. tion of this class is mainly studied for human L1 element using an assay to monitor retrotransposition in cultured human HeLa cells (16) and SART1 of the silkworm using the Autographa californica nuclear polyhedrosis virus (AcNPV) expression INTRODUCTION system (17). Although L1 and SART1 both have 30UTR and Non-long terminal repeat (non-LTR) retrotransposons, also poly (A) tail at their 30 end, they show different requirement called long interspersed nuclear elements (LINEs) or poly for the RNA sequence to initiate the reverse transcription. The (A) elements, are the most abundant family among mobile presence of 30 UTR is dispensable for L1 retrotransposition, *To whom correspondence should be addressed. Tel: +81 4 7136 3659; Fax: +81 4 7136 3660; Email: [email protected] ª The Author 2005. Published by Oxford University Press. All rights reserved. The online version of this article has been published under an open access model. Users are entitled to use, reproduce, disseminate, or display the open access version of this article for non-commercial purposes provided that: the original authorship is properly and fully attributed; the Journal and Oxford University Press are attributed as the original place of publication with the correct citation details given; if an article is subsequently reproduced or disseminated not in its entirety but only in part or as a derivative work this must be clearly indicated. For commercial re-use, please contact [email protected] 1994 Nucleic Acids Research, 2005, Vol. 33, No. 6 Figure 1. Identification of a new subtype of the R1 element from the silkworm, Bombyx mori.(A) Schematic representation of 28S gene-specific LINEs. Shown in the middle is a diagram of the rDNA unit of Bombyx mori. The newly identified R1 clone (named R1Bmks) is integrated into the sequence 74 bp downstream of the R2 insertion site. Open reading frames (ORFs) are depicted by open boxes. The positions of non-synonymous mutations in the ORF1 and nucleotide insertions in the ORF2 (see B and C) are shown by white and black arrowheads, respectively. (B and C) Altered amino acid sequence of R1Bmks in the ORF2. Insertion of 3 nt within the RT domain results in alteration of 10 amino acids (indicated by bold line), compared with R1Bm (B). Addition of a single nucleotide in R1Bmks alters the amino acid sequences and made the length of ORF2 shorter by 12 amino acids, compared with R1Bm (C). The amino acids conserved between more than two elements are indicated by bold letters. Putative translational stop was indicated by asterisks. R1Bm clones are aligned with R1Dm (X51968; accession number) from D.melanogaster; R1Sc (L00945) from Sciara coprophila. but poly (A) tract seems essential (16). In addition, active L1 DNA extracted from Bombyx mori strain, Kinshu · Showa. elements possess the ability to transduce non-L1 DNA flank- The reaction mixture was denatured at 94C for 1 min, fol- ing their 30 ends to new genomic locations (3,18,19). In con- lowed by 30 cycles of 98C for 30 s, 60C for 30 s, and 72C trast, the recognition of 30UTR by SART1 proteins is crucial for 12 min. The PCR products were loaded on 0.6% agarose for the SART1 retrotransposition (17), and the loss of poly (A) gel, and electrophoresed. The DNA band in the calculated size tract resulted in a severe loss of the efficiency for the initiation was excised from the gel and purified by the QIAquick Gel of reverse transcription (20). Extraction Kit (Qiagen). The recovered product was digested R1Bm is a member of recently-branched subtype, and inser- with EcoRI and PstI, subcloned between the EcoRI and PstI ted specifically into the 28S rDNA of the silkworm (9,21). The sites of the pAcGHLTB plasmid (PharMingen). The resulting R1 insertion site is located 74 bp downstream of the R2 site plasmid, named R1WT-pAcGHLTB, contained the 64 bp 0 (Figure 1A) (22). R1Bm is flanked by specific 14 bp target site polyhedrin 5 UTR and the GST-X5-(His)6-X29 coding gene duplication (TSD), and lacks the poly (A) tract at its 30 end. fused in-frame with MSEEERE of the R1 ORF1, followed To understand the basal mechanisms of TPRT, it is of great by R1 ORF2/30UTR and the polyhedrin 30UTR. Point muta- interest to know how this poly (A)-less R1 initiates its reverse tions were introduced into R1WT-pAcGHLTB with primer transcription. In this study, we have newly cloned the R1 sets listed in Table 1 using QuickChangeTM Mutagenesis element from the silkworm genome, and firstly succeeded Kit (Stratagene). The mutation of each plasmid was confirmed in retrotransposing the R1 sequence into the 28S rDNA target by DNA sequencing. The D30UTR mutant was constructed by of the host cells with recombinant baculovirus, AcNPV. Using self-ligation of the DNA fragment amplified from R1WT- the in vivo retrotransposition system of R1, we studied the pAcGHLTB with the inverse PCR using 50-phosphorylated functional roles of 30UTR of R1 RNA and co-expressed 28S primers, R1 A4992 and pAcGHLTB-S3304. R1WT- rRNA downstream of R1 sequence. pAcGHLTB plasmids with various 30 tails were constructed as follows. First, 333 bp fragment of 30 junction between R1 and 28S rDNA was amplified by PCR with a primer set, R1 MATERIALS AND METHODS S4861 and 28S rDNA(+57) using the silkworm genomic DNA as a template and was directly cloned into pGEM-T vector Plasmid construction (Promega). Second, PCR reaction was conducted between R1 The R1 ORF1/ORF2/30UTR portion was directly amplified by S4861 and the various primers with PstI sites (Table 1), and the PCR with Pfu Turbo DNA polymerase (Stratagene) using resulting fragments were cloned into the NcoI and PstI sites of primers R1 S519, R1 A5136 (Table 1) and 5 ng of the genomic R1WT-pAcGHLTB. Nucleic Acids Research, 2005, Vol. 33, No. 6 1995 Table 1. List of primers Name Sequence (50!30) R1 S519 AAAAAGAATTCAGATGTCGGAGGAGGAGAGGGAGCTATTTTCCCCT R1 S4861 GTTTACCACGCGGACCTGGT R1 A4992 TCACCCACATTCTTCGTCGCCAGGCAGTCC

Load more