DOCSLIB.ORG

Downregulation of the Canonical WNT Signaling Pathway by TGF1 Inhibits Photoreceptor Differentiation of Adult Human Müller Glia with Stem Cell Characteristics

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Downregulation of the Canonical WNT Signaling Pathway by TGF1 Inhibits Photoreceptor Differentiation of Adult Human Müller Glia with Stem Cell Characteristics King’s Research Portal DOI: 10.1089/scd.2015.0262 Document Version Publisher's PDF, also known as Version of record Link to publication record in King's Research Portal Citation for published version (APA): Angbohang, A., Wu, N., Charalambous, T., Eastlake, K., Lei, Y., Kim, Y. S., Sun, X. H., & Limb, G. A. (2015). Downregulation of the Canonical WNT Signaling Pathway by TGF1 Inhibits Photoreceptor Differentiation of Adult Human Müller Glia with Stem Cell Characteristics. STEM CELLS AND DEVELOPMENT, 25(1), 1-12. https://doi.org/10.1089/scd.2015.0262 Citing this paper Please note that where the full-text provided on King's Research Portal is the Author Accepted Manuscript or Post-Print version this may differ from the final Published version. If citing, it is advised that you check and use the publisher's definitive version for pagination, volume/issue, and date of publication details. And where the final published version is provided on the Research Portal, if citing you are again advised to check the publisher's website for any subsequent corrections. General rights Copyright and moral rights for the publications made accessible in the Research Portal are retained by the authors and/or other copyright owners and it is a condition of accessing publications that users recognize and abide by the legal requirements associated with these rights. •Users may download and print one copy of any publication from the Research Portal for the purpose of private study or research. •You may not further distribute the material or use it for any profit-making activity or commercial gain •You may freely distribute the URL identifying the publication in the Research Portal Take down policy If you believe that this document breaches copyright please contact [email protected] providing details, and we will remove access to the work immediately and investigate your claim. Download date: 23. Sep. 2021 STEM CELLS AND DEVELOPMENT ORIGINAL RESEARCH REPORTS Volume 25, Number 1, 2016 Mary Ann Liebert, Inc. DOI: 10.1089/scd.2015.0262 Downregulation of the Canonical WNT Signaling Pathway by TGFb1 Inhibits Photoreceptor Differentiation of Adult Human Mu¨ller Glia with Stem Cell Characteristics Angshumonik Angbohang,1,* Na Wu,1,2,* Thalis Charalambous,1 Karen Eastlake,1 Yuan Lei,2 Yung Su Kim,1 Xinghuai H. Sun,2 and G. Astrid Limb3 Mu¨ller glia are responsible for the retina regeneration observed in zebrafish. Although the human retina harbors Mu¨ller glia with stem cell characteristics, there is no evidence that they regenerate the retina after disease or injury. Transforming growth factor-b (TGFb) and Wnt signaling regulate retinal neurogenesis and inflammation, but their roles in the neural differentiation of human Mu¨ller stem cells (hMSC) are not known. We examined hMSC lines in vitro for the expression of various Wnt signaling components and for their modulation by TGFb1, as well as the effect of this cytokine on the photoreceptor differentiation of these cells. Culture of hMSC with a combination of factors that induce photoreceptor differentiation of hMSC (FGF2, taurine, retinoic acid, and insulin-like growth factor type1; FTRI), markedly upregulated the expression of components of the canonical Wnt signaling pathway, including WNT2B, DKK1, and active b-CATENIN. Although FTRI did not modify mRNA expression of WNT5B, a component of the noncanonical/planar cell polarity Wnt pathway, it upregulated its secretion. Furthermore, TGFb1 not only decreased WNT2B expression, but also inhibited FTRI-induced photoreceptor differentiation of hMSC, as determined by expression of the photoreceptor markers NR2E3, RHODOPSIN, and RECOVERIN. Inhibition of TGFb1 signaling by an ALK5 inhibitor prevented TGFb1-induced changes in the expression of the two Wnt ligands examined. More importantly, inhibition of the canonical WNT signaling by XAV-939 prevented FTRI-induced photoreceptor dif- ferentiation. These observations suggest that TGFb may play a key role in preventing neural differentiation of hMSC and may constitute a potential target for induction of endogenous regeneration of the human retina. Introduction lead to blindness, including inflammatory, proangiogenic, and dystrophic retinal diseases, have been associated with he spontaneous retinal regeneration observed in abnormal proliferation of Mu¨ller glia that does not lead to Tzebrafish has been ascribed to the ability of a population repair, but to the formation of glial scarring [6]. Many of of Mu¨ller glia to dedifferentiate and become progenitors that these conditions are also accompanied by local increased give rise to retinal neurons [1]. Although Mu¨ller glia dedif- production of proinflammatory cytokines, such as trans- ferentiation into retinal progenitors has not been demon- forming growth factor-b (TGFb) [7–9], which may poten- strated in vivo in the human eye, a population of Mu¨ller glia tially modify the neural progenicity of hMSC. able to proliferate indefinitely in vitro has been identified [2]. TGFb signaling mediated through Smad 2/3, which is Unlike their inability to regenerate the human retina, when controlled by transcriptional corepressors such as Tgif1 and cultured with selective growth and differentiation factors Six3b, has been demonstrated to regulate Mu¨ller glia-derived these cells can be induced to acquire characteristics of retinal photoreceptor regeneration in the adult zebrafish [10]. In neurons, for which they have been termed human Mu¨ller addition, signaling by the TGFb superfamily (including stem cells (hMSC) [2–5]. The reasons why Mu¨ller glia do not TGFb1, TGFb2, TGFb3, and bone morphogenic proteins) regenerate the adult human retina are not known, but it is regulates mammalian cell proliferation, differentiation, mi- possible that factors produced in adult life or during degen- gration, and apoptosis during embryogenesis [11]. During erative diseases may prevent these cells from exerting these early development, TGFb has been shown to synergize or functions in vivo. Most retinal degenerative conditions that antagonize with Wnt proteins, a family of highly conserved 1Division of Ocular Biology and Therapeutics, UCL Institute of Ophthalmology, London, United Kingdom. 2Department of Ophthalmology and Visual Science, Eye & ENT Hospital, Shanghai Medical College, Fudan University, Shanghai, China. 3NIHR Biomedical Research Centre for Ophthalmology at Moorfields Eye Hospital and UCL Institute of Ophthalmology, London, United Kingdom. *These authors contributed equally to the work. Ó Angshumonik Angbohang, et al., 2015; Published by Mary Ann Liebert, Inc. This Open Access article is distributed under the terms of the Creative Commons License (http://creativecommons.org/licenses/by/4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly credited. 1 2 ANGBOHANG ET AL. secreted signaling molecules that regulate cell-to-cell inter- effect of this cytokine on the expression of the DKK1 and actions [12–14]. Wnt signaling is a major regulator of neu- WNT2B and WNT5B ligands, previously shown to be ex- rogenesis in the adult hippocampus [15], and it has been pressed by mammalian Mu¨ller glial cells [19], as well as on suggested that the pathways initiated by various Wnt ligands the phosphorylation of b-catenin in cells undergoing photo- may depend on the receptors expressed by a given target cell receptor differentiation. In this study, we demonstrate that [16]. Activation of the canonical Wnt signaling by TGFb has TGFb1 downregulates the expression of the canonical Wnt been shown to mediate fibrosis [17], and cooperation between signaling ligand WNT2B and increases the phosphorylation TGFb and Wnt signaling pathways are known to play a role in of b-catenin, while upregulating the expression of the non- controlling developmental events such as the regulation of canonical Wnt ligand WNT5B in hMSC. Interestingly, osteoblast differentiation of human mesenchymal stem cells TGFb1 inhibits photoreceptor differentiation of hMSC in [18]. In addition, it has been shown that Wnt signaling is vitro, an event shown to be mediated by activation of the activated during retina degeneration and that Wnt activation canonical Wnt signaling pathway. protects retinal cells from oxidative stress. From these ob- servations it is suggested that Wnt activation by growth fac- Materials and Methods tors may increase the threshold for apoptosis and prevent Human Mu¨ller stem cell culture further photoreceptor degeneration [19]. Although interaction of these signaling pathways in fish Human Mu¨ller stem cell lines (hMSC) developed in our and amphibians as well as small mammals during devel- laboratory were cultured as previously described [2]. Briefly, opment and adult regeneration are documented [20], there is cells were grown in Dulbecco’s modified Eagle’s medium no knowledge of the role of these factors in the regulation of (DMEM) (Gibco-BRL) containing 10% fetal calf serum neural differentiation of hMSC in the adult human eye. On (FCS) and 1% Penicillin/Streptomycin mix. Three different this basis, we investigated the role of TGFb1 on the regulation hMSC, named MIO-M1, MIO-M7, and MIO-M8, from pas- of the WNT signaling pathway in hMSC by examining the sages 7 to 33 were used for the experiments. To assess the Table 1. Primer Sequences Used for RT-PCR to Assess Gene Expression of Components of the Wnt Signaling Pathway and Photoreceptor Differentiation Markers in hMSC Gene Accession No. Sequence Tm(°C) Product size(bp) b-ACTIN NM_001101 (F) CATGTACGTTGCTATCCAGGC
Load more

Recommended publications
  • Genetic Variants in WNT2B and BTRC Predict Melanoma Survival
    ACCEPTED MANUSCRIPT Genetic Variants in WNT2B and BTRC Predict Melanoma Survival Qiong Shi1, 2, 3, 9, Hongliang Liu2, 3, 9, Peng Han2, 3, 4, 9, Chunying Li1, Yanru Wang2, 3, Wenting Wu5, Dakai Zhu6, Christopher I. Amos6, Shenying Fang7, Jeffrey E. Lee7, Jiali Han5, 8* and Qingyi Wei2, 3* 1Department of Dermatology, Xijing Hospital, Fourth Military Medical University, Xi’an, Shaanxi 710032, China; 2Duke Cancer Institute, Duke University Medical Center, Durham, NC 27710, USA, 3Department of Medicine, Duke University School of Medicine, Durham, NC 27710, USA, 4Department of Otorhinolaryngology Head and Neck Surgery, First Affiliated Hospital, Xi'an Jiaotong University College of Medicine, Xi'an, Shaanxi 710061, China; 5Department of Epidemiology, Fairbanks School of Public Health, Indiana University Melvin and Bren Simon Cancer Center, Indiana University, Indianapolis,MANUSCRIPT IN 46202, USA 6Community and Family Medicine, Geisel School of Medicine, Dartmouth College, Hanover, NH 03755, USA; 7Department of Surgical Oncology, The University of Texas M. D. Anderson Cancer Center, Houston, Texas 77030, USA. 8Channing Division of Network Medicine, Department of Medicine, Brigham and Women’s Hospital, Boston, MA 02115, USA 9These authors contributed equally to this work. ACCEPTED *Correspondence: Qingyi Wei, M.D., Ph.D., Duke Cancer Institute, Duke University Medical Center and Department of Medicine, Duke School of Medicine, 905 S LaSalle Street, Durham, NC 27710, USA, Tel.: (919) 660-0562, E-mail: [email protected] and Jiali Han, M.D., Ph.D., 1 _________________________________________________________________________________ This is the author's manuscript of the article published in final edited form as: Shi, Q., Liu, H., Han, P., Li, C., Wang, Y., Wu, W., … Wei, Q.
    [Show full text]
  • The Wnt Signaling Pathway in Tumorigenesis, Pharmacological
    Wang et al. Biomarker Research (2021) 9:68 https://doi.org/10.1186/s40364-021-00323-7 REVIEW Open Access The Wnt signaling pathway in tumorigenesis, pharmacological targets, and drug development for cancer therapy Zhuo Wang1,2†, Tingting Zhao1,2†, Shihui Zhang3, Junkai Wang1, Yunyun Chen1,2, Hongzhou Zhao1,2, Yaxin Yang4, Songlin Shi2, Qiang Chen5 and Kuancan Liu1,2* Abstract Wnt signaling was initially recognized to be vital for tissue development and homeostasis maintenance. Further studies revealed that this pathway is also important for tumorigenesis and progression. Abnormal expression of signaling components through gene mutation or epigenetic regulation is closely associated with tumor progression and poor prognosis in several tissues. Additionally, Wnt signaling also influences the tumor microenvironment and immune response. Some strategies and drugs have been proposed to target this pathway, such as blocking receptors/ligands, targeting intracellular molecules, beta-catenin/TCF4 complex and its downstream target genes, or tumor microenvironment and immune response. Here we discuss the roles of these components in Wnt signaling pathway in tumorigenesis and cancer progression, the underlying mechanisms that is responsible for the activation of Wnt signaling, and a series of drugs targeting the Wnt pathway provide multiple therapeutic values. Although some of these drugs exhibit exciting anti-cancer effect, clinical trials and systematic evaluation should be strictly performed along with multiple-omics technology. Keywords: Wnt signaling, beta-catenin, Epigenetic modification, Tumor microenvironment, Drug development Background polyposis coli (APC), glycogen synthase kinase-3β (GSK- The Wnt signaling cascade is critical for tissue morpho- 3β), Axin, casein kinase 1(CK1). Degradation of beta- genesis, homeostasis, and regeneration.
    [Show full text]
  • Wnt/Β-Catenin Signaling Regulates Regeneration in Diverse Tissues of the Zebrafish
    Wnt/β-catenin Signaling Regulates Regeneration in Diverse Tissues of the Zebrafish Nicholas Stockton Strand A dissertation Submitted in partial fulfillment of the Requirements for the degree of Doctor of Philosophy University of Washington 2016 Reading Committee: Randall Moon, Chair Neil Nathanson Ronald Kwon Program Authorized to Offer Degree: Pharmacology ©Copyright 2016 Nicholas Stockton Strand University of Washington Abstract Wnt/β-catenin Signaling Regulates Regeneration in Diverse Tissues of the Zebrafish Nicholas Stockton Strand Chair of the Supervisory Committee: Professor Randall T Moon Department of Pharmacology The ability to regenerate tissue after injury is limited by species, tissue type, and age of the organism. Understanding the mechanisms of endogenous regeneration provides greater insight into this remarkable biological process while also offering up potential therapeutic targets for promoting regeneration in humans. The Wnt/β-catenin signaling pathway has been implicated in zebrafish regeneration, including the fin and nervous system. The body of work presented here expands upon the role of Wnt/β-catenin signaling in regeneration, characterizing roles for Wnt/β-catenin signaling in multiple tissues. We show that cholinergic signaling is required for blastema formation and Wnt/β-catenin signaling initiation in the caudal fin, and that overexpression of Wnt/β-catenin ligand is sufficient to rescue blastema formation in fins lacking cholinergic activity. Next, we characterized the glial response to Wnt/β-catenin signaling after spinal cord injury, demonstrating that Wnt/β-catenin signaling is necessary for recovery of motor function and the formation of bipolar glia after spinal cord injury. Lastly, we defined a role for Wnt/β-catenin signaling in heart regeneration, showing that cardiomyocyte proliferation is regulated by Wnt/β-catenin signaling.
    [Show full text]
  • Evolutionarily Conserved Tbx5–Wnt2/2B Pathway Orchestrates Cardiopulmonary Development
    Evolutionarily conserved Tbx5–Wnt2/2b pathway orchestrates cardiopulmonary development Jeffrey D. Steimlea,b,c, Scott A. Rankind,e,f,g, Christopher E. Slagleh,i,j,k, Jenna Bekenya,b,c, Ariel B. Rydeena,b,c, Sunny Sun-Kin Chanl,m, Junghun Kweona,b,c, Xinan H. Yanga,b,c, Kohta Ikegamia,b,c, Rangarajan D. Nadadura,b,c, Megan Rowtona,b,c, Andrew D. Hoffmanna,b,c, Sonja Lazarevica,b,c, William Thomasn,o, Erin A. T. Boyle Andersonp, Marko E. Horbn,o, Luis Luna-Zuritaq,r, Robert K. Hom, Michael Kybal,m, Bjarke Jensens, Aaron M. Zornd,e,f,g, Frank L. Conlonh,i,j,k, and Ivan P. Moskowitza,b,c,1 aDepartment of Pediatrics, University of Chicago, Chicago, IL 60637; bDepartment of Pathology, University of Chicago, Chicago, IL 60637; cDepartment of Human Genetics, University of Chicago, Chicago, IL 60637; dCenter for Stem Cell and Organoid Medicine, Cincinnati Children’s Research Foundation, Cincinnati, OH 45229; eDepartment of Pediatrics, College of Medicine, University of Cincinnati, Cincinnati, OH 45229; fDivision of Developmental Biology, Perinatal Institute, Cincinnati Children’s Research Foundation, Cincinnati Children’s Hospital Medical Center, University of Cincinnati, Cincinnati, OH 45229; gDepartment of Pediatrics, College of Medicine, University of Cincinnati, Cincinnati, OH 45229; hDepartment of Biology, University of North Carolina at Chapel Hill, Chapel Hill, NC 27599; iDepartment of Genetics, University of North Carolina at Chapel Hill, Chapel Hill, NC 27599; jIntegrative Program for Biological and Genome Sciences, University of North
    [Show full text]
  • Tsukushi Functions As a Wnt Signaling Inhibitor by Competing with Wnt2b for Binding to Transmembrane Protein Frizzled4
    Tsukushi functions as a Wnt signaling inhibitor by competing with Wnt2b for binding to transmembrane protein Frizzled4 Kunimasa Ohtaa,b,1,2, Ayako Itoa,c,1, Sei Kuriyamaa,d,3, Giuseppe Lupoe,f, Mitsuko Kosakag,4, Shin-ichi Ohnumah, Shinichi Nakagawai, and Hideaki Tanakaa,c,d aDepartment of Developmental Neurobiology, Graduate School of Medical Sciences, Kumamoto University, Kumamoto 860-8556, Japan; bPrecursory Research for Embryonic Science and Technology, Japan Science and Technology Agency, Saitama 332-0012, Japan; cGlobal Center of Excellence, Kumamoto University, Kumamoto 860-8556, Japan; d21st Century Center of Excellence, Kumamoto University, Kumamoto 860-8556, Japan; eDepartment of Biology and Biotechnology “C. Darwin,” University of Rome “La Sapienza,” 00185 Rome, Italy; fIstituto Pasteur–Fondazione Cenci Bolognetti, 00185, Rome, Italy; gRIKEN Center for Developmental Biology, Kobe 650-0047, Japan; hInstitute of Ophthalmology, University College London, London EC1V 9EL, United Kingdom; and IRIKEN Advanced Science Institute, Nakagawa RNA Biology Laboratory, Saitama 351-0198, Japan Edited* by Lynn T. Landmesser, Case Western Reserve University, Cleveland, OH, and approved July 8, 2011 (received for review January 11, 2011) The Wnt signaling pathway is essential for the development of We previously described the isolation of Tsukushi (TSK) protein diverse tissues during embryogenesis. Signal transduction is acti- isoforms (13), soluble molecules belonging to the small leucine- vated by the binding of Wnt proteins to the type I receptor low- rich proteoglycan (SLRP) family (14), and showed that they work density lipoprotein receptor–related protein 5/6 and the seven-pass as extracellular modulators of pivotal signaling cascades during transmembrane protein Frizzled (Fzd), which contains a Wnt- early embryonic development in chicks and frogs (13, 15–17).
    [Show full text]
  • Deregulated Wnt/Β-Catenin Program in High-Risk Neuroblastomas Without
    Oncogene (2008) 27, 1478–1488 & 2008 Nature Publishing Group All rights reserved 0950-9232/08 $30.00 www.nature.com/onc ONCOGENOMICS Deregulated Wnt/b-catenin program in high-risk neuroblastomas without MYCN amplification X Liu1, P Mazanek1, V Dam1, Q Wang1, H Zhao2, R Guo2, J Jagannathan1, A Cnaan2, JM Maris1,3 and MD Hogarty1,3 1Division of Oncology, The Children’s Hospital of Philadelphia, Philadelphia, PA, USA; 2Department of Biostatistics and Epidemiology, University of Pennsylvania School of Medicine, Philadelphia, PA, USA and 3Department of Pediatrics, University of Pennsylvania School of Medicine, Philadelphia, PA, USA Neuroblastoma (NB) is a frequently lethal tumor of Introduction childhood. MYCN amplification accounts for the aggres- sive phenotype in a subset while the majority have no Neuroblastoma (NB) is a childhood embryonal malig- consistently identified molecular aberration but frequently nancy arising in the peripheral sympathetic nervous express MYC at high levels. We hypothesized that acti- system. Half of all children with NB present with features vated Wnt/b-catenin (CTNNB1) signaling might account that define their tumorsashigh riskwith poor overall for this as MYC is a b-catenin transcriptional target and survival despite intensive therapy (Matthay et al., 1999). multiple embryonal and neural crest malignancies have A subset of these tumors are characterized by high-level oncogenic alterations in this pathway. NB cell lines without genomic amplification of the MYCN proto-oncogene MYCN amplification express higher levels of MYC and (Matthay et al., 1999) but the remainder have no b-catenin (with aberrant nuclear localization) than MYCN- consistently identified aberration to account for their amplified cell lines.
    [Show full text]
  • Towards an Integrated View of Wnt Signaling in Development Renée Van Amerongen and Roel Nusse*
    HYPOTHESIS 3205 Development 136, 3205-3214 (2009) doi:10.1242/dev.033910 Towards an integrated view of Wnt signaling in development Renée van Amerongen and Roel Nusse* Wnt signaling is crucial for embryonic development in all animal Notably, components at virtually every level of the Wnt signal species studied to date. The interaction between Wnt proteins transduction cascade have been shown to affect both β-catenin- and cell surface receptors can result in a variety of intracellular dependent and -independent responses, depending on the cellular responses. A key remaining question is how these specific context. As we discuss below, this holds true for the Wnt proteins responses take shape in the context of a complex, multicellular themselves, as well as for their receptors and some intracellular organism. Recent studies suggest that we have to revise some of messengers. Rather than concluding that these proteins are shared our most basic ideas about Wnt signal transduction. Rather than between pathways, we instead propose that it is the total net thinking about Wnt signaling in terms of distinct, linear, cellular balance of signals that ultimately determines the response of the signaling pathways, we propose a novel view that considers the receiving cell. In the context of an intact and developing integration of multiple, often simultaneous, inputs at the level organism, cells receive multiple, dynamic, often simultaneous and of both Wnt-receptor binding and the downstream, sometimes even conflicting inputs, all of which are integrated to intracellular response. elicit the appropriate cell behavior in response. As such, the different signaling pathways might thus be more intimately Introduction intertwined than previously envisioned.
    [Show full text]
  • The Pennsylvania State University
    The Pennsylvania State University The Graduate School Department of Neural and Behavioral Sciences A REGENERATIVE RESPONSE OF ENDOGENOUS NEURAL STEM CELLS TO PERINATAL HYPOXIC/ISCHEMIC BRAIN DAMAGE A Thesis in Neuroscience by Ryan J. Felling © 2006 Ryan J. Felling Submitted in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy May 2006 ii The thesis of Ryan J. Felling was reviewed and approved* by the following: Steven W. Levison Professor of Neurology and Neurosciences Thesis Advisor Co-Chair of Committee Teresa L. Wood Associate Professor of Neural and Behavioral Sciences Co-Chair of Committee Sarah K. Bronson Assistant Professor of Cell and Molecular Biology Charles Palmer Professor of Pediatrics James R. Connor Professor and Vice-Chair Department of Neurosurgery; Director, G.M. Leader Family Laboratory for Alzheimer's Disease Research Robert J. Milner Professor of Neural and Behavioral Sciences Head of Neuroscience Graduate Program *Signatures are on file in the Graduate School iii ABSTRACT Hypoxic/ischemic (H/I) insults are the leading cause of neurologic injury during the perinatal period, affecting 2-4 per 1000 term births as well as a high percentage of premature infants. The ensuing sequelae are devastating and include cerebral palsy, epilepsy and cognitive deficits. Despite astounding advances in perinatal care, the incidence of cerebral palsy has changed little over the last 50 years. This demands that we pursue alternative therapeutic strategies that will reduce the significant morbidity associated with perinatal H/I encephalopathy. The revelation that the brain retains populations of neural stem cells throughout life offers the promise of endogenous regeneration following brain injury.
    [Show full text]
  • Demineralized Bone Alters Expression of Wnt Network Components During Chondroinduction of Post-Natal fibroblasts Karen E
    OsteoArthritis and Cartilage (2004) 12, 497–505 © 2004 OsteoArthritis Research Society International. Published by Elsevier Ltd. All rights reserved. doi:10.1016/j.joca.2004.02.009 International Cartilage Repair Society Demineralized bone alters expression of Wnt network components during chondroinduction of post-natal fibroblasts Karen E. Yates Ph.D* Department of Orthopedic Surgery, Brigham and Women’s Hospital, and Skeletal Biology Research Center, Massachusetts General Hospital, Boston, USA Summary Objective: The Wnt family of secreted proteins, their receptors (Fzd proteins) and antagonists (secreted Fzd-related proteins, or Sfrp) regulate chondrocyte differentiation and chrondrogenesis during embryonic development. Here, the hypothesis that the Wnt regulatory network contributes to chondrocyte differentiation of post-natal cells was tested in an in vitro model of chondroinduction by demineralized bone powder (DBP). Design: Human dermal fibroblasts (hDFs) were cultured in porous, three-dimensional (3D) collagen sponges with or without chondroinduc- tive DBP. In some experiments, lithium chloride (LiCl), an agonist of the Wnt/-catenin signaling pathway, was added to the culture media. Sponges were cultured for intervals (0.5–21 days) before processing for molecular, histologic, and biochemical analyses. Expression of wnt, fzd, and sfrp genes was characterized by semi-quantitative RT-PCR. Fibroblasts’ contacts with DBP were documented by histology. Accumulation of proteoglycan in extracellular matrix was evaluated by histology (metachromasia in toluidine blue-stained sections) and quantitative immunoassay (chondroitin 4-sulfate ELISA). Results: Expression of 15 wnt, fzd, and sfrp family members was detected in hDFs by RT-PCR. A subset of those genes (wnt2b, wnt5b, wnt10b, fzd6, fzd7) showed altered expression in hDFs exposed to DBP for 3 days.
    [Show full text]
  • Recent Achievements in Stem Cell-Mediated Myelin Repair (2016)
    REVIEW CURRENT OPINION Recent achievements in stem cell-mediated myelin repair Janusz Joachim Jadasza, Catherine Lubetzki b,c,d,e, Bernard Zalcb,c,d, Bruno Stankoff b,c,d,e, Hans-Peter Hartunga, and Patrick Ku¨rya Purpose of review Following the establishment of a number of successful immunomodulatory treatments for multiple sclerosis, current research focuses on the repair of existing damage. Recent findings Promotion of regeneration is particularly important for demyelinated areas with degenerated or functionally impaired axons of the central nervous system’s white and gray matter. As the protection and generation of new oligodendrocytes is a key to the re-establishment of functional connections, adult oligodendrogenesis and myelin reconstitution processes are of primary interest. Moreover, understanding, supporting and promoting endogenous repair activities such as mediated by resident oligodendroglial precursor or adult neural stem cells are currently thought to be a promising approach toward the development of novel regenerative therapies. Summary This review summarizes recent developments and findings related to pharmacological myelin repair as well as to the modulation/application of stem cells with the aim to restore defective myelin sheaths. Keywords multiple sclerosis, pharmacological modulation, regeneration, remyelination, stem cells INTRODUCTION sclerosis have been identified and are currently Multiple sclerosis is a chronic inflammatory demye- applied mainly in the treatment of RRMS patients. linating disease of the central nervous system (CNS) These strategies include general immunomodula- and is characterized by damage and loss of myelin tion/suppression, modulation of immune cell egress sheaths and oligodendrocytes. As these axon-glia from lymph nodes, their penetration into brain interactions build the structural base for accelerated parenchyma up to neutralization and depletion of nerve conduction and have furthermore been specific immune cell types [3].
    [Show full text]
  • I REGENERATIVE MEDICINE APPROACHES to SPINAL CORD
    REGENERATIVE MEDICINE APPROACHES TO SPINAL CORD INJURY A Dissertation Presented to The Graduate Faculty of The University of Akron In Partial Fulfillment of the Requirements for the Degree Doctor of Philosophy Ashley Elizabeth Mohrman March 2017 i ABSTRACT Hundreds of thousands of people suffer from spinal cord injuries in the U.S.A. alone, with very few patients ever experiencing complete recovery. Complexity of the tissue and inflammatory response contribute to this lack of recovery, as the proper function of the central nervous system relies on its highly specific structural and spatial organization. The overall goal of this dissertation project is to study the central nervous system in the healthy and injured state so as to devise appropriate strategies to recover tissue homeostasis, and ultimately function, from an injured state. A specific spinal cord injury model, syringomyelia, was studied; this condition presents as a fluid filled cyst within the spinal cord. Molecular evaluation at three and six weeks post-injury revealed a large inflammatory response including leukocyte invasion, losses in neuronal transmission and signaling, and upregulation in important osmoregulators. These included osmotic stress regulating metabolites betaine and taurine, as well as the betaine/GABA transporter (BGT-1), potassium chloride transporter (KCC4), and water transporter aquaporin 1 (AQP1). To study cellular behavior in native tissue, adult neural stem cells from the subventricular niche were differentiated in vitro. These cells were tested under various culture conditions for cell phenotype preferences. A mostly pure (>80%) population of neural stem cells could be specified using soft, hydrogel substrates with a laminin coating and interferon-γ supplementation.
    [Show full text]
  • Analysis of the Canonical WNT Pathway Simona Giunta Department of Biological Sciences, Brunel University, Uxbridge, Middlesex, UK
    05-giunta 25-02-2010 15:21 Pagina 187 ACTA BIOMED 2009; 80: 187-199 © Mattioli 1885 R EVIEW A gust of WNT: analysis of the canonical WNT pathway Simona Giunta Department of Biological Sciences, Brunel University, Uxbridge, Middlesex, UK Abstract. The Wnt pathway is a signal-transduction cascade that mediates communication between cells; the Wnt pathway is involved in key steps during embryological development and in the maintenance of adult tissue homeostasis. Mutational dysregulation of Wnt cascade components has been observed in diverse hu- man pathological conditions and in oncogenic transformations. For these reasons, the Wnt signalling path- way has acquired growing interest in scientific and medical research over recent years. This review outlines the biochemical and functional features of the Wnt cascade with particular emphasis on a detailed function- al analysis of all key players. In this instance, the regulations of the pathway have also been covered, empha- sizing novelty in this regard. Furthermore, past and present studies on Wnt have been included, as well as a prediction of scientific progress, which may be made in this rapidly evolving field, in the near future; the re- view also embraces considerations on how further understanding of the Wnt pathway will provide important insight into managing human diseases. (www.actabiomedica.it) Key words: Wnt canonical pathway, b-catenin, signal transduction, haematopoietic stem cells, carcinogenesis Introduction molecules which regulate the main steps of embryoge- nesis. Multicellular organisms necessitate a communi- The Wnt family of signalling proteins has been cation system to grow and function; in complex mul- found to be involved in embryonic patterning, in the ticellular organisms, like humans, cell-to-cell commu- homeostasis of adult tissue self-renewal and in the nication becomes the basis of life.
    [Show full text]