I REGENERATIVE MEDICINE APPROACHES to SPINAL CORD

Total Page:16

File Type:pdf, Size:1020Kb

Load more

REGENERATIVE MEDICINE APPROACHES TO SPINAL CORD INJURY A Dissertation Presented to The Graduate Faculty of The University of Akron In Partial Fulfillment of the Requirements for the Degree Doctor of Philosophy Ashley Elizabeth Mohrman March 2017 i ABSTRACT Hundreds of thousands of people suffer from spinal cord injuries in the U.S.A. alone, with very few patients ever experiencing complete recovery. Complexity of the tissue and inflammatory response contribute to this lack of recovery, as the proper function of the central nervous system relies on its highly specific structural and spatial organization. The overall goal of this dissertation project is to study the central nervous system in the healthy and injured state so as to devise appropriate strategies to recover tissue homeostasis, and ultimately function, from an injured state. A specific spinal cord injury model, syringomyelia, was studied; this condition presents as a fluid filled cyst within the spinal cord. Molecular evaluation at three and six weeks post-injury revealed a large inflammatory response including leukocyte invasion, losses in neuronal transmission and signaling, and upregulation in important osmoregulators. These included osmotic stress regulating metabolites betaine and taurine, as well as the betaine/GABA transporter (BGT-1), potassium chloride transporter (KCC4), and water transporter aquaporin 1 (AQP1). To study cellular behavior in native tissue, adult neural stem cells from the subventricular niche were differentiated in vitro. These cells were tested under various culture conditions for cell phenotype preferences. A mostly pure (>80%) population of neural stem cells could be specified using soft, hydrogel substrates with a laminin coating and interferon-γ supplementation. To guide and possibly recruit native stem cells, as well as reduce injury in the spinal cord, an injectable delivery iii strategy is necessary. An in situ cross-linking hydrogel could increase latency and localization of treatments. In this project, a chitosan/PEG based hydrogel was tailored for CNS tissues with low swelling post-gelation, a low elastic modulus (0.37 kPa), and very low cytotoxicity. When injected into the spinal cord parenchyma, the hydrogel elicited close to the same response as the saline injected surgical sham group. Overall, these platforms can be used to manufacture future strategies to locally deliver therapeutics that combat spinal cord injury. iv ACKNOWLEDGEMENTS Graduate school has been a long and bumpy road. I definitely would not have made it to the end in one piece without many of wonderful people encouraging, helping, and sometimes down right pushing me along the way. I would like to thank Dr. Leipzig, for taking me into his lab and teaching me to do research when I had no real experience. I’m sure there were some frustrating times along the way (writing the mini-book comes to mind!), but you stuck with me and made me into a stronger person. I appreciate all the times you came into the lab to teach us techniques and you open door policy. Getting so much face time with your advisor can be a rare thing, and I am happy to have received direction “from the source.” Thank you for encouraging a sense of family in the lab, from semi-annual lab outings to sharing your garden produce and dahlia tubers. A big thank you to my committee, Drs. Chase, Cheng, Joy, Willits, and the newly joined Dr. Monty! Your comments, critiques, and questions have helped to mold this project. I am grateful that I got to learn from you in and out of the classroom, you all greatly inspire me. A special thank you to Dr. Monty and Dr. Willits for talks and advice, I strive to someday be the role-model to future graduate students the way you were to me. To all the students I have had the pleasure of working with, graduate and undergraduate, I am extremely grateful for research discussions, non-research talks, pick- me-ups after failed experiments, and all around brightening my day. I believe that great research comes from a collaborative effort, where minds from different backgrounds and v areas of expertise really meld to make something special. Thank you to Andrew, Hannah, Mahmoud, Pritam, Shahrzad, and Trevor for answering my incessant questions, being excellent sounding-boards, suggesting solutions to problems big and small, and just for being amazing scientists and surrounding me with positivity. The early (read: glory) years would not have been the same without my previous labmates, who are now very dear friends. Hang, Aleesha, Natalie, and Liza: I miss you every day and wish each of you were still in my daily life! I must also thank and spread the appreciation to friends and sources of knowledge outside of my own lab. Frank, you helped me immensely in and out of the machine shop! Not only did you make amazing things that greatly enhanced my research, but you kept me sane with all the trips to the rec and introduced me to new friends through crazy walleyball games. Mary Beth, I definitely would not have finished everything up without our running (a.k.a. therapy) sessions towards the end of my project. Thank you for being a great friend and a kick- butt colleague. You all were so supportive and integral to my success as a graduate student. I look up to each one of you, and I hope we continue to stay in contact and remain friends. Saving the best for last, I must acknowledge my family, without whom I certainly would not have achieved so much in my life. I am eternally grateful that I get to call you all family (be it by blood or by choice), you are my rock, my lifeline, my cheerleaders, my angry mob, my everything. Also, thank you for keeping me grounded in the fact that there is life going on OUTSIDE of a laboratory. I cannot name everyone here, I do like trees, but need to say a few special thanks to Anthony, Caitlin, and Kent, and to Leah and Amanda, my oldest friends. I must officially thank my husband, Brian, you should be vi nominated for saint-hood. I cannot wait to see what else life has in store for us (should be easy compared to these last couple years)! I would not have even started this journey if not for the constant love, support, and encouragement of my parents and my brother, all of whom have helped make me the person I am today. Thank you for teaching me by example, the person that I want to be. vii TABLE OF CONTENTS Page LIST OF FIGURES ......................................................................................................... xiv CHAPTER I. INTRODUCTION ........................................................................................................... 1 II. CENTRAL NERVOUS SYSTEM GROSS ANATOMY, CELL TYPES, AND MATERIAL BACKGROUND ........................................................................................... 7 Introduction ..................................................................................................................... 7 Anatomy of the CNS & Progress of Neurological Damage ........................................... 9 Anatomy & Physiology of the CNS............................................................................ 9 Loss of Neural Function............................................................................................ 18 Neurodegenerative Diseases ..................................................................................... 25 Role of Glia in Degeneration & Regeneration of CNS Axons ................................. 26 Biomaterials for Scaffold Preparation .......................................................................... 28 Definition of Biomaterial & Requirements for Neural TE Scaffolds ....................... 28 Biodegradable Scaffolds ........................................................................................... 29 Sample of current Biomaterials in CNS TE .............................................................. 33 Cell Sources for CNS TE .............................................................................................. 38 viii Primary Cell Treatment of CNS Injury: Glial Cells ................................................. 40 Pluripotent Stem Cells: Embryonic Stem Cells ........................................................ 42 Induced Stem Cells ................................................................................................... 46 Adult Stem Cells: Endogenous Stem Cells in the Brain & Spinal Cord .................. 48 Mesenchymal Stem Cells .......................................................................................... 52 Stimulation & Guidance ............................................................................................... 55 Physical Cues ............................................................................................................ 56 Chemical Cues .......................................................................................................... 63 Electrical Stimulation................................................................................................ 73 Concluding Remarks ..................................................................................................... 75 III. MOLECULAR LEVEL INVESTIGATION OF SPINAL CORD INJURY MODEL ........................................................................................................................................... 77 Summary ....................................................................................................................... 77 Introduction ..................................................................................................................
Recommended publications
  • FLNC Missense Variants in Familial Noncompaction Cardiomyopathy

    FLNC Missense Variants in Familial Noncompaction Cardiomyopathy

    Cardiogenetics 2019; volume 9:8181 FLNC missense variants than 2 according to current echocardio- in familial noncompaction graphic criteria, or 2.3 on CMR.1,2 Correspondence: Jaap I. van Waning, Approximately 10% of patients diagnosed Department of Clinical Genetics, EE 2038, cardiomyopathy with NCCM have concurrent congenital Erasmus MC, POB 2040, 3000CA Rotterdam, heart defects (CHD).3,4 the Netherlands. Tel.: +3107038388 - Fax: +3107043072. Jaap I. van Waning,1 In 30-40% of cases diagnosed with E-mail: [email protected] Yvonne M. Hoedemaekers,2 NCCM a pathogenic variant can be identi- 2,3 4 Wouter P. te Rijdt, Arne I. Jpma, fied. Around 80% of these pathogenic vari- Acknowledgements: JVW was supported by a Daphne Heijsman,4 Kadir Caliskan,5 ants involve the same sarcomere genes, that grant from the Jaap Schouten Foundation. Elke S. Hoendermis,6 are the major causes for hypertrophic car- WPTR was supported by a Young Talent Program (CVON PREDICT) grant 2017T001 Tineke P. Willems,7 diomyopathy (HCM) and dilated cardiomy- - Dutch Heart Foundation. 8 opathy (DCM), in particular MYH7, Arthur van den Wijngaard, 5,6 3 MYBPC3 and TTN. Filamin C (FLNC) Albert Suurmeijer, Conflict of interest: the authors declare no plays a central role in muscle functioning Marjon A. van Slegtenhorst,1 potential conflict of interest. by maintaining the structural integrity of the Jan D.H. Jongbloed,2 muscle fibers. Pathogenic variants in FLNC Received for publication: 20 March 2019. Danielle F. Majoor-Krakauer,1 2 were found to be associated with a wide Revision received: 29 July 2019. Paul A.
  • Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”

    Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”

    Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P.
  • Lower Genomic Stability of Induced Pluripotent Stem Cells Reflects

    Lower Genomic Stability of Induced Pluripotent Stem Cells Reflects

    Zhang et al. Cancer Commun (2018) 38:49 https://doi.org/10.1186/s40880-018-0313-0 Cancer Communications ORIGINAL ARTICLE Open Access Lower genomic stability of induced pluripotent stem cells refects increased non‑homologous end joining Minjie Zhang1,2†, Liu Wang3†, Ke An1,2†, Jun Cai1, Guochao Li1,2, Caiyun Yang1, Huixian Liu1, Fengxia Du1, Xiao Han1,2, Zilong Zhang1,2, Zitong Zhao1,2, Duanqing Pei4, Yuan Long5, Xin Xie5, Qi Zhou3 and Yingli Sun1* Abstract Background: Induced pluripotent stem cells (iPSCs) and embryonic stem cells (ESCs) share many common features, including similar morphology, gene expression and in vitro diferentiation profles. However, genomic stability is much lower in iPSCs than in ESCs. In the current study, we examined whether changes in DNA damage repair in iPSCs are responsible for their greater tendency towards mutagenesis. Methods: Mouse iPSCs, ESCs and embryonic fbroblasts were exposed to ionizing radiation (4 Gy) to introduce dou- ble-strand DNA breaks. At 4 h later, fdelity of DNA damage repair was assessed using whole-genome re-sequencing. We also analyzed genomic stability in mice derived from iPSCs versus ESCs. Results: In comparison to ESCs and embryonic fbroblasts, iPSCs had lower DNA damage repair capacity, more somatic mutations and short indels after irradiation. iPSCs showed greater non-homologous end joining DNA repair and less homologous recombination DNA repair. Mice derived from iPSCs had lower DNA damage repair capacity than ESC-derived mice as well as C57 control mice. Conclusions: The relatively low genomic stability of iPSCs and their high rate of tumorigenesis in vivo appear to be due, at least in part, to low fdelity of DNA damage repair.
  • Calcium-Induced Calcium Release in Noradrenergic Neurons of the Locus Coeruleus

    Calcium-Induced Calcium Release in Noradrenergic Neurons of the Locus Coeruleus

    bioRxiv preprint doi: https://doi.org/10.1101/853283; this version posted November 23, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Calcium-induced calcium release in noradrenergic neurons of the locus coeruleus Hiroyuki Kawano1, Sara B. Mitchell1, Jin-Young Koh1,2,3, Kirsty M. Goodman1,4, and N. Charles Harata1,* 1 Department of Molecular Physiology and Biophysics, University of Iowa Carver College of Medicine, Iowa City, IA, USA 2 Molecular Otolaryngology and Renal Research Laboratories, Department of Otolaryngology-Head and Neck Surgery, University of Iowa Carver College of Medicine, Iowa City, IA, USA 3 Department of Biomedical Engineering, University of Iowa College of Engineering, Iowa City, IA, USA 4 Department of Biology & Biochemistry, University of Bath, Bath, UK * Correspondence to: N. Charles Harata, MD, PhD Department of Molecular Physiology & Biophysics University of Iowa Carver College of Medicine 51 Newton Road, Iowa City, IA 52242, USA Phone: 1-319-335-7820 Fax: 1-319-335-7330 E-mail: [email protected] Number of words: 8620; Number of figures: 12. 1 bioRxiv preprint doi: https://doi.org/10.1101/853283; this version posted November 23, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.
  • Table S1 the Four Gene Sets Derived from Gene Expression Profiles of Escs and Differentiated Cells

    Table S1 the Four Gene Sets Derived from Gene Expression Profiles of Escs and Differentiated Cells

    Table S1 The four gene sets derived from gene expression profiles of ESCs and differentiated cells Uniform High Uniform Low ES Up ES Down EntrezID GeneSymbol EntrezID GeneSymbol EntrezID GeneSymbol EntrezID GeneSymbol 269261 Rpl12 11354 Abpa 68239 Krt42 15132 Hbb-bh1 67891 Rpl4 11537 Cfd 26380 Esrrb 15126 Hba-x 55949 Eef1b2 11698 Ambn 73703 Dppa2 15111 Hand2 18148 Npm1 11730 Ang3 67374 Jam2 65255 Asb4 67427 Rps20 11731 Ang2 22702 Zfp42 17292 Mesp1 15481 Hspa8 11807 Apoa2 58865 Tdh 19737 Rgs5 100041686 LOC100041686 11814 Apoc3 26388 Ifi202b 225518 Prdm6 11983 Atpif1 11945 Atp4b 11614 Nr0b1 20378 Frzb 19241 Tmsb4x 12007 Azgp1 76815 Calcoco2 12767 Cxcr4 20116 Rps8 12044 Bcl2a1a 219132 D14Ertd668e 103889 Hoxb2 20103 Rps5 12047 Bcl2a1d 381411 Gm1967 17701 Msx1 14694 Gnb2l1 12049 Bcl2l10 20899 Stra8 23796 Aplnr 19941 Rpl26 12096 Bglap1 78625 1700061G19Rik 12627 Cfc1 12070 Ngfrap1 12097 Bglap2 21816 Tgm1 12622 Cer1 19989 Rpl7 12267 C3ar1 67405 Nts 21385 Tbx2 19896 Rpl10a 12279 C9 435337 EG435337 56720 Tdo2 20044 Rps14 12391 Cav3 545913 Zscan4d 16869 Lhx1 19175 Psmb6 12409 Cbr2 244448 Triml1 22253 Unc5c 22627 Ywhae 12477 Ctla4 69134 2200001I15Rik 14174 Fgf3 19951 Rpl32 12523 Cd84 66065 Hsd17b14 16542 Kdr 66152 1110020P15Rik 12524 Cd86 81879 Tcfcp2l1 15122 Hba-a1 66489 Rpl35 12640 Cga 17907 Mylpf 15414 Hoxb6 15519 Hsp90aa1 12642 Ch25h 26424 Nr5a2 210530 Leprel1 66483 Rpl36al 12655 Chi3l3 83560 Tex14 12338 Capn6 27370 Rps26 12796 Camp 17450 Morc1 20671 Sox17 66576 Uqcrh 12869 Cox8b 79455 Pdcl2 20613 Snai1 22154 Tubb5 12959 Cryba4 231821 Centa1 17897
  • Combined Pharmacological Administration of AQP1 Ion Channel

    Combined Pharmacological Administration of AQP1 Ion Channel

    www.nature.com/scientificreports OPEN Combined pharmacological administration of AQP1 ion channel blocker AqB011 and water channel Received: 15 November 2018 Accepted: 13 August 2019 blocker Bacopaside II amplifes Published: xx xx xxxx inhibition of colon cancer cell migration Michael L. De Ieso 1, Jinxin V. Pei 1, Saeed Nourmohammadi1, Eric Smith 1,2, Pak Hin Chow1, Mohamad Kourghi1, Jennifer E. Hardingham 1,2 & Andrea J. Yool 1 Aquaporin-1 (AQP1) has been proposed as a dual water and cation channel that when upregulated in cancers enhances cell migration rates; however, the mechanism remains unknown. Previous work identifed AqB011 as an inhibitor of the gated human AQP1 cation conductance, and bacopaside II as a blocker of AQP1 water pores. In two colorectal adenocarcinoma cell lines, high levels of AQP1 transcript were confrmed in HT29, and low levels in SW480 cells, by quantitative PCR (polymerase chain reaction). Comparable diferences in membrane AQP1 protein levels were demonstrated by immunofuorescence imaging. Migration rates were quantifed using circular wound closure assays and live-cell tracking. AqB011 and bacopaside II, applied in combination, produced greater inhibitory efects on cell migration than did either agent alone. The high efcacy of AqB011 alone and in combination with bacopaside II in slowing HT29 cell motility correlated with abundant membrane localization of AQP1 protein. In SW480, neither agent alone was efective in blocking cell motility; however, combined application did cause inhibition of motility, consistent with low levels of membrane AQP1 expression. Bacopaside alone or combined with AqB011 also signifcantly impaired lamellipodial formation in both cell lines. Knockdown of AQP1 with siRNA (confrmed by quantitative PCR) reduced the efectiveness of the combined inhibitors, confrming AQP1 as a target of action.
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus

    A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus

    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
  • Transcriptomic Analysis of Native Versus Cultured Human and Mouse Dorsal Root Ganglia Focused on Pharmacological Targets Short

    Transcriptomic Analysis of Native Versus Cultured Human and Mouse Dorsal Root Ganglia Focused on Pharmacological Targets Short

    bioRxiv preprint doi: https://doi.org/10.1101/766865; this version posted September 12, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-ND 4.0 International license. Transcriptomic analysis of native versus cultured human and mouse dorsal root ganglia focused on pharmacological targets Short title: Comparative transcriptomics of acutely dissected versus cultured DRGs Andi Wangzhou1, Lisa A. McIlvried2, Candler Paige1, Paulino Barragan-Iglesias1, Carolyn A. Guzman1, Gregory Dussor1, Pradipta R. Ray1,#, Robert W. Gereau IV2, # and Theodore J. Price1, # 1The University of Texas at Dallas, School of Behavioral and Brain Sciences and Center for Advanced Pain Studies, 800 W Campbell Rd. Richardson, TX, 75080, USA 2Washington University Pain Center and Department of Anesthesiology, Washington University School of Medicine # corresponding authors [email protected], [email protected] and [email protected] Funding: NIH grants T32DA007261 (LM); NS065926 and NS102161 (TJP); NS106953 and NS042595 (RWG). The authors declare no conflicts of interest Author Contributions Conceived of the Project: PRR, RWG IV and TJP Performed Experiments: AW, LAM, CP, PB-I Supervised Experiments: GD, RWG IV, TJP Analyzed Data: AW, LAM, CP, CAG, PRR Supervised Bioinformatics Analysis: PRR Drew Figures: AW, PRR Wrote and Edited Manuscript: AW, LAM, CP, GD, PRR, RWG IV, TJP All authors approved the final version of the manuscript. 1 bioRxiv preprint doi: https://doi.org/10.1101/766865; this version posted September 12, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity.
  • Wnt/Β-Catenin Signaling Regulates Regeneration in Diverse Tissues of the Zebrafish

    Wnt/Β-Catenin Signaling Regulates Regeneration in Diverse Tissues of the Zebrafish

    Wnt/β-catenin Signaling Regulates Regeneration in Diverse Tissues of the Zebrafish Nicholas Stockton Strand A dissertation Submitted in partial fulfillment of the Requirements for the degree of Doctor of Philosophy University of Washington 2016 Reading Committee: Randall Moon, Chair Neil Nathanson Ronald Kwon Program Authorized to Offer Degree: Pharmacology ©Copyright 2016 Nicholas Stockton Strand University of Washington Abstract Wnt/β-catenin Signaling Regulates Regeneration in Diverse Tissues of the Zebrafish Nicholas Stockton Strand Chair of the Supervisory Committee: Professor Randall T Moon Department of Pharmacology The ability to regenerate tissue after injury is limited by species, tissue type, and age of the organism. Understanding the mechanisms of endogenous regeneration provides greater insight into this remarkable biological process while also offering up potential therapeutic targets for promoting regeneration in humans. The Wnt/β-catenin signaling pathway has been implicated in zebrafish regeneration, including the fin and nervous system. The body of work presented here expands upon the role of Wnt/β-catenin signaling in regeneration, characterizing roles for Wnt/β-catenin signaling in multiple tissues. We show that cholinergic signaling is required for blastema formation and Wnt/β-catenin signaling initiation in the caudal fin, and that overexpression of Wnt/β-catenin ligand is sufficient to rescue blastema formation in fins lacking cholinergic activity. Next, we characterized the glial response to Wnt/β-catenin signaling after spinal cord injury, demonstrating that Wnt/β-catenin signaling is necessary for recovery of motor function and the formation of bipolar glia after spinal cord injury. Lastly, we defined a role for Wnt/β-catenin signaling in heart regeneration, showing that cardiomyocyte proliferation is regulated by Wnt/β-catenin signaling.
  • Effects of Aquaporin 4 and Inward Rectifier

    Effects of Aquaporin 4 and Inward Rectifier

    9-Experimental Surgery Effects of aquaporin 4 and inward rectifier potassium channel 4.1 on medullospinal edema after methylprednisolone treatment to suppress acute spinal cord injury in rats1 Ye LiI, Haifeng HuII, Jingchen LiuIII, Qingsan ZhuIV, Rui GuV IAssociate Professor, Department of Orthopaedics, China-Japan Union Hospital, Jilin University, Changchun, China. Conception, design, intellectual and scientific content of the study; acquisition of data; manuscript writing; critical revision. IIAttending Doctor, Department of Orthopaedics, China-Japan Union Hospital, Jilin University, Changchun, China. Acquisition of data, manuscript writing. IIIProfessor, Department of Orthopaedics, China-Japan Union Hospital, Jilin University, Changchun, China. Scientific content of the study, acquisition of data, manuscript writing. IVProfessor, Department of Orthopaedics, China-Japan Union Hospital, Jilin University, Changchun, China. Acquisition of data. VProfessor, Department of Orthopaedics, China-Japan Union Hospital, Jilin University, Changchun, China. Intellectual, scientific, conception and design of the study; critical revision. Abstract Purpose: To investigate the effects of aquaporin 4 (AQP4) and inward rectifier potassium channel 4.1 (Kir4.1) on medullospinal edema after treatment with methylprednisolone (MP) to suppress acute spinal cord injury (ASCI) in rats. Methods: Sprague Dawley rats were randomly divided into control, sham, ASCI, and MP- treated ASCI groups. After the induction of ASCI, we injected 30 mg/kg MP via the tail vein at various time points. The Tarlov scoring method was applied to evaluate neurological symptoms, and the wet–dry weights method was applied to measure the water content of the spinal cord. Results: The motor function score of the ASCI group was significantly lower than that of the sham group, and the spinal water content was significantly increased.
  • Non-Coding Rnas in the Cardiac Action Potential and Their Impact on Arrhythmogenic Cardiac Diseases

    Non-Coding Rnas in the Cardiac Action Potential and Their Impact on Arrhythmogenic Cardiac Diseases

    Review Non-Coding RNAs in the Cardiac Action Potential and Their Impact on Arrhythmogenic Cardiac Diseases Estefania Lozano-Velasco 1,2 , Amelia Aranega 1,2 and Diego Franco 1,2,* 1 Cardiovascular Development Group, Department of Experimental Biology, University of Jaén, 23071 Jaén, Spain; [email protected] (E.L.-V.); [email protected] (A.A.) 2 Fundación Medina, 18016 Granada, Spain * Correspondence: [email protected] Abstract: Cardiac arrhythmias are prevalent among humans across all age ranges, affecting millions of people worldwide. While cardiac arrhythmias vary widely in their clinical presentation, they possess shared complex electrophysiologic properties at cellular level that have not been fully studied. Over the last decade, our current understanding of the functional roles of non-coding RNAs have progressively increased. microRNAs represent the most studied type of small ncRNAs and it has been demonstrated that miRNAs play essential roles in multiple biological contexts, including normal development and diseases. In this review, we provide a comprehensive analysis of the functional contribution of non-coding RNAs, primarily microRNAs, to the normal configuration of the cardiac action potential, as well as their association to distinct types of arrhythmogenic cardiac diseases. Keywords: cardiac arrhythmia; microRNAs; lncRNAs; cardiac action potential Citation: Lozano-Velasco, E.; Aranega, A.; Franco, D. Non-Coding RNAs in the Cardiac Action Potential 1. The Electrical Components of the Adult Heart and Their Impact on Arrhythmogenic The adult heart is a four-chambered organ that propels oxygenated blood to the entire Cardiac Diseases. Hearts 2021, 2, body. It is composed of atrial and ventricular chambers, each of them with distinct left and 307–330.
  • Mechanisms of Synaptic Plasticity Mediated by Clathrin Adaptor-Protein Complexes 1 and 2 in Mice

    Mechanisms of Synaptic Plasticity Mediated by Clathrin Adaptor-Protein Complexes 1 and 2 in Mice

    Mechanisms of synaptic plasticity mediated by Clathrin Adaptor-protein complexes 1 and 2 in mice Dissertation for the award of the degree “Doctor rerum naturalium” at the Georg-August-University Göttingen within the doctoral program “Molecular Biology of Cells” of the Georg-August University School of Science (GAUSS) Submitted by Ratnakar Mishra Born in Birpur, Bihar, India Göttingen, Germany 2019 1 Members of the Thesis Committee Prof. Dr. Peter Schu Institute for Cellular Biochemistry, (Supervisor and first referee) University Medical Center Göttingen, Germany Dr. Hans Dieter Schmitt Neurobiology, Max Planck Institute (Second referee) for Biophysical Chemistry, Göttingen, Germany Prof. Dr. med. Thomas A. Bayer Division of Molecular Psychiatry, University Medical Center, Göttingen, Germany Additional Members of the Examination Board Prof. Dr. Silvio O. Rizzoli Department of Neuro-and Sensory Physiology, University Medical Center Göttingen, Germany Dr. Roland Dosch Institute of Developmental Biochemistry, University Medical Center Göttingen, Germany Prof. Dr. med. Martin Oppermann Institute of Cellular and Molecular Immunology, University Medical Center, Göttingen, Germany Date of oral examination: 14th may 2019 2 Table of Contents List of abbreviations ................................................................................. 5 Abstract ................................................................................................... 7 Chapter 1: Introduction ............................................................................