King’s Research Portal DOI: 10.1089/scd.2015.0262 Document Version Publisher's PDF, also known as Version of record Link to publication record in King's Research Portal Citation for published version (APA): Angbohang, A., Wu, N., Charalambous, T., Eastlake, K., Lei, Y., Kim, Y. S., Sun, X. H., & Limb, G. A. (2015). Downregulation of the Canonical WNT Signaling Pathway by TGF1 Inhibits Photoreceptor Differentiation of Adult Human Müller Glia with Stem Cell Characteristics. STEM CELLS AND DEVELOPMENT, 25(1), 1-12. https://doi.org/10.1089/scd.2015.0262 Citing this paper Please note that where the full-text provided on King's Research Portal is the Author Accepted Manuscript or Post-Print version this may differ from the final Published version. If citing, it is advised that you check and use the publisher's definitive version for pagination, volume/issue, and date of publication details. And where the final published version is provided on the Research Portal, if citing you are again advised to check the publisher's website for any subsequent corrections. General rights Copyright and moral rights for the publications made accessible in the Research Portal are retained by the authors and/or other copyright owners and it is a condition of accessing publications that users recognize and abide by the legal requirements associated with these rights. •Users may download and print one copy of any publication from the Research Portal for the purpose of private study or research. •You may not further distribute the material or use it for any profit-making activity or commercial gain •You may freely distribute the URL identifying the publication in the Research Portal Take down policy If you believe that this document breaches copyright please contact [email protected] providing details, and we will remove access to the work immediately and investigate your claim. Download date: 23. Sep. 2021 STEM CELLS AND DEVELOPMENT ORIGINAL RESEARCH REPORTS Volume 25, Number 1, 2016 Mary Ann Liebert, Inc. DOI: 10.1089/scd.2015.0262 Downregulation of the Canonical WNT Signaling Pathway by TGFb1 Inhibits Photoreceptor Differentiation of Adult Human Mu¨ller Glia with Stem Cell Characteristics Angshumonik Angbohang,1,* Na Wu,1,2,* Thalis Charalambous,1 Karen Eastlake,1 Yuan Lei,2 Yung Su Kim,1 Xinghuai H. Sun,2 and G. Astrid Limb3 Mu¨ller glia are responsible for the retina regeneration observed in zebrafish. Although the human retina harbors Mu¨ller glia with stem cell characteristics, there is no evidence that they regenerate the retina after disease or injury. Transforming growth factor-b (TGFb) and Wnt signaling regulate retinal neurogenesis and inflammation, but their roles in the neural differentiation of human Mu¨ller stem cells (hMSC) are not known. We examined hMSC lines in vitro for the expression of various Wnt signaling components and for their modulation by TGFb1, as well as the effect of this cytokine on the photoreceptor differentiation of these cells. Culture of hMSC with a combination of factors that induce photoreceptor differentiation of hMSC (FGF2, taurine, retinoic acid, and insulin-like growth factor type1; FTRI), markedly upregulated the expression of components of the canonical Wnt signaling pathway, including WNT2B, DKK1, and active b-CATENIN. Although FTRI did not modify mRNA expression of WNT5B, a component of the noncanonical/planar cell polarity Wnt pathway, it upregulated its secretion. Furthermore, TGFb1 not only decreased WNT2B expression, but also inhibited FTRI-induced photoreceptor differentiation of hMSC, as determined by expression of the photoreceptor markers NR2E3, RHODOPSIN, and RECOVERIN. Inhibition of TGFb1 signaling by an ALK5 inhibitor prevented TGFb1-induced changes in the expression of the two Wnt ligands examined. More importantly, inhibition of the canonical WNT signaling by XAV-939 prevented FTRI-induced photoreceptor dif- ferentiation. These observations suggest that TGFb may play a key role in preventing neural differentiation of hMSC and may constitute a potential target for induction of endogenous regeneration of the human retina. Introduction lead to blindness, including inflammatory, proangiogenic, and dystrophic retinal diseases, have been associated with he spontaneous retinal regeneration observed in abnormal proliferation of Mu¨ller glia that does not lead to Tzebrafish has been ascribed to the ability of a population repair, but to the formation of glial scarring [6]. Many of of Mu¨ller glia to dedifferentiate and become progenitors that these conditions are also accompanied by local increased give rise to retinal neurons [1]. Although Mu¨ller glia dedif- production of proinflammatory cytokines, such as trans- ferentiation into retinal progenitors has not been demon- forming growth factor-b (TGFb) [7–9], which may poten- strated in vivo in the human eye, a population of Mu¨ller glia tially modify the neural progenicity of hMSC. able to proliferate indefinitely in vitro has been identified [2]. TGFb signaling mediated through Smad 2/3, which is Unlike their inability to regenerate the human retina, when controlled by transcriptional corepressors such as Tgif1 and cultured with selective growth and differentiation factors Six3b, has been demonstrated to regulate Mu¨ller glia-derived these cells can be induced to acquire characteristics of retinal photoreceptor regeneration in the adult zebrafish [10]. In neurons, for which they have been termed human Mu¨ller addition, signaling by the TGFb superfamily (including stem cells (hMSC) [2–5]. The reasons why Mu¨ller glia do not TGFb1, TGFb2, TGFb3, and bone morphogenic proteins) regenerate the adult human retina are not known, but it is regulates mammalian cell proliferation, differentiation, mi- possible that factors produced in adult life or during degen- gration, and apoptosis during embryogenesis [11]. During erative diseases may prevent these cells from exerting these early development, TGFb has been shown to synergize or functions in vivo. Most retinal degenerative conditions that antagonize with Wnt proteins, a family of highly conserved 1Division of Ocular Biology and Therapeutics, UCL Institute of Ophthalmology, London, United Kingdom. 2Department of Ophthalmology and Visual Science, Eye & ENT Hospital, Shanghai Medical College, Fudan University, Shanghai, China. 3NIHR Biomedical Research Centre for Ophthalmology at Moorfields Eye Hospital and UCL Institute of Ophthalmology, London, United Kingdom. *These authors contributed equally to the work. Ó Angshumonik Angbohang, et al., 2015; Published by Mary Ann Liebert, Inc. This Open Access article is distributed under the terms of the Creative Commons License (http://creativecommons.org/licenses/by/4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly credited. 1 2 ANGBOHANG ET AL. secreted signaling molecules that regulate cell-to-cell inter- effect of this cytokine on the expression of the DKK1 and actions [12–14]. Wnt signaling is a major regulator of neu- WNT2B and WNT5B ligands, previously shown to be ex- rogenesis in the adult hippocampus [15], and it has been pressed by mammalian Mu¨ller glial cells [19], as well as on suggested that the pathways initiated by various Wnt ligands the phosphorylation of b-catenin in cells undergoing photo- may depend on the receptors expressed by a given target cell receptor differentiation. In this study, we demonstrate that [16]. Activation of the canonical Wnt signaling by TGFb has TGFb1 downregulates the expression of the canonical Wnt been shown to mediate fibrosis [17], and cooperation between signaling ligand WNT2B and increases the phosphorylation TGFb and Wnt signaling pathways are known to play a role in of b-catenin, while upregulating the expression of the non- controlling developmental events such as the regulation of canonical Wnt ligand WNT5B in hMSC. Interestingly, osteoblast differentiation of human mesenchymal stem cells TGFb1 inhibits photoreceptor differentiation of hMSC in [18]. In addition, it has been shown that Wnt signaling is vitro, an event shown to be mediated by activation of the activated during retina degeneration and that Wnt activation canonical Wnt signaling pathway. protects retinal cells from oxidative stress. From these ob- servations it is suggested that Wnt activation by growth fac- Materials and Methods tors may increase the threshold for apoptosis and prevent Human Mu¨ller stem cell culture further photoreceptor degeneration [19]. Although interaction of these signaling pathways in fish Human Mu¨ller stem cell lines (hMSC) developed in our and amphibians as well as small mammals during devel- laboratory were cultured as previously described [2]. Briefly, opment and adult regeneration are documented [20], there is cells were grown in Dulbecco’s modified Eagle’s medium no knowledge of the role of these factors in the regulation of (DMEM) (Gibco-BRL) containing 10% fetal calf serum neural differentiation of hMSC in the adult human eye. On (FCS) and 1% Penicillin/Streptomycin mix. Three different this basis, we investigated the role of TGFb1 on the regulation hMSC, named MIO-M1, MIO-M7, and MIO-M8, from pas- of the WNT signaling pathway in hMSC by examining the sages 7 to 33 were used for the experiments. To assess the Table 1. Primer Sequences Used for RT-PCR to Assess Gene Expression of Components of the Wnt Signaling Pathway and Photoreceptor Differentiation Markers in hMSC Gene Accession No. Sequence Tm(°C) Product size(bp) b-ACTIN NM_001101 (F) CATGTACGTTGCTATCCAGGC