Proc. Natl. Acad. Sci. USA Vol. 88, pp. 8944-8948, October 1991 Genetics X/Y translocations resulting from recombination between homologous sequences on Xp and Yq PAULINE H. YEN*t, SIAO-PING TSAI*t, SHARON L. WENGERf, MARK W. STEELEt, THULUVANCHERI K. MOHANDASt, AND LARRY J. SHAPIRO*t§ *Howard Hughes Medical Institute, and Departments of tPediatrics and §Biological Chemistry, University of California, Los Angeles, School of Medicine, Harbor-University of California, Los Angeles, Medical Center, Torrance, CA 90509; and tDivision of Medical Genetics, Children's Hospital of Pittsburgh, PA 15213 Communicated by Elizabeth F. Neufeld, July 17, 1991

ABSTRACT Several regions of sequence homology be- tric inversion of the Y chromosome during primate evolution tween the human X and Y chromosomes have been identified. (11). These segments are thought to represent areas of these chro- X/Y translocations occur rarely in the human population mosomes that have engaged in ineiotic recombination in rela- and some 50 cases have been reported (16-21). The majority tively recent evolutionary times. Normally, the X and Y of these-translocations have breakpoints at Xp22 and Yq11 chromosomes pair during mdosis and exchange DNA only when analyzed cytogenetically. The reciprocal products of within the pseudoautosomal region at the distal short arms of the translocations have never been recovered. Some ofthese both chromosomes. However, it has been suggested that aber- translocations are sporadic events, whereas others are inher- rant recombination involving other segments ofhigh homology ited. All females with Xp22;Yqll translocations have been could be responsible for the production of X/Y translocations. phenotypically normal except for short stature. All males We have studied four X/Y translocation patients using mo- carrying such translocations have an additional intact Y lecular probes detecting homologous sequences on X and Y chromosome. Although some of these males appear to have chromosomes. In one translocation the breakpoints have been a normal phenotype, others have various abnormalities. They isolated and sequenced. The mapping data are consistent with are usually short and, depending on the breakpoints on the X the hypothesis that X/Y translocations arise by homologous chromosome, some have mental retardation, ichthyosis, and recombination. The sequencing data from one translocation other phenotypic anomalies. Because of extensive sequence demonstrate this directly. similarities between Xp22 and Yq1l, homologous recombi- nation between these sequences has been suggested as the The mammalian sex chromosomes are thought to have etiology ofX/Y translocations (19). In this report we present evolved from an ancestral homologous chromosome pair (1). our studies on four X/Y translocations using probes from Although sequences have been deleted, inserted, or rear- Xp22.3 that detect homologous sequences on Yql1. In one ranged on the sex chromosomes over time to accommodate translocation the translocation junction was isolated and their now specialized functions, significant sequence simi- sequenced,¶ and the data showed that this X/Y translocation larities remain between the present-day X and Y chromo- was the result of a precise homologous recombination be- somes. Sequences in the pseudoautosomal region at the tween the X and the Y sequences. terminal portions of the short arms of the sex chromosomes are identical and, during male meiosis, there is a single and MATERIALS AND METHODS obligatory X-Y crossover within this region (2). Occasionally the X-Y interchange occurs outside the pseudoautosomal Patient RP and Cell Lines. Patient RP has a 46,Y,t(X;Y) region and the testis-determining factor (TDF) gene is trans- (p22.3;q11.2) karyotype. He inherited the translocation chro- ferred to the X chromosome resulting in an XX male phe- mosome from his mother. Both RP and his mother are Xga notype (3, 4). Outside the pseudoautosomal region, homol- negative whereas both maternal grandparents are Xga posi- ogous sequences have been found on the long arm of the X tive and have normal karyotypes, suggesting that the X/Y chromosome and the short arm or the proximal long arm of translocation occurred in the maternal grandfather. At birth, the Y chromosome. These regions share >95% similarity as RP had a depressed nasal bridge, anteverted nares, and detected by probes DXYS1, DXYS61, and others (5-10). bilateral simian creases. At 13 months of age, he had severe Because some of these sequences are found only on the X developmental delay, seizures, and ichthyosis. A lympho- chromosome of great apes, they are thought to have been blastoid cell line was established from RP. CF94 (22), CF108 generated by transposition of sequences from the X chromo- (23), and CF109 (24) contain three previously reported X/Y some to the Y chromosome after the divergence of humans translocation chromosomes in which the breakpoints are from great apes; however, recent loss of the Y homologs in cytogenetically indistinguishable from that in RP. These great apes is also a possible explanation. In addition, several translocated chromosomes have been segregated from the loci in the Xpter-Xp22 region were found to share 85-95% normal Y chromosome in somatic cell hybrids by fusion of similarity with sequences in Yqll or the pericentric region of the patients' fibroblasts with HPRT- A9 cells. Our previous the Y chromosome. These include the genes for steroid studies have shown that CF108 retains the functional STS sulfatase (STS; refs. 11 and 12), the tooth enamel protein locus on the X chromosome, whereas CF94, CF109, and RP amelogenin (AMG; ref. 13), and several loci defined by have deleted the X chromosome-linked STS gene (25-27). anonymous DNA fragments (14, 15). The homology shared DNA Probes. Probes used to define the breakpoints in these by the short arm of the X chromosome and the long arm of X/Y translocations come from the distal short arm of the the Y chromosome has been cited as evidence for a pericen- human X chromosome. M1A (15), CS17D, CS21B, and CS19AB (27) are from the DXS31, S232A, S232B, and S232C The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked "advertisement" IThe sequences reported in this paper have been deposited in the in accordance with 18 U.S.C. §1734 solely to indicate this fact. GenBank data base (accession nos. M76716 and M76717).

8944 Downloaded by guest on October 2, 2021 Genetics: Yen et al. Proc. Natl. Acad. Sci. USA 88 (1991) 8945

loci on the X chromosome, respectively. CS12C is from the X 't GOa QO S232E locus on the Y chromosome (27). Probe pSTS118A is X x >- L LL L co x xx m o m from the seventh intron ofthe STS gene (11). All ofthe above probes detect homologous sequences on the X and the Y chromosomes. Probe dic56 from the DXS143 locus is X In a mouse chromosome-specific (28). addition, AMG cDNA STS clone pGEM17-2 (29) was used that detects the AMG locus in the Xp22.1-p22.3 region and the AMGL locus in the pericentric region of the Y chromosome (13). General Procedures. Isolation of genomic DNA from cul-

tured cells, restriction endonuclease digestion, Southern blot X - _ analysis, and isolation of phage and plasmid DNA were carried out according to standard procedures (30). DNA 12C-X sequences were determined using the dideoxynucleotide chain-termination method (31). Cloning the Translocation Breakpoint in Patient RP. Probe CS19AB (S232C) detects an altered 13-kilobase (kb) EcoRI S232sY2x- AMO& w genomic fragment containing the translocation breakpoint in VW RP. DNA from the lymphoblastoid cell line derived from RP k,- was digested with EcoRI and size-fractionated by sucrose- Y--20 gradient centrifugation. Fractions containing 13- to 20-kb S232C 3 fragments were pooled and were ligated to the arms of X- .- -1 EMBL4, packaged in vitro, and used to transfect Escherichia coli. The library constructed was screened with labeled FIG. 1. Southern blot analysis of the breakpoints in the X/Y CS19AB using standard procedures (30). translocation chromosomes. Genomic DNA was isolated from fibro- blasts of a female with four X chromosomes (XXXX), a normal RESULTS female (XX), a normal male (XY), a lymphoblastoid cell line of patient RP with X/Y translocation, mouse-human hybrid cell lines Molecular Studies of the Breakpoints in X/Y Transloca- containing unrelated X/Y translocation chromosomes (CF94, tions. We have studied translocation breakpoints on the X CF109, and CF108), and mouse cell line B82. The DNA was digested and Y chromosomes in four X/Y translocations. Three ofthe with EcoRI and analyzed on Southern blots with probes detecting translocation chromosomes have been isolated in mouse- homologous sequences on the X and the Y chromosomes as indi- human hybrids CF94, CF108, and CF109 (25). The fourth one cated. A probe from the S232C locus detects an altered fragment in RP. was initially studied in a lymphoblastoid cell line established from a male patient, RP. This translocation chromosome was X/Y translocation from RP. The results are summarized in subsequently separated from the normal Y chromosome in a Table 1. In addition to mouse-human hybrid clone CF158. Cytogenetically, all these the previously mapped translocation translocations have breakpoints at and These breakpoints on the X chromosome in CF94 and RP, the X Xp22.3 Yqll.2. chromosome in CF108 and are now breakpoints were further studied using probes that detect breakpoints CF109 homologous sequences on the distal short arm of the X mapped to the interval between DXS31 and S232A and chromosome and the proximal long arm of the Y chromo- between S232C and DXS143, respectively. The order ofthese some. Long-range restriction mapping of the area immedi- loci on the Y chromosome has not been previously deter- ately proximal to the pseudoautosomal region on the X mined. By assuming that the X/Y translocations studied here chromosome has established the following order of loci, as are simple and do not involve complex rearrangements ofthe Xpter-DXS31-S232A-STS-12CX-S232B-S232C-DXS143, with DXS31 and DXS143 at -5 and 410 megabases from the Table 1. Characterization of the breakpoints in Xp telomere, respectively (27, 32-34). Our previous studies X/Y translocations on some of these X/Y translocations have localized the X Probe Chromosome Locus RP CF94 CF109 CF108 chromosome breakpoints in CF94, CF108, and RP to be MIA X DXS31 between S232C and DXS143, distal to S232A, and within the Y DYS22 + + + + S232C locus, respectively (27). CF109 has been shown to lack CS17D X S232A - -- + STS activity (25), suggesting that its X chromosome break- Y S232AY + + + + point is proximal to the STS locus. Most of the probes from pSTS118A X STS -- - + the above loci detect homologous sequences on Yq, except Y STSP + + + + dic56 from the DXS143 locus, which is X chromosome- CS12C X 12CX - - - + specific (28). In addition, a mouse AMG cDNA pGEM17-2 Y S232E + + + - (29) was used that detects the more proximal AMG locus in CS21B X S232B - -- + the Xp22.1-p22.3 region and the AMGL locus in the peri- Y S232D + + + - centric region of the Y chromosome (13). CS19AB X S232C + - - + The presence ofX and Y homologous sequences in the four Y S232CY + + + - X/Y translocation chromosomes was determined using the dic56 X DXS143 + + + + various probes and some of the results are shown in Fig. 1. pGEM17-2 X AMG + + + + The X chromosome fragments show a dosage increase with Y AMGL - - - - the number ofX chromosomes present in the genomic DNAs, All and the Y fragments are identified their absence in female probes except dic56 detect homologous sequences on Xp22- by Xpter and Yqll. The presence (+) or absence (-) of the X or Y samples. Because the RP lymphoblastoid cell line contains a chromosome sequences on the translocation chromosomes in the normal Y chromosome in addition to the X/Y translocation, various cell lines (RP, CF94, CF108, and CF109) was determined by the presence of the Y sequences on the translocated Y was Southern blot analysis shown in Fig. 1. Probe CS19AB detects an determined by dosage comparison with a normal male and altered fragment (+) in RP. The loci are designated as described (ref. later confirmed by using clone CF158 containing only the 35; see also refs. 36 and 37) except for the S232 loci (27). Downloaded by guest on October 2, 2021 8946 Genetics: Yen et al. Proc. Natl. Acad. Sci. USA 88 (1991) chromosomes, they can be used to derive the following order tion fragments ofCS19A and JRP1 showed that they share >8 for the various Y loci as Yq-DYS22, S232AY, STSP-S232E, kb of sequence homology indicated by the shaded area in the S232D-S232CY-Ycen. The relative orders of DYS22, figure (data not shown). Several restriction sites within the S232AY, and STSP and of S232E and S232D cannot be common areas are conserved. Comparison of the restriction determined at the present time. Their relative position may be maps of CS19A, JRP1, and JRP3 suggested that the altered the same as that of their X chromosome homologs. It is also fragment in RP is the product of precise homologous recom- noted that the X/Y translocation chromosomes in RP, CF94, bination between X and Y chromosome fragments. This was and CF109 contain either the X chromosome sequences or confirmed by DNA sequencing. About 1200 bases of DNA the Y chromosome sequences, but not both; whereas in sequence around the breakpoints was determined and 47 CF108 both X and Y chromosome sequences detected by mismatches were identified indicating that the X and Y probes from the S232A and STS loci are present. Probe chromosomes share 96% similarity in this region. The cross- CS19AB from the S232C locus detects an altered restriction over between X and Y chromosomes leading to the X/Y fragment in RP (Fig. 1). Instead of an 11-kb EcoRI fragment translocation in RP occurred within a 63-base stretch of as seen with a normal X chromosome, RP has a 13-kb complete identity (Fig. 2B). fragment in addition to the 20-kb fragment characteristic of the normal Y chromosome. The 13-kb fragment is more likely to contain the junction of the translocation rather than a DISCUSSION restriction fragment length polymorphism as it was observed Ourdata show that the X/Y translocation in RP was the result only in RP but not in 30 other males studied. This altered of a recombination event between homologous sequences in fragment was, therefore, cloned and characterized. Xp22 and Yqll. The translocations in CF94 and CF109 are Cloning the Translocation Breakpoints in RP. DNA isolated likely to have been generated by the same mechanism. A from the lymphoblastoid cell line of RP was digested with simple model is, therefore, proposed in which the six loci on EcoRI and cloned in the A phage vector EMBL4. The library Xp22.3 that we have studied and their homologous sequences was screened with probe CS19AB (S232C), which detected on Yq have the same linear order, with the DXS31 locus and the translocation junction fragment. Two clones were iso- its Y chromosome homolog (DYS22) at the distal end and the lated: clone JRP1 contains the 20-kb Y chromosome fragment S232C locus and its Y chromosome homolog (S232CY) at the and clone JRP3 contains the 13-kb altered fragment. An proximal end (Fig. 3). This would be expected if there has additional clone JRP4 was isolated from a normal human been a pericentric inversion during the evolution of the Y genomic library screened with the same probe. Restriction chromosome. However, the relative order of some of the Y maps of these clones were constructed and compared with a loci has not been established and no long-range restriction previously isolated clone CS19A containing the normal 11-kb map of Yqll is yet available. Recombination between these X chromosome fragment (Fig. 2A). JRP4 overlaps the left half homologous sequences should result in a translocated chro- of JRP1 where restriction maps of the two are identical (data mosome that retains either the X chromosome homolog or not shown), confirming that JRP1 is derived from the normal the Y chromosome homolog, but not both. This is what we Y chromosome in RP. Cross hybridization between restric- have observed in the translocation chromosomes in RP, A Probe

.-4 044 0.4 R N N H SR I a 1KB .--- CS19A (X) I Al.

...,...---...... S R N SS N f NN NN HNS HH R JRP1 (Y) I I II I I II I I p m pp p m pp p p

R N SSN N H SR JRP3 (X/Y) I I sEN* p B * * ~~~~~~~~~~... * CGATTCTTTTAGTTCCTCTGTACCGGTGTGCAGAGGTGCATAAGCAAGGCCCCTTTTGCTCAGAATTATTTAGTCTATGATTAGTTATTTA Y *******.*****.*************.*********************************,**************************** *** CGATTCTTTTAGTTCCTCTGTACCGGTGTGCAGAGGTGCATAAGCAAGGCCCCTTTTGCTCAGAATTATTTAGTCTATGATTAGTTACTTA X/VA/ ***.************.***************** **************************** X CAATTCTTTTAGTTCCTCTGTACTGGTGTGCAGAGGTGCATAAGCAAGGCCCCT TTrTGCTCAGAATTATTTAGTCTATGATTAGTTACTTA

FIG. 2. Characterization of the junction fragment of the X/Y translocation chromosome in patient RP. (A) Restriction maps of thejunction fragment (JPR3) and the corresponding fragments on the X chromosome (CS19A) and the Y chromosome (JRP1). The X and Y chromosome sequences are indicated with a solid bar and an open bar, respectively. H, HindIII; M, BamHI; N, Xmn I; P, Pst I; R, EcoRI; and S, Sst I. The shaded area between the maps ofCS19A and JRP1 indicates a region ofhigh homology as determined by two-dimensional blot hybridization (11). The presumed site of crossover between CS19A and JRP1 in RP is indicated with a vertical double-headed arrow. A BamHI fragment of CS19A, CS19AB, that detected an altered fragment in RP and was later used to isolate JRP1 and JRP3 is indicated above the map of CS19A. Horizontal arrows above the maps indicate sequencing strategy to identify the translocation breakpoints. (B) DNA sequences at the junction ofthe X/Y translocation and the corresponding regions on the X and the Y chromosomes. Arrows above the sequences indicate positions where the X and Y chromosome sequences differ. A crossover between the X and Y chromosome has occurred within a 63-base stretch of complete identity. Downloaded by guest on October 2, 2021 Genetics: Yen et al. Proc. Natl. Acad. Sci. USA 88 (1991) 8947

Xp Yq CRI-S232, which appears to promote recombination (27). telomere telomere Recombination between two S232-like sequences flanking hetero- the STS locus has been shown to be responsible for the high au~ogooa.useudo- chromatin deletion frequency in this region. In three cases where the junction fragments have been cloned and characterized, the breakpoints have been shown to be near if not within the DXS31 { DYS22 variable-number tandem repeat sequences in the S232-like S232A sequences (43). Even though the X chromosome breakpoint CFIO8 S232AY STS - in the X/Y translocation chromosome in RP is only 3 kb from STSP an S232-like sequence, no S232-like sequences have been 12CX - S232E3 found within 8 kb of the breakpoint on the Y chromosome. It S2328 - -S232DJ is unlikely that the translocation in RP is promoted by RP S232-like sequences. S232C - - S232CY Chromosome translocations associated with human neo- DXS143 - plasia have been studied extensively (44, 45) and molecular CF94, CF109 characterization of the translocation junctions has yielded AMG A F AMGL insight into the pathogenesis of these tumors. It is generally believed that such somatic chromosomal translocations alter I the regulation or the structure of cellular protooncogenes conferring growth advantage to the cells, thus leading to FIG. 3. Schematic presentation of X/Y translocations generated malignancy. Chromosome translocations in lymphoid tumors by recombination between Xp and Yq. The distal short arm of the X often involve the immunoglobulin genes and the T-cell re- chromosome (Xp22-Xpter) and the proximal long arm of the Y ceptor genes. It has been suggested that the recombinases chromosome (Yqll) are shown. The distances between the various that carry out the variable-diversity-joining region joining of loci do not represent the actual distances. The relative order of the the immunoglobulin genes and T-cell receptor genes may Y loci within the brackets is unknown and is assumed to be the same promote these translocations. The mechanisms that generate as their homologs on the X chromosome. Arrows between the chromosomes indicate the positions where recombination between other translocations not involving immunoglobulin and T-cell the X and Y chromosomes occurred to generate the various trans- receptor genes are largely unknown, although the involve- location chromosomes. ment ofAlu sequence has been implied in the formation ofthe Philadelphia chromosome (46, 47). CF94, and CF109. Similar results have been reported by Only a few constitutional (germ line) chromosome trans- Ballabio et al. (19) who studied seven X/Y translocations locations have been characterized at the molecular level. with breakpoints at Xp22.3 and Yqll, including one used in These translocations have facilitated the mapping and cloning this study (CF109). They used probes from the STS and of the Duchenne muscular dystrophy locus on the X chro- DXS31 loci and found that all seven translocations lacked the mosome (48), the putative testis-determining gene SR Yon the X chromosome-specific fragments while retaining the Y Y chromosome (49), an aniridia locus on chromosome 11 chromosome-specific fragments detected by these probes. (50), and the neurofibromatosis type 1 locus on chromosome Probes GMGXY3 and GMGXY19 used in their studies were 17 (51, 52). However, the mechanisms generating these found recently to be included in a yeast artificial chromosome translocations are largely unknown and in only a few cases is clone containing the entire STS gene and an additional 200kb the nucleotide sequence information of the translocation 5' (distal) to the STS gene (54). Therefore, it appears that the junctions available. One involves the translocation of rRNA majority of X/Y translocations with breakpoints in Xp22.3 genes on chromosome 21 to the short arm of the X chromo- some interrupting the Duchenne and Yql1 are generated by aberrant homologous recombi- muscular dystrophy locus nation. Since the translocation chromosome in (48). This translocation is reciprocal but a small amount of CF108 retains DNA is missing. There is no significant homology between both homologs of S232A and STS, it is likely to have been the two chromosomes around the breakpoints that would generated by a crossover involving sequences between the have facilitated the translocation, although a tetranucleotide DXS31 and S232A loci on the X chromosome and sequences CGGC sequence has been suggested to be involved. Another between the STS pseudogene (STSP) and the S232E locus on case involves an XX male in which the terminal short arm of the Y chromosome. This could have been promoted by the Y chromosome was translocated to the X chromosome by low-copy repetitive sequences, which are known to be com- homologous recombination between two Alu elements in mon in this region of the X chromosome (38-40). However, otherwise nonhomologous regions of X and Y chromosomes we cannot rule out the possibility that there has been a more (53). The X/Y translocations described here, therefore, are complex rearrangement in this case. In addition there are unique in that they are promoted by extensive homology X/Y translocations with breakpoints other than Xp22 and shared by the X and Y chromosomes. Yqll, although they are quite rare (20). These translocations could have been generated by homologous recombination We thank Hsiao-Fen Huang and Merry Passage for excellent between sequences shared by other regions of the X and Y technical assistance, Carey Johnson for some of the art work, and chromosomes. Nelva Hitt for help in preparing the manuscript. This work was X/Y translocations described here are likely to have been supported by funds from the Howard Hughes Medical Institute, promoted by the extensive sequence homology shared by Xp Grants HD12178 and HD15193 from the National Institutes of and Yq. During male meiosis short arms of human X and Y Health, and Grant 1-639 from the March of Dimes. chromosomes pair and a synaptonemal complex is formed (41, 42). It is possible that rarely during this process the long 1. Ohno, S. (1969) Annu. Rev. Genet. 3, 495-524. arm of the Y chromosome aberrantly pairs with homologous 2. Ellis, N. & Goodfellow, P. N. (1989) Trends Genet. 5,406-410. 3. Page, D. C., de la Chapelle, A. & Weissenbach, J. (1985) sequences on Xp, thus promoting recombination between Nature (London) 315, 224-226. these two regions. Alternatively, the X and Y may occasion- 4. Petit, C., de la Chapelle, A., Levilliers, J., Castillo, S., Noel, ally pair aberrantly as shown in Fig. 3, without simultaneous B. & Weissenbach, J. (1987) Cell 49, 595-602. pairing of the pseudoautosomal region. Recently, we have 5. Page, D. C., Harper, M. E., Love, J. & Botstein, D. (1984) studied a low-copy repetitive sequence detected by probe Nature (London) 311, 119-123. Downloaded by guest on October 2, 2021 8948 Genetics: Yen et al. Proc. Natl. Acad. Sci. USA 88 (1991)

6. Wolfe, J., Erickson, R. P., Rigby, P. W. J. & Goodfellow, Cloning:A Laboratory Manual (Cold Spring Harbor Lab., Cold P. N. (1984) EMBO J. 3, 1997-2003. Spring Harbor, NY), 2nd Ed. 7. Geldwerth, D., Bishop, C., Guellaen, G., Koenig, M., Verg- 31. Sanger, F., Nicklen, S. & Coulson, A. R. (1977) Proc. Natl. naud, G., Mandel, J.-L. & Weissenbach, J. (1985) EMBO J. 4, Acad. Sci. USA 74, 5463-5467. 1739-1743. 32. Li, X.-M., Yen, P., Mohandas, T. & Shapiro, L. J. (1990) 8. Affara, N. A., Florentin, L., Morrison, N., Kwok, K., Cook, Nucleic Acids Res. 18, 2783-2788. A., Jamieson, D., Glasgow, L., Meredith, L., Boyd, E. & 33. Ross, M. T., Ballabio, A. & Craig, I. W. (1990) Genomics 6, Ferguson-Smith, M. A. (1986) Nucleic Acids Res. 14, 5353- 528-539. 5373. 34. Petit, C., Levilliers, J. & Weissenbach, J. (1990) Proc. Natl. 9. Bickmore, W. A. & Cooke, H. J. (1987) Nucleic Acids Res. 15, Acad. Sci. USA 87, 3680-3684. 6261-6271. 35. Tenth International Workshop on Human Gene Mapping (1989) 10. Arveiler, B., Vincent, A. & Mandel, J.-L. (1989) Genomics 4, Cytogenet. Cell Genet. 51, (1-4). 460-471. 36. Mandel, J. L., Willard, H. F., Nussbaum, R. L., Romeo, G., 11. Yen, P. H., Marsh, B., Allen, E., Tsai, S.-P., Ellison, J., Puck, J. M. & Davies, K. E. (1989) Cytogenet. Cell Genet. 51, Connolly, L., Neiswanger, K. & Shapiro, L. J. (1988) Cell 55, 384-437. 1123-1135. 37. Weissenbach, J., Goodfellow, P. N. & Smith, K. D. (1989) 12. Fraser, N., Ballabio, A., Zollo, M., Persico, G. & Craig, I. Cytogenet. Cell Genet. 51, 438-449. (1987) Development 101, Suppl., 127-132. 38. Bardoni, B., Guioli, S., Raimondi, E., Heilig, R., Mandel, 13. Lau, E. C., Mohandas, T. K., Shapiro, L. J., Slavkin, H. C. & J. L., Ottolenghi, S. & Camerino, G. (1988) Genomics 3, 32-38. Snead, M. L. (1989) Genomics 4, 162-168. 39. Petit, C., Levilliers, J., Rouyer, F., Simmler, M. C., Herouin, 14. Koenig, M., Moisan, J. P., Heilig, R. & Mandel, J.-L. (1985) E. & Weissenbach, J. (1990) Genomics 6, 651-658. Nucleic Acids Res. 13, 5485-5501. 40. Knowlton, R. G., Nelson, C. A., Brown, V. A., Page, D. C. & 15. Koenig, M., Camerino, G., Heilig, R. & Mandel, J.-L. (1984) Donis-Keller, H. (1989) Nucleic Acids Res. 17, 423-437. Nucleic Acids Res. 12, 4097-4109. 41. Moses, M. J., Counce, S. J. & Paulson, D. F. (1975) Science 16. Bernstein, R. (1985) The Y Chromosome, Part B: Clinical 187, 363-365. Aspects of Y Chromosome Abnormalities (Liss, New York), 42. Chandley, A. C., Goetz, P., Hargreave, T. B., Joseph, A. M. pp. 171-206. & Speed, R. M. (1984) Cytogenet. Cell Genet. 38, 241-274. 17. Johnston, K., Schonberg, S., Littman, V., Gregory, T., 43. Johnson, C. L., Li, X.-M., Yen, P. H. & Shapiro, L. J. (1990) Gelbart, S., O'Donnell, J. & Cox, D. R. (1987) Am. J. Med. Am. J. Hum. Genet. 47, A222 (abstr.). Genet. 27, 603-611. 44. Croce, C. M. (1987) Cell 49, 155-156. 18. Agematsu, K., Koike, K., Morosawa, H., Nakahori, Y., 45. Rabbitts, T. H., Boehm, T. & Mengle-Gaw, L. (1988) Trends Nakagome, Y. & Akabane, T. (1988) Hum. Genet. 80, 105-107. Genet. 4, 300-304. 19. Ballabio, A., Carrozzo, R., Gil, A., Gillard, B., Affara, N., 46. Rodgers, J. (1985) Nature (London) 317, 559. Ferguson-Smith, M. A., Fraser, N., Craig, I., Rocchi, M., 47. Chen, S. J., Chen, Z., Font, M.-P., d'Auriol, L., Larsen, C.-J. Romeo, G. & Angria, G. (1989) Ann. Hum. Genet. 53, 9-14. & Berger, R. (1989) Nucleic Acids Res. 17, 7631-7642. 20. Cameron, I. T., Buckton, K. E. & Baird, D. T. (1984) Hum. 48. Bodrug, S. E., Ray, P. N., Gonzalez, I. L., Schmickel, R. D., Genet. 67, 457-459. Sylvester, J. E. & Worton, R. G. (1987) Science 237, 1620- 21. Bernstein, R., Rosendorff, J., Ramsay, M., Pinto, M. R. & 1624. Page, D. C. (1987) Am. J. Hum. Genet. 41, 145-156. 49. Sinclair, A. H., Berta, P., Palmer, M. S., Hawkins, J. R., 22. Allderdice, P. W., Aveling, J. V. & Eales, B. A. (1983) Am. J. Griffiths, B. L., Smith, M. J., Foster, J. W., Frischauf, A.-M., Hum. Genet. 35, 124 (abstr.). Lovell-Badge, R. & Goodfellow, P. N. (1990) Nature (London) 23. Speevak, M., Clifford, B., Cox, D. M. & Hunter, A. G. W. 346, 240-244. (1985) Clin. Genet. 27, 595-599. 50. Gessler, M., Simola, K. 0. J. & Bruns, G. A. P. (1989) Science 24. Ferguson-Smith, M. A., Sanger, R., Aitken, D. A. & Boyd, E. 244, 1575-1578. (1982) Cytogenet. Cell Genet. 32, 273-274. 51. Viskochil, D., Buchberg, A. M., Xu, G., Cawthon, R. M., 25. Geller, R. L., Shapiro, L. J. & Mohandas, T. K. (1986) Am. J. Stevens, J., Wolff, R. K., Culver, M., Carey, J. C., Copeland, Hum. Genet. 38, 884-890. N. G., Jenkins, N. A., White, R. & O'Connell, P. (1990) Cell 26. Yen, P. H., Allen, E., Marsh, B., Mohandas, T., Wang, N., 62, 187-192. Taggart, R. T. & Shapiro, L. J. (1987) Cell 49, 443-454. 52. Wallace, M. R., Marchuk, D. A., Andersen, L. B., Letcher, 27. Yen, P. H., Li, X.-M., Tsai, S.-P., Johnson, C., Mohandas, T. R., Odeh, H. M., Saulino, A. M., Fountain, J. W., Brereton, & Shapiro, L. J. (1990) Cell 61, 603-610. A., Nicholson, J., Mitchell, A. L., Brownstein, B. H. & Col- 28. Middlesworth, W., Bertelson, C. & Kunkel, L. M. (1985) lins, F. S. (1990) Science 249, 181-186. Nucleic Acids Res. 13, 5723. 53. Rouyer, F., Simmler, M.-C., Page, D. C. & Weissenbach, J. 29. Snead, M. L., Zeichner-David, M., Chandra, T., Robson, (1987) Cell 51, 417-425. K. J. H., Woo, S. L. C. & Slavkin, H. C. (1983) Proc. NatI. 54. Carrozzo, R., Ellison, J., Yen, P., Taillon-Miller, P., Brown- Acad. Sci. USA 80, 7254-7258. stein, B. H., Persico, G., Ballabio, A. & Shapiro, L. Genomics, 30. Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989) Molecular in press. Downloaded by guest on October 2, 2021