Volume 33, Issue 3, September 2017 ISSN 0204-8809

AACTACTA MMICROBIOLOGICAICROBIOLOGICA BBULGARICAULGARICA Bulgarian Society for Microbiology Union of ScienƟ sts in Bulgaria Acta Microbiologica Bulgarica

The journal publishes editorials, original research works, research reports, reviews, short communications, letters to the editor, historical notes, etc from all areas of microbiology

An Offi cial Publication of the Bulgarian Society for Microbiology (Union of Scientists in Bulgaria)

Volume 33 / 3 (2017)

Editor-in-Chief Angel S. Galabov

Press Product Line Sofi a Editor-in-Chief Angel S. Galabov

Editors Maria Angelova Hristo Najdenski

Editorial Board S. Aydemir, Izmir, Turkey L. Boyanova, Sofi a E. Carniel, Paris, France M. Da Costa, Coimbra, Portugal E. DeClercq, Leuven, Belgium F. Delpeyroux, Paris, France S. Denev, Stara Zagora D. Fuchs, Innsbruck, Austria S. Groudev, Sofi a I. Iliev, Plovdiv A. Ionescu, Bucharest, Romania L. Ivanova, Varna V. Ivanova, Plovdiv I. Mitov, Sofi a I. Mokrousov, Saint-Petersburg, Russia P. Moncheva, Sofi a M. Murdjeva, Plovdiv A. Netrusov, Moscow, Russia R. Peshev, Sofi a M. Petrovska, Skopje, FYROM J. C. Piffaretti, Massagno, Switzerland S. Radulovic, Belgrade, Serbia I. Ranin, Belgrade, Serbia P. Raspor, Ljubljana, Slovenia B. Riteau, Marseille, France J. Rommelaere, Heidelberg, Germany G. Satchanska, Sofi a E. Savov, Sofi a A. Stoev, Kostinbrod S. Stoitsova, Sofi a T. Tcherveniakova, Sofi a E. Tramontano, Cagliari, Italy A. Tsakris, Athens, Greece F. Wild, Lyon, France Volume 33, Issue 3, AACTACTA MICROBIOLOGICAMICROBIOLOGICA BULGARICABULGARICA September 2017

CONTENTS

Review Article

Tannins as Natural Helpers in Reinforcement of Human Health ...... 105 Neli Vilhelmova-Ilieva, Angel S. Galabov Regular Papers An update on Brucellosis: Endemic and Potential Global Re-emerging Zoonotic and Foodborne Disease ...... 111 Vaso Taleski, Milka Zdravkovska, Liljana Simjanovska, Marija Darkovska Serafi movska

Propolis Use and Helicobacter pylori: two case reports ...... 115 Lyudmila Boyanova, Rossen Nikolov, Rumyana Markovska, Daniel Yordanov, Ivan Mitov

Microalgae Flat Plate-Photobioreactor (FP-PBR) System Development: Computational Tools to Improve Experimental Results ...... 119 Camila Hinterholz, Adilson Schuelter, Aparecido Módenes, Daniela Trigueros, Carlos Borba, Fernando Espinoza-Quiñones, Alexander Kroumov

Therapeutic Alternatives to Antibiotic Administration in Veterinary Medicine ...... 125 Constantin Chiurciu, Viorica Chiurciu, Mihai Danes, Costin Stoica, Gabriel Oltean, Bogdan Frunzareanu, Dana Banciu, Elena Lupu, Cristian Uluitu, Diana Oprisiu, Petre Stefan, Irina Ionescu, Valentina Filip, Catalin Tudoran, Ion Nicolae, Lucia Diaconu, Silvia Stanculescu, Alina Radu, Paul Chitonu

Investigation into the Antimicrobial Activities of Tincture Prepared from Twenty Six Plants Growing in Macedonia ...... 131 Natalija Atanasova-Pancevska, Dzoko Kungulovski

Selected Lactobacillus bulgaricus and Streptococcus thermophilus Strains from Bulgarian Yogurt Demonstrate Signifi cant Anti-Infl ammatory Potential ...... 137 Irina Gotova, Zhechko Dimitrov, Hristo Najdenski

Comparison Of The Expression Levels Of Exopolysaccharide Genes in Streptococcus thermophilus LBB.T54 Grown in Semi-Defi ned Media and Milk ...... 143 Miroslava Terzieva, Zoltan Urshev

Cronicle ...... 147 AACTACTA MICROBIOLOGICAMICROBIOLOGICA BULGARICABULGARICA Volume 33 / 3 (2017)

Review Tannins as Natural Helpers in Reinforcement of Human Health Neli Vilhelmova-Ilieva*, Angel S. Galabov Department of Virology, The Stephan Angeloff Institute of Microbiology, Bulgarian Academy of Sciences, Sofi a, Bulgaria

Abstract Since ancient times, folk medicine has used the potency of a wide range of plants for treatment of various diseases. In recent years, the development of technology has made it possible to identify the active ingredients determining these properties of plants. One of the largest group of substances isolated from plants are polyphenols. Tannins are a type of polyphenols that have already proven to possess different bio- logical activities important to human health, such as antioxidant, antitumoral, antimicrobial, antiviral, etc.. As an integral part of many food products, tannins are included in the daily diet of many people suffering from various diseases. Tannins can naturally enhance the body‘s ability to cope with various infections and diseases, improving the immune response and also having a positive effect on patients with heart disease and high blood pressure, which makes them promising therapeutic agents. All of the activities described above allow tannins to be considered as promising therapeutic agents. Keywords: tannins, ellagitannins, plant substances, biological activities, antiviral effects, therapeutic agents

Резюме От древни времена народната медицина използва ефективността на голям асортимент от рас- тения за лечение на различни заболявания. През последните години развитието на технологиите направи възможно идентифицирането на активните съставки, които определят тези свойства на рас- тенията. Една от най-големите групи вещества, изолирани от растения, са полифенолите. Танините са вид полифеноли, вече доказали различни свои биологични активности важни за човешкото здра- ве, като антиоксиданта, антитуморна, антимикробна, антивирусна и други. Като неделима част от много хранителни продукти танините са включени в ежедневната диета на много хора, страдащи от различни заболявания. Танините подобряват способността на организма да се справя с различни инфекции и заболявания, усилвайки имунния отговор. Също така те имат положителен ефект върху сърдечно-съдовите заболявания и високото кръвно налягане. Описаните активности позволяват та- нините да се смятат за обещаващи лечебни средства.

Introduction Tannins are a group of polyphenols with mo- connected by carbon-carbon bonds (Okuda et al., lecular weight ranging between 500 and 3000. They 1991). Hydrolysable tannins can be subdivided into are soluble in water and alcohols and are located in gallotannins or ellagitannins, depending on wheth- the root, bark, stem and outer layers of the plant tis- er they contain gallic or ellagic acid in their struc- sue. They form complexes with proteins, carbohy- ture. Ellagitannins are made up of two galloyl units drates, alkaloids and gelatin (Widsten et al., 2014). connected together and forming the basic structur- Tannins are divided into two groups: hydrolysable, al unit of ellagitannins – hexahydroxydifenic acid which can be hydrolyzed to glucose and gallic acid (HHDP). They are important secondary metabo- or other polyphenolic acids, and condensed tan- lites of plants because of their property to induce nins (proanthocyanidins), composed of fl avonoid resistance against microorganisms due to their abil- monomers, mostly (+) catechin or (-) epikatehin ity to bind with proteins and polysaccharides, there-

105 by blocking their growth. purpurea (foxglove), reserpine from Rauwolfi a ser- Many tannins are isolated and structurally pentina (snakeroot), aspirin from Salix alba (willow characterized from plant species used in traditional bark), tetramethylpyrazine, also known as Ligus- medicine. Grape, strawberry, cranberry, blueberry, trazine, from Jatropha podagrica, and tetrandrine pomegranate, chestnut, walnut, Brazil nut, pecan from Stephenia tetradra (Kwan, 1994; O’Kane et nut are with the highest content of tannins (Asca- al., 2003; Iwalokun et al., 2011). cio-Valdés et al., 2011). Along with other representatives of natural This group of plant products has attracted origin, certain types of tannins also show a positive the attention of an increasing number of research effect against hypertension. Castalagin, chebulinic teams due to their multifunctional properties that acid and corilagin isolated from the leaves of Lum- make them promising medicinals. nitzera racemosa are hydrolysable tannins with Antioxidant activity pronounced antihypertensive activity (Lin et al., Free radicals, which are present in the human 1993). body, are considered to be responsible for the ap- Antitumor activity pearance of more than 100 chronic disorders in hu- One of the most remarkable abilities of tan- mans, including atherosclerosis, arthritis, jaundice, nins is their activity against various tumors as cer- liver damage, central nervous system injury, gastri- vical cancer, prostate cancer, malignant cells in tis, neoplasms, etc. The reasons for their formation skin, breast, stomach, lung, esophagus, liver, etc. are different: environmental pollutants, radiation, (Barrajon-Catalan et al., 2010; Ascacio-Valdés et chemicals, toxins, fried and spicy foods and physi- al., 2011; Yildirım and Kutlu, 2015). cal stress can cause depletion of antioxidants in the Ellagitannins possess the ability to bind to immune system, changes in gene expression and proteins located on the surface of the cell membrane production of abnormal proteins. The struggle with thus preventing the proliferation of metastatic cells. degenerative diseases requires increased levels of They can induce apoptosis in tumor cells by inhibit- antioxidants in the body. Foods of plant origin usu- ing the factors responsible for the formation of me- ally contain natural antioxidants. The role of anti- tastases. Another mechanism suggests that during oxidants is to inactivate reactive oxygen species, DNA replication ellagitannins bind to carcinogens and thus slow down or prevent oxidative damage thus preventing their mutation effect (Sepúlveda et (Jain et al., 2015). al., 2011). Corilagin induces cell cycle arrest at the Tannins have the ability to prevent the forma- G2/M phase and the apoptosis in cancer cells lines tion of free radicals, as well as to reduce the dam- of ovarian cancer SKOv3ip, Hey and HO-8910PM age they cause in the cells (Yokozawa et al., 2002; (Jia et al., 2013). In literature there are many data Sepúlveda et al., 2011). This effect is stronger when on ellagitannins with antitumor activity – geraniin, tannins contain a greater number of phenolic hy- corilagin (Okabe et al., 2001), oenothein A and B, droxyl groups (Hatano et al., 1989). Products de- woodfordin C, D and F (Miyamoto et al., 1997). rived from the metabolism of tannins also possess Extracts containing tannins induce apoptotic activ- antioxidant properties (Ito, 2011). ity in cells of breast and prostate cancer (Bawadi et Antidiabetic activity al., 2005). According to the World Health Organization There is evidence that ellagitannins reduce (WHO), about 80% of the population uses herbal the negative effects of chemotherapy and mitigate medicines of traditional medicine for treatment of the effects of radiation exposure in anticancer ther- various diseases (Sani, 2015). apy (Varadkar and Dubey, 2001). Extracts from various plant species with Cell proliferation and differentiation activity proved high content of tannins show antidiabet- Geraniin and furosin isolated from Phyllan- ic activity (Rao et al., 2003; Raut and Gaikwad, thus muellerianus stimulated the proliferation and 2006). C-glycosidic ellagitannins lagerstroemin, differentiation of human keratinocytes and dermal fl osin B and reginin A from Lagerstroemia specio- fi broblasts, as well as the biosynthesis of collagen sa used for treatment of diabetes in the Philippines (Agyare et al., 2011). are activators of glucose transport (Yoshida et al., Immunomodulatory activities 2010). Ellagitannins show immunomodulatory ac- Antihypertensive activity tivities using different mechanisms as a promoter of The treatment of hypertension includes many the formation of catechin-polysaccharide complex drugs of natural origin, as digitoxin from Digitalis that is a potential immunostimulant (Monobe et al.,

106 2008); enhance the functionality of macrophag- Antiparasitic activity es (Ushio et al., 1991); for release of nitric oxide Ellagitannins manifested antiparasitic activity (NO), tumour necrosis factor (TNF) and interfer- against intracellular amastigotes of Leishmania Do- on (IFN) (Kolodziej and Kiderlen, 2005); stimulate novan (Kolodziej et al., 2001) or direct toxicity for the secretion of cytokines IL-1 , IL-2 and TNF- extracellular promastigote Leishmania donovani or by human peripheral mononuclear cells (Wang et L. major strains (Kolodziej and Kiderlen, 2005). al., 2002). It has been shown that when administered via the Enzyme inhibitory activity feed of the plants rich in tannins they inhibit the de- Representatives of this group of compounds velopment of the various stages of gastrointestinal are also effective inhibitors of certain enzymes. nematodes of ruminants (Hoste et al., 2012). Woodfruticosin (woodfordin C) has atni-topoi- Antiviral activity somerase II activity; eugenifl orin D1 and D2 iso- In recent years, antiviral activity of various lated from Eugenia unifl ora L. and oenothein B tannins has been increasingly often reported. It is effectively inhibit Epstein-Barr virus (EBV) DNA a potential inhibitor of various enveloped viruses polymerase. Enzymes 5α-reductase and aromatase due to its capability of binding with different pro- have an important role in the development of be- teins and altering their structure, thus inactivating nign prostatic hyperplasia, whose potential inhibi- them. tors are oenothein A and B isolated from Epilobium Many studies have been conducted on tannins species. against the replication of human immunodefi ciency It has been suggested that an important fac- virus (HIV) and the results of the various teams in- tor in the expression of genes, DNA replication and dicate that the targets of action of tannins in rep- differentiation of cells is the enzyme poly(ADP-ri- licative cycle of HIV are several. There is evidence bose) glicohydrolase that can be inhibited by oligo- of ellagitannins that suppressed HIV replication meric ellagitannins oenothein B and nobotanin B, E by inhibiting reverse transcriptase (Asanaka et al., and K. The enzyme α-glucosidase (maltase), pos- 1988; Notka et al., 2004). Other authors reported sibly important in the development of type-2 diabe- on ellagitannins (geranin and corilagin) that reduce tes, is inhibited by chebulagic acid (isolated from HIV replication by inhibiting the HIV-1 protease Terminalia chebula), tellimagrandin I and eugeniin and HIV-1 integrase enzyme (Notka et al., 2004), (casuarictin) (Yoshida et al.,2010). and ellagitannins isolated from Tuberaria lignosa Antimicrobial activity that inhibit the entry of HIV in MT-2 cells (Bedoya Many tannins exhibit activity against vari- et al., 2010). ous bacteria and fungi. Three galotannins: penta-, The replication of human, porcine and duck hexa-, and hepta-O-galloylglucose, isolated from infl uenza A virus in vitro is prevented by hydrolysa- mango (Mangifera indica L.), prevent the prolifer- ble tannin strictinin (Saha et al., 2010). ation of Gram-positive food spoilage bacteria, and In herpesvirus infections, chemotherapy was reduce the growth of Gram-negative Escherichia developed based on the application of nucleoside coli as the most likely inhibitory effects of these analogues that reduce the duration of symptoms hydrolyzable tannins due to their iron-complexing and lead to faster healing of the lesions. The most properties (Engels et al., 2009). Tannins isolated commonly used nucleoside is acyclovir (ACV). The from Solanum trilobatum Linn show antibacterial disadvantage of nucleoside analogues is the rela- activity against Staphylococcus аureus, Strepto- tively rapid selection of resistant mutants (Abraham coccus pyrogens, Salmonella typhi, Pseudomonas et al., 2007). Patients with compromised immune aeruginosa, Proteus vulgaris and E. coli (Doss et systems, and especially HIV- positive ones, are at al., 2009). the highest risk (Ziyaeyan et al., 2007). The growth of Е. coli, Candida albicans, Cry- Due to the frequent failure of treatment with potococcus neoformans bacteria and Aspergillus nucleoside analogues, there is a need for the devel- fumigatus fungus is affected by the action of pome- opment of new inhibitors of herpes viruses (Knick- granate, punicalagin, punicalin, gallagic and ellag- elbein et al., 2009). ic acids. Derivatives of ellagic acid demonstrated For hundreds of years, man has used nat- activity against Klebsiella pneumoniae, Bacillus ural sources for the treatment of various diseases. cereus, S. typhi and S. pyogenes (Ascacio-Valdés et Fractions and crude extracts, and isolated and pu- al., 2011). rifi ed compounds from them were tested for antivi- ral activity against many viruses, including herpes

107 (Hassan et al., 2015). A signifi cant part of these ex- Chebulagic acid and punicalagin – two hydrolysa- tracts showed remarkable anti-herpesvirus activity. ble tannins isolated from Terminalia chebula Retz. Grape, apple, strawberry juices and extract of Aza- inactivated HSV-1 entry and the cell-to-cell spread dirachta indica possess anti-HSV activities. The as their targets are HSV-1 glycoproteins (Lin et al., aqueous extract of Carissa edulis root from Kenya 2011). Hydrolyzable tannin casuarinin from Termi- shows in vitro and in vivo antiviral activity against nalia arjuna Linn prevent the attachment of HSV-2 acyclovir (ACV) sensitive and ACV resistant strain in the cell, and also violates the late stages of in- of HSV-1 and HSV-2. The extract of Ceratostigma fection (Cheng et al., 2002). Eugeniin (from Geum willmattianum demonstrates suppression of viral japonicum and Syzygium aromaticum) showed a adsorption, replication and transcription of HSV-1 signifi cant inhibitory effect on the activity of DNA and HSV-2 (Chattopadhyay et al., 2010). Essential polymerase of HSV-1 (Kurokawa et al., 1998). oils of ginger, thyme, hyssop and sandalwood ef- Our research in this area is mainly related to fectively inhibit drug-resistant clinical HSV-1 strain a substance that belongs to the group of nonahy- (Schnitzler et al., 2007). Extracts of Cardamine droxyterphenoil-bearing C-glucosidic ellagitan- angulata, Conocephalum conicum, Lysichiton nins. This substance is castalagin and is extracted americanum, Polypodium glycyrrhiza and Verbas- from powdered pedunculate oak (i.e., Quercus ro- cum thapsus exhibit antiviral activity against HSV bur). It provides an activity against the replication (Jassim and Naji, 2003), extracts of the Taiwanese of HSV-1 greater than that of acyclovir and well-de- folk remedy Boussingaultia gracilis and Serissa ja- fi ned, but relatively lower activity against HSV-2 ponica and the extract of Senna petersiana are used replication (Vilhelmova et al., 2011). Successfully for sexually transmitted diseases (Chattopadhyay et combined with acyclovir, castalagin exerts a strong al., 2010). The methanolic crude extract of Mal- synergistic effect (Vilhelmova et al., 2011). In addi- lotus peltatus possesses weak anti-HSV activity tion, castalagin shows clear activity against strains (Bag et al., 2012). Eucalyptus globulus is a tradi- of HSV-1 and HSV-2 resistant to acyclovir and its tional herb that has been used in Iran for many combination with acyclovir has a clear synergistic years. The methanolic extract of this plant inhibits effect (Vilhelmova-Ilieva et al., 2014). HSV-1 replication in cell cultures in various dilu- We have also studied the two substances ves- tions (Davood et al., 2012). Acetone, ethanol and calagin and grandinin from the same group, whose methanol extracts of Phyllanthus urinaria inhibit activity is not as as strong as that of castalagin, but HSV-2 infection in vitro (Yang et al., 2005). An ex- is signifi cant and selective. They also demonstrate tract of Ribes nigrum L., known as blackcurrant in a synergistic effect when combined with ACV as Europe and Kurokarin® in Japan, inhibits HSV-1 in sensitive and in resistant to ACV strains of HSV attachment to the cell membrane and inhibits vi- -1 and HSV-2 (Vilhelmova et al., 2011; Vilhelmo- rus replication of HSV-1, HSV-2 and VZV by sup- va-Ilieva et al., 2014). pression of protein synthesis in infected cells in the early stage of infection (Suzutani et al., 2003). The Conclusion ethanolic extract of Rheum offi cinale and methanol Plant species from almost all plant families extract of Paeonia suffruticosa inhibit the attach- are at the heart of alternative medicine in differ- ment and penetration of HSV-1, and other studies ent countries. Roots, stems, bark, leaves, fl owers, show that the aqueous extract of P. suffruticosa and fruits and grains possess medicinal properties, from ethanolic extract of Melia toosendan affect the at- which substances with different structure are iso- tachment and replication of HSV -1 and HSV-2. A lated,an important part of which is occupied by garlic extract and an extract of Terminalia chebula tannins. They possess various biological activities, showed anti-HCMV activity (Chattopadhyay et al., including anti-herpetic activity results in a damage 2010), as well as extracts of Euphorbia australis at different stages of the virus replicative cycle. and Scaevola spinescens (Jassim and Naji, 2003). Further research remains to be conducted to discov- Various tannins were tested for anti-herpesvi- er new active substances, as well to establish the ral activity. Seven ellagitannins isolated from Phyl- exact mechanism of action and the optimal concen- lantus myrtifolius and P. urinary, and eugenifl orin D trations in which active ingredients can be applied. (1) and D (2) isolated from Eugenia unifl ora L. are With its diversity Nature provides a vast world in active against DNA polymerase of EBV (Lee et al., which future antiviral agents are hiding. 2000). Ellagitannin geraniin possesses a virucid- al effect against herpesviruses (Notka et al., 2004).

108 J. R. Coll. Gen. Pract. 25: 489–494. References Hassan, S. T., R. Masarčíková, K. Berchová. (2015). Bioactive Abraham, A. M., S. Kavitha, P. Joseph, R. George, D. Pillay, natural products with anti-herpes simplex virus properties. J. Malathi, M. V. Jesudason, G. Sridharan (2007). Aciclo- J. Pharm. Pharmacol. 67: 1325-1336. vir resistance among indian strains of herpes simplex virus Hatano, T., R. Edamatsu, M. Hiramatsu, A. Mori, Y. Fujita, T. as determined using a dye uptake assay. Indian J. Med. Yasuhara, T. Yoshida, T. Okuda (1989). Effects of tannins Microbiol. 25: 260-262. and related polyphenols on superoxide anion radical, and Agyare, C., M. Lechtenberga, A. Detersa, F. Petereita, A. Hen- on 1,1-diphenyl-2-picrylhydrazyl radical. Chem. Pharm. sel (2011). Ellagitannins from Phyllantus muellerianus Bul. 37: 2016-2021. (Kuntze) Exell.: Geraniin and furosin stimulate cellular Hoste, H., C. Martinez-Ortiz-De-Montellano, F. Manolara- activity, differentiation and collagen synthesis of human ki, S. Brunet, N. Ojeda-Robertos, I. Fourquaux, J. F. J. skin keratinocytes and dermal fi broblasts. Phytomedicine Torres-Acosta, C. A. Sandoval-Castro (2012). Direct and 18: 617-624. indirect effects of bioactive tannin-rich tropical and tem- Asanaka, M., T. Kurimura, R. Kobayashi, T. Okuda, M. Mori, perate legumes against nematode infections. Vet. Parastol. H. Yokoi (1988). Fourth International Conference on Im- 186: 18-27. munopharmacol. Osaka, Japan, 1988. Abstr. p. 47. Ito, H. (2011). Metabolites of the ellagitannin geraniin and Ascacio-Valdés, J., J. J. Buenrostro-Figueroa, A. Aguil- their antioxidant activities. Planta Med. 77: 1110-1115. era-Carbo, A. Prado-Barragán, R. Rodríguez-Herrera, C. Iwalokun, B. A., S. A. Hodonu, S. Nwoke, O. Ojo, P. U. Ago- N. Aguilar (2011). Ellagitannins: biosynthesis, biodeg- mo (2011). Evaluation of the possible mechanisms of anti- radation and biological properties. J. Med. Plant Res. 5: hypertensive activity of Loranthus micranthus: an African 4696-4703. mistletoe. Biochem. Research. Int. Article ID 159439. Bag, P., D. Chattopadhyay, H, Mukherjee, D, Ojha, N, Man- Jain S, A. Jain, S. Jain, N. Malviya, V. Jain, D. Kumar (2015). dal, M. C. Sarkar, T. Chatterjee, G. Das, S. Chakraborti Estimation of total phenolic, tannins, and fl avonoid con- (201). Anti-herpes virus activities of bioactive fraction tents and antioxidant activity of Cedrus deodara heart and isolated pure constituent of Mallotus peltatus: an eth- wood extracts. Egypt. Pharmaceut. J. 14: 10-14. nomedicine from Andaman Islands. Virology J. 9: 98. Jassin, S. A. A., M. A. Naji (2003). Novel antiviral agents: a Barrajon-Catalan, E., S. Fernandez-Arroyo, D. Saura, E. medicinal plant perspective. J. Appl. Microbiol. 95: 412- Guillen, A. Fernandez-Gutierrez, A. Segura-Carretero, V. 427. Mico l (2010). Cistaceae aqueous extracts containing ella- Jia, L., H. Jin, J. Zhou, L. Chen, Y. Lu, Y. Ming, Y. Yu (2013). gitannins show antioxidant and antimicrobial capacity and A potential anti-tumor herbal medicine, corilagin, inhibits cytotoxic activity against human cancer cells. Food Chem. ovarian cancer cell growth through blocking the TGF-β Toxicol. 48: 2273-2282. signaling pathways. BMC Complement. Altern. Med. Bawadi, H. A., R. R. Bansode, A. Trappey II, R. E. Truax, 13:33. doi: 10.1186/1472-6882-13-33. J. N. Losso (2005). Inhibition of Caco-2 colon, MCF-7 Knickelbein J. E., R. L. Hendricks, P. Charukamnoetkanok and Hs578T breast and DU 145 prostatic cancer cell pro- (2009). Management of herpes simplex virus stromal ker- liferation by water-soluble black bean condensed tannins. atitis: an evidence-based review. Surv. Ophthalmol. 54: Cancer Lett. 218: 153-162. 226-234. Bedoyaa, L. M., M. J. Abadb, S. Sánchez-Palominoa, J. Al- Kolodziei, H., O. Kayser, A. F. Kiderlen, H. Ito, T. Hatano, camia, P. Bermejob (2010). Ellagitannins from Tuberaria T. Yoshida, L. Y. Foo (2001). Antileishmanial activity of lignosa as entry inhibitors of HIV. Phitomedicine 17: 69- hydrolyzable tannins and their modulatory effect on ni- 74. tric oxide and tumor necrosis factor-α released in macro- Cheng, H. Y., Lin, I. I., Lin, T. I. (2002). Antiherpes simplex phages in vitro. Planta Med. 67: 825-832. virus type 2 activity of casuarinin from the bark of Termi- Kolodziej, H., A. Kiderlen (2005). Antileishmanial activity nalia arjuna Linn. Antiviral Res. 55: 447-455. and immune modulatory effects of tannins and related Chattopadhyay, D., S. Das, S. Chakrabory, S. K. Bhattacharya compounds on Leishmania parasitised RAW 264.7 cells. (2010). Ethnomedicines for the development of anti-her- Phytochem. 66: 2056-2071. pesvirus agents, in: Chattopadhyay, D. (Ed.), Ethnomedi- Kurokawa, M., T. Hozumi, P. Basnet, M. Nakano, S. Kadota, cine: A Source of Complementary Therapeutics, Research T. Namba, T. Kawana, K. Shiraki (1998). Purifi cation and Signpost, Kerala, India, pp, 117-147. characterization of eugeniin as an anti-herpesvirus com- Davood, A. A., Z. M. Javad, A. Alimohammad, A. A. Abbas, pound from Geum japonicum and Syzygium aromaticum. M. Hamidreza (2012). Evaluation effect of hydroalcoholic J. Pharmacol. Exp. Ther. 284: 728-735. extract of Eucalyptus globules and Artemisia draconculus Kwan, C.-Y. (1994). Plant-derived drugs acting on cellular compare with acyclovir against herpes simplex virus type Ca2+ mobilization in vascular smooth muscle: tetrameth- 1. Med. Plant Res. 2: 6-10. ylpyrazine and tetrandrine. Stem Cells 12: 64–67. Doss, A., H. M. Mubarack, R. Dhanabalan (2009). Antibacte- Lee, M. H., J. F. Chiou, K. Y. Yen, L. L. Yang (2000). EBV rial activity of tannins from the leaves of Solanum triloba- DNA polimerase inhibition of tannins from Eugenia uni- tum Linn. Ind. J. Sci. Technol. 2: 41-43. fl ora. Cancer Lett. 154: 131-136. Engels, C., M. Knödler, Y.-Y. Zhao, R. Carle, M. G. Gänzle, Lin, L.-T., T.-Y. Chen, C.-Y. Chung, R. S. Noyce, T. B. Grin- A. Schieber (2009). Antimcrobial activity of gallotannins dley, C. McCormick, T.-C. Lin, G.-H. Wang, C.-C. Lin, C. isolated from mango (Mangifera indica L.) Kernels. J. Ag- D. Richardson (2011). Hydrolyzable tannins (chebulagic ric. Food Chem. 57: 7712-7718. avid and punicalagin) target viral glycoprotein-glycos- Fry, J. (1975). Deaths and complications from hypertension. aminoglycan interactions to inhibit herpes simplex virus

109 1 entry and cell-to-cell spread. J. Virol. 85: 4386-4398. Sepúlveda, L., A. Ascacio, R. Rodriguez-Herrera, A. Aguil- Lin, T. C., F. L. Hsu, J. T. Cheng (1993). Antihypertensive ac- era-Carbό, C. N. Aguilar (2011). Ellagic acid: Biological tivity of corilagin and chebulinic acid, tannins from Lum- properties and biotechnological development for produc- nitzera racemosa. J. Nat. Prod. 56: 629-632. tion processes. Afr. J. Biotechnol. 10: 4518-4523. Lyra R. M., D, Oliveira, N. Lins, N. Cavalcanti (2006 ). Pre- Suzutani, T., M. Ogasawara, I. Yoshida, M. Azuma, Y. M. vention of type 2 diabetes mellitus. Arq. Bras. Endocrinol. Knox (2003). Anti-herpesvirus activity of an extract of Ri- Metab. 50: 239-249. bes nigrum L. Phytother. Res. 17: 609-613. Miyamoto, K., T. Murayama, T. Yoshida, T. Hatano, T. Oku- Ushio, Y., T. Fang, T. Okuda, H. Abe (1991). Modifi cation- da Anticarcinogenic activities of polyphenols in food and al changes in function and morphology of cultured mac- herbs. In Antinutrients and Phytochemicals in Food, ed. rophages by geraniin. Jpn. J. Pharmacol. 57: 187–196. By Shahidi, F., American Chemical Society: Washington, Varadkar, P., P. Dubey (2001). Modulation of radiation-in- DC., 1997, pp. 245-259. duced protein kinase C activity by phenolics. J. Radiol. Monobe, M., K. Ema, F. Kato, M. Maeda-Yamamoto (2008). Prot. 21: 361-370. Immunostimulating activity of a crude polysaccharide de- Vilhelmova, N., R. Jacquet, S. Quideau, A. Stoyanova, A. S. rived from green tea (Camellia sinensis) extract. J. Agric. Galabov (2011). Three-dimensional analysis of combina- Food Chem. 27: 1423–1427. tion effect of ellagitannins and acyclovir on herpes sim- Notka, F., G. Meier, R. Wagner (2004). Concerted inhibitory plex virus types 1 and 2. Antiviral Res. 89: 174-181. activities of Phyllanthus amarus on HIV replication in vit- Vilhelmova-Ilieva N., R. Jacquet, S. Quideau, A. S. Galabov ro and ex vivo. Antiviral Res. 64: 93–102. (2014). Ellagitannins as synergists of ACV on the repli- Okabe, S., M. Suganuma, Y. Imayoshi, S. Taniguchi, T. Yoshi- cation of ACV-resistant strains of HSV 1 and 2. Antiviral da, H. Fujiki (2001). New TNF-α releasing inhibitors, ge- Res. 110: 104-114. raniin and corilagin, in leaves of Acer nikoense Megusuri- Wang, C. C., L. G. Chen, L. L. Yang (2002). In vitro immuno- no-ki. Biol. Pharm. Bull. 24: 1145-1148. modulatory effects of cuphiin D 1 on human mononuclear O’Kane, P. D., L. R. Queen, Y. Ji, V. Reebye, P. Stratton, cells. Anticancer Res. 22: 4233-4236. G. Jackson, A. Ferro (2003). Aspirin modifi es nitric ox- Widsten P., C. D. Cruz, G. C. Fletcher, M. A. Pajak, T. K. ide synthase activity in platelets: effects of acute versus McGhie (2014). Tannins and extracts of fruit byproducts: chronic aspirin treatment. Cardiovas. Res. 59: 152–159. antibacterial activity against foodborne bacteria and anti- Okuda, T., T. Yoshida, T. Hatano (1991). Chemistry and bio- oxidant capacity. J. Agric. Food Chem. 62: 11146–11156. logical activity of tannins in medicinal plants. Econ. Me- Yang, C.-M., H.-Y. Cheng, T.-C. Lin, L.-C. Chiang, C.-C. Lin dicinal Plant. Res. 5: 129-165. (2005). Acetone, ethanol and methanol extracts of Phyl- Rao, B. K., P. R. Sudarshan, M. D. Rajasekhar, N. Nagaraju, lantus urinaria inhibit HSV-2 infection in vitro. Antiviral Ch. A. Rao (2003). Antidiabetic activity of Terminaliapal- Research. 67: 24–30. lida fruit in alloxan induced diabetic rats. J. Ethnophar- Yildirım, I., T. Kutlu (2015). Anticancer agents: saponin and macol. 85: 169–172. tannin. Int. J. Biol. Chem. 9: 332-340. Raut, N. A., N. J. Gaikwad (2006). Antidiabetic activity of Yokozawa, T., C. P. Chen, D. Y. Rhyu, T. Tanaka, Y. C. Park, hydro-ethanolic extract of Cyperus rotundus in alloxan in- K. Kitani (2002). Potential of sanguiin H-6 against oxida- duced diabetes in rats. Fitoterapia 77: 585–588. tive damage in renal mitichondria and apoptosis mediated Saha, R. K., T. Takahashi, Y. Kurebayashi, K. Fukushima, by peroxynitrite in vivo. Nephron 92: 133-141. A. Minami, N. Kinbara, M. Ichitani, Y. M. Sagesaka, T. Yoshida, T., Y. Amakura, M. Yoshimura (2010). Struktural Suzuki (2010). Antiviral effect of strictinin on influenza features and biological properties of ellagitannis in some virus replication. Antiviral Res. 88: 10-18. plant families of the order Myrtales. Int. J. Mol. Sci. 11: Sani, U. M. (2015). Phytochemical screening and antidiabetic 79-106. effects of extracts of the seeds of Citrullus lanatus in al- Ziyaeyan, M., A. Alborzi, A. Japoni, M. Kadivar, M. A. loxan-induced diabetic albino mice. J. App. Pharm. Sci. Davarpanah, B. Pourabbas, A. Abassian (2007). Frequen- 5: 51-54. cy of acyclovir-resistant herpes simplex viruses isolated Schnitzler, P., C. Koch, J. Rsichling (2007). Susceptibility of from the general immunocompetent population and pa- drug-resistant clinical herpes simplex virus type 1 strain to tients with acquired immunodefi ciency syndrome. Int. J. essential oils of ginger, thyme, hyssop, and sandalwood. Dermatol. 46: 1263–1266. Antimicrob. Agents Chemother. 51: 1859-1862.

110 AACTACTA MICROBIOLOGICAMICROBIOLOGICA BULGARICABULGARICA Volume 33 / 3 (2017)

An update on Brucellosis: Endemic and Potential Global Re-emerging Zoonotic and Foodborne Disease

Vaso Taleski, Milka Zdravkovska, Liljana Simjanovska, Marija Darkovska Serafi movska

University „Goce Delchev”, Faculty of Medical Sciences, Shtip, Republic of Macedonia Abstract Brucellosis is a re-emerging zoonotic disease, which spreads in different ways: respiratory (inha- lation), contact, alimentary (consumption of unpasteurized milk and contaminated dairy products) or a combination of these. The disease has existed in the Republic of Macedonia since 1980, with over 12.000 reported and confi rmed human cases. All neighbouring and many other European countries have also re- ported existence of brucellosis with signifi cantly different incidence. Brucellosis remains a rare disease in EU/EEA. In 2014, 354 confi rmed cases of brucellosis were reported by 18 EU/EEA countries. The highest rates were reported by Greece (135), Spain (60) and Portugal (50). The control of brucellosis is very com- plicated due to large reservoirs in domestic and wild animals. The control of animal brucellosis is impera- tive for the control of human brucellosis. Keywords: Brucella, brucellosis, food-borne, re-emerging, reservoirs, zoonotic.

Резюме Бруцелозата е възобновяващо се зоонозно заболяване, което се разпространява по различни начини: респираторно (инхалации), чрез контакт, чрез храна (консумация на непастьоризирано мля- ко и замърсени млечни продукти) или комбинация от тях. Съществуването на болестта в Република Македония е потвърдено от 1980 г. с над 12 000 съобщени и потвърдени случая с хора. Всички съ- седни и много други европейски държави също съобщават за наличие на бруцелоза със значителни различия в честота на проявление. Бруцелозата остава рядко заболяване в страните от Европейския съюз и страните от Източноевропейския регион. През 2014 г. са съобщени 354 потвърдени случая на бруцелоза от 18 страни от от тях. Най-много са случаите, регистрирани в Гърция (135), Испания (60) и Португалия (50). Контролът на бруцелозата е много труден поради големия брой на домашниите и диви животни, като резервоар на инфекцията. Контролът на бруцелозата при животните е задължи- телен с оглед контрола на заболяването при хората.

Introduction In 450 BC Hippocrates gave the fi rst descrip- over 500.000 new human cases per year, also a tion of the disease. Capasso presented proofs of disease which is signifi cantly changing the global bone lesions in humans killed during the eruption ecological map with new strains, hosts and reser- of Vesuvius in 79 AD, and of presence of bacte- voirs (Pappas, 2010). ria with similar morphology as Brucella in car- The disease was successfully eradicated in bonized cheese (Capasso, 2002). Marston was the most of the developed countries but has remained fi rst to describe brucellosis as a separate disease in endemic in others. Areas with high risk are the Med- 1859. David Bruce fi rst isolated the agent (Brucella iterranean countries (Portugal, Spain, Italy, Greece, melitensis) in 1887 in Malta. Zammit indicated bru- Turkey and North Africa), East Europe, Africa, the cellosis as a zoonotic disease 18 years later. Middle East, South and Central America and the About 60% of emerging human pathogens are Caribbean (Taleski et al., 2002; Corbel, 2006). Sev- defi ned as zoonotic. Brucellosis is one of the world- eral traditional endemic areas like France, Israel wide most common re-emerging zoonotic diseases and most of the Latin American countries have (Godfroid et al., 2005; Selleem et al., 2010) with accomplished control of brucellosis while in oth-

111 er parts of the world the situation has dramatically Brucella strains as marine mammals and atypical worsened (Syria, Mongolia, Iraqi, Saudi Arabia), Brucella species represent a new zoonotic threat (Papas et al., 2006). Over long periods, no reports for humans. on the epidemiological and epizootic situations Recently reported brucellae from amphibians from some countries were available. (worldwide-distributed exotic frogs) are genetical- Brucella species are classifi ed as a catego- ly highly diverse and might represent several new ry B pathogen, a potent bioweapon and the most Brucella species or a link between free-living soil common laboratory-acquired pathogen. Brucellosis saprophytes and the pathogenic Brucella. Amphib- primarily affects domestic and wild animals and ian brucellae are capable of causing disease in dif- is then transmitted to humans. The route of trans- ferent frog species ranging from localized manifes- mission may be respiratory, contact, alimentary tations to generalized infections. Frogs represent a (food or water) or a combination of these. Spread- new and ecologically signifi cant natural host and ing through food is very important as it happens by reservoir (Eisenberg et al., 2011; Scholz et al., consuming unpasteurized milk, and dairy products 2016; Dahouk et al., 2017). made of such milk. Because of the potentiality of emergence of Numerous diagnostic tests, from isolation, new species as human pathogens, brucellosis is a serologic tests to molecular diagnostics, have been continuously re-emerging zoonotic disease. Brucel- developed. The Brucella genome has been com- losis remains a rare disease in EU/EEA. In 2014, pletely sequenced, but recent detection of new spe- 354 confi rmed cases of brucellosis were reported cies has instigated a number of queries about their by 18 EU/EEA countries. The highest rates were origin, evolution and taxonomy, which indicates a reported by Greece (135), Spain (60) and Portu- need of revision of the global map of brucellosis. gal (50), following by Germany (47), France (16), The optimal treatment of human brucellosis is con- Sweden (16), (ECDC, 2016). tinuously under debate (Ariza et al., 2007). The aim of this study was designed to give some up-dated information on new Brucella strains and reservoirs, the current epidemiology situation, paths of transmission of the disease with respect to zoonotic and foodborne diseases, and the current successful measures for control and prevention of brucellosis in the Republic of Macedonia, a small country with a long history and experience as an endemic area.

Materials and Methods Reviews, presentations of offi cial data, re- ports, scientifi c papers and conference reports were Fig. 1. Reported confi rmed brucellosis cases: rate analyzed and presented. per 100 000 population, EU/EEA, 2014 (Source: Annual epidemiological report, ECDC, 2016) Results and Discussion Until recently, the genus Brucella was con- Brucellosis has existed in R. Macedonia since sidered to represent a genetically homogeneous and 1980 with over 12.000 reported and confi rmed hu- clonal group of bacteria associated with: 1.Terreste- man cases (Taleski et al., 2013). The disease exists rial mammalian hosts (classical strains B. meliten- in all neighbouring and some other European coun- sis, B. abortus, B. suis, B. canis, B. ovis, B. neoto- tries with signifi cantly different incidence (Cekan- mae), 2. Marine mammals (B. ceti and B. pinnipe- jac et al., 2009; Obradovic and Velic, 2009; Nico- dialis), and 3. „Atypical”, more recently identifi ed letti, 2010; Nenova et al., 2013). (B. microti, B. inopinata, B. papionis and B. vulpis). B. melitensis biotype 2 was confi rmed as All species are genetically highly related , > 99% an etiological agent in R. Macedonia. A recent (Holger et al., 2008; Holger et al., 2010; Audic et study based on molecular methods for species typ- al., 2011; Nymo et al., 2011). The most infective ing (AMOS PCR and RT PCR), and genotyping terrestrial Brucella species are B. meiltensis and (MLVA-16 and MLVA-8), beside B. melitenisis, B. abortus, while B. suis is less pathogenic. New also confirmed B. abortus (for the first time in

112 R. Macedonia). Epidemiological data suggested a soil-associated motile bacterium to a host-adapted that about 23% of the disease had spread by the pathogen. Whilst there is no evidence to date that alimentary way (foodborne disease due to con- frog’s isolates represent a zoonotic threat, appropri- sumption of unpasteurized milk, cheese, and under- ate measures should be taken to avoid unnecessary cooked infected meat), 34% by contact and 43 % by contact with potentially infected amphibians until a combined way of spreading brucellosis. The re- the zoonotic potential of this group is better under- spiratory way is rare and happens in laboratories or stood. while working with infected animals. About 80% of Control of animal brucellosis is imperative the patients lived in rural, and 20% in urban areas. for control of human brucellosis. Preventive mea- The disease has a seasonal character in the Medi- sures include effective veterinary and health con- terranean area, with a maximum in May-June and trol of animals (trading, transport, slaughter, vacci- minimum in winter. Since 2008, in R. Macedonia, nation) and animal products (meat, milk and their the national control strategy has been completely products), education of the population, multi-insti- changed from „test and slaughter” to vaccination of tutional cooperation and continuous state fi nancial small ruminants (sheep and goats) with Rev 1 vac- support. Exchanges of positive and successful ex- cine, applied intraocularly (Naletoski et al., 2009; perience and collaboration of all countries in en- Banai, 2010; Blasco, 2010). The results indicate a demic areas is imperative, beside international help signifi cant decrease in the epizooty in animals and with resources and expertise. human morbidity (287, 167, 107, 94, 47, 35, 20 and 23 human cases in 2009, 2010, 2011, 2012, 2013, 2014, 2015 and 2016, respectively).

Fig. 2. Human cases in Macedonia

Conclusions References: Control of brucellosis is very complicated Ariza, J., M. Bosilkovski, A. Cascio, J. D. Colmenero, M. J. due to large and novel reservoirs in domestic and Corbel, M. E. Falagas, Z. A. Memish, M. R. H. Roushan, wild animals. E. Rubinstein, N. V. Sipsas, J. Solera, E. J. Young, G. Pap- pas (2007). Perspectives for the treatment of brucellosis in New Brucella species (marine mammals) as the 21st century: the Ioannina recommendations. PlosMed well as “atypical” Brucella strains have enhanced J. 4: e317. the understanding of the evolution of the genus from Audic, S., M. Lscot, J. M. Claverie, A. Cloeckaert, M. S. Zy-

113 gmunt (2011). The genome sequence of Brucella pinnipe- tion campaign in sheep and goats in Republic of Macedo- dialis B2/94 sheds light on the evolutionary history of the nia: Lessons learned. Croat. Med. J. 51: 351-356. genus Brucella. BMC Evol. Biol. 11: 200. Nenova, R., I. Tomova, T. Kantardjiev, B. Likov (2013). Bru- Banai, M. (2009). Insights into the problem of B. melitensis cellosis in Bulgaria – an overview of the present sitiation. and rationalizing a vaccination program in Israel. Interna- Eighth Balkan Congress of Microbiology. Microbiologia tional Scientifi c Conference in South Eastern Europe and Balcanica 2013. Veliko Tarnovo, Bulgaria, October 2nd – Mediterranean Region. Struga, Macedonia, Contributions, 5th, 2013, 60. pp. 168-179. Nicoletti, P. (2010). Brucellosis: past, present and future. In- Blasco, J. M. (2010). Control and eradication strategies for ternational Scientifi c Conference in South Eastern Europe Brucella melitensis infection in sheep and goats. Interna- and Mediterranean Region. Struga, Macedonia, 12-14 tional Scientifi c Conference in South Eastern Europe and Nov 2009, pp. 21-31. Mediterranean Region. Struga, Macedonia. Contributions, Nymo, I., H. Nymo, M. Tryland, J. Godfroid (2011). A re- pp. 146-164. view of Brucella infection in marine mammals, with spe- Capasso, L. (2002). Bacteria in two-millenia-old cheese and cial emphasis on Brucella pinnipedialis in the hooded seal related epizoonoses in Roman polutations. J. Infect. 45: (Cystophora cristata). Vet. Res. 42: 93. 122-127. Obradovic, Z., R. Velic (2010). Epidemiological characteris- Cekanjac R., J. Mladenovic, E. Ristanovic, S. Lazic (2010). tics of brucellosis in Federation of Bosnia and Herzegovi- Epidemiological characteristics of brucellosis in Serbia, na. Croat. Med. J. 51: 345-350. 1980-2008. Croat. Med. J. 51: 337–344. Pappas, G., P. Papadimitrou, N. Akritidis, L. Christou, E. V. Corbel, M. (2006). Brucellosis in Humans and Animals: FAO, Tsianos (2006). The new global map of human brucello- OIE, WHO. sis. Lancet Infect. Dis. 6: 91-99. Dahouk, S. A., S. Kohler, A. Occialini, M. P. J. de Bagüés, J. Pappas, G. (2010). The changing Brucella ecology: novel A. Hammerl, T. Eisenberg, G. Vergnaud, A. Cloeckaert, reservoirs, new threats. Int J Antimicrob Agents. Epub. M. S. Zygmunt, A. M. Whatmore, F. Melzer, K. P. Drees, 36(Suppl 1): 8-11. J. T. Foster, A. R. Wattam, H. C. Scholz (2017). Brucella Scholz H.C., K. Nöckler, C. Göllner, P. Bahn, G. Vergnaud, spp. of amphibians comprises genomically diverse motile H. Tomaso, S. Al Dahouk, P. Kämpfer, A. Cloeckaert, M. strains competent for replication in macrophages and sur- Maquart, M. S. Zygmunt, A. M. Whatmore, M. Pfeffer, B. vival in mammalian hosts. Sci. Rep. 7: 44420. Huber, H. J. Busse, B. K. De (2010). Brucella inopinata ECDC, Annual epidemiological report 2016. sp. nov., isolated from a breast implant infection. IJSEM Eisenberg, T., H. P. Hamman, U. Kaim, K. Schlez, H. Seeger, 60: 801-808. N. Schauerte, F. Melzer, H. Tomaso, H. C. Scholz, M. S. Scholz, H. C., K. Muhldorfer, C. Shilton, S. Benedict, A. M. Koylass, A. M. Whatmore, M. Zschöck (2011). Isolation Whatmore, J. Blom, T. Eisenberg (2016). The change of of potentially novel Brucella spp. from frogs. Appl. Envi- medically important genus: worldwide occurrence of ge- ron. Microbiol. 78: 3753-3755. netically diverse novel Brucella species in exotic frogs. Godfroid, J, A. Cloeckaert, J. P. Liautard, S. Kohler, D. Fre- PLoS ONE 11(12): e0168872. tin, K. Walravens, B. Garin-Bastuji, J. J. Letesson (2005). Seleem, M. N., S. M. Boyle, N. Sriranganathan (2010). Bru- From the discovery of the Malta fever’s agent to the dis- cellosis: a re-emerging zoonosis.Vet. Microbiol. 140: 392- covery of a marine mammal reservoir, brucellosis has 398. continuously been a re-emerging zoonosis. Vet. Res. 36: Taleski V., L. Zerva, T. Kantardjiev, Z. Cvetnic, M. Erski-Bil- 313-326. jic, B. Nikolovski, J. Bosnjakovski, V. Katalinic-Jankovic, Holger, C. S., Z. Hubalek, I. Sedlacek, G. Vergnaud, H. To- A. Panteliadou, S. Stojkoski, T. Kirandziski (2002). An maso, S. Al Dahouk, F. Melzer, P. Kämpfer, H. Neubauer, overview of the epidemiology and epizootology of bru- A. Cloeckaert, M. Maquart, M. S. Zygmunt, A. M. What- cellosis in selected countries of Central and Southeast Eu- more, E. Falsen, P. Bahn, C. Göllner, M. Pfeffer, B. Huber, rope. Vet. Microbiol. 90: 147-155. H. J. Busse, K.Nöckler (2008). Brucella microti sp. nov., Taleski V., M. Zdravkovska, S. Mrenoski, V. Markovski, D. isolated from the common vole Microtus arvalis. IJSEM Bosnjakovski (2013). Control of human brucellosis in 58: 375-382. Macedonia: past and present. The Fifth Eurasia Congress Naletoski, I., T. Kirandziski, D. Mitrov, K. Krstevski, I. Dza- of Infectious Diseases, 15-18 May 2013, Tirana, Albania, dzovski, S. Acevskiet (2010). Gaps in brucellosis eradica- pp. 445-446.

114 AACTACTA MICROBIOLOGICAMICROBIOLOGICA BULGARICABULGARICA Volume 33 / 3 (2017)

Propolis Use and Helicobacter pylori: Two Case Reports

Lyudmila Boyanova1, Rossen Nikolov2, Rumyana Markovska1, Daniel Yordanov1, Ivan Mitov1

1Department of Medical Microbiology, Medical University of Sofi a, Zdrave street 2, 1431 Sofi a, Bulgaria 2Department of Gastroenterology, University Hospital St. Ivan Rilski, Medical University of Sofi a, Sofi a, Bulgaria

Abstract Propolis possesses many beneficial biological activities and 13C urea breath (13C UBT) test is considered to be the best non-invasive test for the diagnosis of Helicobacter pylori infection. The aim of this study was to evaluate propolis effects on H. pylori infection status and 13C UBT results of two untreated symptomatic adults. The first patient with chronic gastritis and gastroesophage- al reflux was tested by 13C UBT for H. pylori several times over >1 year. The subject used only non-antibiotic agents involving propolis. All 13C UBT results of the patient were positive. The second patient had taken propolis on the day before the test and the UBT result was negative, while the culture was positive. In conclusion, although propolis alone or with other non-antibiotic agents may be a good adjunct in the infection therapy, the long-term bee glue use did not lead to H. pylori eradication in the first patient. Conversely, the use of propolis several days before the test may result in false negative UBT results, raising the question of the need to avoid propolis use at least several days before the UBT. The optimal dosage and duration of bee glue use should be further evaluated. Keywords: Helicobacter pylori; propolis; urea breath test; UBT; non-antibiotic; probiotics

Резюме Прополисът притежава много полезни биологични активности и 13C дихателният урея (13C UBT) тест се счита за най-добрият неинвазивен тест за диагностициране на инфекци- ята. Целта на това изследване е да се проучи действието на прополиса върху статуса на H. pylori инфекция и резултатите от 13C UBT на двама нелекувани симптоматични възрастни. Първият пациент с хроничен гастрит и гастроезофагеален рефлукс е изследван с 13C UBT за Н. pylori няколко пъти в продължение на над една година. Пациентът е приемал само неан- тибиотични агенти, вкл. прополис. Всички резултати от 13С UBT на този пациент бяха поло- жителни. Вторият пациент е вземал прополис в деня преди теста, а резултатът от UBT беше отрицателен, докато културелното изследване беше положително. В заключение, въпреки че прополисът самостоятелно или заедно с други небиотични агенти може да бъде добър суплемент в лечението на инфекцията, продължителното използване на агента не доведе до ерадикация на H. pylori при първия пациент. Обратно, прополисът, използван няколко дни преди началото на теста, може да доведе до фалшиви отрицателни UBT резултати, което по- ставя въпроса за необходимостта от избягване на употребата на прополис поне няколко дни преди провеждане на UBT. Оптималната дозировка и продължителността на употребата на прополиса трябва да бъдат допълнително проучени.

Corresponding author: Prof. Lyudmila Boyanova, M.D., Ph. D., D.M.Sc. Department of Medical Microbiology, Medical University of Sofi a, Zdrave Street 2, 1431 Sofi a, Bulgaria, (+359 2) 91 72 730, E-mail: [email protected]

115 Introduction sheep blood) media were used for the isolation and Helicobacter pylori eradication can strongly microaerophilic (CampyGen envelopes, Oxoid, reduce the risks of severe gastroduodenal diseas- UK) incubation was performed at 37° C for up to es in the positive patients. However, eradication 10 days. is often diffi cult to be obtained mainly due to the The study was approved by the Ethical Com- constantly increasing H. pylori resistance to antibi- mittee of Medical University of Sofi a. otics and poor patient compliance, patient allergy to One of the patients (a 60-year-old woman) the drugs used or side effects of the therapy (Talebi suffered from chronic gastritis and gastroesopha- Bezmin Abadi, 2017). Because of this, the use of geal refl ux, reported to have penicillin allergy and non-antibiotic agents may be helpful as a treatment avoided using antibiotic. Three months before the adjunct or for prophylaxis of the infection. fi rst UBT testing, she used bismuth compound Urea breath test (UBT) is considered to be (CBS-colloidal bismuth subcitrate 120 mg bid) for the best non-invasive test for the diagnosis of the 20 days, as well as propolis (30% ethanol extract infection (Malfertheiner et al., 2012). It is known at recommended dose of 30 drops tid), lansoprazole that using antibiotics up to one month before the (30 mg bid) and probiotic/probiotic combination test and using proton pump inhibitors up to 14 days (containing 2 x 109 colony forming units of Lacto- before the test as well as the presence of bleeding bacillus spp. and Bifi dobacterium spp. per capsule ulcers or atrophic gastritis can lead to false-nega- with inulin addition) daily for several months. The tive 13C UBT results due to reduced bacterial densi- UBT result was positive. Six months later, she un- ty (Malfertheiner et al., 2012). derwent a second UBT test and reported that had The aim of this study was to evaluate the ef- taken CBS (as above) for 20 days, and both pro- fects of propolis on the H. pylori infection status biotic combination and propolis for two months. and 13C UBT results of two untreated adult patients The UBT result was positive. Fourteen months af- with gastroduodenal diseases. ter the fi rst UBT test, the patients performed one more UBT test, reporting the use of propolis only Case reports (as above). The third UBT result was positive like The case reports of two adult patients with the previous ones. gastroduodenal diseases taking propolis with or The second patient was a 40-year-old man without other non-antibiotic agents were described with chronic gastritis. He was untreated for H. pylo- (Table 1). The patients were untreated for H. pylori ri eradication, and had taken propolis (30% ethanol infection and did not take nonsteroidal anti-infl am- extract at recommended dose) irregularly, includ- matory drugs (NSAIDs). Informed written consent ing on the day before the test. The UBT result was was obtained from both patients. negative, while the culture was H. pylori positive. The UBTs were performed following at least a 6-hour fast of the patients. The patients received Discussion 2 g of citric acid as a test meal and 75 mg of com- Propolis or bee glue possesses important an- mercially available 13C-urea (Gisbert and Pajares, tibacterial, antiviral, antifungal, antioxidant, and 2004). Two breath samples taken from each subject antitumor activities (Khalil, 2006). The resinous were a baseline breath sample and a second (post- mixture contains phenols, including caffeic acid dose) breath sample exactly 30 minutes after the phenethyl ester, as well as terpenes, tannins, pol- 13C-urea ingestion. ysaccharides, aromatic acids and aldehydes and The breath samples were evaluated by 13C other compounds (Khalil, 2006). The caffeic acid UBT infrared spectrometer IR-force 200 (Richen- phenethyl ester is linked to benefi cial biological force, Beijing, China) or HeliFANplus (Fischer activities such as antioxidant, anticancer, antimi- ANalysen Instrumente GmbH, Leipzig, Germany). crobial, immune-modulatory and anti-infl ammato- Cut-off delta over baseline (DOB) value of 2.05 ry effects (Yuksel and Akyol, 2016). was used according to the ROC curve that was pre- In our previous study (Boyanova et al., 2005), viously determined (Boyanova et al., 2013). Bulgarian propolis (30% ethanol extract) showed a The culture was performed with two gastric good and dose-dependent in vitro activity against biopsy specimens as described previously (Boy- most H. pylori strains tested, inhibiting >86% of anova et al., 2005). Briefl y, a selective (containing the strains tested by an agar-well diffusion meth- a selective supplement of Dent) and non-selective od. However, Coelho et al. (2007) assessed Bra- media (Mueller Hinton agar, Oxoid, UK with 5% zilian green propolis (20 drops of alcoholic extract

116 Table 1. Untreated H. pylori positive symptomatic adults in the study. No Sex and age UBT Non-antibiotic agents UBT result Culture (years) (results) 1 Woman (60) 1st month Propolis1, probiotics2, PPI3 Positive NA5 and CBS4 3 months earlier 7th month CBS for 20 days, propolis Positive NA and probiotics for 2 months 15th month Propolis regularly Positive NA 2 Man (40) One visit Propolis on the day before Negative Positive the test

1Propolis-30% ethanol extract, 30 drops tid 2Probiotic/prebioic combination (2 x 109 colony forming units of Lactobacillus spp. and Bifi dobacterium spp. per capsule with inulin addition bid). 3PPI- lansoprazole 30 mg bid 4CBS- colloidal bismuth subcitrate 120 mg bid 5NA-non-available of propolis tid for seven days) effect on H. pylo- Conclusion ri-positive subjects and observed temporary H. py- In conclusion, even though propolis use alone lori suppression in some patients by UBT. or together with other non-antibiotic agents may be In this study, even long-term use of propolis, a good adjunct in H. pylori therapy, it was not able without or with other non-antibiotic agents, failed to eradicate H. pylori infection. Conversely, using to eradicate H. pylori infection. Nevertheless, dif- bee glue shortly before the UBT testing can be a ferent dosages or non-antibiotic combinations with reason for false-negative UBT results. Propolis use bee glue should be further evaluated. On the oth- in the control of H. pylori infection requires addi- er hand, propolis use shortly before the UBT led tional evaluation to determine the optimal doses, to a false-negative result, while the culture was treatment duration and combinations with other H. pylori positive. This result can pose the ques- non-antibiotic agents. The avoidance of propolis tion of the need to avoid using bee glue at least use several days before UBT needs to be further several days before UBT testing. Similarly, in the evaluated. study of Coelho et al. (2007), in half of the patients evaluated, propolis led to a 20% reduction of the Acknowledgements UBT values, refl ecting a temporary decrease in the This research was funded by the Grant/Con- bacterial density in the stomach. tract B02/17 (12.12.2014) from the National Sci- Cui et al. (2013) observed that a propolis ence Fund at the Ministry of Education and Science phenolic compound (caffeic acid phenethyl ester) of Bulgaria, Project Ref. B02/2 (14.07.2014) enti- reduces H. pylori enzyme (peptide deformylase) tled “Complex study of Helicobacter pylori viru- activity. Recently, Baltas et al. (2016) have found lence and resistance factors and epidemiology of that ethanol propolis extracts inhibited H. pylo- the infection”. ri urease, with inhibition concentrations (IC50) of 0.260-1.525 mg/ml. References Therefore, bee products have a potential in Baltas, N,, S. A. Karaoglu, C. Tarakci, S. Kolayli (2016). Ef- the control of H. pylori infection. In our prior study, fect of propolis in gastric disorders: inhibition studies on honey consumption was linked to a lower H. pylori the growth of Helicobacter pylori and production of its urease. J. Enzyme Inhib. Med. Chem. 31: 46-50. positivity rate (odds ratio, 0.38 and a 95% confi - Boyanova, L., G. Gergova, R. Nikolov, S. Derejian, E. Laza- dence interval, 0.19-0.78), (Boyanova et al., 2015). rova, N. Katsarov, I. Mitov, Z. Krastev (2005). Activity of Moreover, Nostro et al. (2006) have reported that a Bulgarian propolis against 94 Helicobacter pylori strains propolis + clarithromycin combination had either in vitro by agar-well diffusion, agar dilution and disc dif- synergistic or additive activity against H. pylori. fusion methods. J. Med. Microbiol. 54: 481-483. Boyanova, L., Y. Ilieva, B. Vladimirov, G. Gergova, R. Ni- kolov, Z. Spassova, L. Mateva, R. Mitova, I. Terziev, I.

117 Mitov (2013). The rate of Helicobacter pylori in adult pa- Malfertheiner, P., F. Megraud, C. A. O’Morain, J. Atherton, tients with the 13C urea breath test. Gen. Med. XV: 22-25. A. T. Axon, F. Bazzoli, G. F. Gensini, J. P. Gisbert, D. Y. Boyanova, L., J. Ilieva, G. Gergova, B. Vladimirov, R. Ni- Graham, T. Rokkas, E. M. El-Omar, E. J. Kuipers; Euro- kolov, I. Mitov (2015). Honey and green/black tea con- pean Helicobacter Study Group (2012). Management of sumption may reduce the risk of Helicobacter pylori in- Helicobacter pylori infection-the MaastrichtIV/Florence fection. Diagn. Microbiol. Infect. Dis. 82: 85-86. Coelho, L. G., E. M. Bastos, C. C. Resende, C. M. Paula e Consensus Report. Gut 61:646-664. Silva, B. S. Sanches, F. J. de Castro, L. D. Moretzsohn, W. Nostro, A., L. Cellini, S. Di Bartolomeo, M. A. Cannatelli, E. L. Vieira, O. R. Trindade (2007). Brazilian green propo- Di Campli, F. Procopio, R. Grande, L. Marzio, V. Alonzo lis on Helicobacter pylori infection. A pilot clinical study. (2006). Effects of combining extracts (from propolis or Helicobacter 12: 572-574. Zingiber offi cinale) with clarithromycin on Helicobacter Cui, K., W. Lu, L. Zhu, X. Shen, J. Huang (2013). Caffeic acid phenethyl ester (CAPE), an active component of propolis, pylori. Phytother. Res. 20: 187-190. inhibits Helicobacter pylori peptide deformylase activity. Talebi Bezmin Abadi, A. (2017). Helicobacter pylori treat- Biochem. Biophys. Res. Commun. 435: 289-294. ment: New perspectives using current experience. J. Glob. Gisbert J. P., J. M. Pajares (2004). Review article: C-urea Antimicrob. Resist. 8: 123-130. breath test in the diagnosis of Helicobacter pylori in- Yuksel, S., S. Akyol (2016). The consumption of propolis and fection: a critical review. Aliment. Pharmacol. Ther. 20: royal jelly in preventing upper respiratory tract infections 1001-1017. Khalil, M. L. (2006). Biological activity of bee propolis in and as dietary supplementation in children. J. Intercult. health and disease. Asian Pac. J. Cancer Prev. 7: 22-31. Ethnopharmacol. 5: 308-311.

118 AACTACTA MICROBIOLOGICAMICROBIOLOGICA BULGARICABULGARICA Volume 33 / 3 (2017)

Microalgae Flat Plate-Photobioreactor (FP-PBR) System Development: Computational Tools to Improve Experimental Results

Camila Hinterholz1, Adilson Schuelter1, Aparecido Módenes1, Daniela Trigueros1, Carlos Borba1, Fernando Espinoza-Quiñones1, Alexander Kroumov2 1Department of Chemical Engineering, West Paraná State University, Rua da Faculdade 645, Jardim Santa Maria, CEP: 85903-000, Toledo, PR, Brazil 2The Stephan Angeloff Institute of Microbiology–Bulgarian Academy of Sciences, Acad. G. Bonchev St., Bl. 26, Sofi a 1113, Bulgaria

Abstract The new multifunctional “Algae Lab” was established by our research team in West Parana State University of Toledo. Several microalgae strains were isolated and identifi ed by applying modern molecular techniques. The system analysis theory was applied when developing and designing novel fl at plate pho- tobioreactors (FP-PBRs). One of the objectives of this study was to use computing fl uid dynamics (CFD) simulations in order to support the scale up procedure of (FP-PBRs). The improved hydrodynamics of the construction refl ected in optimal fl ashing-light effects and yielding in high cell density cultures. Keywords: algae Lab, fl at plate photobioreactors, microalgae

Резюме Нова многофункционална «Лаборатория за водорасли» бе създадена от нашия изследователски екип в Университета на Западна Парана в Толедо. Няколко щама микроводорасли бяха изолирани и идентифицирани чрез прилагане на съвременни молекулярни техники. Теорията на системния анализ бе приложена при разработването и проектирането на нови плоски- фотобиореактори (П-ФБР). Една от целите на това изследване е да се използват симулации при изчисляване динамика на флуидите (ИДФ), за да се оптимизира процедурата по мащабиране на (П-ФБР). Подобрената хидродинамика на конструкцията се отразява в оптималните «светлинни мигащи ефекти»и добива на култури с висока клетъчна плътност.

Introduction Microalgae have been the focus of many 2010), which reduces signifi cantly the space need- scientists around the world for many years, mainly ed. It has been reported that some microalgae can due to their important role in the atmosphere CO2 produce as much as 80% oil of their dry cell weight. remediation process. In this sense, microalgae can Their year-round production and very high growth act both by preventing the CO2 from going into the rates make them a superior source of biodiesel pro- atmosphere, through the production of biofuels, and duction (Brennan and Owende, 2010; Borowitzka by reducing the CO2 levels from the air, through the and Moheimani, 2013; Milano et al., 2016; Olof- photosynthesis process. intuyi et al., 2016; Thomas et al., 2016). Besides Biofuels play an important role in the current that, microalgae can grow anywhere in open ponds, economy, since the dependence of human beings closed photobioreactors (PBRs) and waste water of on petroleum has increased signifi cantly due to the wide pH range and chemical composition. In this large industrialization and transportation, which has context, there are several different biofuels that led to an increase in crude oil prices, besides global can be produced from microalgae biomass, such warming (Malcata, 2011). In this context, microal- as biodiesel (Cheng et al., 2015; Kokkinos et al., gae present various advantages when compared 2015; Maranduba et al., 2016; Sharma et al., 2016), to ground plants, such as the production of 30 to bioethanol (Fasahati et al., 2015; Hernández et al., 100 times higher than plants by hectare (Demibras, 2015; Simas-Rodrigues et al., 2015; Saïdane-Bchir

119 et al., 2016), biohydrogen (Sambusiti et al., 2015; mental efforts, computer simulations are important Torzillo et al., 2015; Eroglu and Melis, 2016) and tools for the optimization of the process. biogas (Klassen et al., 2015; Neves et al., 2016; Santos-Ballardo et al., 2016). Materials and Methods Besides their role in reducing global warm- Since microalgae growth in FP-PBRs is a very ing, microalgae are also capable of synthesizing complex process, with many variables and opera- high value products (HVP), such as pigments (Mac- tional parameters that must be taken into account, intyre et al., 2002; Dufossé et al., 2005; Pasquet et the use of the System Analysis Theory is very inter- al., 2011), polyunsaturated fatty acids (Thepenier esting, since it divides the process into subsystems et al., 1994; Furuhashi et al., 2016), biologically and hierarchic levels, which are studied separately, active compounds – antibacterial, antifungal, anti- as shown in our previous work (Kroumov et al., viral, antitumor (Borowitzka, 1995; Mendes et al, 2016). Figure 1 shows a simplifi ed scheme of the 2003; Ördög et al., 2004; Mimouni et al., 2012; Sk- system and its divisions. jånes et al., 2013) among others. For both the fi rst and second hierarchic lev- With all that in mind, it is of the uttermost im- els of knowledge, computer simulations are very portance to optimize microalgae growth systems, interesting to evaluate various different scenarios mainly with closed PBRs, such as column or fl at- at a low cost and high effi ciency. Thus, this paper plates, due to the possibility of better controlled op- aims to present how mathematical modeling and erational parameters. Among the closed PBRs, the computer simulations can help improve microalgae fl at-plate (FP-PBR) are well known because of their growth and biomass production when developing capacity to produce high cell concentration, which novel FP-PBRs. is mainly due to the small trajectory that the light First hierarchic level of knowledge – Kinetic needs to penetrate inside the PBR (distance between modeling the plates) (Richmond and Cheng-Wu, 2001). As seen in Fig. 1, the fi rst hierarchic level of When evaluating microalgae biomass growth knowledge consists of the physiological study of in novel PBRs, the key parameters that must be the microalgae cells, taking into account their re- taken into account are nutrient concentration in the quirements and tolerances towards the operational medium, light availability and distribution, CO2 parameters. concentration in the inlet gas and its speciation in When studying microalgae growth in a de- water, pH and temperature (Kroumov et al., 2016; termined PBR, mathematical modeling has proved Kroumov et al., 2017). In order to reduce experi- to be a powerful tool to reduce work efforts and

Fig. 1. Simplifi ed scheme of the FP-PBR system divided into three hierarchic levels of knowledge

120 process development costs. In order to build a com- lations, one can evaluate the fl ux of various differ- plex model that is able to describe cells growth in ent PBR confi gurations without all the laboratorial a FP-PBR, some different concepts must be taken work. into account, such as the CO2 and SO2 dissociation Third hierarchic level of knowledge reactions in water (when used fl ue gas), mass trans- The third hierarchic level (complete PBR fer between gas and liquid, the defi nitions of spe- model) can be considered as a fi nal step in a mod- cifi c transformation rate and conversion, as well as eling process. At this level all valuable knowledge Henry’s law. from previous levels can be combined and pre- Second hierarchic level of knowledge – served into the complete PBR mathematical model. Hydrodynamics simulations Verifi cation of the model at this level is not an easy It has been extensively reported that the task and most probably requires a loop procedure, movement of the fl uid inside a PBR greatly infl u- where real experiments are performed with PBR ences its productivity, since it is responsible for (preferably in a pilot plant scale) to correct and various factors, such as mixing, CO2 solubility, gas prove the hypothesis assumed in previous levels. holdup and, most important, light availability. This Scale-up and scale-down procedures here worked is because the movement of the fl uid is responsi- powerfully. In any case of PBR design, these stud- ble for getting microalgae cells close to the reactors ies can vary, but this is only one goal to obtain a walls, where they can absorb light energy, and then robust complete PBR model, which will be ap- move them back to the inner portion of the PBR, the plied for its scale up. Our studies on this subject dark part, where they can fi nish the photosynthetic received their complete form and were published process as well as recuperate their photosynthetic elsewhere (Kroumov et al., 2016). In this paper we machinery. This is called the fl ashing-light effect, showed in details our approach on how to model which promotes very fast light-dark (L/D) cycles. and study column PBR constructions when using

In order to study the fl uid dynamics of differ- fl ue gas as a source of CO2 for autotrophic microal- ent FP-PBR confi gurations, there are several soft- gae growth. Computer simulations with the com- ware packages that can be used to simulate the fl ow plex PBR mathematical model taking into account by applying mathematical models that describe knowledge from hydrodynamics and microalgae multiphase fl uid fl ows. The two most common ap- kinetics were demonstrated by advanced research proaches to model multiphase fl ux considering air groups (Nahua and Alopaeus, 2013). The appli- bubbles are the Euler-Euler, which considers both cation of such an approach for different systems phases (continuous – liquid and disperse – gas) as was successful throughout our 30 years of research interpenetrating continua, and the Euler-Lagrange, with bio-, photobioreactors and other systems. We which uses the volume-averaged Navier-Stokes applied this knowledge to create a new multifunc- equations to describe the motion of the liquid while tional “Algae Lab” in West Parana State University tracking down each bubble (Mousavi et al., 2008). of Toledo under the CNPq grant “Science without Considering that in microalgae production in borders” #400771/2014-4. a PBR the disperse phase fraction is high, tracking down each bubble can become hard work, demand- Results and Discussion ing a lot of computer processing. Thus, there have As mentioned above, a new multifunctional been reports (García et al., 2012) that the Euler-Eu- “Algae Lab” was created by our research team. The ler model is the best choice in this case, since it topics of the lab included studies in the following is simple and demands less computational work, hottest areas of: giving satisfactory results (Krishna et al., 2000; Bi- - Algal physiology, taxonomy, and morphol- tog et al., 2011; Studley and Battaglia, 2011) even ogy; though it loses accuracy since it does not take co- - Algae isolation: By using standard methods alescence or bubble breakage into account. In the for algae isolation and preservation, we were able Euler-Euler model, the movement of the fl uid is to locate regions rich in algae species and take sam- modeled through its equations of mass and momen- ples from there. Several promising algae species tum conservation. (Fig. 2) were isolated and are currently being used In FP-PBRs, one way to improve the fl u- in our Lab. id movement towards the fl ashing-light effect is - Algae identifi cation: By applying modern through the addition of baffl es that force the liquid molecular techniques for molecular identifi cation to go a certain way. By using computational simu- of microalgae we were able to identify the species

121 Fig. 2. Strains isolated in the new multifunctional “Algae Lab”-UNIOESTE-Toledo

Poterioochromonas malhamensis, Chlorella sp., Mi- ferent cultivation conditions and this strain showed cractinium sp., Tetradesmus acuminatus and Scened- potential to be used for CO2 sequestration from esmus sp., as shown in Fig. 2. waste gases rich in CO2. - Algae cultivation: Having in mind the specif- - Kinetics studies with promising selected ics of microalgae, their ability to produce bioactive strains in PBRs of different scale; kinetics studies compounds under autotrophic, mixotrophic and het- were a milestone for the overall process and FP- erotrophic growth, we were checking the metabolic PBR development. Our fi rst detailed study on mi- ability of every selected algae species under such croalgae kinetics was executed by using new iso- conditions; Application of cultivation techniques to ensure optimal light-dark cycles conditions and “fl ashing light effects” in the chosen PBR vessel. - Medium optimization: Our previous studies included the robust methodology to calculate the recipe of nutrients medium components and their optimization by applying linear programming and chemical elements presence in the microalgae cells. The complete study on this subject can be found elsewhere (Kroumov et al., 2015). - Algae selection on the basis of their potential to produce different biologically active compounds: Several isolated (Fig. 2) microalgae species with po- Fig. 3. Different PBR types and volumes design tential to produce bioactive compounds were culti- for microalgae growth vated under specifi c light specter spectrum conditions and promising results were achieved (Gonçalves et lated, identifi ed and selected P.malhamensis strain al., 2017). (Fig. 2). - Global biorefi nery concept: This concept - Hydrodynamics studies: hydrodynam- was discussed in details elsewhere (Kroumov et al., ics was studied by mathematical models, and the 2017). All the studies in the Algae Lab have been movement of the culture inside the FP-PBR was conducted under this complex concept. simulated by using computational fl uid dynamics - PBR design – different types and scale of CFD software. Along with that, the fl ashing-light PBRs (Fig. 3) were set up by applying system anal- effect was evaluated, as well as the role it plays on ysis theory on how to study and model the PBRs. microalgae growth. This study showed an improve- Special attention was given to kinetics and hydrody- ment of about 250% on cell growth when using an namics studies and their relationship. internal bubbles disperser, which changed the fl uid - Algae as promising source of low value movement towards the fl ashing-light effect. products – bio-fuels, proteins, etc. The new isolated - Development of different scenarios of ap- and identifi ed P. malhamensis strain was cultivated plication of the strains products covered with engi- in two 10L FP-PBRs (see Fig. 3) under many dif- neering specifi cation.

122 and comprehensive workfl ow for lipid analysis. Biotech- - Pilot plant studies with new PBR construc- nol. J. 11: 1262-1267. tions in order to cover a wide possibility of knowl- García, S., E. Paternina, O. R. Pupo, A. Bula, F. Acuña (2012). edge transfer to industrial scale. CFD simulation of multiphase fl ow in an airlift column photobioreactor for the cultivation of microalgae. ASME Conclusion 2012 6th International Conference on Energy Sustainabil- The new multifunctional Algae Lab” was ity, Parts A and B. 16: 1253. Gonçalves, V., C. Hinterholz, M. Klen, A. Módenes, A. Krou- established by our research team in West Parana mov, D. Trigueros (2017). Extraction procedures of carot- State University of Toledo. Our research team has enoids and fi cobilines from microalga Scenedesmus sp. set ambitions goals for the studies which will be cultures. XXI Simpósio nacional de bioprocessos – XII performed in it. The preliminary three-year study Simpósio de hidrólise enzimática de biomassas, Aracaju has shown that the chosen strategy works well and – BR. has highlighted new insights and new unexpected Hernández, D., B. Riaño, M. Coca, M. García-González (2015). Saccharifi cation of carbohydrates in microalgal challenging directions in algology area. biomass by physical, chemical and enzymatic pre-treat- ments as a previous step for bioethanol production. Chem. Acknowledgements Eng. J. 262: 939-945. The authors would like to give special thanks Klassen, V., O. Blifernez-Klassen, Y. Hoekzema, J. Mussg- to CNPq (National Counsel of Technological and nug, O. Kruse (2015). A novel one-stage cultivation/fer- Scientifi c Development) for the Special Visiting mentation strategy for improved biogas production with microalgal biomass. J. Biotechnol. 215: 44-51. Researcher Fellowship for Alexander Dimitrov Kokkinos, N., A. Lazaridou, N. Stamatis, S. Orfanidis, A. Kroumov, Ph.D. and for the Post-Doctoral Fellow- Mitropoulos, A. Christoforidis, N. Nikolaou (2015). Bio- ship for Adilson Ricken Schuelter, Ph.D. through diesel production from selected microalgae strains and the program “Science without borders” under the determination of its properties and combustion specifi c grant #400771/2014-4, and to CAPES for the doc- characteristics. J. Eng. Sci. Technol. Rev. 8: 1-6. toral fellowship for Camila Larissa Hinterholz, Krishna, R., J. M. Van Baten, M. I. Urseanu (2000). Three- phase Eulerian simulations of bubble column reactors op- M.Sc. erating in the churn-turbulent regime: A scale up strategy. Chem. Eng. Sci. 55: 3275-3286. References Kroumov A., A. Módenes, D. Trigueros (2015). A complex Bitog, J. P., I. B. Lee, C. G. Lee, K. S. Kim, H. S. Huang, S. theoretical approach for algal medium optimization for W. Hong, I. H. Seo, K. S. Kwon, E. Motafa (2011). Appli- CO2 fi xation from fl ue gas, Acta Microbiol. Bulg. 31: 61- cation of computational fl uid dynamics for modeling and 70. designing photobioreactors for microalgae production: A Kroumov, A. D., A. N. Módenes, D. E. G. Trigueros, F. R. review. Comput. Electron. Agric. 76: 131-147. Espinoza-Quinnes, C. E. Borba, F. B. Scheufele, C. L. Borowitzka, M. A., N. R. Moheimani (2013). Sustainable bio- Hinterholz (2016). A systems approach for CO2 fi xation fuels from algae, Mitig. Adapt. Strategies Glob. Chang. from fl ue gas by microalgae – theory review. Process Bio- 18: 13-25. chem. 51: 1816-1831. Brennan, L., P. Owende (2010). Biofuels from microalgae – Kroumov A., F. Scheufele, D. Trigueros, A. Modenes, M. a review of technologies for production, processing, and Zaharieva, H. Najdenski (2017). Modeling and tech- extractions of biofuels and co-products, Renew. Sustain. no-economic analysis of algae for bioenergy and coprod- Energy Rev. 14: 557-577. ucts, in: Rastogi, R., D. Madamwar, A. Pandey (Eds.), Al- Cheng, H., L. Whang, K. Chan, M. Chung, S. Wu, C. Liu, W. gal Green Chemistry: Recent Progress in Biotechnology, Lee (2015). Biological butanol production from microal- Elsevier, pp. 201-241. gae-based biodiesel residues by Clostridium acetobutyli- Macintyre, H., T. Kana, T. Anning, R. Geider (2002). Photo- cum. Bioresour. Technol. 184: 379-385. acclimation of photosynthesis irradiance response curves Demirbas, A. (2010). Use of algae as biofuel sources. Energ. and photosynthetic pigments in microalgae and cyanobac- Convers. Manage 51: 2738-2749. teria. J. Phycol. 38: 17-38. Dufossé, L., P. Galaup, A. Yaron, S. Arad, P. Blanc, K. Murthy, Malcata F. (2011). Microalgae and biofuels: a promising part- G. Ravishankar (2005). Microorganisms and microalgae nership? Trends Biotechnol. 29: 542–549. as sources of pigments for food use: a scientifi c oddity or Maranduba, H., S. Robra, I. Nascimento, R. Da Cruz, L. Ro- an industrial reality? Trends Food Sci. Tech. 16: 389-406. drigues, J. De Almeida Neto (2016). Improving the energy Eroglu, E., A. Melis (2016). Microalgal hydrogen production balance of microalgae biodiesel: Synergy with an autono- research. Int. J. Hydrogen Energ. 41: 12772-12798 mous sugarcane ethanol distillery. Energy 115: 888-895. Fasahati, P., H. Woo, J. Liu (2015). Industrial-scale bioetha- Mendes, R., B. Nobre, M. Cardoso, A. Pereira, A. Palavra nol production from brown algae: Effects of pretreatment (2003). Supercritical carbon dioxide extraction of com- processes on plant economics. Appl. Energ. 139: 175-187. pounds with pharmaceutical importance from microalgae. Furuhashi, T., T. Nakamura, L. Fragner, V. Roustan, V. Schön, Inorg. Chim. Acta. 356: 328-334. W. Weckwerth (2016). Biodiesel and polyunsaturated fat- Milano, J., H. C. Ong, H. H. Masjuki, W. T. Chong, M. K. ty acids production from algae and crop plants - a rapid Lam, P. K. Loh, V. Vellayan (2016). Microalgae biofuels

123 as an alternative to fossil fuel for power generation. Re- Santos-Ballardo, D., S. Rossi, C. Reyes-Moreno, A. Valde- new. Sustain. Energ. Rev. 58: 180-197. z-Ortiz (2016). Microalgae potential as a biogas source: Mimouni, V., L. Ulmann, V. Pasquet, M. Mathieu, L. Picot, G. current status, restraints and future trends. Rev. Environ. Bougaran, B. Schoefs (2012). The potential of microalgae Sci. BioTechnol. 15: 243-264. for the production of bioactive molecules of pharmaceuti- Sambusiti, C., M. Bellucci, A. Zabaniotou, L. Beneduce, F. cal interest. Curr. Pharm. Biotechnol. 13: 2733-2750. Monlau (2015). Algae as promising feedstocks for fer- Mousavi, S. M., A. Jafari, S. Yaghmaei, M. Vossoughi, I. mentative biohydrogen production according to a biore- Turunen (2008). Experiments and CFD simulation of fer- fi nery approach: a comprehensive review. Renew. Sust. rous biooxidation in a bubble column bioreactor. Comput. Energ. Rev. 44: 20-36. Chem. Eng. 32: 1681-1688. Sharma, A., P. Sahoo, S. Singhal, G. Joshi (2016). Explora- Nauha E., V. Alopaeus (2013). Modeling method for combin- tion of upstream and downstream process for microwave ing fl uid dynamics and algal growth in a bubble column assisted sustainable biodiesel production from microalgae photobioreactor. Chem. Eng. J. 229: 559-568. Chlorella vulgaris. Bioresour. Technol. 216: 793-800. Neves, V., E. Sales, L. Perelo (2016). Infl uence of lipid ex- Simas-Rodrigues, C., H. Villela, A. Martins, L. Marques, P. traction methods as pre-treatment of microalgal biomass Colepicolo, A. Tonon (2015). Microalgae for economic for biogas production. Renew. Sust. Energ. Rev. 59: 160- applications: advantages and perspectives for bio-ethanol. 165. J. Exp. Bot. 66: 4097-4108. Olofi ntuyi, I. O., K. D. Oluborode, O. O. Popoola (2016). Skjånes, K., C. Rebours, P. Lindblad (2013). Potential for Green building: exploratory use of bamboo leaf ash to re- green microalgae to produce hydrogen, pharmaceuticals duce CO emission and energy conservation in concrete 2 and other high value products in a combined process. Cr. production. Eur. J. Eng. Technol. 4: 22-28. Rev. Biotech. 33: 172 – 215. Ördög, V., W. Stirk, R. Lenobel, M. Bancířová, M. Strnad, J. Studley, A., F. Battaglia (2011). CFD analyses of the mix- Van Staden, L. Németh (2004). Screening microalgae for ing characteristics in bubble column and airlift reactors. some potentially useful agricultural and pharmaceutical ASME 2011 Int. Mechanical Engineering Congr. & Expo. secondary metabolites. J. Appl. Phycol. 16: 309-314. Pasquet, V., J. Chérouvrier, F. Farhat, V. Thiéry, J. Piot, J. Bé- pp. 1–10. rard, L. Picot (2011). Study on the microalgal pigments Thepenier, C., C. Gudin, B. Sarrobert (1994). U.S. Patent No. extraction process: Performance of microwave assisted 5,338,673. Washington, DC: U.S. Patent and Trademark extraction. Process Biochem. 46: 59-67. Offi ce. Richmond, A., Z. Cheng-Wu (2001). Optimization of a fl at Thomas, D. M., J. Mechery, S. V. Paulose (2016). Carbon di- plate glass reactor for mass production of Nannochlorop- oxide capture strategies from fl ue gas using microalgae: A sis sp. outdoors. J. Biotechnol. 85: 259-269. review. Environ. Sci. Pollut. R. 23: 16926-16940. Saïdane-Bchir, F., A. El Falleh, E. Ghabbarou, M. Hamdi Torzillo, G., A. Scoma, C. Faraloni, L. Giannelli (2015). Ad- (2016). 3rd Generation bioethanol production from mi- vances in the biotechnology of hydrogen production with croalgae isolated from slaughterhouse wastewater. Waste the microalga Chlamydomonas reinhardtii. Cr. Rev. Bio- Biomass Valori. 7: 1041-1046. tech. 35: 485 – 496.

124 AACTACTA MICROBIOLOGICAMICROBIOLOGICA BULGARICABULGARICA Volume 33 / 3 (2017)

Therapeutic Alternatives to Antibiotic Administration in Veterinary Medicine

Constantin Chiurciu1, Viorica Chiurciu1, Mihai Danes2, Costin Stoica1, Gabriel Oltean1, Bogdan Frunzareanu1, Dana Banciu1, Elena Lupu1, Cristian Uluitu1, Diana Oprisiu1, Petre Stefan1, Irina Ionescu1, V alentina Filip1, Catalin Tudoran1, Ion Nicolae1, Lucia Diaconu1, Silvia Stanculescu1, Alina Radu1, Paul Chitonu1* 1Romvac Company SA, 077190 Voluntari - Ilfov, Romania 2”Spiru Haret” University, Faculty of Veterinary Medicine, Bucharest, Romania Abstract Starting from ONE HEALTH concept of integrated medicine in which human, animal and environ- mental health are approached together, this paper presents the attempts of ROMVAC Co. to reduce the risk of the occurrence and spread of antibiotic-resistant germs (ARGs) originating from the digestive tract of broiler chickens and mammary glands of dairy cows. The purpose is to demonstrate the effi cacy of alterna- tive veterinary medicines to antibiotic therapy in avian enteritis and dairy cow mastitis. Enterococcus faecium NCIMB 11181 culture at a minimum concentration of 1x108 CFU / ml; Ross 308 broiler chickens (250,000 heads); automatic dosing system in water fl ow - Dosatrom. The product was administered during the fi rst 3 days of life and the body weight evolution was monitored at 0, 7, 14, 21, 28 and 35 days. Oils with strong antibacterial and antiviral effects (oregano, thyme, pine etc.) were used by ROMVAC to produce three medicines: a) Greenvet mastirat - gel, curative, b) Ugeroclean - S, liquid soap and c) Ugeroclean - gel applied after milking. The products were administered locally to mammalian ani- mals (cattle, sheep, goats) daily for 7 days. Udder edema, milk production, dermal reaction to the product (erythema, nodules, pustules, etc.) and clinical status of the animals were daily monitored. Chickens that received probiotic had a weight gain of 68 grams / chicken (over 6 tons per 100,000 chickens) and a lower mortality rate of 0.78% (1794 chickens). E. coli and Salmonella germs have com- pletely disappeared from the digestive tract. Vegetable oil products improved clinical symptoms of mastitis, were well tolerated by animals, de- creased the intensity of erythema, improved the clinical condition of animals, maintained milk production, very few cases requiring antibiotic treatment. The product is also an insect repellent. The in vitro antiviral activity of vegetable oils on CDV paramyxovirus has also been demonstrated. Replacement of antibiotic treatment in veterinary medicine with alternative therapies avoids the occurrence and transmission to the human consumer of ARGs via chicken and milk. Keywords: ONE HEALTH concept, antibiotic resistance, avian enteritis, cow mastitis

Резюме Във връзка с концепцията на интегративната медицина за ЕДИННО ЗДРАВЕ, в която се предприема единен подход към здравето на човека, животните и околната среда, настоящата статия представя опитите на ROMVAC Co. да намали риска от появата и разпространението на резистентни към антибиотици микроорганизми, произхождащи от храносмилателния тракт на бройлерни пиле- та и млечните жлези на крави. Целта е да се демонстрира ефикасността на ветеринарни лекарства, алтернативни на антибиотичната терапия на птичия ентерит и мастита на кравите. Култури от En- terococcus faecium NCIMB 11181 при минимална концентрация 1x108 CFU / ml; бройлерни пилета Ross 308 (250,000), автоматична дозираща система във воден поток Dosatrom. Продуктът се при- лага през първите 3 дни от живота и се следи развитието на телесното тегло на 0, 7, 14, 21, 28 и 35

* Corresponding author: e-mail: [email protected]; [email protected].

125 ден. ROMVAC използват етерични масла със силни антибактериални и антивирусни ефекти (риган, мащерка, бор и др.), за производството на три лечебни препарата: a) Greenvet mastirat - gel, лечебен, b) Ugeroclean - S, течен сапун и c) Ugeroclean – гел за приложение след доене. Продуктите се прилагат локално върху бозайници (говеда, овце, кози) ежедневно в продължение на 7 дни. Ежедневно се прави проверка за едема на вимето, млекопродукция, кожни реакции към продукта (едема, нодули, обриви и т.н.). Пилетата, които са получили пробиотика, наддават на тегло 68 г/пиле (повече от 6 тона за 100 000 пилета) и са с по-ниска смъртност - 0.78% (1794 пилета). От храносмилателния им тракт напълно са изчезнали E. coli и Salmonella. Продуктите от зеленчукови етерични масла подобряват клиничните симптоми на мастита, добре се понасят от животните, намаляват интензивността на еритемата, подобряват клиничното състояние на животните, поддържат продукцията на мляко и само в единични случаи се налага приложението на антибиотици. Освен това продуктът е репелент за насекоми. Демонстрирана е също in vitro антивирусната активност на зеленчуковите масла върху CDV парамиксовирус. Чрез заместване на антибиотичното лечение във ветеринарната медицина с алтернативни терапии се избягва появата и разпростванението чрез пилетата и млякото на антибиотик-резистентни микроорганизми към консумиращите хора.

Introduction Antibiotic resistance is such a worrying phe- the risk of the occurrence and spread of antibiotic-re- nomenon worldwide that it is already being talked of sistant germs (ARGs) originating from the digestive a post-antibiotic era (Alanis, 2005). One of the many tract of broiler chickens and mammary glands of dairy causes of antibiotic resistance is the excessive and cows. The purpose is to demonstrate the effi ciency of unjustifi ed use of antibiotics in intensive animal hus- using these products as an alternative in veterinary bandry. Daily man-made products, such as meat and medicine to the excessive use of antibiotics in the milk, can be sources of muti-resistant bacteria that treatment of avian enteritis and mastitis in ruminants. arise from repeated exposure to a wide range of an- tibiotics. Materials and Methods. Devoted to the “ONE HEALTH” concept, in Bioenterom products which human, animal and environmental health forms The BIOENTEROM product was tested in an a whole, ROMVAC Co. has initiated a program to cre- industrial farm, on 234,000 Ross 308 broiler chickens, ate new products that reduce the need for antibiotics compared to a similar fl ock benefi ting from the clas- in animal husbandry. This paper presents two distinct sic probiotic free growth technology. The chickens are solutions dedicated to reducing the use of antibiotics raised in halls with the capacity of 18,000 heads/hall, in the control of intestinal infections in broiler chick- and the population density was 18 chickens/square ens and ruminants’ mastitis, the major diseases that meter. For the test lot, cultures of Enterococcus faeci- cause widespread use of antibiotics in these species um NCIMB 11181, with a minimum concentration of (Pol and Ruegg, 2007). ROMVAC Co. has developed 1x108 CFU / ml, were administered in drinking wa- the BIOENTEROM product, a probiotic contain- ter in a concentration of 0.2-2%, using DOSATRON, ing live bacteria of the genus Enterococcus faecium an automatic drug dosing system for fl ow water. The strain NCIMB 11181, usable from the fi rst day of life product was administered daily in the fi rst 3 days of of broiler chickens, for the rapid colonization of the life. In the control group, for the fi rst 3 days of life, digestive tube with a benefi cial fl ora, with a multipli- chickens received Enrofl oxacin 10% (1ml/l) and Colic- cation rate of 18 minutes/generation, capable to block rid (0.5ml/l) in drinking water. Average body weights cellular receptors in the gut for pathogenic bacteria. were recorded on the fi rst day and then at 7, 14, 21, 28 The Greenvet series was also produced. It is intended and 35 days. The mortality rate was also recorded and for the prevention and treatment of mastitis in rumi- bacterial examinations of intestinal fl ora were carried nants and consists of three products: Greenvet masti- out in dead chickens. rat - curative gel, b) Ugeroclean - S, liquid soap and c) Greenvet products Ugeroclean - protective gel, applicable after milking. In order to obtain GREENVET products, a They are based on very strong antibacterial vegetable three-stage process was designed: a) establishing the oils (oregano, thyme, pine, etc.). bacteriological and/or fungal profi le of mastitis in some Starting from ONE HEALTH concept, this pa- ruminant species; b) in vitro testing of substances with per presents the attempts of ROMVAC Co. to reduce antibacterial activity (Aiemsaard et al., 2011); and c)

126 clinical testing of products resulting from the combina- tion of effective components in in vitro testing. There were ruminants (bovine, ovine and goats) with mammalian clinical signs from which milk was harvested. The samples were examined bacteriologi- cally and mycologically. Isolated bacterial strains were identifi ed based on morphological and biochemical characteristics using the APIWEB (Biomerieux) and ABIS online software (www.tgw1916.net) and tested for Fig. 1. Evolution of average body weight of antibiotic sensitivity determination. Antibiotics against chickens (ordinate – average body weight in grams; which sensitivity was assessed were: Gentamycin, Ne- abscissa – age of broilers in days at the time of body weight measurement). omycin, Enrofl oxacin, Colistin Sulfate, Amoxicillin, Ampicillin, Oxitetracycline, Doxycycline, Erythromy- Of the 12 isolated bacterial strains, 3 species cin, Sulfamethoxazole + Trimethoprim, Florfenicol, are known as pathogens (P. aeruginosa, E. coli, S. Novobiocin, Lincomycin + Spectinomycin, Phospho- chromogenes) and 4 are opportunistic pathogens (S. muscine. Anti-septic oils (pine, juniper, cypress, thyme, xylosus, S. lugdunensis, B. licheniformis, K. vari- oregano, peppermint oil), salvia extract, honey, propo- ans). Following the mycological examination, Pen- lis, kaolin, collagen, vitamin D2, have been used as an- icillium spp. was isolated from a bovine milk sam- tibacterial and healing substances. Of these, 8 combina- ple and Penicillium spp. and Cladosporium spp. tions were performed which were subjected to in vitro were isolated from another bovine milk sample. In testing of the bactericidal effect. The fi nal products the rest of the samples (10) mycological examina- were based on the most effective formulas. tion was negative. In vitro testing of formulations obtained Results and Discussion Antimicrobial activity testing of the 8 com- Bioenterom products binations of active substances (P1-P8 products) Comparative analysis of the results revealed was performed against 6 isolated microbial species differences in weight and mortality rates. The data are Table 2. Evolution of broiler mortality represented in the tables and diagrams below. 14 21 28 35 Comparative analysis of body weight gain of Variant 7 days chickens show, at 35 days, an average increase of 68 g days days days days in the group that received BIOENTEROM compared Control 0.92% 1.25% 1.69% 2.12% 2.58% to the control group, which, for a number of 100,000 BIOENTEROM 0.41% 0.74% 1.15% 1.45% 1.81% chickens, is an increase of more than 6 tons of meat (Table 1, Fig. 1). from ruminant mastitis, using the dilution meth- od. Minimum Inhibitory Concentration (MIC) is Table 1. Evolution of average body weight of the concentration at which an antibacterial agent chickens 0 7 14 21 28 35 Variant days days days days days days Control 41.5 208 505 992 1500 1984 BIOENTEROM 41.5 216 526 1031 1521 2052 Тhere is a reduction in mortality in the group re- ceiving the BIOENTEROM probiotic by 0.78% com- pared to the control group. Also, the bacteriological examination revealed that the BIOENTEROM group did not show germs of the genus Salmonella and en- Fig. 2. Evolution of broiler mortality (ordinate – teropathogens Escherichia coli (Table. 2, Fig. 2). rate of mortality (%); abscissa – age of broilers in days at the time of mortality measurement. Greenvet products The results obtained from the bacteriological, completely inhibits the growth of the test microor- mycological and antibiotic sensitivity examinations ganism. Serial dilutions of the antibacterial agent are presented in Table 3. were performed in the liquid culture medium (BHI

127 Table 3. Results of bacteriological, mycological and antibiotic sensitivity examinations No. Bacteriological Antibiotic sensitivity chart Mycological exam exam 1. Staphylococcus Sensitive: FOS, FFC, CN, LS, TY, SXT negative spp., non- Moderate: ENR, NV, AML hemolytic Resistant: DOX, OT, E 2. S. lugdunensis Sensitive: LS, CN, FFC, FOS, ENR, SXT, TY negative Moderate: N, AML Resistant: OT,DOX, E, AMP, AML, NV, E 3. Staphylococcus Sensitive: SXT, AMP, E, CN, ENR, FFC, N, negative spp., non- DOX, LS, E hemolytic Moderate: NV Resistant: AML 4. S. xylosus Sensitive: E, AML, AMP,SXT, CN, FFC, ENR, negative LS, OT, DOX, N Moderate: Resistant: FOS, NV 5. S. chromogenes Sensitive: E, AML, AMP,SXT, CN, FFC, FOS, negative ENR, LS, DOX, N Moderate: Resistant: NV 6. S. chromogenes Sensitive: CN, FOS, FFC, ENR, NV, SXT Penicillium Moderate: LS Resistant: OT, DOX, N, AML, AMP, E 7. E. coli Sensitive: CN, FOS, ENR, OT, DOX, N, CT, negative AML Moderate: FFC Resistant: LS, AMP, E, SXT 8. Bacillus Sensitive: CN, FFC, FOS, ENR, OT, LS, DOX, negative licheniformis N, AML Moderate: NV Resistant: E, AMP 9. S. xylosus Sensitive: AML, E, SXT, LS, FFC, FOS, ENR, Penicillium, OT, LS, DOX, N Cladosporium Moderate: Resistant: NV, AMP 10. Staphylococcus Sensitive: CN, FFC, FOS, ENR, LS, DOX, N, negative spp., hemolytic SXT,NV Moderate: AML Resistant: OT, AMP, E 11. P. aeruginosa Sensitive: CN, FOS, ENR, LS, CT negative Resistant: OT, AMP, AML, DOX, N, SXT, NV 12. Kocuria varians Sensitive: ENR, OT, FOS, DOX, AML, AMP, negative SXT, G,FFC Moderate: N Resistant: NV

Explanation: CN - Gentamicin, N - Neomycin, P - Penicillin, ENR - Enrofl oxacin, AML - Amoxicillin, AMP - Ampicillin, CT - Colistin, DOX - Doxycycline, OT - Oxytetracycline, SXT - Sulfamethoxazole + Trimeth- oprim, LS - Lincomycin + Spectinomycin, FOS - Fosfomycin, FFC - Florfenicol, NV - Novobiocin.

128 glucose broth, red-phenol), to which a suspension product with external application, curative in the of microorganisms was added. After an incubation treatment of ruminant mastitis - especially for the in- of 18-24 h, the MIC was identifi ed as the minimal cipient forms previously treated with various drugs antibacterial agent concentration at which bacterial containing antibiotics. The product contains: essen- growth did not occur. The MIC is considered to be tial oils (pine, thyme, oregano, and mint), kaolin, the concentration of the antimicrobial agent in the collagen, vitamin D2, natrosol, deionized water. The last tube, where there was no change in color from following formula - at work - will additionally con-

Table 4. Results of antimicrobial activity testing in vitro

MIC of antimicrobial active substances Microorganisms P1 P2 P3 P4 P6 P7 P8 E. coli 1/16 0 1/8 1/16 1/16 1/16 1/16 S. aureus 1/16 0 1/4 1/4 1/16 1/16 1/4 Streptococcus agalactiae 1/16 0 1/16 1/16 1/16 1/32 1/16 Enterobacter cloacae 1/16 0 1/8 1/8 1/16 1/16 1/16 Streptococcus uberis 1/16 0 1/16 1/16 1/16 1/16 1/4 B. licheniformis 0000000 red to yellow. The results are shown in Table 4. tain different amounts of honey and propolis. P1 and P6 products showed high and constant The product restores the elasticity of the ud- antibacterial activity (1/16 dilution) versus E. coli, der, prevents its infl ammation, moisturizes and re- S. aureus, S. agalactiae, S. uberis and E. cloacae. vitalizes the skin, improves circulation, prevents P3 and P4 had a relatively high antibacterial activity, irritation during milking, reduces edema and he- more intense against S. agalactiae (1/16), averaging matoma, also causes a signifi cant increase in milk against Enterobacter (1/8) and lower than S. aureus production. It is recommended for the treatment of (1/4). P7 showed high activity against the tested mi- incipient forms - curative or advanced - adjuvant, croorganisms (except B. licheniformis), the highest for classical treatment of cattle, buffaloes, goats, activity (1/32) against to Streptococcus agalactiae. sheep, swine, canines etc. P8 showed higher activity (1/16) than E. coli, E. Apply to the entire breast skin or only to the cloacae and S. agalactiae, lower (1/8) than S. au- affected quarter, whenever it is needed or after each reus and S. uberis, and absent from B. licheniformis. milking, for 2-3 days as such or complementary to None of the products had activity against B. licheni- the usual treatment depending on the condition of formis. Product P2 did not have microbial activity the condition as mentioned above. against any tested species. 2. Ugeroclean S - liquid soap is a veterinary The P1, P6, P7 products (but also P3, P4, P8) product with external application. In milking hy- could be used to prevent/control infections with mi- giene, an important role is given to the washing and croorganisms resistant to Oxitetracycline, Neomy- disinfection solution before milking. There are a cin, Gentamycin, Erythromycin or other antibiotics. large number of washing and disinfecting agents on Clinical testing of the products obtained com- the market before milking. These agents are based pared to classical treatment formulas on chemicals having a disinfecting or surfactant From the list of volatile oils tested in the lab- role for washing. Over time, chemicals are losing oratory, it was chosen those with a pronounced an- their effectiveness against increasingly resistant tibacterial activity (oregano, thyme, pine etc.) from bacterial strains. For this reason, GREENVET has which ROMVAC Co. produced three new drugs: a) a attempted to test formulations of washing agents curative medicinal product - Greenvet mastitrat - gel, based on herbal extracts and volatile oils. b) liquid soap - Ugeroclean - S, used to clean the ud- The product contains volatile oils with an- der before milking and c) protective gel - Ugeroclean tiseptic role (pine, juniper, and cypress), sage ex- - G, a formula applied after milking to form a protec- tract, fl axseed oil, honey, propolis extract, and sur- tive layer at the nipple level (Adukwu et al., 2012). factants. Also, honey and propolis extract have a 1. Greenvet mastitrat - gel - is a veterinary very good antiseptic action.

129 3. Ugeroclean G - is a veterinary product with ed in higher weight gains, lower mortality losses, external application after milking, designed to form reduced the spread of pathogenic microorganisms a protective layer at the nipple level, in order to in the environment, and the development of antibi- maintain the health of the udder. These substances otic-resistant strains. make a protective fi lm, stopping the penetration of GREENVET products, applied according to pathogenic microorganisms inside the udder. The recommendations, produced positive results. The Ugeroclean-G composition consists of: volatile products are effective in maintaining the healthy oils (pine, juniper, and cypress), natrosol, menthol, condition of the udder and protect the animal from sage infusion, honey, propolis extract. It is recom- insects biting. Products are well tolerated by the mended to apply a thin fi lm to the nipple, which animal body with no side effects on the skin. Milk has antiseptic activity and contributes to the healing production was not adversely affected after admin- of the cutaneous micro-lesions occurring during the istration. milking. Replacement of antibiotic treatment in veteri- The products were tested in the farm on a nary medicine with alternative therapies is not only herd of 345 cattle, of which: milk cows -190 heads, possible (Duval, 1995), but gives the advantage to pregnant heifers - 30 heads, youth 12 - 18 months avoid the occurrence and transmission of ARGs to - 35 heads, youth 6 - 12 months - 30 heads, calves the human consumer via chicken and milk. 0 - 6 months - 60 heads. Approximately 8 to 10% of dairy cows had Acknowledgements udder problems. Among the causes were local The research was carried out under the OLI- microbism, mechanical milking system failures, GOLAC - EUROSTARS EUREKA program (PN- chemicals used for disinfection, lack of movement, II-PT-PCCA-2013-4-0415), Contract no. 155/2014 environmental factors (rainy weather and lower or and GREENVET - PARTNERSHIP program (PN- very high temperatures) as well as high milk pro- II-PT-PCCA-2013-4), Contract no. 155/2014, duction. At the end of the administration period, funded by the Romanian Ministry of Research and the clinical status of most animals was found to Innovation- UEFISCDI and ROMVAC Company. improve. In the early mastitis forms, it is effective when administered in a timely manner, with respect References to indications, and successfully replaces the use Adukwu E. C., S. C. H. Allen, C. A. Phillips (2012). The an- chemotherapy or antibiotics. Thanks to its compo- ti-biofi lm activity of lemongrass (Cymbopogon fl exuosus) sition of essential oils, the product also possesses and grapefruit (Citrus paradisi) essential oils against fi ve strains of Staphylococcus aureus. J. Appl. Microbiol. 113 repellent activity for insects reducing the risk of (5): 1217–1227. disease spread by insect biting. Aiemsaard J., S. Aiumlamai, C. Aromdee, S. Taweechaisu- papong, W. Khunkitti (2011). The effect of lemongrass Conclusions oil and its major components on clinical isolate mastitis The preventive use of the BIOENTEROM pathogens and their mechanisms of action on Staphylo- probiotic in broiler ensures rapid colonization of coccus aureus DMST 4745. Res. Vet. Sci. 91 (3): e31-e37. Alanis A. J. (2005). Resistance to antibiotics: are we in the the digestive tract with benefi cial fl ora, blocks the post-antibiotic era? Arch. Med. Res. 36 : 697–705. development of pathogenic bacteria, effectively Duval J. (1995). Treating mastitis without antibiotics. Ecolog- combats bacterial enteritis, removing E. coli and ical Agriculture Projects. AGRO-BIO - 370 - 11E, McGill Salmonella from the digestive tract. Also, protect- University Canada. http://eap.mcgill.ca/agrobio/ab370- ing the intestinal mucosa by forming a biofi lm at 11e.htm. this level reduces the absorption of toxins in the Pol, M., P. L. Ruegg (2007). Treatment practices and quantifi - cation of antimicrobial drug usage in conventional and or- digestive tract. The use of BIOENTEROM result- ganic dairy farms in Wisconsin. J. Dairy Sci. 90: 249-261.

130 AACTACTA MICROBIOLOGICAMICROBIOLOGICA BULGARICABULGARICA Volume 33 / 3 (2017)

Investigation into the Antimicrobial Activities of Tincture Prepared from Twenty Six Plants Growing in Macedonia

Natalija Atanasova-Pancevska1*, Dzoko Kungulovski2

1Department of Microbiology and Microbial Biotechnology, Institute of Biology 2Faculty of Natural Sciences and Mathematics, “Ss. Cyril and Methodius” University, Skopje, Macedonia

Abstract Antibiotic resistance has become a global concern. In recent years there has been increasing inci- dence of multiple resistance in human pathogenic microorganisms, largely due to the indiscriminate use of commercial antimicrobial drugs commonly employed in the treatment of infectious diseases. This has forced scientists to search for new antimicrobial substances from various sources like medicinal plants. The study was designed to determine the antimicrobial properties of a tincture prepared from 26 plants growing in Macedonia. The antimicrobial potential of the tincture was evaluated using the mi- cro-broth dilution method using 96-well microtiter plates, which enabled determination of the minimal inhibitory concentration (MIC) and minimal bactericidal concentration (MBC) or minimal fungicidal con- centration (MFC). The tincture was subjected to serial dilutions in descending concentrations starting from a concentration of 50% and fi nishing with a concentration of 0.39%. Thirteen reference bacterial strains and eight fungal strains were used. Generally, the tincture was found to be active, with MIC ranging from 0.39 to 25%, and with MBC and MFC ranging from 0.78 to 50%. However, of the tested fungi, Fusarium sp. and A. niger ATCC 1052 were found to be the most resistant of the examined microorganisms, the most resistant appeared to be P. aeruginosa ATCC 9027 and S. enteridis FNS-BCC 98. The present study suggests that the tincture from these plants is a potential source of natural antibac- terial and antifungal agents. After this screening experiment, further work should be performed to describe the antimicrobial activities in more detail. Keywords: antimicrobial, tincture, 96-well microtiter plates

Резюме Резистентността към антибиотици се превърна в глобален проблем. През последните години се наблюдава нарастваща честота на множествена резистентнос на патогенните микроорганизми по човека. Този феномен до голяма степен се дължи на безразборното използване на търговски анти- микробни средства при лечението на инфекциозни заболявания. Това принуждава учените да търсят нови антимикробни вещества от различни източници като напр. лечебните растения. Настоящото проучване е предназначено да определи антимикробните свойства на тинктура, приготвена от 26 растения, отглеждани в Македония. Антимикробният потенциал на тинктурата се оценява по метода за разреждане на микроорганизмите, използвайки микротитърни плаки с 96 ямки, които позволяват определянето на минимална инхибираща концентрация (MIC) и минимална бактерицидна концентрация (MBC) или минимална фунгицидна концентрация (MFC). Тинктурата се подлага на серийни разреждания в низходящи концентрации, започвайки от концентрация 50% и завършваща с концентрация 0.39%. Използвани са тринадесет референтни бактериални щамове и осем гъбични щама. Установено е, че тинктурата проявява антимикробна активност. Определената MIC варира от

* Corresponding author: Natalija Atanasova-Pancevska E-mail: [email protected]

131 0,39 до 25%, а MBC и MFC варират от 0,78 до 50%. Резултатите, обаче показват, че от изследваните микроорганизми най-резистентни са гъбите Fusarium sp. и A. niger АТСС 1052, а от бактериите - P. aeruginosa АТСС 9027 и S. enteridis FNS-BCC 98. Настоящото проучване показва, че тинктурата от тези растения е потенциален източник на естествени антибактериални и противогъбични средства. След този скринингов експеримент трябва да се извърши по-нататъшна работа, за да се опишат антимикробните дейности по-подробно.

Introduction The use of plants for treating diseases is as According to the WHO, traditional medicine old as the human species. For centuries, the thera- includes health practices, approaches, knowledge peutic properties of various medicinal plants have and beliefs incorporating plants, animals and been used to treat human diseases. It has been es- mineral based medicine, spiritual therapies, manual timated that between 60-90% of the populations of techniques and exercises, applied singularly or in developing countries use traditional and botanical combination to treat, diagnose and prevent illnesses medicines almost exclusively and consider them and maintain well-being. The therapeutic use of to be a normal part of primary healthcare (WHO, natural products is the early medical practice. To 2002). date, in the world there are more than 85,000 plant

Table 1. Evaluated plants in the study.

Common name Latin binomial name Family Plant part 1 st john’s-wort Hypericum perforatum Hypericaceae fl owers 2 yarrow Achillea millefolium Asteraceae leaves 3 european centaury Centaurium erythraea Gentianaceae fl owers 4 milk thistle Marianum silybum Asteraceae fl owers 5 greater celandine Chelidonium majus Papaveraceae leaves 6 white birch tree Betula alba Betulaceae leaves 7 blackberry Rubus fruticosus Rosaceae leaves 8 common horsetail Equisetum arvense Equisetaceae aerial part 9 smooth rupturewort Herniaria glabra Caryophyllaceae aerial part 10 summer savory Satureja hortensis Lamiaceae leaves 11 common nettle Urtica dioica Urticaceae leaves 12 great yellow gentian Gentiana lutea Gentianaceae leaves 13 common agrimony Agrimonia eupatoria Rosaceae aerial part 14 wall germander Teucrium chamaedrys Lamiaceae aerial part 15 breckland wild thyme Thymus serpyllum Lamiaceae leaves 16 mountain germander Teucrium montanum Lamiaceae aerial part 17 common dandelion Taraxacum offi cinale Asteraceae fl owers 18 horse chestnut Aesculus hippocastanum Sapindaceae fl owers 19 white man’s foot Plantago major Plantaginaceae leaves 20 lemon balm Melissa offi cinalis Lamiaceae leaves 21 sage Salvia offi cinalis Lamiaceae leaves 22 dog rose Rosa canina Rosaceae fl owers 23 shepherd’s purse Capsella bursa-pastoris Brassicaceae leaves 24 common knotgrass Polygonum aviculare Polygonaceae aerial part 25 peppermint Mentha piperita Lamiaceae leaves 26 clove Eugenia caryophyllata Myrtaceae fl ower buds

132 species that have been documented for medical use. latest edition of the European Pharmacopoeia. This indicates that plant-derived natural products hold Each of the dried herbs was mixed with ethanol great promise for the discovery and development of 35% (V/V) in a 1 to 10 ratio (10 g herbal drug per new pharmaceuticals against diverse human ailments 100 ml ethanol) and allowed to stand for 5 days (Qurishi et al., 2010). in the dark at room temperature with occasional The expanding bacterial resistance to antibiotics shaking; then they were fi ltered and combined. has become a growing concern worldwide (Gardam, Then the tincture was stored under refrigeration at 2000). Increasing bacterial resistance is prompting a 4oC for further studies. resurgence in research of the antimicrobial role of herbs against resistant strains (Hemaiswarya et al., 2008; Test Microorganisms Alviano and Alviano, 2009). A vast number of medicinal Antimicrobial activities were tested against plants have been recognized as valuable resources of thirteen bacteria and eight molds (Table 2). The natural antimicrobial compounds (Mahady, 2005). microorganisms were provided from the collec- The screening of plant products for antimicro- tion of the Microbiology Laboratory at the Faculty bial activity have shown that the higher plants repre- of Natural Sciences and Mathematics in Skopje. sent a potential source of novel antibiotic prototypes (Afolayan, 2003). Culture Media The aim of this study was comparison of a spec- Test bacteria were cultured in Mueller-Hin- trum of antimicrobial properties of a tincture prepared ton broth and Mueller-Hinton agar (Merck, from 26 plants growing in Macedonia, to create a re- Darmstadt, Germany), and for the molds Sab- serve for new sources of antimicrobial agents, some of ouraud Dextrose Broth and Sabouraud Dextrose which may be extracts from plants. agar (Merck, Darmstadt, Germany) was used.

Table 2. Test microorganisms used in the study. Bacteria Molds 1 Bacillus subtilis ATCC 6633 Aspergillus ochraceus 2 Bacillus pumilus NCTC 8241 Alternaria alternata 3 Bacillus sp. Fusarium sp. 4 Staphylococcus citrus Botrytis cinerea 5 Staphylococcus albus Penicillium sp. 6 Staphylococcus aureus Plasmopara viticola 7 Micrococcus luteus Aspergillus niger ATCC 1052 8 Listeria monocytogenes Penicillium commune 9 Sarcina lutea 10 Escherichia coli ATCC 8739 11 Pseudomonas aeruginosa ATCC 9027 12 Salmonella typhimurium 13 Salmonella enteridis

Materials and Methods Standardization of Microbial Suspension Processing of medicinal plants Microbial suspension was prepared by The whole plant or parts of plants (Table 1) the direct colony method. The turbidity of the were used to prepare extracts for the study. The plants initial suspension was adjusted by compari- collected were washed with water to remove the soil son with 0.5 McFarland’s standard (Andrews, and dust particles. Then they were dried in a thorough- 2005). The initial suspension contained about ly shaded place, and blended to form a fi ne powder 108 colony forming units (CFU)/mL. and stored in airtight containers. Microdilution Method Preparation of tinctures The antimicrobial activities of the tincture The tinctures were prepared according to the were assessed using the microdilution method with

133 Table 3. Antimicrobial activity of tincture against test Gram-positive and Gram-negative bacteria. Bacteria MIC1 MBC2 Gram-positive bacteria B. subtilis ATCC 6633 25 50 B. pumilus NCTC 8241 12.5 25 Bacillus sp. 12.5 25 S. citrus 0.39 0.78 S. albus 6.25 25 S. aureus ATCC 6.25 12.5 M. luteus 3.125 6.25 L. monocytogenes 12.5 25 S. lutea 0.39 6.25 Gram-negative E. coli ATCC 8739 6.25 12.5 P. aeruginosa ATCC 9027 25 50 S. typhimurium 12.5 25 S. enteridis 25 50 1MIC= Minimum inhibitory concentration (% tincture, V/V) 2MBC= Minimum bactericidal concentration (% tincture, V/V) resazurin as an indicator of microbial growth (Sarker Results and Discussion et al. 2007). The antimicrobial assay was performed Medicinal plants have generated the interest by using a sterile 96-well plate, and the minimum of man for therapeutic values chiefl y because of the inhibitory concentration (MIC) and minimum presence of secondary metabolites. It is obvious that bactericidal/fungicidal concentration (MBC/ MFC) plants have their own builtin defense mechanism values were determined. The test plates were against infection by almost all microorganisms. prepared by dispensing 50 μL of Mueller-Hinton The antimicrobial properties of plant extracts, broth/ Sabouraud dextrose Broth into each well. A therefore, are a result of the presence of secondary volume of 50 μL from the stock solution of tested metabolites, such as alkaloids, phenols, fl avanoids, tincture was added into the fi rst column of the plate terpenoids, essential oils etc (Cowan, 1999). and then two-fold serial dilutions of extracts were The present study offers some interesting performed. Each test plate included growth control aspects about the antimicrobial activity of etha- and sterility control. MIC was defi ned as the lowest nolic plant preparations in vitro.The tinctures’ an- concentration of tested tincture that prevented a timicrobial activity was evaluated by determining resazurin color change from blue to pink. All tests the minimum inhibitory concentration (MIC) and were performed in triplicate and MIC values were minimum bactericidal (MBC) and fungicidal con- constant. centration (MFC). We used 96-well microplates The wells that demonstrated inhibitory ac- disposed in 12 columns (1 to 12) and eight lines (A tivities were further tested for bactericidal/ fungi- to H). The tested tincture was assessed for its anti- cidal activity. A sample from each well that tested bacterial properties against all test Gram-positive positive for inhibitory activity was inoculated on and Gram-negative bacteria. The resulting data are fresh sterile Mueller-Hinton agar/Sabouraud dex- presented in Table 3. trose Agar plates and incubated additionally for 24 Our results showed that the tincture was h at 37oC for bacteria, and 5 days at 25oC, for molds. active against all the bacteria used. However, the Absence of colonies was regarded as positive for power of bacterial growth inhibition depended on bactericidal/fungicidal activity, while growth of the bacterial species. In most cases the tincture colonies was regarded as negative. MBC/ MFC was found to be active with MICs ranging from was defi ned as the lowest concentration of the tinc- 6.25-12.5 %. Only S. citrus and S. lutea were more ture that resulted in microbial death. All tests were sensitive, with MICs of 0.39%. The most resistant performed in triplicate and MBC/MFC values were bacteria were B. subtilis ATCC 6633, P. aeruginosa constant. ATCC 9027 and S. enteridis, all with MICs of 25%.

134 Furthermore, the activity of the tincture was exam- The tincture was assessed also for its anti- ined in detail determining the minimal bactericidal fungal properties against eight test molds. The re- concentrations. Similar sensitivity was shown by sulting data are presented in Table 4. According to the tested bacteria when we observed MBCs. The these results, the most sensitive molds, with MIC tincture exerted good to moderate effects against of 0.39% and MFC of 0.78%, were A. ochraceus, Gram-positive and Gram-negative bacteria. How- B. cinerea and P. commune. However, Fusarium sp. ever, the presented results show that Gram-positive and A. niger ATCC 1052 were the most resistant bacteria were more sensitive than Gram-negative molds, with MFC more than 50% tincture. Despite bacteria. Cos et al.(2006), reported that Gram-nega- these fi ndings, from the results it can be concluded tive bacteria are generally more resistant compared that this tincture showed antifungal activity and can to the Gram-positive ones. Also, Shan et al. (2007), be used for effective control of molds. This study reported that Gram-positive bacteria were generally has paved the way for the development of a bio- more sensitive to the tested extracts than Gram-neg- active natural product with phytosanitary applica- ative. A possible explanation for these observations tions, with the added benefi ts of being an environ- may lie in the signifi cant differences in the outer mentally safe and economically viable product. layers of Gram-negative and Gram-positive bacte- ria. Gram-negative bacteria possess an outer mem- Table 4. Antimicrobial activity of tincture against brane and a unique periplasmic space not found in test molds. Gram-positive bacteria (Duffy and Power, 2001). Molds MIC1 MFC2 The resistance of Gram-negative bacteria to- A. ochraceus 0.39 0.78 wards antibacterial substances is related to the hy- A. alternata 25 50 drophilic surface of their outer membrane, which is rich in lipopolysaccharide molecules, presenting Fusarium sp. >50 >50 a barrier to the penetration of numerous antibiotic B. cinerea 0.39 0.78 molecules. It is also associated with the enzymes in Penicillium sp. 25 50 the periplasmic space, which are capable of breaking P. viticola 6.25 12.5 down the molecules introduced from outside (Nikai- A. niger ATCC 1052 >50 >50 do, 1994; Gao et al., 1999). Gram-positive bacteria P. commune 0.39 0.78 do not possess this type of outer membrane and cell 1MIC= Minimum inhibitory concentration (% tincture, V/V) wall structure. Antibacterial substances can easily 2MFC= Minimum fungicidal concentration (% tincture, V/V) destroy the bacterial cell wall and cytoplasmic mem- brane and result in a leakage of the cytoplasm and its According to our fi ndings, the tincture showed coagulation (Kalemba and Kunicka, 2003). a good microbicidal effect and in vitro activity, so Plant diseases create challenging problems it has the potential of a natural antimicrobial agent in commercial agriculture and pose real econom- against both bacteria and molds. ic threats to both conventional and organic farm- Unlike modern drugs that invariably comprise ing systems. Disease management is complicated a single active species, herb extracts and/or prescrip- by the presence of multiple types of pathogens. For tions contain multiple active constituents. Natural any one crop the grower must deal with a variety of compounds contained in these “herbal cocktails” can fungi, bacteria, viruses and nematodes. This situa- act in a synergistic manner within the human body, tion is even more complicated for organic vegetable and can provide unique therapeutic properties with growers because they usually produce a wide array minimal or no undesirable side-effects (Kaufman et of vegetable crops and are prohibited from applying al., 1999). conventional synthetic fungicides. The world mar- A screening of biological properties of medical ket continues to be extremely competitive and con- plant tinctures demonstrated that herbal extractions tinues to require that growers supply high-quality are a potential reserve for the creation of new sourc- diseasefree produce with an acceptable shelf life. es of antimicrobial agents, particularly for antibiot- Disease management is therefore a critical consid- ic-resistant clinical strains of microorganisms, which eration in organic vegetable production. The use of are formed under the constant infl uence of synthetic natural products for the control of fungal diseases and semi-synthetic drugs. in plants is considered as an interesting alternative to synthetic fungicides due to their less negative im- pacts on the environment (Cao and Forrer, 2001).

135 Conclusions Gao, Y., M. J. van Belkum, M. E. Stiles (1999). The outer The use of crude extracts of plant parts and phyto- membrane of Gram-negative bacteria inhibits antibacte- chemicals of known antimicrobial properties can rial activity of brochocin-C. Appl. Environ. Microb. 65: 4329–4333. be of great signifi cance in therapeutic treatments. Gardam, M. A. (2000). Is methicillin-resistant Staphylococ- In recent years, a number of studies have been con- cus aureus an emerging community pathogen? A review ducted in various countries to prove such effi cien- of the literature. Can. J. Infect. Dis. 11(4): 202-211. cy. Many plants have been used because of their Hemaiswarya, S., A. K. Kruthiventi, M. Doble (2008). Syn- antimicrobial traits, which are due to the secondary ergism between natural products and antibiotics against metabolites synthesized by the plants. These prod- infectious diseases. Phytomedicine 15: 639–652 Kalemba, D., A. Kunicka (2003). Antibacterial and antifun- ucts are known by their active substances like phe- gal properties of essential oils. Curr. Medic. Chem. 10: nolic compounds, which are part of essential oils, 813–829. as well as of tanning agents. Kaufman, P. B., L. J. Csake, S. Warber, J. A. Duke, H. L. Bri- elmann (1999). Natural products from plants. CRC Press, Boca Raton. References Mahady, G. B. (2005). Medicinal plants for the prevention Afolayan, A. J. (2003). Extracts from the shoots of Arcto- and treatment of bacterial infections. Curr. Pharm. Des. tis artotoides inhibit the growth of bacteria and fungi. 11: 2405–2427 Pharm. Biol. 41: 22-25. Nikaido, H. (1996). Outer membrane. In: Neidhardt, F. C. Alviano, D. S., C. S. Alviano (2009). Plant extracts: search for (Ed.), Escherichia coli and Salmonella typhimurium: Cel- new alternatives to treat microbial diseases. Curr. Pharm. lular and Molecular Biology. American Society for Micro- Biotechnol. 10: 106–121 biology Press, Washington, D.C., pp. 29–47. Andrews, J.M. (2005). BSAC standardized disc susceptibility Sarker, S. D., L. Nahar, Y. Kumarasamy (2007). Microtitre testing method (version 4). J. Antimicrob. Chemother. 56: platebased antibacterial assay incorporating resazurin as 60–76. an indicator of cell growth, and its application in the in Cao, K. Q., H. R. Forrer (2001). Current status and prosperity vitro antibacterial screening of phytochemicals. Methods on biological control of potato late blight (Phytophthora 42: 321–324. infestans). J. Agric. Hebei Unive. 24(2): 51–58 Shan, B., Y. Cai, J. D. Brooks, H. Corke (2007). The in vitro Cos, P., A. J. Vlietinck, D. Vanden Berghe, L. Maes (2006). antibacterial activity of dietary spice and medicinal her- Anti-infective potential of natural products: how to devel- bextracts. Int. J. Food Microb. 117: 112–119. op a stronger in vitro ‘proof-of concept’. J. Ethnopharma- Qurishi, Y., A. Hamid, M. A. Zargar, S. K. Singh, A. K. Sax- col. 106: 290–302. ena (2010). Potential role of natural molecules in health Cowan, M. M. (1999). Plant products as antimicrobial agents. and disease: Importance of boswellic acid. J. Med. Plants Clin. Microbiol. Rev. 12: 564–582. Res. 4: 2778-2785. Duffy, C. F., R. F. Power (2001). Antioxidant and antimicrobi- WHO, The world health report (2002). Reducing Risks, Pro- al properties of some Chinese plant extracts. Inter. J. Anti- moting Healthy Life microb. Agent. 17: 527–529.

136 AACTACTA MICROBIOLOGICAMICROBIOLOGICA BULGARICABULGARICA Volume 33 / 3 (2017)

Selected Lactobacillus bulgaricus and Streptococcus thermophilus Strains from Bulgarian Yogurt Demonstrate Signifi cant Anti-Infl ammatory Potential

Irina Gotova1,*, Zhechko Dimitrov1, Hristo Najdenski2 1R&D Department of LB Bulgaricum PLC, 14 Malashevska Str., 1202 Sofi a, Bulgaria 2The Stephan Angeloff Institute of Microbiology, Bulgarian Academy of Sciences, 26 Acad. Georgi Bonchev Str., 1113 Sofi a, Bulgaria Abstract In vitro tests for establishing the anti-infl ammatory potential of twenty-two previously selected Lac- tic acid bacteria (LAB) strains were carried out. The aim was to compare the anti-infl ammatory potential of Lactobacillus delbrueckii subsp. bulgaricus and Streptococcus thermophilus isolated from authentic homemade yogurt in non-industrial mountain villages in Bulgaria with selected strains originated from the intestinal tract of healthy volunteers. The assessed signal peptide associated with infl ammation was IL-8, with and without stimulation of TNF-alpha, in order to simulate infl ammatory shock in vitro. To establish the anti-infl ammatory potential of the strains, two cytokines with predominant anti-infl ammatory effects, IL-10 and TGF-beta were evaluated as well. The different cytokines were evaluated using three different analytical models, including mice splenocytes. Among the presented strains of intestinal origin only two L. gasseri, one Enterococcus faecium and one Bi fi dobacterium longum possessed simultaneously the desirable optimal cytokine profi le, where the highest induction of IL-10 was 1670.2 pg/ml (E. faecium 2092/2); the strongest reduction of IL-8 was 46.9 pg/ml (B. longum 10/48) and the induction of TGF- SS varied between 548.75 and 834.53 pg/ml. Among the strains of yogurt origin, three Lactobacillus bulgaricus and three Streptococcus thermophilus possessed concurrent or even better anti-infl ammatory profi les, where the highest induction of IL-10 was 1584.1 pg/ ml (L. bulgaricus b58); the strongest reduction of IL-8 was 46.0 pg/ml (Str. thermophilus T43) and the in- duction of TGF-SS varied between 499.96 and 841.50 pg/ml. Keywords: probiotics, Bulgarian yogurt, cytokines, infl ammation, Lactobacillus bulgaricus, Streptococcus thermophilus

Резюме Бяха извършени in vitro тестове за установяване на противъзпалителния потенциал на двадесет и два щама, предварително подбрани, млечнокисели бактерии. Целта е да се сравни противъзпали- телния потенциал на щамове Lactobacillus delbrueckii subsp. bulgaricus и Streptococcus thermophilus, изолирани от домашни кисели млека в неиндустриализирани планински райони на България с под- брани щамове с интестинален произход, изолирани от здрави доброволци. Оценените сигнални пептиди, които се свързват с процесите на възпалението са IL-8, при наличието на предварително стимулиране с TNF-alpha или без такова, с което се цели да се симулира инфламаторен шок в лабо- раторни условия. За да се установи противъзпалителния потенциал, също така бяха оценени и двата цитокина IL-10 и TGF-SS, които са с преобладаващ противовъзпалителен ефект. Различните цито- кини бяха оценени чрез използването на три различни аналитични модела, включителни спленоцити от мишки. Сред представените щамове с интестинален произход, само два L. gasseri, Enterococcus faecium и един Bifi dobacterium longum притежават едновременно желания оптимален цитокинов профил, където най-високата индукция на IL-10 е 1670,2 pg/ml (E. faecium 2092/2); най-силната редукция на

* Corresponding author Irina Gotova E-mail: [email protected]

137 IL-8 е 46,9 pg/ml (B. longum 10/48) и индукцията на TGF-SS варира в стойностите между 548,75 и 834,53 pg/ml. Сред щамовете с киселомлечен произход, три L. bulgaricus и три Str. thermophilus при- тежават конкурентни или дори по-добри противовъзпалителни цитокинови профили, където най-ви- соката индукция на IL-10 е 1584,1 pg/ml (L. bulgaricus b58); най-силната редукция на IL-8 е 46,0 pg/ ml (Str. thermophilus T43) и индукцията на TGF-SS варира в стойностите между 499,96 and 841,50 pg/ml. Introduction Although the precise cause of infl ammatory demonstrated, in-vitro (Smits et al., 2005; Hsieh et bowel disease (IBD) remains unknown, the most ac- al., 2013) and in-vivo, in various animal models (Di cepted hypothesis of pathogenesis is that dysbiosis Giacinto et al., 2005; Jeon et al., 2012; Oksaharju triggered by environmental factors in modern way et al., 2013) and clinical studies (Timmerman et al., of living rather than any specifi c pathogens may 2004; Ringel et al., 2009; Paramsothy et al., 2017). have played the primary causative role (Tong et al., Fermented food products like yogurt are important 2013; Matsuoka and Kanai, 2015; Ni et al., 2017). sources of transiting bacteria for the gastrointesti- A better understanding of the mutual interactions nal tract (GIT), delivering approximately 108 live between the microbiota and host immune system bacteria per gram (Bulgarian State Standard, 2010). would shed light on disease prevention and treat- While research on probiotics with immune modula- ment (Lin and Zhang, 2017). Cytokines are secret- tion effects is mostly focusing on isolates of intes- ed proteins that regulate and determine the nature tinal origin, relatively little is known about the ef- of immune responses. The functions of these pro- fects of the dairy bacteria that takes part of the daily teins are diverse and include participation in normal food intake of large group of the modern society. As T-cell-mediated immunity, the infl ammatory re- mentioned by Rocha et al., (2012), this contradicts sponse, cancer, autoimmunity, allergy, etc. Various to the present concept of probiotics, based on the pathologic conditions are accompanied by changes hypothesis that the live bacteria in Bulgarian yo- in cytokine levels (Borish and Rosenwasser, 1996) gurt exert health-benefi cial effects on the consumer therefore the measurement of cytokine production and longevity (Metchnikoff, 1907). The aim of this is widely used (Katial et al., 1998; Papadopoulos study was to assess in-vitro strains of intestinal and et al., 2014). In some gastrointestinal infectious yogurt origin and to compare the most promising and infl ammatory conditions, infl ammatory cells, among them in order to confi rm or reject the possi- including monocytes and activated lymphocytes, bility of anti-infl ammatory abilities of strains suit- secrete excessive infl ammatory products such as able for production of dairy foods. cell-mediated T helper type 1 (TH-1) cytokines. Pro-infl ammatory cytokines like tumor necrosis Materials and Methods factor alpha (TNF-α), IL-1, IL-6 and interferons are Bacterial strains and growth conditions among the fi rst cytokines produced in response to Lactobacillus bulgaricus and Streptococcus pathogenic bacteria (Miettinen et al., 1998). IL-8 thermophilus strains were isolated from homemade may be induced by TNF-α. The intestinal epithe- yogurt and cultivated at 37°C in MRS broth (Ox- lium is capable of releasing some pro-infl amma- oid, England) and M17 broth (Oxoid, England), tory chemokines such as IL-8 (Bai et al., 2004), respectively: L. bulgaricus b53/2; L. bulgaricus which is one of the most potent chemoattractants b144; L. bulgaricus b1997; L. bulgaricus b1972; for neutrophils. Different populations of regulatory L. bulgaricus b120; L. bulgaricus b2092; L. bulga- T cells exert their infl ammation - modulating effect ricus b58; L. bulgaricus b181; S. termophilus T69; by secreting specifi c cytokines, including IL-10 or S. termophilus T21; S. termophilus T43; S. termo- more regulatory cytokines, such as TGF-SS. IL-10 philus T59; S. termophilus T109. produced by macrophages and lymphocytes can in- Nine bacterial strains were isolated from hibit the production of TNF-α and other TH-1 type healthy volunteers (men and women, mean age cytokines, due to its function to limit and ultimately 36 years) and used for comparison. Among them terminate immune and infl ammatory responses, as the Bifi dobacterium strains (Gotova et al., 2017) pointed by Moore et al., (2001). Certain probiotic were cultivated in MRS broth with L-cysteine sup- strains help regulate infl ammation and modulate the plement under anaerobic conditions and the other host immune system via their enhanced ability to strains (Gotova et al., 2017) of intestinal origin infl uence the secretion of these important cytokines were cultivated at 37°C in MRS broth. (Plaza-Diaz et al., 2015, 2017). This effect has been For the purpose of the analyses the concen-

138 tration was adjusted to 1.109 CFU/mL by centrifu- USA). Murine ELISA kits were used for the super- gation at stationary phase and resuspended in PBS natants obtained from splenocytes. Human ELISA buffer. All strains are possession of the LB Bulgari- kits were used for the supernatants obtained from cum PLC collection. combined human epithelial and monocytic cell Cell cultures and preparation lines. Each cytokine was evaluated in three separate The Cell lines Caco-2 and HT-29 (ATCC) - analyses in the presence of control sample, contain- were cultured in media consisting of DMEM (In- ing only competent and/or epithelium cells and me- vitrogen, USA) with 10% fetal bovine serum (In- dia, but no bacteria. vitrogen, USA) and in a CO2-incubator (5% CO2) at 37°C. Results and Discussion The Cell line THP-1 (ATCC) - was cultivat- Considering the basic role of the anti-infl am- ed in media consisting of RPMI 1640 (Invitrogen, matory cytokine IL-10, the fi rst task was to select

USA) with 10% fetal bovine serum and in a CO2 - the strains with the highest induction regardless of incubator (5% CO2) at 37°C. their origin. Table 1 shows the concentrations of The two-component well-in-well cluster IL-10 evaluated on two different models, but cor- (NuncTM Lab-Tek, Thermo Scientifi c™, USA) was responding to this cytokine analytical laboratory prepared by using both HT-29 and THP-1 cell lines. approaches. Table 1 also shows the concentrations A monolayer of HT-29 was cultivated in the upper of IL-8 together with the concentrations of IL-10 wells, separated by a membrane (0.45 μm). After for each strain. fi fteen days of maturation of HT-29, the second The combined cell line model with human cell line THP-1 was cultivated in the lower well HT-29 and THP-1 (differentiated to macrophages) of the cluster. The cells were differentiated for 24 represents in vitro the interaction between these h to macrophages in the presence of 1 μg/mL phor- two types of cells - epithelium and monocytic in bol-myristate-acetate (PMA). Macrophages were the human body. The values evaluated on murine washed with PBS (pH 7.4) to remove PMA and splenocytes are close but higher as splenocytes non-attached cells. To proceed, 200 μl suspension comprise a variety of immune cell types with par- of the tested bacteria (concentration 1.109 CFU/mL) ticular interactions, which makes them more rep- was added to 1.8 mL of RPMI media and then in- resentative, considering the complicated immune cubated in the lower well, together with the macro- signaling in the body. L. gasseri G4 strain demon- phages, and in the presence of the epithelium cell strates the highest induction of IL-10 and would be line (HT-29) in the upper well. After incubation for very appropriate for anti-infl ammatory formulas,

20 h in the CO2-incubator (5% CO2) at 37°C, super- but the next task was to evaluate pro-infl ammato- natants were collected and centrifuged for measure- ry IL-8, because the optimal profi le of the selected ment of cytokines. strain should not cause additional infl ammation in the GIT. Splenocytes isolation and preparation Being the most powerful chemokine for ac- Spleens from BALB/c mice (eight weeks tivating neutrophils, the increased levels of IL-8 old) were cultivated in RPMI 1640 with 10% fetal could result in lesions in the gut epithelium. IL-8 is bovine serum. The spleens were rubbed through a a secondary and local marker of infl ammation. It is sterile sieve (mesh - 100 μm), washed with RPMI released mostly by epithelial cells. The increased in- 1640 and centrifuged at 135 g for 10 min. The pel- duction of pro-infl ammatory cytokine TNF-α could lets were resuspended in 5 mL 0.87% of ammoni- be a triggering factor for abnormal induction of um chloride for 2 min to remove erythrocytes. 100 IL-8 and infl ammatory shock in the body, although μL of splenocyte suspension were transferred into it is not an obligatory condition for increased levels each well and then 100 μL of bacterial suspension of IL-8. Therefore, the evaluation was performed was added for evaluation after incubation in a CO2 in the presence of TNF-α and compared with the

- incubator (5% CO2) for 20 h at 37°C. The super- values obtained without TNF-α, to check whether natants were collected and centrifuged for measure- there are strains that could regulate this induction. ment of cytokines. L. gasseri G4 demonstrates more than ten Cytokine assay in vitro times higher levels of IL-8 when induced with It was accomplished by the use of various en- TNF-α, compared with all the other selected strains. zyme-linked immunosorbent assay (ELISA) kits, This is why it is inappropriate for consumption by according to the producer’s instruction (Diaclone, people with intestinal infl ammation. E. faecium

139 Table 1. Concentrations of IL-10 and IL-8 induced by LAB strains and evaluated with different analytical models, pg/ml

Cytokine IL-10 IL-10 IL8 IL8 with TNF-α HT29/THP1 Splenocytes HT29/THP1 Caco-2 Strain L. gasseri G4 1860.6 ± 42,5* 1917.58 ± 48,2 271.6 ± 12.5 1482.0 ± 37.2 L. gasseri G7 1508.5 ± 39,8 1565.47 ± 38,4 52.9 ± 3.7 103.2 ± 5.8 L. gasseri G8 1489.9 ± 39,2 1546.86 ± 30,2 53.3 ± 3.9 107.0 ± 5.7 L. gasseri G11 1441.2 ± 35,4 1498.19 ± 31,6 63.7 ± 4.4 119.0 ± 5.8 E. facecium 2092/2 1670.2 ± 37,8 1727.21 ± 40,6 56.4 ± 4.2 123.4 ± 6.0 B. longum 1/2 1178.5 ± 29,8 1235.54 ± 35,0 43.5 ± 3.0 103.8 ± 5.5 B. longum 2/9 1258.0 ± 31,4 1314.98 ± 36,9 49.5 ± 3.3 110.3 ± 5.7 B. longum 3/15 1308.1 ± 30,8 1365.08 ± 41,6 58.7 ± 3.8 111.0 ± 5.9 B. longum 10/48 1449.1 ± 34,0 1506.07 ± 32,0 46.9 ± 3.2 90.2 ± 5.2 L. bulgaricus b53/2 1367.5 ± 32,6 1424.48 ± 30,6 65.7 ± 4.5 118.6 ± 5.7 L. bulgaricus b144 1400.4 ± 38,8 1457.40 ± 33,0 59.7 ± 4.7 116.3 ± 5.5 L. bulgaricus b1997 1276.6 ± 35,6 1018.69 ± 28,5 56.1 ± 4.7 132.1 ± 6.3 L. bulgaricus b1972 1067.6 ± 28,6 1333.61 ± 30,0 62.9 ± 4.9 123.6 ± 6.1 L. bulgaricus b120 930.2 ± 29,4 980.20 ± 26,3 66.6 ± 4.8 125.6 ± 6.0 L. bulgaricus b2092 945.2 ± 32,5 1002.23 ± 27,8 59.3 ± 4.5 119.8 ± 6.1 L. bulgaricus b58 1527.1 ± 40,2 1584.08 ± 36,4 78.1 ± 5.0 122.1 ± 6.2 L. bulgaricus b181 1041.8 ± 32,6 1098.84 ± 30,4 53.0 ± 3.6 110.3 ± 5.9 S. termophilus T69 1137.7 ± 38,0 1194.75 ± 38,2 46.4 ± 3.1 101.5 ± 4.8 S. termophilus T21 1331.7 ± 34,8 1388.70 ± 38,5 46.2 ± 2.9 133.0 ± 6.5 S. termophilus T43 1348.2 ± 38,6 1405.16 ± 40,2 46.0 ± 3.0 97.5 ± 5.1 S. termophilus T59 1597.9 ± 42,0 1659.70 ± 44,3 48.6 ± 3.2 103.6 ± 5.6 S. termophilus T109 973.9 ± 35,4 1033.20 ± 29,8 49.1 ± 3,5 123.0 ± 5,6 Control 4.8 ± 0.2 3.1 ± 0.1 50.4 ± 2.2 144.5 ± 4,9 Legend - *: mean values ± standard deviation

2092/2 is evaluated with the second highest result important to measure the concentrations of IL-8. for IL-10 concentration, but strains- S. thermophilus The assessment of this cytokine on one of the possi- T59 and L. bulgaricus b58, respectively, differ in- ble paths for production (epithelium/monocytic cell signifi cantly from this result but also surpass the L. line model) shows a remarkably decreased level by gasseri G7 strain and all selected Bifi dobacterium all S. thermophilus strains. The results are compet- strains. Furthermore, both yogurt strains are able to itive only with those of Bifi dobacterium strains, decrease the induction of IL-8 in the presence of where the absolute minimum measured belongs to TNF-α under the level of the control as well as L. B. longum 1/2. gasseri G7, which possesses an optimal anti-in- In addition to their ability to affect intestinal fl ammatory profi le. Another two strains - L. bul- epithelial cells and macrophages, probiotics also garicus b144 and L. bulgaricus C3/2 demonstrated help infl uence the differentiation and function of a signifi cant concentrations of IL-10 compared to number of other immune cells associated with an the selected Bifi dobacterium strains, where only B. infl ammatory response, including dendritic cells as longum 10/48 is comparable, but it appears to be well as T cells (Thomas and Versalovic, 2010; Ber- very diffi cult to cultivate in laboratory conditions. mudez-Brito et al., 2012). They also are an impor- This is an additional issue that limits the potential tant source of cytokines that help promote differ- industrial usage of strains of intestinal origin. entiation of naive T cells into Th1, Th2, Th17 or T As the main target of this study was to select regulatory cells, thus the appropriate cell-mediated a representative L. bulgaricus and S. thermophilus or humoral immune response. TGF-β is a regula- with anti - infl ammatory potential, it was equally tory cytokine which promotes the development of

140 regulatory T cells. is shown that none of the strains of intestinal origin In order to receive a more complete profi le of are able to induce the production of TGF-β in con- the anti- infl ammatory potential of certain strains, centrations above the control on both epithelial and evaluation of TGF-β which is released by both combined cell lines, unlike the concentrations eval- epithelial and immunocompetent cells, was per- uated on splenocytes, where all strains demonstrate formed. Therefore, it is appropriate to compare the moderate induction of this cytokine.

Table 2. TGF-β concentrations analyzed by using different analytical models: epithelial cell line; combined (epithelium/monocytic) and splenocytes, pg/ml

Cytokine TGF-β TGF-β TGF-β Strain Caco-2 HT-29/THP-1 splenocytes L.gasseri G4 72.6 ± 5.3* 259.0 ± 10.6 674.22 ± 16.8 L.gasseri G7 277.3 ± 11.2 279.3 ± 11.0 548.75 ± 15.2 L.gasseri G8 66.0 ± 5.6 313.2 ± 15.2 660.28 ± 16.4 L.gasseri G11 171.6 ± 10.6 262.4 ± 11.8 834.53 ± 16.9 B. longum 1/2 191.5 ± 11.0 279.3 ± 12.6 736.95 ± 16.8 B. longum 2/9 303.7 ± 14.8 330.2 ± 14.0 646.34 ± 15.8 B. longum 3/15 171.6 ± 11.5 341.1 ± 13.7 590.58 ± 15.7 B. longum 10/48 125.4 ± 8.4 306.4 ± 15.0 688.16 ± 16.0 E. facecium 2092/2 382.9 ± 15.0 550.4 ± 15.2 689.00 ± 16.0 L. bulgaricus b53/2 204.7 ± 13.2 309.8 ± 16.2 702.10 ± 17.5 L. bulgaricus b144 118.8 ± 8.2 289.5 ± 13.2 716.04 ± 17.4 L. bulgaricus b1997/4 230.1 ± 10.7 296.3 ± 15.4 653.31 ± 15.8 L. bulgaricus b1972/1 178.2 ± 11.8 289.5 ± 14.8 499.96 ± 14.6 L. bulgaricus b120 349.9 ± 15.0 303.1 ± 14.2 764.83 ± 16.5 L. bulgaricus b2092/13 244.3 ± 9.8 289.5 ± 13.9 702.10 ± 16.2 L.bulgaricus b58/1 257.5 ± 10.5 421.7 ± 15.8 716.04 ± 16.8 L. bulgaricus b181/10 165.0 ± 11.2 265.8 ± 12.0 618.46 ± 14.9 S. termophilus T69 204.7 ± 10.0 486.1 ± 16.5 813.62 ± 15.8 S. termophilus T21 99.0 ± 7.6 333.6 ± 14.7 757.86 ± 16.5 S. termophilus T43 244.3 ± 12.2 421.7 ± 15.0 841.50 ± 17.0 S. termophilus T59 1089.3 ± 21.8 306.4 ± 14.5 618.46 ± 16.2 S. termophilus T109 891.3 ± 17.0 496.2 ± 15.1 550.60 ± 15.6 Control 231.1 ± 10.9 343.7 ± 14.8 372.5 ± 9.4 Legend - *: mean values ± standard deviation results for some cytokines evaluated on different Conclusion laboratory models. Table 2 presents the signifi cant The novelty of this study is the ability of difference between TGF-β production on epithelial some LAB strains of yogurt origin not only to in- cell line Caco-2, combined cell lines (epithelium/ duce concurrent levels of the anti-infl ammatory IL- monocytic) and splenocytes. Caco-2 synthesizes 10 concentration, but also to decrease the levels of TGF-β even without being induced by bacteria, IL-8, even additionally induced by TNF-α, to the as shown by the high level of the control. TGF-β values that are more likely to cause suppression of values obtained from splenocytes are many times an already existing infl ammation. higher than on epithelial and combined cell lines, All probiotic properties are strain-specifi c, as which demonstrates the different power of these it is well known and as the results clearly demon- three analytical models. An exception of this obser- strate. For example, the difference between L. gas- vation are strains S. thermophilus T59 and S. ther- seri G7 and L. gasseri G4, where the fi rst one is mophilus T109 that make a surprising difference suitable for developing anti-infl ammatory formulas with their very high values obtained on epithelial and the other is not. Another case is the difference cell line. To summarize the results from Table 2, it between the intensity with which the strains in same

141 gamma interferon production in human peripheral blood species are able to induce certain cytokine, like L. mononuclear cells. Infect. Immunol. 66: 6058-62. bulgaricus b144 and L. bulgaricus b120 strains. Moore, K., M. de Waal, R. Coffman, A. O’Garra (2001). In- In conclusion, it can be summarized that the terleukin-10 and the interleukin-10 receptor. Ann. Rev. Im- selected LAB strains have the potential to reduce munol. 19: 683-765. intestinal infl ammation: - L. bulgaricus b58, L. bul- Ni, J., G. Wu, L. Albenberg, V. Tomov (2017). Gut microbiota garicus b144, L. bulgaricus b53/2 and S. thermoph- and IBD: causation or correlation? Nat. Rev. Gastroenterol Hepatol. doi: 10.1038/nrgastro.2017.88. ilus T59, S. thermophilus T43, S. thermophilus T21. Oksaharju, A., T. Kooistra, R. Kleemann, W. van Duyvenvoor- Due to the in-vitro results and their natural ability de, M. Miettinen, J. Lappalainen, K. Lindstedt, P. Kova- to produce yogurt, these strains could be directed to nen, R. Korpela, R. Kekkonen (2013). Effects of probiotic future clinical trials and eventually included in the Lactobacillus rhamnosus GG and Proprionibacterium diet of people with IBD. freudenreichii ssp. shermanii JS supplementation on intestinal and systemic markers of infl ammation in ApoE*3Leiden mice consuming a high-fat diet. Br. J. References Nutr. 110: 77-85. Bai, A., Q. Ouyang, W. Zhang, C. Wang, S. Li (2004). Pro- Papadopoulos, J., A. Karpouzis, J. Tentes, C. Kouskoukis biotics inhibit TNF-α-induced interleukin-8 secretion of (2014). Assessment of interleukins IL-4, IL-6, IL-8, IL-10 HT-29 cells. World J. Gastroenterol. 10: 455-457. in acute urticaria. J. Clin. Med. Res. 6: 133-137. Bermudez-Brito, M., J. Plaza-Diaz, S. Munoz-Quezada, C. Paramsothy, S., M. Kamm, N. Kaakoush, A. Walsh, J. van den Gomez-Llorente, A. Gil (2012). Probiotic mechanisms of Bogaerde, D. Samuel, R. Leong, S. Connor, W. Ng, R. Par- action. Ann. Nutr. Metab. 61: 160-174. amsothy, W. Xuan, E. Lin, H. Mitchell, T. Borody (2017). Borish, L., L. Rosenwasser (1996). Update on cytokines. J. Multidonor intensive faecal microbiota transplantation for Allergy Clin. Immunol. 97: 719-734. active ulcerative colitis: a randomised placebo-controlled Bulgarian State Standard 12 (2010). Bulgarian Yogurt Di Giacinto, C., M. Marinaro, M. Sanchez, W. Strober, M. trial. Lancet 389: 1218–1228. Boirivant (2005). Probiotics ameliorate recurrent Th-1 Plaza-Díaz, J., J. Fernandez-Caballero, N. Chueca, F. Garcia, mediated murine colitis by inducing IL-10 and IL-10-de- C. Gómez-Llorente, M. Sáez-Lara, L. Fontana, A. Gil pendent TGF-beta-bearing regulatory cells. J. Immunol. (2015). Pyrosequencing analysis reveals changes in in- 174: 3237-3246. testinal microbiota of healthy adults who received a daily Gotova, I., Zh. Dimitrov, H. Najdenski (2017). Clinical as- dose of immunomodulatory probiotic strains. Nutrients 7: sessment of Lactobacillus gasseri strain selected by in vit- 3999-4015.

ro tests. Int. J. Microbiol. Biotechnol. 2: 156-160. Plaza-Díaz, J., F. Ruiz-Ojeda, L. Vilchez-Padial, A. Gil Hsieh, P., Y. An, Y. Tsai, Y. Chen, C. Chunag, C. Zeng, C. (2017). Evidence of the anti-infl ammatory effects of pro- Wang, V. An-Erl King (2013). Potential of probiotic strains biotics and synbiotics in intestinal chronic diseases. Nutri- to modulate the infl ammatory responses of epithelial and ents 9: 555. doi:10.3390/nu9060555. immune cells in vitro. New Microbiol. 36: 167-179. Ringel Y., I. Carroll (2009). Alterations in the intestinal mi- Jeon, S., H. Kayama, Y. Ueda, T. Takahashi, T. Asahara, H. crobiota and functional bowel symptoms. Gastrointest. Tsuji, N. Tsuji, H. Kiyono, J. Ma, T. Kusu, R. Okumura, Endosc. Clin. N. Am. 19: 141–150. H. Hara, H. Yoshida, M. Yamamoto, K. Nomoto, K. Smits, H., A. Engering, D. van der Kleij, E. de Jong, K. Schip- Takeda (2012). Probiotic Bifi dobacterium breve induces per, T. van Capel, B. Zaat, M. Yazdanbakhsh, E. Wierenga, IL-10-producing Tr1 cells in the colon. PLoS Pathog. 8: Y. van Kooyk, M. Kapsenberg (2005). Selective probiotic e1002714. bacteria induce IL-10-producing regulatory T cells in vitro Katial, R., D. Sachanandani, C. Pinney, M. Lieberman (1998). by modulating dendritic cell function through dendritic Cytokine production in cell culture by peripheral blood cell-specifi c intercellular adhesion molecule 3-grabbing mononuclear cells from immunocompetent hosts. Clin. nonintegrin. J. Allergy Clin. Immunol. 115: 1260-1267. Diagn. Lab. Immunol. 5: 78-81. Thomas, C., J. Versalovic (2010). Probiotics-host communi- Lin, L., J. Zhang (2017). Role of intestinal microbiota and cation: modulation of signaling pathways in the intestine. metabolites on gut homeostasis and human diseases. BMC Gut Microbes 1: 148-163. Immunol. 18: 2. doi:10.1186/s12865-016-0187-3. Timmerman, H., C. Koning, L. Mulder, F. Rombouts, A. Matsuoka, K., T. Kanai (2015). The gut microbiota and in- Beynen (2004). Monostrain, multistrain and multispecies fl ammatory bowel disease. Semin. Immunopathol. 37: 47- probiotics - a comparison of functionality and effi cacy. 55. Int. J. Food Microbiol. 96: 219-233. Metchnikoff, E. (1907). The prolongation of life. London: Tong, M., P. Wegener, B. Roth, A. Ippoliti, B. Wei, J. Bor- Heinemann. neman, D. McGovern, D. Franc, E. Li, S. Horvath, R. Miettinen, M., S. Matikainen, J. Vuopio-Varkila, J. Pirhonen, Knight, J. Braun (2013). A modular organization of the K. Varkila, M. Kurimoto, I. Julkunen (1998). Lactobacilli human intestinal mucosal microbiota and its association and Streptococci induce interleukin-12 (IL-12), IL-18 and with infl ammatory bowel disease. PLoS One 8: e80702.

142 AACTACTA MICROBIOLOGICAMICROBIOLOGICA BULGARICABULGARICA Volume 33 / 3 (2017)

Comparison of the Expression Levels of Exopolysaccharide Genes in Streptococcus thermophilus LBB.T54 Grown in Semi-Defi ned Media and Milk Miroslava Terzieva* and Zoltan Urshev LB Bulgaricum PLC, R&D Center, 12A Malashevska str., Sofi a, Bulgaria Abstract Exopolysaccharide (EPS) production by Streptococcus thermophilus strains is exploited by dairy companies to obtain fermented milk with improved texture. In previous studies of S. thermophilus LBB. T54, however, EPS yields in M17 were negligible compared to milk. It remained unclear whether dif- ferences in the composition of the medium simply stimulated the growth and viable cell counts or also changed the expression level of the eps cluster. The aim of the study was to test the potential change of the expression levels of selected genes from the eps cluster in S. thermophilus LBB.T54 when grown in M17, compared to milk. Strain LBB.T54 was cultured in LM17 (M17 with lactose) or milk at 37oC. qPCR was performed with primer pairs targeting the epsD, epsE and rpoA genes. The rpoA gene was used to normal- ize the results. qPCR measurements clearly indicated a 2-4 fold higher expression levels of both epsD and epsE in strain S. thermophilus LBB.T54 when grown in milk compared to LM17. Growth in other semi-de- fi ned media (M17 with glucose, Elliker broth and modifi ed Trypticase soy broth with glucose) resulted in similar expression levels of epsD and epsE as that in LM17. EPS yields in milk reached 33 mg/l while in LM17 they did not exceed 5 mg/l. In the process of starter culture preparation and from technological point of view, the application of LM17 medium or another semi-defi ned medium seems to be counter-productive compared to milk-based media when EPS yields are essential for products obtained with LBB.T54. Keywords: exopolysaccharide, expression, M17, milk, qPCR, Streptococcus thermophilus

Резюме Образуването на извънклетъчни полизахариди (ИПЗ) при щамове Streptococcus thermophilus се използва от млекопреработвателите за получаване на ферментирали млека с подобрена структу- ра. В предишни изследвания на S. thermophilus LBB.T54, обаче, добивите от ИПЗ получени в М17 бяха пренебрежимо малки в сравнение с млякото. Остана неясно дали разликите в състава на хра- нителните среди просто стимулират развитието и броя на живите бактерии или променят също и нивата на експресия на полизахаридния (eps) клъстер. Целта на изследването беше да се определят потенциалните промени в нивата на експресия на избрани гени от eps-клъстера при култивиране- то на S. thermophilus LBB.T54 на среда М17 и на мляко. Щам LBB.T54 беше култивиран на LM17 (M17 с лактоза) или мляко при 37oC. Беше проведен количествен PCR (qPCR) с праймери, насочени към гените epsD, epsE и rpoA, като rpoA генът беше използван за нормализиране на резултатите. qPCR-измерванията ясно показаха 2-4-кратно по-високи нива на експресия на epsD и epsE при раз- витието на S. thermophilus LBB.T54 на мляко в сравнение с LM17. Култивирането на щама на други полу-дефинирани среди (М17 с глюкоза, Еликер бульон или модифициран триптиказен бульон с глюкоза) показаха сходни нива на експресия на epsD и epsE като тези на LM17. Добивите на ИПЗ на мляко достигаха 33 mg/l докато на LM17 те не надхвърляха 5 mg/l. От технологична гледна точка в процеса на приготвяне на закваска, използването на LM17 или друга полу-дефинирана среда из- глежда контра-продуктивно в сравнение с млечна среда, когато добивите на ИПЗ са от значение за продукти, получени с LBB.T54.

* Correspondence to: Miroslava Terzieva E-mail: [email protected]

143 Introduction 1,6 x 106 Da composed of glucose:galactose:rham- Exopolysaccharide-producing strains of lac- nose ratio of 5:1:1 (Urshev et al., 2008) tic acid bacteria are applied by dairy producers to The aim of this study was to develop a suit- modify the texture of fermented milk – to increase able qPCR method to test the potential change of viscosity, creaminess and stability (De Vuyst et al., the expression levels of selected genes from the eps 2003). cluster in S. thermophilus LBB.T54 when grown in In Streptococcus thermophilus, EPS synthe- M17, compared to milk. sis is proportional to biomass accumulation and Materials and Methods therefore optimizing the growth conditions results Bacterial strains and growth conditions in improved polymer yields (De Vuyst et al., 1998). Strain S. thermophilus LBB.T54 is an in- EPS yields are increased with the addition of low dustrial strain maintained in the LBB Culture col- molecular nitrogen sources such as casein hydroly- lection (LB Bulgaricum PLC, Sofi a, Bulgaria) se- sate, yeast extract or peptones (Cerning et al., 1990; lected for its ability to produce viscosity in milk. García-Garibay and Marshall, 1991; Sebastiani and LBB.T54 was cultured in LM17 (M17 with lactose) Zelger, 1998; Ricciardi et al., 2002). However, lit- (Terzaghi and Sandine, 1975) or sterile 10% recon- tle is known about the regulation at gene level of stituted skim milk. Additionally, other semi-defi ned the eps cluster in this species. media were used – GM17 (M17 with glucose), El- In S. thermophilus, the eps genes are chro- liker broth or modifi ed Trypticase soy broth with mosomally located in a succession of up to 12 or glucose. All incubations were performed overnight 13 open reading frames (Stingele et al., 1996; Al- at 37oC. mirón-Roig et al., 2000), which are transcribed in RNA isolation a single mRNA. The eps gene cluster starts with Two milliliters of culture were used to isolate more constant sequences of regulatory genes, fol- RNA with the E.Z.N.A. Bacterial RNA Kit (Ome- lowed by variable in content and order genes, en- ga Bio-tec, Norcross, USA). For the milk cultures coding glycosyltransferases, that make the chemi- one additional preliminary step was added and milk cal composition and structure of the EPS unique to was solubilized with the addition of 3 volumes of a particular strain. epsD and epsE are known to be 2% sodium citrate – 0,5N NaOH solution, followed present in most strains of S. thermophilus as they by centrifugation at 5000 g for 5 min. All next steps are related to the regulation and the initial step in were performed according to the manufacturer’s in- EPS synthesis, respectively. A recent review on the structions. The quantity and purity of RNA were as- genetics and application of EPS in lactic acid bacte- sessed spectrophotometrically. The quality of RNA ria was published by Zeidan et al. (2017). was confi rmed electrophoretically to visualize in- For qPCR and gene expression analysis, a tact 16S- and 23S-rRNA bands. careful selection of a house-keeping reference gene qPCR reaction is essential. For S. themophilus the rpoA gene was Quantitative PCR (qPCR) was performed us- selected from a list of previously validated refer- ing the iTaqTM Universal SYBR® Green One-step ence genes (Sumby et al., 2012; Løvdal and Saha, Kit (Bio-Rad Laboratories, Hercules, CA, USA) 2014). on a C1000 Touch Thermal Cycler appended with Strain S. thermophilus LBB.T54 was found CFX Real-Time System (Bio-Rad Laboratories). to produce a neutral EPS with molecular mass of The qPCR reactions (10 microliters) contained

Table 1. Primers used to perform qPCR in the study

Name sequence, 5’-3’ target epsD186F TGTTGGGCTCCGAACACTTC internal region within epsD435R ACGACTACGAGCAACTTCCATCAA epsD epsE892F GCTCAAGACCGTGTGGGAGAA internal region within epsE1237R TTCGACCGCTTACTTGCCAAA epsE rpoA468F TGCACCAGTGGGAACTTTGG internal region within rpoA625R CGAGGGCATCTTCTGGGATG rpoA

144 40ng of each RNA preparation and 10 pmol of the primer pairs listed in Table 1. No-template controls and no-reverse transcriptase controls were also in- cluded. The amplifi cation conditions recommended by the manufacturer of the kit were used. Expres- sion levels were calculated with the Comparative

CT method (ΔΔCT) using the expression level in LM17 as baseline (1.00).

EPS quantifi cation EPS was quantifi ed using a previously de- scribed method (Urshev et al., 2008) Briefl y, 50 ml of sample were treated with 17,5% (v/v) 80% Trichloroacetic acid and centrifuged at 10000 g for 20 min. Three volumes of cold absolute ethanol were added to the supernatant and EPS was precip- itated overnight at 4oC. EPS was then pelleted by centrifugation at 6000 g for 20 min and resuspend- ed in 20 ml hot water, dialyzed for 48h against dis- tilled water and quantifi ed spectrophotometrically with the phenol-sulfuric acid method (Dubois et al., 1956). Glucose was used as standard and re- sults were presented as mg/l glucose equivalents. The values obtained for non-inoculated media were subtracted from the result obtained for each sample.

Results All preparations obtained with the E.Z.N.A. kit contained a typical yield of 40 ng/μl RNA with A260/A280 ratio within 1,8-2,0 and visible intact Fig. 1. Relative expression levels of the epsD and 16S- and 23S-rRNA bands after electrophoretic epsE genes of S. thermophilus LBB.T54 grown separation. Control qPCR reactions without reverse in LM17 and milk medium. Results from two transcriptase (noRT-controls) showed difference in independent trials (A and B) are presented. Error Cq values greater than 6 compared to RT-samples, bars are derived from triplicate measurements. indicating that residual DNA was not interfering in the analysis. to milk while the addition of low molecular nitrogen Triplicate qPCR measurements in two inde- source, such as yeast extract, to milk improved EPS pendent trials clearly indicated a 2-4 fold higher yield (Urshev, 2009). It remained unclear whether expression levels of both epsD and epsE in strain S. differences in the composition of the medium sim- thermophilus LBB.T54 when grown in milk com- ply stimulated the growth and viable cell counts or pared to LM17 (Fig. 1). Good correlation was ob- also changed the expression level of the eps cluster. served between the expression levels of these two The obtained results in the present study genes as they are co-expressed as members of the showed that compared to semi-defi ned media such same cluster. Growth in other semi-defi ned media as M17, milk not only offered much richer nutritive resulted in similar expression levels of epsD and environment for EPS synthesis, but also stimulat- epsE as that in LM17 (results not shown). ed the expression of the genes from the eps cluster. The averaged EPS yields for the two inde- Also the difference in expression levels in the two pendent trials reached 33 mg/l in milk while in media indicates that the eps cluster in this strain is LM17 they did not exceed 5 mg/l. tightly regulated. Other authors demonstrated that the expression of genes encoding enzymes related Discussion to sugar nucleotide synthesis, precursors of the EPS In previous studies of S. thermophilus LBB. polymer, strongly infl uenced EPS yields (Escalante T54, EPS yields in M17 were negligible compared et al., 1998; Degeest and de Vuyst, 2000; Svensson

145 from Streptococcus thermophilus grown in a milk medium et al., 2005). In addition, we have found that in S. and evidence for their growth-associated biosynthesis. J. thermophilus LBB.T54 gene cluster of EPS synthe- Appl. Microbiol. 84: 1059-1068. sis itself has different expression levels that corre- De Vuyst, L., M. Zamfi r, F. Mozzi, T. Adriany, V. Marshall, B. late to EPS yields. Degeest, F. Vaningelgem. (2003). Exopolysaccharide-pro- The two genes epsD and epsE belong to a sin- ducing Streptococcus thermophilus strains as functional gle cluster and are transcribed in a single mRNA. starter cultures in the production of fermented milks. Int. Dairy J. 13: 707-727. Our results showed a good correlation of the ex- Dubois, M., K. Gilles, J. Hamilton, P. Rebers, F. Smith (1956). pression levels of these two genes. We can there- Colorimetric method for determination of sugars and re- fore assume that targeting of either gene for per- lated substances. Anal. Chem. 28: 350-356. forming the qPCR analysis gives adequate picture Escalante, A., G. Washer-Rodarte, M. García-Garibay, A. Far- of the expression of the whole eps cluster. rés (1998). Enzymes involved in carbohydrate metabolism The qPCR method developed in this study and their role on exopolysaccharide production in Strep- tococcus thermophilus. J. Appl. Microbiol. 84: 108-114. proved to be suitable to assess the expression of the García-Garibay, M., V. Marshall (1991). Polymer production epsD and epsE genes form the eps cluster of S. ther- by Lactobacillus delbrueckii ssp. bulgaricus. J. Appl. mophilus LBB.T54 in a manner that can predict the Bacteriol. 70: 325-328. EPS yield. Lower expression levels of the two eps Løvdal, T., A. Saha (2014). Reference gene selection in Car- genes, when using LM17 as growth medium, corre- nobacterium maltaromaticum, Lactobacillus curvatus, lated with low EPS yields. Therefore, experimental and Listeria innocua subjected to temperature and salt stress. Mol. Biotechnol. 56: 210-222. data obtained with qPCR can contribute to further Ricciardi, A., E. Parente, M. Crudele, F. Zanetti, G. Scolari, optimization of growth conditions to achieve high- I. Mannazzu (2002). Exopolysaccharide production by er and constant EPS yields and improved texture of Streptococcus thermophilus SY: production and prelimi- fermented milk using S. thermophilus LBB.T54 as nary characterization of the polymer. J. Appl. Microbiol. starter culture. 92: 297-306. Sebastiani, H. and G. Zelger (1998). Texture formation by thermophilic lactic acid bacteria. Milchwissenschaft 53: Conclusion 15-20. From technological point of view, the appli- Stingele, F., J.-R. Neeser, B. Mollet (1996). Identifi cation and cation of LM17 medium or another semi-defi ned characterization of the eps (exopolysaccharide) gene clus- medium for starter culture preparation seems to be ter from Streptococcus thermophilus Sfi 6. J. Bacteriol. counter-productive compared to milk-based media 178: 1680-1690. when EPS yields are essential for products obtained Sumby, K., P. Grbin, V. Jiranek (2012). Validation of the use of multiple internal control genes, and application of re- with S. thermophilus LBB.T54. Monitoring the ex- al-time quantitative PCR, to study esterase gene expres- pression level of the eps cluster in this strain can sion in Oenococcus oeni. Appl. Microbiol. Biotechnol. 96: give further insight to the effect of different stress 1039-1047. factors that are part of the starter culture process Svensson, M., E. Waak, U. Svensson, P. Rådström (2005). such as freezing and freeze-drying in order to avoid Metabolically improved exopolysaccharide production loss and improve the EPS-producing capacity of by Streptococcus thermophilus and its infl uence on the rheological properties of fermented milk. Appl. Environ. the strain. Microbiol. 71: 6398-6400. Terzaghi, B., W. Sandine (1975). Improved medium for lac- References tic streptococci and their bacteriophages. Appl. Microbiol. Almirón-Roig, E., E. Mulholland, M. Gasson, A. Griffi n 29: 807-813. (2000). The complete cps gene cluster from Streptococcus Urshev, Z. (2009). Formation and nature of the exocellular thermophilus NCFB 2393 involved in the biosynthesis of polysaccharides of Streptococcus thermophilus and Lac- a new exopolysaccharide. Microbiology 146: 2793-2802. tobacillus delbrueckii ssp. bulgaricus. Dissertation. Sofi a Cerning, J., C. Bouillanne, M. Landon, M. Desmazeaud University. Faculty of biology. Sofi a. Bulgaria. (1990). Comparison of exocellular polysaccharide pro- Urshev, Z., Z. Dimitrov, N. Fatchikova, I. Petrova, D. Ish- duction by thermophilic lactic acid bacteria. Sciences des limova (2008). Partial characterization and dynamics of Aliments 10: 443-451. synthesis of high molecular mass exopolysaccharides Degeest, B., L. de Vuyst (2000). Correlation of activities of from Lactobacillus delbrueckii ssp. bulgaricus and Strep- the enzymes alpha-phosphoglucomutase, UDP-galactose tococcus thermophilus. World J. Microbiol. Biotechnol. 4-epimerase, and UDP-glucose pyrophosphorylase with 24: 171-179. exopolysaccharide biosynthesis by Streptococcus thermo- Zeidan, A., V. Poulsen, T. Janzen, P. Buldo, P. Derkx, G. Øre- philus LY03. Appl. Environ. Microbiol. 66: 3519-3527. gaard, A. Neves (2017). Polysaccharide production by De Vuyst, L., F. Vanderveken, S. Van de Ven, B. Degeest lactic acid bacteria: from genes to industrial applications. (1998). Production by and isolation of exopolysaccharides FEMS Microbiol. Rev. 41: 168-200.

146 AACTACTA MICROBIOLOGICAMICROBIOLOGICA BULGARICABULGARICA Volume 33 / 3 (2017)

Cronicle Tenth Balkan Congress of Microbiology Microbiologica Balkanica 2017 Park Hotel Moskva, Sofi a, Bulgaria November 16 – 18, 2017

The Organizing Committee informs that the Tenth Balkan Congress of Microbiology will be held on November 16-18, 2017 in the Park Hotel Moskva, Sofi a Bulgaria. The Congress will be attended by microbiologists, specialists in the fi elds of general and applied mi- crobiology, medical microbiology, virology, environmental microbiology, microbial biotechnologies, food microbiology, infectious immunology and parasitology from the Balkan region (Bulgaria, Greece, Turkey, Serbia, Romania, Republic of Macedonia, Montenegro, Albania, Bosna and Herzegovina), members of the Balkan Society for MIcrobiology. Scientists from Slovenia, Croatia, Poland, USA, Netherlands, France, Germany, Italy, Russia, Ukraine, England, and Portugal will also participate in the Congress. The scientifi c program contains plenary lectures given by leading scientists, large oral and poster sessions and organized discussions on present milestones in microbiology.

The registration details will be given in the website: www.mb2017.bg

The Congress reports in English will be published in Acta Microbiologica Bulgarica, volume 33, issue 4 (2017) and volume 34 issue 1 (2018). The reports have to be prepared according to the „Guide of Authors” of the Journal.

147 Acta Microbiologica Bulgarica

GUIDE FOR AUTHORS

The journal Acta Microbiologica Bulgarica is organ of the Bulgarian Society for Microbiology (Union of Scientists in Bulgaria). The journal is continuation of the edited till 1993 journal of the same name, cited in Index Medicus and Medline. The new edition is published two times per year.

Types of articles

The journal publishes editorials, original research works, research reports, reviews, short communications, letters to the editor, historical notes, etc from all areas of microbiology. The manuscripts should not represent research results which the authors have already published or submitted in other books or journals. The papers submitted for publication in Acta Microbiologica Bulgarica are peer-reviewed by two experts from the respective scientifi c fi eld who remain anonymous to the authors.

Article structure

The papers are published in English, accompanied by a bilingual summary (English and Bulgarian). The papers should be typed with double-spacing (28-30 lines), on a white paper in A4 format, with margins of 3 cm. The length of the original research paper, including the annexes (tables, fi gures, etc.) should not exceed a signature or printer’s sheet (30,000 signs, that is, 16 pages with 30 lines each) in Times New Roman 12. The length of shorter reports should not exceed seven pages.The submitted manuscript must contain the name/s and surname/s of the author/s, the name and address of the institution and or organisation where it was prepared. The name and address of the corresponding author should be noted. The abstract should not exceed 250 words and should represent briefl y the goals, methods, main results (with numerical data) and basic conclusions of the research.The most essential six keywords must be added to the abstract. The manuscript contains the following sections: introduction, materials and methods, results, discussion, acknowledgements, references. The introduction must be concise with a clearly defi ned goal and with previous knowledge of the problem. The materials and methods ought to contain suffi cient data to enable the reader to repeat the investigation without seeking additional information. The results should be presented briefl y and clearly, and the discussion should explain the results.The measuring units and other technical data should be given according to the Sl-system. Illustrations (tables and fi gures) are submitted separately and their places in the text should be clearly indicated. Tables should be given in a separate sheet, numbered and above-entitled. The fi gures must be accompanied by legends in a separate sheet.

Reference style

The references used are cited in the manuscript as follows:  In the case of single author - the author’s surname and the year of publication (Petrov, 2012);  In the case of two authors - the authors surnames and the year of publication (Petrov and Vassileva, 2013);  In the case of more than two authors - the fi rst author’s surname, at all., and the year of publication (Christova et al., 2014). The references included in the section “References” of the manuscript should be arranged fi rst alphabetically and then further sorted chronologically if necessary. More then one reference from the same author(s) in the same year must be identifi ed by the letters “a”, “b”, “c”, etc. place after the year of publication.

148 Examples: Reference to a journal publication: Georgiev, P., V. Simeonov, T. Ivanov (2010). Production of thermostables enzymes. Biotechnol. Biotec. Eq. 27: 231-238. Reference to a book: John, R., W. Villiam, G. Wilmington (2011). New approach for purifi cation of enteroviral proteins, in: Peterson, K., A. Smith (Eds.), Methods in Proteinology. Elsevier, London, pp. 281-304. Journal names should be abbreviated according to the List of Title World Abbreviations: http://www.issn.org/services/online-services/access-to-the-ltwa/ Manuscripts should be submitted to the Editorial Board of the journal Acta Microbiologica Bulgarica in electronic version of the paper to the following address: [email protected] The publications in Acta Microbiologica Bulgarica are free of charge. The authors of the manuscripts need to cover the costs of printing collared illustrations. https://library.caltech.edu/reference/abbreviations/

149 The Edition of Acta Microbiologica Bulgarica volume 33 issue 3 is fi nancially supported by the National Science Fund of Bulgaria (Project DNP 05-18/2016)

150