DOCSLIB.ORG

WO 2008/022468 Al

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
WO 2008/022468 Al (12) INTERNATIONAL APPLICATION PUBLISHED UNDER THE PATENT COOPERATION TREATY (PCT) (19) World Intellectual Property Organization International Bureau (43) International Publication Date (10) International Publication Number 28 February 2008 (28.02.2008) PCT WO 2008/022468 Al (51) International Patent Classification: [CA/CA]; 103-6190 Agronomy Road, Vancouver, British C07H 21/02 (2006.01) C12Q 1/02 (2006.01) Columbia V5T 1Z3 (CA). A61K 31/105 (2006.01) C12Q 1/18 (2006.01) (72) Inventors; and A61K 48/00 (2006.01) C12Q 1/42 (2006.01) (75) Inventors/Applicants (for US only): KRYSTAL, Gerald A61P 37/02 (2006.01) A61K 31/704 (2006.01) [CA/CA]; 5661 Elm Street, Vancouver, British Columbia C12N 15/55 (2006.01) A61K 31/337 (2006.01) V6N 1A3 (CA). ONG, Christopher [CA/CA]; 906-1 189 C12N 9/16 (2006.01) A61K 33/24 (2006.01) Howe Street, Vancouver, British Columbia V6Z 2X4 (CA). (21) International Application Number: MUI, Alice [CA/CA]; 301-3440 West Broadway, Vancou PCT/CA2007/001501 ver, British Columbia V6R 4R2 (CA). (22) International Filing Date: 24 August 2007 (24.08.2007) (74) Agent: CHATTERJEE, Alakananda; Gowling Lafleur (25) Filing Language: English Henderson LLP, 1055 Dunsmuir Street, Suite 2300, Van couver, British Columbia V7X IJl (CA). (26) Publication Language: English (81) Designated States (unless otherwise indicated, for every (30) Priority Data: kind of national protection available): AE, AG, AL, AM, 60/823,404 24 August 2006 (24.08.2006) US AT,AU, AZ, BA, BB, BG, BH, BR, BW, BY, BZ, CA, CH, (71) Applicants (for all designated States except US): CN, CO, CR, CU, CZ, DE, DK, DM, DO, DZ, EC, EE, EG, BRITISH COLUMBIA CANCER AGENCY [CA/CA]; ES, FI, GB, GD, GE, GH, GM, GT, HN, HR, HU, ID, IL, 675 West 10th Avenue, Vancouver, British Columbia V5Z IN, IS, JP, KE, KG, KM, KN, KP, KR, KZ, LA, LC, LK, 1L3 (CA). THE UNIVERSITY OF BRITISH COLUM¬ LR, LS, LT, LU, LY, MA, MD, ME, MG, MK, MN, MW, BIA UNIVERSITY-INDUSTRY LIAISON OFFICE MX, MY, MZ, NA, NG, NI, NO, NZ, OM, PG, PH, PL, [Continued on next page] (54) Title: COMPOSITIONS AND METHODS FOR TREATING MYELOSUPPRESSION (57) Abstract: The invention provides, in part, compositions and methods for protecting a hemopoietic cell, or for treating myelosuppression, in a subject in need thereof, by administering an effective amount of an inhibitor of a SH2-containing inositol-5 '-phosphatase. PT, RO, RS, RU, SC, SD, SE, SG, SK, SL, SM, SV, SY, European (AT,BE, BG, CH, CY, CZ, DE, DK, EE, ES, FI, TJ, TM, TN, TR, TT, TZ, UA, UG, US, UZ, VC, VN, ZA, FR, GB, GR, HU, IE, IS, IT, LT,LU, LV,MC, MT, NL, PL, ZM, ZW. PT, RO, SE, SI, SK, TR), OAPI (BF, BJ, CF, CG, CI, CM, GA, GN, GQ, GW, ML, MR, NE, SN, TD, TG). (84) Designated States (unless otherwise indicated, for every kind of regional protection available): ARIPO (BW, GH, GM, KE, LS, MW, MZ, NA, SD, SL, SZ, TZ, UG, ZM, Published: COMPOSITIONS AND METHODS FOR TREATING MYELOSUPPRESSXON CROSS-REFERENCE TO RELATED APPLICATIONS [0001] This application claims the benefit of U.S. provisional application number 60/823,404, filed August 24, 2006, which is hereby incorporated by reference. FIELD OF INVENTION [0002] The invention provides compositions and methods for protection against and treatment of myelosuppression, More specifically, the invention provides inhibitors of SH2-containing inositol^' -phosphatase for protection against hemodepletion and treatment of myelosuppression. BACKGROUND OF THE INVENTION [0003] The phosphatidylinositol (PI) 3-kiaase (PDK) pathway plays a central role in regulating many biological processes, including survival and proliferation, through the generation of the potent second messenger, PIP3, This phospholipid is present at low levels in the plasma membrane of unstimulated cells but is rapidly synthesized fiotn PI-4,5-P2 by PI3K in response to a diverse array of extracellular stimuli (reviewed in H). This transiently generated PIP3 attracts pleckstrin homology (PH) domain- containing proteins, such as the s rvival/proliferatioϊi enhancing serine/threonine kinase Akt (also known as protein kinase B (PKB)), to the plasma membrane to mediate its effects (reviewed in 1,12), Activation of the PI3K/Akt pathway has been linked with resistance to chemotherapeutic drugs and to radiation u.and its down regulation via PBK inhibitors lowers e resistance of tumour cell lines to various types of therapy l '1$-To ensure that activation of the PI3K pathway is appropriately suppressed/terminated, the ubiquitously expressed tumour suppressor PTEN hydrolyzes 1 PIP3 to PI' 4 S-P2 while the hemopoietic restricted SH2-containing inositol-5 - phosphatase 1 (SHlPl) 3stem cell SHIP (sSHIP) (which is transcribed from a promoter between exons 5 and 6 of the SHIP gene and is expressed in embryonic l δ l6 stem (ES) cells and co-expressed s albeit at low levels, with SHIPl in HSCs ) , and the more widely expressed SHIP2 break it down to PI-3,4-P2. Within non- hemopoietic cells, PTEN and SHIP2 appear to be the key enzymes that keep PΪP3 levels suppressed while in hemopoietic cells, SHIPl is the central player, [0004] SHIPl (also known as SHIP), has been implicated as a negative regulator of proliferation/survival, differentiation and end cell activation i hemopoietic cells by translocating to membranes following extracellular stimulation and hydrolysing the PBK- generated second messenger, PI-3.4,5-P3 (pπ»3) to Pl-3,4-P2 1. Myeloid progenitors in SHIP-/- mice display enhanced survival and proliferation and this results in an increased number of mature neutrophils and monocyte/ macrophages 2. [0005] A major limitation in treating patients with chemotherapies or radiotherapies is the toxicity of these treatments to bone marrow (BM) cells. This leads to myelosupµressioa which results in anemia, requiring red blood cell transfusions, and increased susceptibility to infections because of a drop in white blood cells (leukocytes) and/or increased bleeding because of insufficient numbers of platelets. This myelosuppression limits the chemotherapy or radiation doses that can b e given, for example, to cancerpatients which in turn limits the likelihood of tumour eradication. Current strategies to replenish the BM deficit that follows these treatments include BM transplantation (which is costly and exposes patients to potentially lethal graft versus host disease) and the administration of cytokines such as erythropoietin (Epo or Epogen), G-CSF (Neupogen) and GM-CSF) to stimulate hemopoietic progenitor proliferation along various differentiation pathways. However, some patients do not respond to these cytokines and none of these treatments reverse the fall in platelet numbers. Additionally, the cost of administering even single cytokines is so prohibitive that most BM transplant facilities do not currently use them to narrow the "septic window" following these transplants and these patients are thus at high risk of dying from trivial infections. SUMMARY OF THE INVENTION [0006] The invention provides, in part, compositions and methods for protecting a hemopoietic cell, or for treating myelosuppression, in a subject in need thereof, by administering an effective amount of an inhibitor of a SH2-contaimng inositol-5'- phosphatase. [0007] In one aspec the invention provides a method of protecting a hemopoietic cell in a subject in need thereofby administering an effective amount of an inhibitor of a hemopoietic-restricted SH2-containing inositol-5'-phos ρhatase to the subject. [0008] In alternative embodiments, the hemopoietic cell may be a hemopoietic progenitor c ll such as a myeloid progenitor cell or a lymphoid progenitor cell, or may be a mature cell. In alternative embodiments, the protecting includes decreasing cell death (e.g., apoptosis), In alternative embodiments, the cell death may be induced by chemotherapy or by radiotherapy, In alternative embodiments the hemopoietic-restricted SH2-containing inositol-5'- ρho$phatase may be a SHIPl molecule. In alternative embodiments, the subject may be a human. In alternative embodiments, the subject may have, or may be suspected of having, cancer (e,g,, a solid tumor). In alternative embodiments, the subject may be undergoing chemotherapy or radiotherapy. In alternative embodimente, the chemotherapy may be a cancer therapy (e.g., cisplatin, doxorubicin, or taxotere)- La alternative embodiments, the method farther comprises administering a chemotherapeutic agent (e,g,, a cancer therapeutic agent, such as cisplatin, doxorubicin, or taxotere) or administering a radiotherapy. The inhibitor may be administered before, during or after administration of said chemotherapeutic agent or said radiotherapy. The inhibitor may be a siRNA, e.g., a sequence consisting essentially of AAGAGTCAGGAAGGAGAGAAT (SEQ ID NO: 10) or AAGAGTCAGGAAGGAGAAAAT (SEQ ID NO: 11), or a small molecule. [0009] In alternative aspects, the invention provides a method of treating myelosuppression (e.g,, immune suppression) in a subject in need thereof by administering an effective amount of an inhibitor of a hemopoietic-restricted SH2- containing inosϊtol-S '-phosphatase to the subject. [0010] In alternative embodiments, the myelosuppression includes a decrease in hemopoietic progenitor cells or mature cells. In alternative embodiments, the treating includes increasing proliferation of a hemopoietic cell or includes reducing death of a hemopoietic cell. In alternative embodiments, the myelosuppression may be induced by chemotherapy or by radiotherapy. In alternative embodiments, the hemopoietic-restricted SH2-containing inositol-5 '-phosphatase maybe a SHIPl molecule. Ih alternative embodiments, the subject may have, or may be suspected of having, a cancer e.g., a solid tumor. In alternative embodiments, the subject may be a human. Ih alternative embodiments, the subject may be undergoing chemotherapy or radiotherapy. In alternative embodiments, the chemotherapy may be a cancer therapy. In alternative embodiments, the cancer therapy may be one o more of risplatin, doxorubicin, or taxotere. In alternative embodiments, the inhibitor may be administered after administration of said chemotherapy or said radiotherapy. In alternative embodiments, the inhibitor may be a siRNA or a small molecule.
Load more

Recommended publications
  • (12) United States Patent (10) Patent No.: US 7.427,605 B2 Davis Et Al
    USOO7427605B2 (12) United States Patent (10) Patent No.: US 7.427,605 B2 Davis et al. (45) Date of Patent: Sep. 23, 2008 (54) INHIBITORS OF RIBONUCLEOTIDE 6,030,942 A 2/2000 Cooperman et al. REDUCTASE SUBUNIT 2 AND USES 7,056,704 B2 * 6/2006 Tuschl et al. ............... 435,911 THEREOF 7,098,030 B2 * 8/2006 Rozema et al. ............... 514,44 (75) Inventors: Mark E. Davis, Pasadena, CA (US); FOREIGN PATENT DOCUMENTS Jeremy D. Heidel, Pasadena, CA (US); WO WOO2,24864 3, 2002 John J. Rossi, Altaloma, CA (US) OTHER PUBLICATIONS (73) Assignee: Calando Pharmaceuticals, Inc., Cerqueria et al., 2005. Overview of ribonucleotide reductase inhibi Pasadena, CA (US) tors: an appealing target in anti-tumour therapy, Curr. Med. Chem. 12:1283. (*) Notice: Subject to any disclaimer, the term of this R.E.E. Aug 12, 2002, XPO024007222, database accession O. past lis listed under 35 Duxbury et al., 2004. Retrovirally mediated RNA interference tar M YW- y yS. geting the M2 Subunit of ribonucleotide reductase: A novel therapeu tic strategy in pancreatic cancer, Surgery 136:261-269. (21) Appl. No.: 11/396,365 Duxbury et al., 2004, RNA interference targeting the M2 subunit of ribonucleotide reductase enhances pancreatic adenocarcinoma (22) Filed: Mar. 31, 2006 chemosensitivity to gemcitabine. Oncogene 28:1539-1548. Kim et al., 2002, Database EMBL, XPO02407223, Database acces (65) Prior Publication Data Sion No. BM754277. Kittler et al., 2004. An endoribonuclease-prepared siRNA screen in US 2006/0263.435A1 Nov. 23, 2006 human cells identifies genes essential for cell division, Nature O O 432:1036-1040.
    [Show full text]
  • Anew Drug Design Strategy in the Liht of Molecular Hybridization Concept
    www.ijcrt.org © 2020 IJCRT | Volume 8, Issue 12 December 2020 | ISSN: 2320-2882 “Drug Design strategy and chemical process maximization in the light of Molecular Hybridization Concept.” Subhasis Basu, Ph D Registration No: VB 1198 of 2018-2019. Department Of Chemistry, Visva-Bharati University A Draft Thesis is submitted for the partial fulfilment of PhD in Chemistry Thesis/Degree proceeding. DECLARATION I Certify that a. The Work contained in this thesis is original and has been done by me under the guidance of my supervisor. b. The work has not been submitted to any other Institute for any degree or diploma. c. I have followed the guidelines provided by the Institute in preparing the thesis. d. I have conformed to the norms and guidelines given in the Ethical Code of Conduct of the Institute. e. Whenever I have used materials (data, theoretical analysis, figures and text) from other sources, I have given due credit to them by citing them in the text of the thesis and giving their details in the references. Further, I have taken permission from the copyright owners of the sources, whenever necessary. IJCRT2012039 International Journal of Creative Research Thoughts (IJCRT) www.ijcrt.org 284 www.ijcrt.org © 2020 IJCRT | Volume 8, Issue 12 December 2020 | ISSN: 2320-2882 f. Whenever I have quoted written materials from other sources I have put them under quotation marks and given due credit to the sources by citing them and giving required details in the references. (Subhasis Basu) ACKNOWLEDGEMENT This preface is to extend an appreciation to all those individuals who with their generous co- operation guided us in every aspect to make this design and drawing successful.
    [Show full text]
  • Perfil Probiótico E Bacteriocinogênico São José Do Rio Preto 2013
    Campus de São José do Rio Preto Aline Teodoro de Paula Leuconostoc mesenteroides SJRP55 isolada de mussarela de búfala: perfil probiótico e bacteriocinogênico São José do Rio Preto 2013 Aline Teodoro de Paula Leuconostoc mesenteroides SJRP55 isolada de mussarela de búfala: perfil probiótico e bacteriocinogênico Tese apresentada como parte dos requisitos para obtenção do título de Doutor em Microbiologia, junto ao Programa de Pós-Graduação em Microbiologia, Área de Concentração - Microbiologia Industrial, Ambiental e de Alimentos, do Instituto de Biociências, Letras e Ciências Exatas da Universidade Estadual Paulista “Júlio de Mesquita Filho”, Campus de São José do Rio Preto. Orientador: Profª. Drª. Ana Lúcia Barretto Penna São José do Rio Preto 2013 2 Aline Teodoro de Paula Leuconostoc mesenteroides SJRP55 isolada de mussarela de búfala: perfil probiótico e bacteriocinogênico Tese apresentada como parte dos requisitos para obtenção do título de Doutor em Microbiologia, junto ao Programa de Pós-Graduação em Microbiologia, Área de Concentração - Microbiologia Industrial, Ambiental e de Alimentos, do Instituto de Biociências, Letras e Ciências Exatas da Universidade Estadual Paulista “Júlio de Mesquita Filho”, Campus de São José do Rio Preto. Comissão Examinadora Profª. Drª. Ana Lúcia Barretto Penna UNESP – São José do Rio Preto Orientador Prof. Dr. Svetoslav Dimitrov Todorov USP – São Paulo Profª. Drª. Vanessa Bíscola USP – São Paulo Prof. Dr. Rafael Chacon Ruiz Martinez USP – São Paulo Profª. Drª. Mara Corrêa Lelles Nogueira FAMERP – São José do Rio Preto São José do Rio Preto 16 de dezembro de 2013 3 Paula, Aline Teodoro de. Leuconostoc mesenteroides SJRP55 isolada de mussarela de búfala : perfil probiótico e bacteriocinogênico / Aline Teodoro de Paula.
    [Show full text]
  • Acquired Immunodeficiency Syndrome (AIDS) Is One of the Most Widespread Diseases on the Planet, and the Need for New Forms of Treatment Has Become Paramount
    Selection of RNA Aptamers that Inhibit Mutant 3 HIV-1 Reverse Transcriptase Presented by: Naeem Husain In partial fulfillment of the requirements for graduation with the Dean’s Scholars Honor’s Degree in Biochemistry ____________________ ____________________ Dr. Andrew D. Ellington Date Supervising Professor ____________________ ____________________ Dr. John F. Stanton Date Honor’s Advisor in Biochemistry I grant the Dean’s Scholars Program permission to __x__ Post a copy of my thesis on the Dean’s Scholars website __x__ Keep a copy of my thesis in the Dean’s Scholars office Selection of RNA Aptamers that Inhibit Mutant 3 HIV-1 Reverse Transcriptase Department: Chemistry and Biochemistry ___________________ Naeem Husain ____________________ ____________________ Signature Date ___________________ Dr. Andrew D. Ellington ____________________ ____________________ Signature Date Table of Contents Acknowledgments 1 Abstract 2 Introduction 4 Methods and Materials 9 Results and Discussion In vitro selection of aptamers that bind to drug-resistant 15 mutant 3 variant of HIV-1 RT Characterization of Aptamer Binding and Specificity to HIV-1 RT 18 Aptamers that inhibit both wild type and mutant 3 RTs 26 Building Aptamer Complexes Bind More Tightly to Target Protein 31 References 35 Acknowledgements I would like to thank my parents who helped me in every step of my life, and I would not be here without them. I would also like to thank my research supervisor, Dr. Andrew Ellington, who has guided me in this difficult journey that people like to call scientific research. I would also like to thank Dr. Ruth Shear, Dr. David Laude and Dr. Alan Cline, who have been my mentors all throughout my time at the University of Texas.
    [Show full text]
  • Antifungals and Anti-Tuberculosis Agents
    Review of our Fungal “Players” Opportunistic fungi Newly emerging fungi Antifungals and – Normal flora Fusarium Candida spp. Scedosporidium Anti-Tuberculosis Agents – Ubiquitous in our environment Trichosporin Aspergillus spp. Cryptococcus spp. Mucor spp. Endemic geographically restricted Christine Kubin, Pharm.D., BCPS Blastomyces sp. Clinical Pharmacist, Infectious Diseases Coccidioides sp. Histoplasma sp. NewYork-Presbyterian Hospital Columbia University Medical Center Risk Factors for Fungal Disease Candidiasis Aspergillosis –Antibiotics – Granulocytopenia (↓ Antifungal Agents – Indwelling catheters neutrophil numbers or – Hyperalimentation function) – Multiple abdominal – T-cell dysfunction surgeries hematologic and other malignancies – Prosthetic material organ allograft recipients – Severe burns immunosuppressive – Neoplastic therapy diseases/chemotherapy – Corticosteroids – Immunosuppressive – Chronic granulomatous therapy disease – Diabetes mellitus –AIDS – Extremes of age – Burn patients Fungi An optimal antifungal drug has... Yeasts Moulds Mucormycosis Wide spectrum of activity (rarely septate) Pneumocystis Aspergillus sp. Favorable pharmacokinetic Candida sp. jervici Dimorphic (septate) Rhizopus Rhizomucor profile Histoplasmosis Mucor HOST FUNGUS Cryptococcus Blastomycosis Absidia Adequate in vivo efficacy neoformans Coccidioidomycosis Paracoccidioidomycosis [Zygomycetes] Low rate of toxicity Sporotrichosis Chromoblastomycosis Dermatophytes Low cost Trichophyton Microsporum Miscellaneous Epidermophyton Pseudoallerscheria
    [Show full text]
  • Development of Optimized Inhibitor Rnas Allowing Multisite-Targeting of the HCV Genome
    molecules Article Development of Optimized Inhibitor RNAs Allowing Multisite-Targeting of the HCV Genome Cristina Romero-López *, Thomas Lahlali †, Beatriz Berzal-Herranz and Alfredo Berzal-Herranz * Instituto de Parasitología y Biomedicina “López-Neyra”, IPBLN-CSIC, PTS Granada, Av. del Conocimiento 17, Armilla, 18016 Granada, Spain; [email protected] (T.L.); [email protected] (B.B.-H.) * Correspondence: [email protected] (C.R.-L.) [email protected] (A.B.-H.); Tel.: +34-958-18-16-21 (C.R.-L. & A.B.-H.) † Current address: INSERM U1052, Cancer Research Centre of Lyon (CRCL), Université Claude-Bernard (UCBL), UMR_S1052, UCBL, 69008 Lyon, France. Academic Editor: Harri Lönnberg Received: 19 April 2017; Accepted: 16 May 2017; Published: 22 May 2017 Abstract: Engineered multivalent drugs are promising candidates for fighting infection by highly variable viruses, such as HCV. The combination into a single molecule of more than one inhibitory domain, each with its own target specificity and even a different mechanism of action, results in drugs with potentially enhanced therapeutic properties. In the present work, the anti-HCV chimeric inhibitor RNA HH363-10, which has a hammerhead catalytic domain and an aptamer RNA domain, was subjected to an in vitro selection strategy to isolate ten different optimised chimeric inhibitor RNAs. The catalytic domain was preserved while the aptamer RNA domain was evolved to contain two binding sites, one mapping to the highly conserved IIIf domain of the HCV genome’s internal ribosome entry site (IRES), and the other either to IRES domain IV (which contains the translation start codon) or the essential linker region between domains I and II.
    [Show full text]
  • (12) United States Patent (10) Patent No.: US 8,946,381 B2 Fear Et Al
    USOO894.6381 B2 (12) United States Patent (10) Patent No.: US 8,946,381 B2 Fear et al. (45) Date of Patent: Feb. 3, 2015 (54) COMPOSITIONS AND USES THEREOF FOR 6,316.223 B1 1 1/2001 Payan et al. THE TREATMENT OF WOUNDS g R 1 $38, E. i al. (75) Inventors: Mark Fear, Mundaring (AU); Paul 6.436,694 B1 8, 2002 Ea. Watt, Mount Claremont (AU); Richard 6,475,726 B1 1 1/2002 Tally et al. Hopkins, North Perth (AU): Nadia 6,521,425 B2 2/2003 Perler et al. Milech, Daglish (AU) 55: R 538. Manillet al. (73) Assignees: Phylogica Limited, Subiaco (AU); The 6.583.10s B1 6, 2003 Marini et al. McComb Foundation, Inc., Wembley 6,583,275 B1 6/2003 Doucette-Stamm et al. (AU) 6,610,820 B1* 8/2003 Bonny . 530/300 (*) Notice: Subject to any disclaimer, the term of this 6,720,4136,720,139 B1 4/2004 ZyskindSchweinfest et al. et al. patent is extended or adjusted under 35 6,846,625 B1 1/2005 Tally et al. U.S.C. 154(b) by 810 days. 6,962.904 B1 * 1 1/2005 Sandberg et al. ............ 514, 18.8 7,041,868 B2 * 5/2006 Greene et al. ................... 602/48 (21) Appl. No.: 12/441,691 7,053,046 B2 * 5/2006 McGrath ...................... 514,216 7,117,096 B2 10/2006 Luo et al. (22) PCT Filed: Feb. 6, 2007 7,303,885 B1* 12/2007 Brunner et al. ................ 435/71 2002fO150906 A1 10, 2002 Debe 2002fO155564 A1 10, 2002 Medrano et al.
    [Show full text]
  • Screening of Natural Compounds That Targets Glutamate Racemase Of
    www.nature.com/scientificreports OPEN Screening of natural compounds that targets glutamate racemase of Mycobacterium tuberculosis reveals the anti-tubercular potential of favonoids Alka Pawar1,2, Prakash Jha 1, Madhu Chopra1, Uma Chaudhry2 & Daman Saluja1* Tuberculosis (TB) is caused by Mycobacterium tuberculosis (MTB), a highly infectious disease accounting for nearly 1.5 million deaths every year and has been a major global concern. Moreover, resistance to anti-TB drugs is an arduous obstacle to efective prevention, TB care and management. Therefore, incessant attempts are being made to identify novel drug targets and newer anti-tubercular drugs to fght with this deadly pathogen. Increasing resistance, adverse efects and costly treatment by conventional therapeutic agents have been inclining the researchers to search for an alternative source of medicine. In this regard natural compounds have been exploited extensively for their therapeutic interventions targeting cellular machinery of MTB. Glutamate racemase (MurI) is an enzyme involved in peptidoglycan (PG) biosynthesis and has become an attractive target due to its moonlighting property. We screened various classes of natural compounds using computational approach for their binding to MTB-MurI. Shortlisted best docked compounds were evaluated for their functional, structural and anti-mycobacterial activity. The results showed that two favonoids (naringenin and quercetin) exhibited best binding afnity with MTB-MurI and inhibited the racemization activity with induced structural perturbation. In addition, fuorescence and electron microscopy were employed to confrm the membrane and cell wall damages in mycobacterial cells on exposure to favonoids. Together, these observations could provide impetus for further research in better understanding of anti-tubercular mechanisms of favonoids and establishing them as lead molecules for TB treatment.
    [Show full text]
  • REVIEW Micrornas and Lymph Node Metastasis in Papillary Thyroid Cancers
    DOI:http://dx.doi.org/10.7314/APJCP.2016.17.1.25 MicroRNAs and Lymph Node Metastasis in Papillary Thyroid Cancer REVIEW MicroRNAs and Lymph Node Metastasis in Papillary Thyroid Cancers Nurul-Syakima Ab Mutalib1*&, Azliana Mohamad Yusof1&, Norfilza Mohd Mokhtar2, Roslan Harun3, Rohaizak Muhammad4, Rahman Jamal1 Abstract Lymph node metastasis (LNM) in papillary thyroid cancer (PTC) has been shown to be associated with increased risk of locoregional recurrence, poor prognosis and decreased survival, especially in older patients. Hence, there is a need for a reliable biomarker for the prediction of LNM in this cancer. MicroRNAs (miRNAs) are small noncoding RNAs that regulate gene translation or degradation and play key roles in numerous cellular functions including cell-cycle regulation, differentiation, apoptosis, invasion and migration. Various studies have demonstrated deregulation of miRNA levels in many diseases including cancers. While a large number of miRNAs have been identified from PTCs using various means, association of miRNAs with LNM in such cases is still controversial. Furthermore, studies linking most of the identified miRNAs to the mechanism of LNM have not been well documented. The aim of this review is to update readers on the current knowledge of miRNAs in relation to LNM in PTC. Keywords: microRNAs - papillary thyroid cancer - lymph node - metastasis - biomarker Asian Pac J Cancer Prev, 17 (1), 25-35 Introduction and hence the reason lymph node surgery is considered important in the treatment of PTC (Moo and Fahey, 2011). Papillary thyroid carcinoma (PTC) is the commonest MicroRNAs (miRNAs), firstly identified in type of thyroid cancer, contributing to more than 80% Caenorhabditis elegans, are endogenous, non-protein- of all thyroid malignancies.
    [Show full text]
  • Leuconostoc Mesenteroides SJRP55: a Potential Probiotic Strain Isolated from Brazilian Water Buffalo Mozzarella Cheese
    Ann Microbiol (2015) 65:899–910 DOI 10.1007/s13213-014-0933-9 ORIGINAL ARTICLE Leuconostoc mesenteroides SJRP55: a potential probiotic strain isolated from Brazilian water buffalo mozzarella cheese Aline Teodoro de Paula & Ana Beatriz Jeronymo-Ceneviva & Luana Faria Silva & Svetoslav Dimitrov Todorov & Bernadette Dora G. Mello Franco & Ana Lúcia Barretto Penna Received: 27 February 2014 /Accepted: 15 June 2014 /Published online: 12 July 2014 # Springer-Verlag Berlin Heidelberg and the University of Milan 2014 Abstract The probiotic potential of Leuconostoc mesenteroides Introduction subsp. mesenteroides SJRP55, isolated from water buffalo mozzarella cheese was evaluated. The microorganism The consumption of functional dairy products that provide presented resistance to stressful conditions that simulated health benefits has increased significantly in the last few years, the gastrointestinal tract, and to the best of our knowledge, and consequently, the industry has begun looking for strains Leuconostoc mesenteroides subsp. mesenteroides SJRP55 with probiotic characteristics for future application in function- was the first of this species with the ability to deconjugate al foods. Probiotics are defined as live, non-pathogenic micro- bile salts. Tolerance to NaCl was temperature dependent, as organisms that, when administered in adequate amounts, con- well the results obtained by aggregation capacity. The strain fer a health benefit to the consumer (FAO/WHO 2002). presented good adhesion properties, β–galactosidase activity, The literature describes countless benefits of probiotic cul- viability in fermented milk during storage, inactive against tures. They have been found to enhance the host’s immune Streptococcus thermophilus and sensitive to most of the tested response, to alleviate symptoms of lactose intolerance, to antibiotics.
    [Show full text]
  • Molecular Assembly for High-Performance Bivalent Nucleic Acid Inhibitor
    Molecular assembly for high-performance bivalent nucleic acid inhibitor Youngmi Kim, Zehui Cao, and Weihong Tan* Center for Research at the Bio/nano Interface, Department of Chemistry, University of Florida Genetics Institute, Shands Cancer Center, and McKnight Brain Institute, University of Florida, Gainesville, FL 32611-7200 Edited by Richard N. Zare, Stanford University, Stanford, CA, and approved February 7, 2008 (received for review December 14, 2007) It is theorized that multivalent interaction can result in better to a single-stranded DNA called the cellular retinol-binding affinity and selectivity than monovalent interaction in the design protein II element (CRBP-II element). Interestingly, although of high-performance ligands. Accordingly, biomolecular engineers the intrinsic affinity of one or more units of RXR-L for one are increasingly taking advantage of multivalent interactions to CRBP-II element (i.e., di-, tri-, or tetravalent interaction) is fabricate novel molecular assemblies, resulting in new functions insufficient to initiate transcription, more than five of these for ligands or enhanced performance of existing ligands. Substan- complexes adjacent to CRBP-II elements can, in fact, initiate the tial efforts have been expended in using small molecules or transcription. As a result, transcriptive response is well regulated epitopes of antibodies for designing multifunctional or better- depending on the concentration of the transcription factor. performing ligands. However, few attempts to use nucleic acid Furthermore, as noted above, this activity demonstrates the aptamers as functional domains have been reported. In this study, cooperative configuration, as noted above, which gives polyva- we explore the design of bivalent nucleic acid ligands by using lent interactions the potential for considerably increased binding thrombin and its aptamers as the model by which to evaluate its affinity.
    [Show full text]
  • ( 12 ) United States Patent (10 ) Patent No.: US 10,682,400 B2 Ali Et Al
    US010682400B2 ( 12 ) United States Patent (10 ) Patent No.: US 10,682,400 B2 Ali et al. (45 ) Date of Patent : Jun . 16 , 2020 ( 54 ) COMBINATION VACCINE DEVICES AND (2013.01 ) ; A61K 2039/55561 ( 2013.01) ; COOK METHODS OF KILLING CANCER CELLS 2317/21 (2013.01 ) ; CO7K 2317/24 (2013.01 ) (71 ) Applicants : President and Fellows of Harvard (58 ) Field of Classification Search College , Cambridge , MA (US ) ; CPC A61K 39/39 ; A61K 39/0011 Dana - Farber Cancer Institute , Inc., See application file for complete search history. Boston , MA (US ) (72 ) Inventors : Omar Abdel -Rahman Ali, Cambridge, ( 56 ) References Cited MA (US ) ; David J. Mooney, Sudbury, U.S. PATENT DOCUMENTS MA (US ) ; Glenn Dranoff , Lexington , MA (US ) 3,773,919 A 11/1973 Boswell et al . 4,522,811 A 6/1985 Eppstein et al . 4,946,778 A 8/1990 Ladner et al. ( 73 ) Assignees : President and Fellows of Harvard 5,073,627 A 12/1991 Curtis et al. College, Cambridge , MA (US ) ; 5,091,513 A 2/1992 Huston et al . Dana - Farber Cancer Institute , Inc. , 5,132,405 A 7/1992 Huston et al . Boston , MA (US ) 5,885,829 A 3/1999 Mooney et al . 5,888,987 A 3/1999 Haynes et al . 5,906,826 A 5/1999 Emery et al. ( * ) Notice: Subject to any disclaimer , the term of this 5,951,976 A 9/1999 Segal patent is extended or adjusted under 35 6,129,716 A 10/2000 Steer U.S.C. 154 ( b ) by 4 days . 6,193,970 B1 2/2001 Pardoll et al.
    [Show full text]