DOCSLIB.ORG

(12) United States Patent (10) Patent No.: US 7.427,605 B2 Davis Et Al

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
(12) United States Patent (10) Patent No.: US 7.427,605 B2 Davis Et Al USOO7427605B2 (12) United States Patent (10) Patent No.: US 7.427,605 B2 Davis et al. (45) Date of Patent: Sep. 23, 2008 (54) INHIBITORS OF RIBONUCLEOTIDE 6,030,942 A 2/2000 Cooperman et al. REDUCTASE SUBUNIT 2 AND USES 7,056,704 B2 * 6/2006 Tuschl et al. ............... 435,911 THEREOF 7,098,030 B2 * 8/2006 Rozema et al. ............... 514,44 (75) Inventors: Mark E. Davis, Pasadena, CA (US); FOREIGN PATENT DOCUMENTS Jeremy D. Heidel, Pasadena, CA (US); WO WOO2,24864 3, 2002 John J. Rossi, Altaloma, CA (US) OTHER PUBLICATIONS (73) Assignee: Calando Pharmaceuticals, Inc., Cerqueria et al., 2005. Overview of ribonucleotide reductase inhibi Pasadena, CA (US) tors: an appealing target in anti-tumour therapy, Curr. Med. Chem. 12:1283. (*) Notice: Subject to any disclaimer, the term of this R.E.E. Aug 12, 2002, XPO024007222, database accession O. past lis listed under 35 Duxbury et al., 2004. Retrovirally mediated RNA interference tar M YW- y yS. geting the M2 Subunit of ribonucleotide reductase: A novel therapeu tic strategy in pancreatic cancer, Surgery 136:261-269. (21) Appl. No.: 11/396,365 Duxbury et al., 2004, RNA interference targeting the M2 subunit of ribonucleotide reductase enhances pancreatic adenocarcinoma (22) Filed: Mar. 31, 2006 chemosensitivity to gemcitabine. Oncogene 28:1539-1548. Kim et al., 2002, Database EMBL, XPO02407223, Database acces (65) Prior Publication Data Sion No. BM754277. Kittler et al., 2004. An endoribonuclease-prepared siRNA screen in US 2006/0263.435A1 Nov. 23, 2006 human cells identifies genes essential for cell division, Nature O O 432:1036-1040. Related U.S. Application Data Lin et al., 2004, Stable suppression of the R2 subunit of (60) Provisional application No. 60/742,100, filed on Dec. SILIZespoissils 5(-- t - O COOby CaCtheE. CSO -damaging RNA agentS N. Royal Epist SEs5. and ribonucleotide reductase inhibitors, J. Biol. Chem. 279:27030. • - ws p pp s Zhou et al., 2003, The human ribonucleotide reductase subunit 362, filed on Mar. 31, 2005. hRRM2 complements p53R2 in response to UV-induced DNA repair (51) Int. Cl in cells with mutant p53, Cancer Res. 63.6583-6594. A6 IK3I/70 (2006.01) * cited by examiner 6, A. 3.08: Primary Examiner Richard Schnizer (52) U.S. Cl 51444. 536/24.5: 514/58 (74) Attorney, Agent, or Firm Ropes & Gray LLP (58) Field of Classification Search ....................... None (57) ABSTRACT See application file for complete search history. The present application relates to inhibitors of ribonucleotide (56) References Cited reductase subunit 2 (R2), and methods and compositions U.S. PATENT DOCUMENTS related to the R2 inhibitors. In certain embodiments, the R2 inhibitors include nucleic acids, such as for example siRNAs. 4,945,195 A 7/1990 Ipcinski 5.998,383 A * 12/1999 Wright et al. ................. 514,44 14 Claims, 45 Drawing Sheets U.S. Patent Sep. 23, 2008 Sheet 1 of 45 US 7.427,605 B2 5 CCCAGGCGCAGCCAATGGGAAGGGTCGGAGGCATGGCACAGCCAATGGGAAGGGCCGGGGCACCAAAGCC AATGGGAAGGGCCGGGAGCGCGCGGCGCGGGAGATTTAAAGGCTGCTGGAGTGAGGGGTCGCCCGTGCAC CCTGTCCCAGCCGTCCTGTCCTGGCTGCTCGCTCTGCTTCGCTGCGCCTCCACTATGCTCTCCCTCCGTG TCCCGCTCGCGCCCATCACGGACCCGCAGCAGCTGCAGCTCTCGCCGCTGAAGGGGCTCAGCTTGGTCGA CAAGGAGAACACGCCGCCGGCCCTGAGCGGGACCCGCGTCCTGGCCAGCAAGACCGCGAGGAGGATCTTC CAGGAGCCCACGGAGCCGAAAACTAAAGCAGCTGCCCCCGGCGTGGAGGATGAGCCGCTGCTGAGAGAAA ACCCCCGCCGCTTTGTCATCTTCCCCATCGAGTACCATGATATCTGGCAGATGTATAAGAAGGCAGAGGC TTCCTTTTGGACCGCCGAGGAGGTTGACCTCTCCAAGGACATTCAGCACTGGGAATCCCTGAAACCCGAG GAGAGATATTTTATATCCCATGTTCTGGCTTTCTTTGCAGCAAGCGATGGCATAGTAAATGAAAACTTGG TGGAGCGATTTAGCCAAGAAGTTCAGATTACAGAAGCCCGCTGTTTCTATGGCTCCAAATTGCCATGGA AAACATACATTCTGAAATGTATAGTCTTCTTATTGACACTTACATAAAAGATCCCAAAGAAAGGGAATTT CTCTTCAATGCCATTGAAACGATGCCTTGTGTCAAGAAGAAGGCAGACTGGGCCTTGCGCTGGATTGGGG ACAAAGAGGCTACCTATGGTGAACGTGTTGTAGCCTTTGCTGCAGTGGAAGGCATTTTCTTTTCCGGTTC TTTTGCGTCGATATTCTGGCTCAAGAAACGAGGACTGATGCCTGGCCTCACATTTTCTAATGAACTTATT AGCAGAGATGAGGGTTTACACTGTGATTTTGCTTGCCTGATGTTCAAACACCTGGTACACAAACCATCGG AGGAGAGAGTAAGAGAAATAATTATCAATGCTGTTCGGATAGAACAGGAGTTCCTCACTGAGGCCTTGCC TGTGAAGCTCATTGGGATGAATTGCACTCTAATGAAGCAATACATTGAGTTTGTGGCAGACAGACTTATG CTGGAACTGGGTTTTAGCAAGGTTTTCAGAGTAGAGAACCCATTTGACTTTATGGAGAATATTTCACTGG AAGGAAAGACTAACTTCTTGAGAAGAGAGTAGGCGAGTATCAGAGGATGGGAGTGATGTCAAGTCCAAC AGAGAATTCTTTTACCTTGGATGCTGACTTCTAAATGAACTGAAGATGTGCCCTTACTTGGCTGATTTTT TTTTTCCATCTCATAAGAAAAATCAGCTGAAGTGTTACCAACTAGCCACACCATGAATTGTCCGTAATGT TCATTAACAGCATCTTTAAAACTGTGTAGCTACCTCACAACCAGTCCTGTCTGTTTATAGTGCTGGTAGT ATCACCTTTTGCCAGAAGGCCTGGCTGGCTGTGACTTACCATAGCAGTGACAATGGCAGTCTTGGCTTTA AAGTGAGGGGTGACCCTTTAGTGAGCTTAGCACAGCGGGATTAAACAGTCCTTTAACCAGCACAGCCAGT TAAAAGATGCAGCCTCACTGCTTCAACGCAGATTTTAATGTTTACTTAAATATAAACCTGGCACTTTACA AACAAATAAACATTGTTTTGTACTCACGGCGGCGATAATAGCTTGATTTATTTGGTTTCTACACCAAATA CATTCTCCTGACCACTAATGGGAGCCAATTCACAATTCACTAAGTGACTAAAGTAAGTTAAACTTGTGTA GACTAAGCATGTAATTTTTAAGTTTTATTTTAATGAATTAAAATATTTGTTAACCAACTTTAAAGTCAGT CCTGTGTATACCTAGATATTAGTCAGTTGGTGCCAGATAGAAGACAGGTTGTGTTTTTATCCTGTGGCTT GTGTAGTGTCCTGGGATTCTCTGCCCCCTCTGAGTAGAGTGTTGTGGGATAAAGGAATCTCTCAGGGCAA GGAGCTTCTTAAGTTAAATCACTAGAAATTTAGGGGTGATCTGGGCCTTCATATGTGTGAGAAGCCGTTT CATTTTATTTCTCACTGTATTTTCCTCAACGTCTGGTTGATGAGAAAAAATTCTTGAAGAGTTTTCATAT GTGGGAGCTAAGGTAGTATTGTAAAATTTCAAGTCATCCTTAAACAAAATGATCCACCTAAGATCTTGCC CCTGTTAAGTGGTGAAATCAACTAGAGGTGGTTCCTACAAGTTGTTCATTCTAGTTTTGTTTGGTGTAAG TAGGTTGTGTGAGTTAATTCATTTATATTTACTATGTCTGTTAAATCAGAAATTTTTTATTATCTATGTT CTTCTAGATTTTACCTGTAGTTCATAAAAAAAAAAAAAAAAAAAAAAAAA 3 FIGURE 1 U.S. Patent Sep. 23, 2008 Sheet 3 of 45 US 7.427,605 B2 U.S. Patent Sep. 23, 2008 Sheet 4 of 45 US 7.427,605 B2 009Z_||_ #7GTRIQOIH ||| ZÅX |O{E\/ U.S. Patent Sep. 23, 2008 Sheet 5 of 45 US 7.427,605 B2 SGIRI[10][H U.S. Patent US 7.427,605 B2 L(HIRIQ?IH U.S. Patent Sep. 23, 2008 Sheet 8 of 45 US 7.427,605 B2 dqZG7/ 8CHIRIQ?INH U.S. Patent Sep. 23, 2008 Sheet 9 of 45 US 7.427,605 B2 R |||||||||||||| |,}! | 6(HRIQOIH U.S. Patent Sep. 23, 2008 Sheet 10 of 45 US 7.427,605 B2 0ICHRIQOIH 00|| 08 09 uo ort adjo', U.S. Patent Sep. 23, 2008 Sheet 11 of 45 US 7.427,605 B2 Facing Olga NH2 ca fuored (9 1S R Se2 O Emma- 99ewdits O CD E. --- g s 2 fluooned g was CD 9. O O ga 9 fuo onted O RSF s s s 9. 2 Frisis begaWiddis (VS S O g g ?uo shed see 9,82 6.3 it coa ? ca O Joond -T- E O O O O O O O O w CN O OO CO w CN r were ve (aped eLues uo) Auo onzo 9, U.S. Patent Sep. 23, 2008 Sheet 12 of 45 US 7.427,605 B2 ZICHRIQ?IH O O O O O O N O CO o w N w va (eed oues uo) Auo onzo 9, U.S. Patent Sep. 23, 2008 Sheet 13 of 45 US 7.427,605 B2 S--8CWRRS C NOOS CO N G--8WRRS er LNOOS w N 2 S--8ICWRIRS P LNOOS 9 s S--8CWRRS R N INOOS peoey Sue Iun U.S. Patent Sep. 23, 2008 Sheet 14 of 45 US 7.427,605 B2 #7ICHIRIQ?IH p9D.p2)p||No. 8 8 8 |eufus Auxeuuweg-WueeW U.S. Patent Sep. 23, 2008 Sheet 15 of 45 US 7.427,605 B2 SICHIRIQ?INH C d o O s w eufS Auxeuuw-98vion lexey ueeW U.S. Patent Sep. 23, 2008 Sheet 16 of 45 US 7.427,605 B2 91GHRIQOIH S N s a o (uodeu oeee Av 3nado, e3ueseuuunroepeeubeu U.S. Patent Sep. 23, 2008 Sheet 17 of 45 US 7.427,605 B2 LICHIRIQ?IH 0'002 eferemy "eAApuequnu Auolo) U.S. Patent Sep. 23, 2008 Sheet 18 of 45 US 7.427,605 B2 8ICHRIQ?INH 0'08 0'09 0'02 efeamy"Iew equinu Auoloo U.S. Patent Sep. 23, 2008 Sheet 19 Of 45 US 7.427,605 B2 fl-19; 6.I(HIRI[10][H[ 0'002 0'00|| Ayiemi equinu Auolo) U.S. Patent Sep. 23, 2008 Sheet 20 of 45 US 7.427,605 B2 0ZCHRIQ?IH U.S. Patent Sep. 23, 2008 Sheet 21 of 45 US 7.427,605 B2 IZCHRI[10][H 00’00|| 00°08 00'09 (Ajuovo Joa) uogenced Agueno U.S. Patent Sep. 23, 2008 Sheet 22 of 45 US 7.427,605 B2 5)Ed ?3d) ZZCHRIQ?IH U.S. Patent Sep. 23, 2008 Sheet 23 of 45 US 7.427,605 B2 s S. isO S s O P 3CUN S. JaquifN U.S. Patent Sep. 23, 2008 Sheet 24 of 45 US 7.427,605 B2 ?7ZCHRIQ?INH %00|| %06 %08 %0,1 %09 %09 %07 %09 leAli ul eSOO % U.S. Patent Sep. 23 9 2008 Sheet 25 of 45 US 79 427,605 B2 U.S. Patent US 7.427,605 B2 OH LZGIRI[]{DIH U.S. Patent Sep. 23, 2008 Sheet 28 of 45 US 7.427,605 B2 8ZCHRIQ?INH em|AunSeo Jo uoloe U.S. Patent Sep. 23, 2008 Sheet 29 Of 45 US 7.427,605 B2 6ZGIRI[10][H & S SSE Six RS SS S s SSS E. &.. o (N O O ope upoWISM) U.S. Patent Sep. 23, 2008 Sheet 30 of 45 US 7.427,605 B2 09GIRI[10][H U.S. Patent Sep. 23, 2008 Sheet 31 of 45 US 7.427,605 B2 [9]CHRIQOIH V U.S. Patent Sep. 23, 2008 Sheet 32 of 45 US 7.427,605 B2 HOXHO Z€(HIRIQÐIH U.S. Patent Sep. 23, 2008 Sheet 33 of 45 US 7.427,605 B2 9 GIRI[10IH$ (uu) ueeued e3ed U.S. Patent US 7.427,605 B2 Sº[HRI[10][H aW. U.S. Patent Sep. 23, 2008 Sheet 36 of 45 US 7.427,605 B2 99GHRIQOIH 0 (Au) equeod eez U.S. Patent Sep. 23, 2008 Sheet 37 of 45 US 7.427,605 B2 U.S. Patent Sep. 23, 2008 Sheet 38 of 45 US 7.427,605 B2 co on N. N. coco ato Lo33 Lo qr Vs is v- rs ve GOW 89CHIRIQ?IH 0088'0 0099'0 gOW U.S. Patent Sep. 23, 2008 Sheet 39 of 45 US 7.427,605 B2 | 6€(HIRI[10][H C 0 90-E'), CO OZ XeulogHO% U.S. Patent Sep. 23, 2008 Sheet 40 of 45 US 7.427,605 B2 0?7CHRIQOIH WNTHÈS-CALIH+{CIO „?OJLIH%IS(55 ociolog of d sire 2 ir unco U.S. Patent Sep. 23, 2008 Sheet 41 of 45 US 7.427,605 B2 [†7(HIRIQ?IH (WNu ulov)/(WNu Se-) U.S. Patent Sep. 23, 2008 Sheet 42 of 45 US 7.427,605 B2 U.S. Patent Sep. 23, 2008 Sheet 43 of 45 US 7.427,605 B2 $#7GHRIQOIH U.S. Patent Sep. 23, 2008 Sheet 45 of 45 US 7.427,605 B2 lf) r U33WI. 2 ? P w SS CD O u V s O L Oy | Y O GN 9. ; eN 33s Vf h O V G ? to O (N v- Co. to rit (N O V O O. O. O. (eele/S/ud) Suolil US 7,427,605 B2 1. 2 INHIBITORS OF RIBONUCLEOTDE than 250, no more than 100 or no more than 50 nucleotides of REDUCTASE SUBUNIT 2 AND USES the target gene nucleic acid sequence Such as any of those THEREOF designated by SEQ ID NOs: 1-3 (FIGS. 1-2), or any homologs (e.g., orthologs and paralogs) or variants thereof. RELATED APPLICATIONS The region of complementarity will preferably be at least 8 nucleotides, and optionally at least 10, 15, 20, 21, 22, 23, 24. This application claims the benefit of U.S. Provisional 25, 26, 27, 28, 29, or 30 nucleotides.
Load more

Recommended publications
  • Anew Drug Design Strategy in the Liht of Molecular Hybridization Concept
    www.ijcrt.org © 2020 IJCRT | Volume 8, Issue 12 December 2020 | ISSN: 2320-2882 “Drug Design strategy and chemical process maximization in the light of Molecular Hybridization Concept.” Subhasis Basu, Ph D Registration No: VB 1198 of 2018-2019. Department Of Chemistry, Visva-Bharati University A Draft Thesis is submitted for the partial fulfilment of PhD in Chemistry Thesis/Degree proceeding. DECLARATION I Certify that a. The Work contained in this thesis is original and has been done by me under the guidance of my supervisor. b. The work has not been submitted to any other Institute for any degree or diploma. c. I have followed the guidelines provided by the Institute in preparing the thesis. d. I have conformed to the norms and guidelines given in the Ethical Code of Conduct of the Institute. e. Whenever I have used materials (data, theoretical analysis, figures and text) from other sources, I have given due credit to them by citing them in the text of the thesis and giving their details in the references. Further, I have taken permission from the copyright owners of the sources, whenever necessary. IJCRT2012039 International Journal of Creative Research Thoughts (IJCRT) www.ijcrt.org 284 www.ijcrt.org © 2020 IJCRT | Volume 8, Issue 12 December 2020 | ISSN: 2320-2882 f. Whenever I have quoted written materials from other sources I have put them under quotation marks and given due credit to the sources by citing them and giving required details in the references. (Subhasis Basu) ACKNOWLEDGEMENT This preface is to extend an appreciation to all those individuals who with their generous co- operation guided us in every aspect to make this design and drawing successful.
    [Show full text]
  • Perfil Probiótico E Bacteriocinogênico São José Do Rio Preto 2013
    Campus de São José do Rio Preto Aline Teodoro de Paula Leuconostoc mesenteroides SJRP55 isolada de mussarela de búfala: perfil probiótico e bacteriocinogênico São José do Rio Preto 2013 Aline Teodoro de Paula Leuconostoc mesenteroides SJRP55 isolada de mussarela de búfala: perfil probiótico e bacteriocinogênico Tese apresentada como parte dos requisitos para obtenção do título de Doutor em Microbiologia, junto ao Programa de Pós-Graduação em Microbiologia, Área de Concentração - Microbiologia Industrial, Ambiental e de Alimentos, do Instituto de Biociências, Letras e Ciências Exatas da Universidade Estadual Paulista “Júlio de Mesquita Filho”, Campus de São José do Rio Preto. Orientador: Profª. Drª. Ana Lúcia Barretto Penna São José do Rio Preto 2013 2 Aline Teodoro de Paula Leuconostoc mesenteroides SJRP55 isolada de mussarela de búfala: perfil probiótico e bacteriocinogênico Tese apresentada como parte dos requisitos para obtenção do título de Doutor em Microbiologia, junto ao Programa de Pós-Graduação em Microbiologia, Área de Concentração - Microbiologia Industrial, Ambiental e de Alimentos, do Instituto de Biociências, Letras e Ciências Exatas da Universidade Estadual Paulista “Júlio de Mesquita Filho”, Campus de São José do Rio Preto. Comissão Examinadora Profª. Drª. Ana Lúcia Barretto Penna UNESP – São José do Rio Preto Orientador Prof. Dr. Svetoslav Dimitrov Todorov USP – São Paulo Profª. Drª. Vanessa Bíscola USP – São Paulo Prof. Dr. Rafael Chacon Ruiz Martinez USP – São Paulo Profª. Drª. Mara Corrêa Lelles Nogueira FAMERP – São José do Rio Preto São José do Rio Preto 16 de dezembro de 2013 3 Paula, Aline Teodoro de. Leuconostoc mesenteroides SJRP55 isolada de mussarela de búfala : perfil probiótico e bacteriocinogênico / Aline Teodoro de Paula.
    [Show full text]
  • Acquired Immunodeficiency Syndrome (AIDS) Is One of the Most Widespread Diseases on the Planet, and the Need for New Forms of Treatment Has Become Paramount
    Selection of RNA Aptamers that Inhibit Mutant 3 HIV-1 Reverse Transcriptase Presented by: Naeem Husain In partial fulfillment of the requirements for graduation with the Dean’s Scholars Honor’s Degree in Biochemistry ____________________ ____________________ Dr. Andrew D. Ellington Date Supervising Professor ____________________ ____________________ Dr. John F. Stanton Date Honor’s Advisor in Biochemistry I grant the Dean’s Scholars Program permission to __x__ Post a copy of my thesis on the Dean’s Scholars website __x__ Keep a copy of my thesis in the Dean’s Scholars office Selection of RNA Aptamers that Inhibit Mutant 3 HIV-1 Reverse Transcriptase Department: Chemistry and Biochemistry ___________________ Naeem Husain ____________________ ____________________ Signature Date ___________________ Dr. Andrew D. Ellington ____________________ ____________________ Signature Date Table of Contents Acknowledgments 1 Abstract 2 Introduction 4 Methods and Materials 9 Results and Discussion In vitro selection of aptamers that bind to drug-resistant 15 mutant 3 variant of HIV-1 RT Characterization of Aptamer Binding and Specificity to HIV-1 RT 18 Aptamers that inhibit both wild type and mutant 3 RTs 26 Building Aptamer Complexes Bind More Tightly to Target Protein 31 References 35 Acknowledgements I would like to thank my parents who helped me in every step of my life, and I would not be here without them. I would also like to thank my research supervisor, Dr. Andrew Ellington, who has guided me in this difficult journey that people like to call scientific research. I would also like to thank Dr. Ruth Shear, Dr. David Laude and Dr. Alan Cline, who have been my mentors all throughout my time at the University of Texas.
    [Show full text]
  • Antifungals and Anti-Tuberculosis Agents
    Review of our Fungal “Players” Opportunistic fungi Newly emerging fungi Antifungals and – Normal flora Fusarium Candida spp. Scedosporidium Anti-Tuberculosis Agents – Ubiquitous in our environment Trichosporin Aspergillus spp. Cryptococcus spp. Mucor spp. Endemic geographically restricted Christine Kubin, Pharm.D., BCPS Blastomyces sp. Clinical Pharmacist, Infectious Diseases Coccidioides sp. Histoplasma sp. NewYork-Presbyterian Hospital Columbia University Medical Center Risk Factors for Fungal Disease Candidiasis Aspergillosis –Antibiotics – Granulocytopenia (↓ Antifungal Agents – Indwelling catheters neutrophil numbers or – Hyperalimentation function) – Multiple abdominal – T-cell dysfunction surgeries hematologic and other malignancies – Prosthetic material organ allograft recipients – Severe burns immunosuppressive – Neoplastic therapy diseases/chemotherapy – Corticosteroids – Immunosuppressive – Chronic granulomatous therapy disease – Diabetes mellitus –AIDS – Extremes of age – Burn patients Fungi An optimal antifungal drug has... Yeasts Moulds Mucormycosis Wide spectrum of activity (rarely septate) Pneumocystis Aspergillus sp. Favorable pharmacokinetic Candida sp. jervici Dimorphic (septate) Rhizopus Rhizomucor profile Histoplasmosis Mucor HOST FUNGUS Cryptococcus Blastomycosis Absidia Adequate in vivo efficacy neoformans Coccidioidomycosis Paracoccidioidomycosis [Zygomycetes] Low rate of toxicity Sporotrichosis Chromoblastomycosis Dermatophytes Low cost Trichophyton Microsporum Miscellaneous Epidermophyton Pseudoallerscheria
    [Show full text]
  • Development of Optimized Inhibitor Rnas Allowing Multisite-Targeting of the HCV Genome
    molecules Article Development of Optimized Inhibitor RNAs Allowing Multisite-Targeting of the HCV Genome Cristina Romero-López *, Thomas Lahlali †, Beatriz Berzal-Herranz and Alfredo Berzal-Herranz * Instituto de Parasitología y Biomedicina “López-Neyra”, IPBLN-CSIC, PTS Granada, Av. del Conocimiento 17, Armilla, 18016 Granada, Spain; [email protected] (T.L.); [email protected] (B.B.-H.) * Correspondence: [email protected] (C.R.-L.) [email protected] (A.B.-H.); Tel.: +34-958-18-16-21 (C.R.-L. & A.B.-H.) † Current address: INSERM U1052, Cancer Research Centre of Lyon (CRCL), Université Claude-Bernard (UCBL), UMR_S1052, UCBL, 69008 Lyon, France. Academic Editor: Harri Lönnberg Received: 19 April 2017; Accepted: 16 May 2017; Published: 22 May 2017 Abstract: Engineered multivalent drugs are promising candidates for fighting infection by highly variable viruses, such as HCV. The combination into a single molecule of more than one inhibitory domain, each with its own target specificity and even a different mechanism of action, results in drugs with potentially enhanced therapeutic properties. In the present work, the anti-HCV chimeric inhibitor RNA HH363-10, which has a hammerhead catalytic domain and an aptamer RNA domain, was subjected to an in vitro selection strategy to isolate ten different optimised chimeric inhibitor RNAs. The catalytic domain was preserved while the aptamer RNA domain was evolved to contain two binding sites, one mapping to the highly conserved IIIf domain of the HCV genome’s internal ribosome entry site (IRES), and the other either to IRES domain IV (which contains the translation start codon) or the essential linker region between domains I and II.
    [Show full text]
  • WO 2008/022468 Al
    (12) INTERNATIONAL APPLICATION PUBLISHED UNDER THE PATENT COOPERATION TREATY (PCT) (19) World Intellectual Property Organization International Bureau (43) International Publication Date (10) International Publication Number 28 February 2008 (28.02.2008) PCT WO 2008/022468 Al (51) International Patent Classification: [CA/CA]; 103-6190 Agronomy Road, Vancouver, British C07H 21/02 (2006.01) C12Q 1/02 (2006.01) Columbia V5T 1Z3 (CA). A61K 31/105 (2006.01) C12Q 1/18 (2006.01) (72) Inventors; and A61K 48/00 (2006.01) C12Q 1/42 (2006.01) (75) Inventors/Applicants (for US only): KRYSTAL, Gerald A61P 37/02 (2006.01) A61K 31/704 (2006.01) [CA/CA]; 5661 Elm Street, Vancouver, British Columbia C12N 15/55 (2006.01) A61K 31/337 (2006.01) V6N 1A3 (CA). ONG, Christopher [CA/CA]; 906-1 189 C12N 9/16 (2006.01) A61K 33/24 (2006.01) Howe Street, Vancouver, British Columbia V6Z 2X4 (CA). (21) International Application Number: MUI, Alice [CA/CA]; 301-3440 West Broadway, Vancou PCT/CA2007/001501 ver, British Columbia V6R 4R2 (CA). (22) International Filing Date: 24 August 2007 (24.08.2007) (74) Agent: CHATTERJEE, Alakananda; Gowling Lafleur (25) Filing Language: English Henderson LLP, 1055 Dunsmuir Street, Suite 2300, Van couver, British Columbia V7X IJl (CA). (26) Publication Language: English (81) Designated States (unless otherwise indicated, for every (30) Priority Data: kind of national protection available): AE, AG, AL, AM, 60/823,404 24 August 2006 (24.08.2006) US AT,AU, AZ, BA, BB, BG, BH, BR, BW, BY, BZ, CA, CH, (71) Applicants (for all designated States except US): CN, CO, CR, CU, CZ, DE, DK, DM, DO, DZ, EC, EE, EG, BRITISH COLUMBIA CANCER AGENCY [CA/CA]; ES, FI, GB, GD, GE, GH, GM, GT, HN, HR, HU, ID, IL, 675 West 10th Avenue, Vancouver, British Columbia V5Z IN, IS, JP, KE, KG, KM, KN, KP, KR, KZ, LA, LC, LK, 1L3 (CA).
    [Show full text]
  • (12) United States Patent (10) Patent No.: US 8,946,381 B2 Fear Et Al
    USOO894.6381 B2 (12) United States Patent (10) Patent No.: US 8,946,381 B2 Fear et al. (45) Date of Patent: Feb. 3, 2015 (54) COMPOSITIONS AND USES THEREOF FOR 6,316.223 B1 1 1/2001 Payan et al. THE TREATMENT OF WOUNDS g R 1 $38, E. i al. (75) Inventors: Mark Fear, Mundaring (AU); Paul 6.436,694 B1 8, 2002 Ea. Watt, Mount Claremont (AU); Richard 6,475,726 B1 1 1/2002 Tally et al. Hopkins, North Perth (AU): Nadia 6,521,425 B2 2/2003 Perler et al. Milech, Daglish (AU) 55: R 538. Manillet al. (73) Assignees: Phylogica Limited, Subiaco (AU); The 6.583.10s B1 6, 2003 Marini et al. McComb Foundation, Inc., Wembley 6,583,275 B1 6/2003 Doucette-Stamm et al. (AU) 6,610,820 B1* 8/2003 Bonny . 530/300 (*) Notice: Subject to any disclaimer, the term of this 6,720,4136,720,139 B1 4/2004 ZyskindSchweinfest et al. et al. patent is extended or adjusted under 35 6,846,625 B1 1/2005 Tally et al. U.S.C. 154(b) by 810 days. 6,962.904 B1 * 1 1/2005 Sandberg et al. ............ 514, 18.8 7,041,868 B2 * 5/2006 Greene et al. ................... 602/48 (21) Appl. No.: 12/441,691 7,053,046 B2 * 5/2006 McGrath ...................... 514,216 7,117,096 B2 10/2006 Luo et al. (22) PCT Filed: Feb. 6, 2007 7,303,885 B1* 12/2007 Brunner et al. ................ 435/71 2002fO150906 A1 10, 2002 Debe 2002fO155564 A1 10, 2002 Medrano et al.
    [Show full text]
  • Screening of Natural Compounds That Targets Glutamate Racemase Of
    www.nature.com/scientificreports OPEN Screening of natural compounds that targets glutamate racemase of Mycobacterium tuberculosis reveals the anti-tubercular potential of favonoids Alka Pawar1,2, Prakash Jha 1, Madhu Chopra1, Uma Chaudhry2 & Daman Saluja1* Tuberculosis (TB) is caused by Mycobacterium tuberculosis (MTB), a highly infectious disease accounting for nearly 1.5 million deaths every year and has been a major global concern. Moreover, resistance to anti-TB drugs is an arduous obstacle to efective prevention, TB care and management. Therefore, incessant attempts are being made to identify novel drug targets and newer anti-tubercular drugs to fght with this deadly pathogen. Increasing resistance, adverse efects and costly treatment by conventional therapeutic agents have been inclining the researchers to search for an alternative source of medicine. In this regard natural compounds have been exploited extensively for their therapeutic interventions targeting cellular machinery of MTB. Glutamate racemase (MurI) is an enzyme involved in peptidoglycan (PG) biosynthesis and has become an attractive target due to its moonlighting property. We screened various classes of natural compounds using computational approach for their binding to MTB-MurI. Shortlisted best docked compounds were evaluated for their functional, structural and anti-mycobacterial activity. The results showed that two favonoids (naringenin and quercetin) exhibited best binding afnity with MTB-MurI and inhibited the racemization activity with induced structural perturbation. In addition, fuorescence and electron microscopy were employed to confrm the membrane and cell wall damages in mycobacterial cells on exposure to favonoids. Together, these observations could provide impetus for further research in better understanding of anti-tubercular mechanisms of favonoids and establishing them as lead molecules for TB treatment.
    [Show full text]
  • REVIEW Micrornas and Lymph Node Metastasis in Papillary Thyroid Cancers
    DOI:http://dx.doi.org/10.7314/APJCP.2016.17.1.25 MicroRNAs and Lymph Node Metastasis in Papillary Thyroid Cancer REVIEW MicroRNAs and Lymph Node Metastasis in Papillary Thyroid Cancers Nurul-Syakima Ab Mutalib1*&, Azliana Mohamad Yusof1&, Norfilza Mohd Mokhtar2, Roslan Harun3, Rohaizak Muhammad4, Rahman Jamal1 Abstract Lymph node metastasis (LNM) in papillary thyroid cancer (PTC) has been shown to be associated with increased risk of locoregional recurrence, poor prognosis and decreased survival, especially in older patients. Hence, there is a need for a reliable biomarker for the prediction of LNM in this cancer. MicroRNAs (miRNAs) are small noncoding RNAs that regulate gene translation or degradation and play key roles in numerous cellular functions including cell-cycle regulation, differentiation, apoptosis, invasion and migration. Various studies have demonstrated deregulation of miRNA levels in many diseases including cancers. While a large number of miRNAs have been identified from PTCs using various means, association of miRNAs with LNM in such cases is still controversial. Furthermore, studies linking most of the identified miRNAs to the mechanism of LNM have not been well documented. The aim of this review is to update readers on the current knowledge of miRNAs in relation to LNM in PTC. Keywords: microRNAs - papillary thyroid cancer - lymph node - metastasis - biomarker Asian Pac J Cancer Prev, 17 (1), 25-35 Introduction and hence the reason lymph node surgery is considered important in the treatment of PTC (Moo and Fahey, 2011). Papillary thyroid carcinoma (PTC) is the commonest MicroRNAs (miRNAs), firstly identified in type of thyroid cancer, contributing to more than 80% Caenorhabditis elegans, are endogenous, non-protein- of all thyroid malignancies.
    [Show full text]
  • Leuconostoc Mesenteroides SJRP55: a Potential Probiotic Strain Isolated from Brazilian Water Buffalo Mozzarella Cheese
    Ann Microbiol (2015) 65:899–910 DOI 10.1007/s13213-014-0933-9 ORIGINAL ARTICLE Leuconostoc mesenteroides SJRP55: a potential probiotic strain isolated from Brazilian water buffalo mozzarella cheese Aline Teodoro de Paula & Ana Beatriz Jeronymo-Ceneviva & Luana Faria Silva & Svetoslav Dimitrov Todorov & Bernadette Dora G. Mello Franco & Ana Lúcia Barretto Penna Received: 27 February 2014 /Accepted: 15 June 2014 /Published online: 12 July 2014 # Springer-Verlag Berlin Heidelberg and the University of Milan 2014 Abstract The probiotic potential of Leuconostoc mesenteroides Introduction subsp. mesenteroides SJRP55, isolated from water buffalo mozzarella cheese was evaluated. The microorganism The consumption of functional dairy products that provide presented resistance to stressful conditions that simulated health benefits has increased significantly in the last few years, the gastrointestinal tract, and to the best of our knowledge, and consequently, the industry has begun looking for strains Leuconostoc mesenteroides subsp. mesenteroides SJRP55 with probiotic characteristics for future application in function- was the first of this species with the ability to deconjugate al foods. Probiotics are defined as live, non-pathogenic micro- bile salts. Tolerance to NaCl was temperature dependent, as organisms that, when administered in adequate amounts, con- well the results obtained by aggregation capacity. The strain fer a health benefit to the consumer (FAO/WHO 2002). presented good adhesion properties, β–galactosidase activity, The literature describes countless benefits of probiotic cul- viability in fermented milk during storage, inactive against tures. They have been found to enhance the host’s immune Streptococcus thermophilus and sensitive to most of the tested response, to alleviate symptoms of lactose intolerance, to antibiotics.
    [Show full text]
  • Molecular Assembly for High-Performance Bivalent Nucleic Acid Inhibitor
    Molecular assembly for high-performance bivalent nucleic acid inhibitor Youngmi Kim, Zehui Cao, and Weihong Tan* Center for Research at the Bio/nano Interface, Department of Chemistry, University of Florida Genetics Institute, Shands Cancer Center, and McKnight Brain Institute, University of Florida, Gainesville, FL 32611-7200 Edited by Richard N. Zare, Stanford University, Stanford, CA, and approved February 7, 2008 (received for review December 14, 2007) It is theorized that multivalent interaction can result in better to a single-stranded DNA called the cellular retinol-binding affinity and selectivity than monovalent interaction in the design protein II element (CRBP-II element). Interestingly, although of high-performance ligands. Accordingly, biomolecular engineers the intrinsic affinity of one or more units of RXR-L for one are increasingly taking advantage of multivalent interactions to CRBP-II element (i.e., di-, tri-, or tetravalent interaction) is fabricate novel molecular assemblies, resulting in new functions insufficient to initiate transcription, more than five of these for ligands or enhanced performance of existing ligands. Substan- complexes adjacent to CRBP-II elements can, in fact, initiate the tial efforts have been expended in using small molecules or transcription. As a result, transcriptive response is well regulated epitopes of antibodies for designing multifunctional or better- depending on the concentration of the transcription factor. performing ligands. However, few attempts to use nucleic acid Furthermore, as noted above, this activity demonstrates the aptamers as functional domains have been reported. In this study, cooperative configuration, as noted above, which gives polyva- we explore the design of bivalent nucleic acid ligands by using lent interactions the potential for considerably increased binding thrombin and its aptamers as the model by which to evaluate its affinity.
    [Show full text]
  • ( 12 ) United States Patent (10 ) Patent No.: US 10,682,400 B2 Ali Et Al
    US010682400B2 ( 12 ) United States Patent (10 ) Patent No.: US 10,682,400 B2 Ali et al. (45 ) Date of Patent : Jun . 16 , 2020 ( 54 ) COMBINATION VACCINE DEVICES AND (2013.01 ) ; A61K 2039/55561 ( 2013.01) ; COOK METHODS OF KILLING CANCER CELLS 2317/21 (2013.01 ) ; CO7K 2317/24 (2013.01 ) (71 ) Applicants : President and Fellows of Harvard (58 ) Field of Classification Search College , Cambridge , MA (US ) ; CPC A61K 39/39 ; A61K 39/0011 Dana - Farber Cancer Institute , Inc., See application file for complete search history. Boston , MA (US ) (72 ) Inventors : Omar Abdel -Rahman Ali, Cambridge, ( 56 ) References Cited MA (US ) ; David J. Mooney, Sudbury, U.S. PATENT DOCUMENTS MA (US ) ; Glenn Dranoff , Lexington , MA (US ) 3,773,919 A 11/1973 Boswell et al . 4,522,811 A 6/1985 Eppstein et al . 4,946,778 A 8/1990 Ladner et al. ( 73 ) Assignees : President and Fellows of Harvard 5,073,627 A 12/1991 Curtis et al. College, Cambridge , MA (US ) ; 5,091,513 A 2/1992 Huston et al . Dana - Farber Cancer Institute , Inc. , 5,132,405 A 7/1992 Huston et al . Boston , MA (US ) 5,885,829 A 3/1999 Mooney et al . 5,888,987 A 3/1999 Haynes et al . 5,906,826 A 5/1999 Emery et al. ( * ) Notice: Subject to any disclaimer , the term of this 5,951,976 A 9/1999 Segal patent is extended or adjusted under 35 6,129,716 A 10/2000 Steer U.S.C. 154 ( b ) by 4 days . 6,193,970 B1 2/2001 Pardoll et al.
    [Show full text]