(12) INTERNATIONAL APPLICATION PUBLISHED UNDER THE PATENT COOPERATION TREATY (PCT) (19) World Intellectual Property Organization International Bureau (43) International Publication Date (10) International Publication Number 28 February 2008 (28.02.2008) PCT WO 2008/022468 Al (51) International Patent Classification: [CA/CA]; 103-6190 Agronomy Road, Vancouver, British C07H 21/02 (2006.01) C12Q 1/02 (2006.01) Columbia V5T 1Z3 (CA). A61K 31/105 (2006.01) C12Q 1/18 (2006.01) (72) Inventors; and A61K 48/00 (2006.01) C12Q 1/42 (2006.01) (75) Inventors/Applicants (for US only): KRYSTAL, Gerald A61P 37/02 (2006.01) A61K 31/704 (2006.01) [CA/CA]; 5661 Elm Street, Vancouver, British Columbia C12N 15/55 (2006.01) A61K 31/337 (2006.01) V6N 1A3 (CA). ONG, Christopher [CA/CA]; 906-1 189 C12N 9/16 (2006.01) A61K 33/24 (2006.01) Howe Street, Vancouver, British Columbia V6Z 2X4 (CA). (21) International Application Number: MUI, Alice [CA/CA]; 301-3440 West Broadway, Vancou PCT/CA2007/001501 ver, British Columbia V6R 4R2 (CA). (22) International Filing Date: 24 August 2007 (24.08.2007) (74) Agent: CHATTERJEE, Alakananda; Gowling Lafleur (25) Filing Language: English Henderson LLP, 1055 Dunsmuir Street, Suite 2300, Van couver, British Columbia V7X IJl (CA). (26) Publication Language: English (81) Designated States (unless otherwise indicated, for every (30) Priority Data: kind of national protection available): AE, AG, AL, AM, 60/823,404 24 August 2006 (24.08.2006) US AT,AU, AZ, BA, BB, BG, BH, BR, BW, BY, BZ, CA, CH, (71) Applicants (for all designated States except US): CN, CO, CR, CU, CZ, DE, DK, DM, DO, DZ, EC, EE, EG, BRITISH COLUMBIA CANCER AGENCY [CA/CA]; ES, FI, GB, GD, GE, GH, GM, GT, HN, HR, HU, ID, IL, 675 West 10th Avenue, Vancouver, British Columbia V5Z IN, IS, JP, KE, KG, KM, KN, KP, KR, KZ, LA, LC, LK, 1L3 (CA). THE UNIVERSITY OF BRITISH COLUM¬ LR, LS, LT, LU, LY, MA, MD, ME, MG, MK, MN, MW, BIA UNIVERSITY-INDUSTRY LIAISON OFFICE MX, MY, MZ, NA, NG, NI, NO, NZ, OM, PG, PH, PL, [Continued on next page] (54) Title: COMPOSITIONS AND METHODS FOR TREATING MYELOSUPPRESSION (57) Abstract: The invention provides, in part, compositions and methods for protecting a hemopoietic cell, or for treating myelosuppression, in a subject in need thereof, by administering an effective amount of an inhibitor of a SH2-containing inositol-5 '-phosphatase. PT, RO, RS, RU, SC, SD, SE, SG, SK, SL, SM, SV, SY, European (AT,BE, BG, CH, CY, CZ, DE, DK, EE, ES, FI, TJ, TM, TN, TR, TT, TZ, UA, UG, US, UZ, VC, VN, ZA, FR, GB, GR, HU, IE, IS, IT, LT,LU, LV,MC, MT, NL, PL, ZM, ZW. PT, RO, SE, SI, SK, TR), OAPI (BF, BJ, CF, CG, CI, CM, GA, GN, GQ, GW, ML, MR, NE, SN, TD, TG). (84) Designated States (unless otherwise indicated, for every kind of regional protection available): ARIPO (BW, GH, GM, KE, LS, MW, MZ, NA, SD, SL, SZ, TZ, UG, ZM, Published: COMPOSITIONS AND METHODS FOR TREATING MYELOSUPPRESSXON CROSS-REFERENCE TO RELATED APPLICATIONS [0001] This application claims the benefit of U.S. provisional application number 60/823,404, filed August 24, 2006, which is hereby incorporated by reference. FIELD OF INVENTION [0002] The invention provides compositions and methods for protection against and treatment of myelosuppression, More specifically, the invention provides inhibitors of SH2-containing inositol^' -phosphatase for protection against hemodepletion and treatment of myelosuppression. BACKGROUND OF THE INVENTION [0003] The phosphatidylinositol (PI) 3-kiaase (PDK) pathway plays a central role in regulating many biological processes, including survival and proliferation, through the generation of the potent second messenger, PIP3, This phospholipid is present at low levels in the plasma membrane of unstimulated cells but is rapidly synthesized fiotn PI-4,5-P2 by PI3K in response to a diverse array of extracellular stimuli (reviewed in H). This transiently generated PIP3 attracts pleckstrin homology (PH) domain- containing proteins, such as the s rvival/proliferatioϊi enhancing serine/threonine kinase Akt (also known as protein kinase B (PKB)), to the plasma membrane to mediate its effects (reviewed in 1,12), Activation of the PI3K/Akt pathway has been linked with resistance to chemotherapeutic drugs and to radiation u.and its down regulation via PBK inhibitors lowers e resistance of tumour cell lines to various types of therapy l '1$-To ensure that activation of the PI3K pathway is appropriately suppressed/terminated, the ubiquitously expressed tumour suppressor PTEN hydrolyzes 1 PIP3 to PI' 4 S-P2 while the hemopoietic restricted SH2-containing inositol-5 - phosphatase 1 (SHlPl) 3stem cell SHIP (sSHIP) (which is transcribed from a promoter between exons 5 and 6 of the SHIP gene and is expressed in embryonic l δ l6 stem (ES) cells and co-expressed s albeit at low levels, with SHIPl in HSCs ) , and the more widely expressed SHIP2 break it down to PI-3,4-P2. Within non- hemopoietic cells, PTEN and SHIP2 appear to be the key enzymes that keep PΪP3 levels suppressed while in hemopoietic cells, SHIPl is the central player, [0004] SHIPl (also known as SHIP), has been implicated as a negative regulator of proliferation/survival, differentiation and end cell activation i hemopoietic cells by translocating to membranes following extracellular stimulation and hydrolysing the PBK- generated second messenger, PI-3.4,5-P3 (pπ»3) to Pl-3,4-P2 1. Myeloid progenitors in SHIP-/- mice display enhanced survival and proliferation and this results in an increased number of mature neutrophils and monocyte/ macrophages 2. [0005] A major limitation in treating patients with chemotherapies or radiotherapies is the toxicity of these treatments to bone marrow (BM) cells. This leads to myelosupµressioa which results in anemia, requiring red blood cell transfusions, and increased susceptibility to infections because of a drop in white blood cells (leukocytes) and/or increased bleeding because of insufficient numbers of platelets. This myelosuppression limits the chemotherapy or radiation doses that can b e given, for example, to cancerpatients which in turn limits the likelihood of tumour eradication. Current strategies to replenish the BM deficit that follows these treatments include BM transplantation (which is costly and exposes patients to potentially lethal graft versus host disease) and the administration of cytokines such as erythropoietin (Epo or Epogen), G-CSF (Neupogen) and GM-CSF) to stimulate hemopoietic progenitor proliferation along various differentiation pathways. However, some patients do not respond to these cytokines and none of these treatments reverse the fall in platelet numbers. Additionally, the cost of administering even single cytokines is so prohibitive that most BM transplant facilities do not currently use them to narrow the "septic window" following these transplants and these patients are thus at high risk of dying from trivial infections. SUMMARY OF THE INVENTION [0006] The invention provides, in part, compositions and methods for protecting a hemopoietic cell, or for treating myelosuppression, in a subject in need thereof, by administering an effective amount of an inhibitor of a SH2-contaimng inositol-5'- phosphatase. [0007] In one aspec the invention provides a method of protecting a hemopoietic cell in a subject in need thereofby administering an effective amount of an inhibitor of a hemopoietic-restricted SH2-containing inositol-5'-phos ρhatase to the subject. [0008] In alternative embodiments, the hemopoietic cell may be a hemopoietic progenitor c ll such as a myeloid progenitor cell or a lymphoid progenitor cell, or may be a mature cell. In alternative embodiments, the protecting includes decreasing cell death (e.g., apoptosis), In alternative embodiments, the cell death may be induced by chemotherapy or by radiotherapy, In alternative embodiments the hemopoietic-restricted SH2-containing inositol-5'- ρho$phatase may be a SHIPl molecule. In alternative embodiments, the subject may be a human. In alternative embodiments, the subject may have, or may be suspected of having, cancer (e,g,, a solid tumor). In alternative embodiments, the subject may be undergoing chemotherapy or radiotherapy. In alternative embodimente, the chemotherapy may be a cancer therapy (e.g., cisplatin, doxorubicin, or taxotere)- La alternative embodiments, the method farther comprises administering a chemotherapeutic agent (e,g,, a cancer therapeutic agent, such as cisplatin, doxorubicin, or taxotere) or administering a radiotherapy. The inhibitor may be administered before, during or after administration of said chemotherapeutic agent or said radiotherapy. The inhibitor may be a siRNA, e.g., a sequence consisting essentially of AAGAGTCAGGAAGGAGAGAAT (SEQ ID NO: 10) or AAGAGTCAGGAAGGAGAAAAT (SEQ ID NO: 11), or a small molecule. [0009] In alternative aspects, the invention provides a method of treating myelosuppression (e.g,, immune suppression) in a subject in need thereof by administering an effective amount of an inhibitor of a hemopoietic-restricted SH2- containing inosϊtol-S '-phosphatase to the subject. [0010] In alternative embodiments, the myelosuppression includes a decrease in hemopoietic progenitor cells or mature cells. In alternative embodiments, the treating includes increasing proliferation of a hemopoietic cell or includes reducing death of a hemopoietic cell. In alternative embodiments, the myelosuppression may be induced by chemotherapy or by radiotherapy. In alternative embodiments, the hemopoietic-restricted SH2-containing inositol-5 '-phosphatase maybe a SHIPl molecule. Ih alternative embodiments, the subject may have, or may be suspected of having, a cancer e.g., a solid tumor. In alternative embodiments, the subject may be a human. Ih alternative embodiments, the subject may be undergoing chemotherapy or radiotherapy. In alternative embodiments, the chemotherapy may be a cancer therapy. In alternative embodiments, the cancer therapy may be one o more of risplatin, doxorubicin, or taxotere. In alternative embodiments, the inhibitor may be administered after administration of said chemotherapy or said radiotherapy. In alternative embodiments, the inhibitor may be a siRNA or a small molecule.