DOCSLIB.ORG

APOBEC3A and APOBEC3B Activities Render Cancer Cells Susceptible to ATR Inhibition Remi Buisson1, Michael S

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
APOBEC3A and APOBEC3B Activities Render Cancer Cells Susceptible to ATR Inhibition Remi Buisson1, Michael S Published OnlineFirst July 11, 2017; DOI: 10.1158/0008-5472.CAN-16-3389 Cancer Molecular and Cellular Pathobiology Research APOBEC3A and APOBEC3B Activities Render Cancer Cells Susceptible to ATR Inhibition Remi Buisson1, Michael S. Lawrence1,2, Cyril H. Benes1, and Lee Zou1,3 Abstract The apolipoprotein B mRNA editing enzyme catalytic poly- ATR-mediated negative feedback loop during replication. The peptide-like APOBEC3A and APOBEC3B have emerged as key surge of abasic sites upon ATR inhibition associated with increas- mutation drivers in cancer. Here, we show that APOBEC3A and ed accumulation of single-stranded DNA, a substrate of APO- APOBEC3B activities impose a unique type of replication stress BEC3A, triggering an APOBEC3A-driven feed-forward loop that by inducing abasic sites at replication forks. In contrast to cells ultimately drove cells into replication catastrophe. In a panel of under other types of replication stress, APOBEC3A-expressing cells cancer cell lines, ATRi selectively induced replication catastrophe in were selectively sensitive to ATR inhibitors (ATRi), but not to a those harboring high APOBEC3A and/or APOBEC3B activities, variety of DNA replication inhibitors and DNA-damaging drugs. showing that APOBEC3A and APOBEC3B activities conferred In proliferating cells, APOBEC3A modestly elicited ATR but susceptibility to ATRi. Our results define an APOBEC-driven repli- not ATM. ATR inhibition in APOBEC3A-expressing cells resulted cation stress in cancer cells that may offer an opportunity for in a surge of abasic sites at replication forks, revealing an ATR-targeted therapy. Cancer Res; 77(17); 1–12. Ó2017 AACR. Introduction APOBEC3A and APOBEC3B (A3A and A3B) are members of the APOBEC family of cytosine deaminases, which convert C to Genomic instability is one of the hallmarks of cancers (1). U in single-stranded DNA (ssDNA; refs. 16–18). Although While genomic instability fuels tumorigenesis, it also offers a APOBEC proteins are important for the cellular defense vulnerability of cancer cells that can be exploited therapeutically. against foreign DNA/RNA during viral infection (19), they DNA replication stress is a major source of genomic instability are not normally expressed in unstressed proliferating cells. (2, 3). Activation of a number of oncogenes, such as MYC, RAS, When A3A and A3B are abnormally expressed in cancer cells, and cyclin E, induces replication stress (4–6). Inactivation of they become potent mutators of the genome. Expression of certain tumor suppressors involved in DNA repair, such as BRCA1 APOBEC3B is prevalent in several cancer types (17, 20–23). In- and BRCA2, also elevates replication stress in cancer cells (7–11). depth analysis of mutation signatures in cancers has implicated Recent cancer genomics studies by others and us revealed that both A3A and A3B in APOBEC-mediated mutagenesis (24). An cancer-associated mutations in the genes encoding mismatch A3AB fusion gene resulting from a deletion in the APOBEC3A- DNA repair proteins and DNA polymerase epsilon (POLE), APOBEC3B locus encodes A3A and associates with increased as well as cancer-associated expression of APOBEC3A and risk for breast and ovarian cancers, and with the APOBEC APOBEC3B, are key drivers of mutation in cancers (12, 13). mutation signature in tumors (25–29). Furthermore, A3A is Notably, the mutations inflicted by these "mutators" display a upregulated in a subset of leukemia (30). When expressed at clear association with either leading or lagging strand of DNA high levels, both A3A and A3B induce DNA double-stranded replication forks, suggesting that they act in a replication-coupled breaks (DSB), and A3A also triggers cell-cycle arrest (17, 18, manner (12, 14, 15). These new findings raise an important 31). Together, these findings show that A3A and A3B are question as to whether these mutators in cancer cells induce important drivers of mutation and genomic instability in a replication stress and, if so, whether the stress induced by them large subset of cancers, raising the question of how cancer cells can be targeted in cancer therapy. cope with these mutators during proliferation, and whether these mutators offer an opportunity for targeted therapy. Here, we show that A3A and A3B impose a unique type of replication stress by cytosine deamination at DNA replication 1Massachusetts General Hospital Cancer Center, Harvard Medical School, Bos- forks. During DNA replication, A3A induces abasic (AP) sites in an 2 ton, Massachusetts. Broad Institute of Harvard and MIT, Cambridge, Massa- UNG2-dependent manner, leading to modest ATR activation. 3 chusetts. Department of Pathology, Massachusetts General Hospital, Harvard Inhibition of ATR in A3A-expressing cells results in a surge of AP Medical School, Boston, Massachusetts. sites at replication forks, revealing a previously unknown ATR- Note: Supplementary data for this article are available at Cancer Research mediated feedback loop that counters A3A. The accumulation of Online (http://cancerres.aacrjournals.org/). AP sites at replication forks upon ATR inhibition increases stalling Corresponding Author: Lee Zou, Massachusetts General Hospital Cancer Cen- of DNA polymerases and exposure of ssDNA, a substrate of A3A. ter, Building 149-7th Floor, 13th Street, Charlestown, MA 02129. Phone: 617-724- In the absence of ATR activity, ssDNA triggers an A3A-driven feed- 9534; Fax: 617-726-7808; E-mail: [email protected] forward loop propelling a further buildup of AP sites and ssDNA doi: 10.1158/0008-5472.CAN-16-3389 at replication forks, which ultimately drives cells into replication Ó2017 American Association for Cancer Research. catastrophe. Interestingly, the replication stress induced by A3A www.aacrjournals.org OF1 Downloaded from cancerres.aacrjournals.org on September 29, 2021. © 2017 American Association for Cancer Research. Published OnlineFirst July 11, 2017; DOI: 10.1158/0008-5472.CAN-16-3389 Buisson et al. renders cells sensitive to ATR inhibitors (ATRi), but not to a variety Antibodies of replication inhibitors and genotoxic drugs, highlighting the The antibodies used in this study were: gH2AX mAb (Cell unique nature of A3A-induced replication stress and the distinc- Signaling Technology and EMD Millipore), APOBEC3B polyclon- tive role of ATR against this stress. In a panel of cancer cell lines, al antibody (Santa Cruz Biotechnology), Flag-M2 mAb (Sigma- ATRi rapidly induces replication catastrophe in those harboring Aldrich), CDC7 mAb (Abcam), PCNA mAb (Santa Cruz Biotech- high A3A and/or A3B activities, suggesting that the replication nology), Chk1 mAb (Santa Cruz Biotechnology), BrdUrd mAb stress imposed by A3A and A3B may offer a promising opportu- (BD Biosciences), PCNA polyclonal antibody (Abcam), Chk2 nity for ATR-targeted therapy in a variety of cancers. pT68 polyclonal antibody (Cell Signaling Technology), Chk1 pS317 polyclonal antibody (Cell Signaling Technology), GAPDH Materials and Methods polyclonal antibody (EMD Millipore), UNG polyclonal antibody (Novus), RPA32 mAb (Thermo Fisher Scientific), RPA70 poly- Cell lines clonal antibody (Bethyl), APE1 mAb (Santa Cruz Biotechnology), All cell lines were obtained from the Center for Molecular biotin polyclonal antibody (Abcam), and ATR polyclonal anti- Therapeutics (CMT) at the MGH Cancer Center (Boston, MA) body (Bethyl). from 2015 to 2016. The CMT has obtained all cell lines described here from commercial repositories (ATTC, DSMZ, ECACC, or JHSF/JCRB). Upon receipt at CMT, the cell lines Results were expanded and frozen stocks were created. Stocks were APOBEC3A and APOBEC3B activate ATR but not ATM in further authenticated as follows: To identify cross-contami- proliferating cancer cells nated or synonymous lines, a panel of SNPs was profiled for Recentstudiesbyothersandusrevealedthatthemutation each cell line (Sequenom) and a pair-wise comparison score signatures of A3A and A3B are associated with the lagging was calculated. In addition, we performed short tandem strand of DNA replication forks, suggesting that A3A and A3B repeat (STR) analysis (AmpFLSTR Identifiler, Applied Biosys- act on ssDNA during DNA replication (12, 14, 15). To tems) and matched this to an existing STR profile generated by investigate whether A3A and A3B induce replication stress, the providing repository. From authenticated frozen stocks, we analyzed the expression data of A3A and A3B in a large cells were not continuously kept in culture for more than 3 panel of cancer cell lines (Supplementary Fig. S1A). Consistent months. For the experiments described in this article, cell lines with previous studies, A3B mRNA was detected in a large were not continuously kept in culture for more than 3 fraction of cancer cell lines (17, 21). A3A mRNA was also months. All cell lines used in this study were tested for detected in a subset of the cell lines. We selected a group of mycoplasma. cell lines that express A3A and A3B mRNAs at various levels according to the microarray data and then determined the Cell culture relative levels of A3A and A3B mRNAs using qRT-PCR (Sup- U2OS-derived and SKOV3-derived cell lines expressing plementary Fig. S1B). Furthermore, we tested these cell lines in vitro APOBEC3A were generated by infecting U2OS cells with lentivirus for A3A and A3B activities using a previously described – expressing APOBEC3A under a doxycycline-inducible promoter assay (Supplementary Fig. S1C S1E; ref. 17). We measured the (pInducer20) and selected with G418 (400 mg/mL). U2OS deriv- overall A3A-A3B activity because the enzymatic
Load more

Recommended publications
  • Longitudinal Peripheral Blood Transcriptional Analysis of COVID-19 Patients
    medRxiv preprint doi: https://doi.org/10.1101/2020.05.05.20091355; this version posted May 8, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. All rights reserved. No reuse allowed without permission. 1 Longitudinal peripheral blood transcriptional analysis of COVID-19 patients 2 captures disease progression and reveals potential biomarkers 3 Qihong Yan1,5,†, Pingchao Li1,†, Xianmiao Ye1,†, Xiaohan Huang1,5,†, Xiaoneng Mo2, 4 Qian Wang1, Yudi Zhang1, Kun Luo1, Zhaoming Chen1, Jia Luo1, Xuefeng Niu3, Ying 5 Feng3, Tianxing Ji3, Bo Feng3, Jinlin Wang2, Feng Li2, Fuchun Zhang2, Fang Li2, 6 Jianhua Wang1, Liqiang Feng1, Zhilong Chen4,*, Chunliang Lei2,*, Linbing Qu1,*, Ling 7 Chen1,2,3,4,* 8 1Guangzhou Regenerative Medicine and Health-Guangdong Laboratory 9 (GRMH-GDL), Guangdong Laboratory of Computational Biomedicine, Guangzhou 10 Institutes of Biomedicine and Health, Chinese Academy of Sciences, Guangzhou, 11 China 12 2Guangzhou Institute of Infectious Disease, Guangzhou Eighth People’s Hospital, 13 Guangzhou Medical University, Guangzhou, China 14 3State Key Laboratory of Respiratory Disease, National Clinical Research Center for 15 Respiratory Disease, Guangzhou Institute of Respiratory Health, the First Affiliated 16 Hospital of Guangzhou Medical University, Guangzhou, China 17 4School of Medicine, Huaqiao University, Xiamen, China 18 5University of Chinese Academy of Science, Beijing, China 19 †These authors contributed equally to this work. 20 *To whom correspondence should be addressed: Ling Chen ([email protected]), 21 Linbing Qu ([email protected]), Chunliang Lei ([email protected]), Zhilong 22 Chen ([email protected]) NOTE: This preprint reports new research that has not been certified by peer review and should not be used to guide clinical practice.
    [Show full text]
  • Apoptotic Cells Inflammasome Activity During the Uptake of Macrophage
    Downloaded from http://www.jimmunol.org/ by guest on September 29, 2021 is online at: average * The Journal of Immunology , 26 of which you can access for free at: 2012; 188:5682-5693; Prepublished online 20 from submission to initial decision 4 weeks from acceptance to publication April 2012; doi: 10.4049/jimmunol.1103760 http://www.jimmunol.org/content/188/11/5682 Complement Protein C1q Directs Macrophage Polarization and Limits Inflammasome Activity during the Uptake of Apoptotic Cells Marie E. Benoit, Elizabeth V. Clarke, Pedro Morgado, Deborah A. Fraser and Andrea J. Tenner J Immunol cites 56 articles Submit online. Every submission reviewed by practicing scientists ? is published twice each month by Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts http://jimmunol.org/subscription http://www.jimmunol.org/content/suppl/2012/04/20/jimmunol.110376 0.DC1 This article http://www.jimmunol.org/content/188/11/5682.full#ref-list-1 Information about subscribing to The JI No Triage! Fast Publication! Rapid Reviews! 30 days* Why • • • Material References Permissions Email Alerts Subscription Supplementary The Journal of Immunology The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2012 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. This information is current as of September 29, 2021. The Journal of Immunology Complement Protein C1q Directs Macrophage Polarization and Limits Inflammasome Activity during the Uptake of Apoptotic Cells Marie E.
    [Show full text]
  • Common Differentially Expressed Genes and Pathways Correlating Both Coronary Artery Disease and Atrial Fibrillation
    EXCLI Journal 2021;20:126-141– ISSN 1611-2156 Received: December 08, 2020, accepted: January 11, 2021, published: January 18, 2021 Supplementary material to: Original article: COMMON DIFFERENTIALLY EXPRESSED GENES AND PATHWAYS CORRELATING BOTH CORONARY ARTERY DISEASE AND ATRIAL FIBRILLATION Youjing Zheng, Jia-Qiang He* Department of Biomedical Sciences and Pathobiology, College of Veterinary Medicine, Virginia Tech, Blacksburg, VA 24061, USA * Corresponding author: Jia-Qiang He, Department of Biomedical Sciences and Pathobiology, Virginia Tech, Phase II, Room 252B, Blacksburg, VA 24061, USA. Tel: 1-540-231-2032. E-mail: [email protected] https://orcid.org/0000-0002-4825-7046 Youjing Zheng https://orcid.org/0000-0002-0640-5960 Jia-Qiang He http://dx.doi.org/10.17179/excli2020-3262 This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/4.0/). Supplemental Table 1: Abbreviations used in the paper Abbreviation Full name ABCA5 ATP binding cassette subfamily A member 5 ABCB6 ATP binding cassette subfamily B member 6 (Langereis blood group) ABCB9 ATP binding cassette subfamily B member 9 ABCC10 ATP binding cassette subfamily C member 10 ABCC13 ATP binding cassette subfamily C member 13 (pseudogene) ABCC5 ATP binding cassette subfamily C member 5 ABCD3 ATP binding cassette subfamily D member 3 ABCE1 ATP binding cassette subfamily E member 1 ABCG1 ATP binding cassette subfamily G member 1 ABCG4 ATP binding cassette subfamily G member 4 ABHD18 Abhydrolase domain
    [Show full text]
  • Interactions Between APOBEC3 and Murine Retroviruses: Mechanisms of Restriction and Drug Resistance
    University of Pennsylvania ScholarlyCommons Publicly Accessible Penn Dissertations 2013 Interactions Between APOBEC3 and Murine Retroviruses: Mechanisms of Restriction and Drug Resistance Alyssa Lea MacMillan University of Pennsylvania, [email protected] Follow this and additional works at: https://repository.upenn.edu/edissertations Part of the Virology Commons Recommended Citation MacMillan, Alyssa Lea, "Interactions Between APOBEC3 and Murine Retroviruses: Mechanisms of Restriction and Drug Resistance" (2013). Publicly Accessible Penn Dissertations. 894. https://repository.upenn.edu/edissertations/894 This paper is posted at ScholarlyCommons. https://repository.upenn.edu/edissertations/894 For more information, please contact [email protected]. Interactions Between APOBEC3 and Murine Retroviruses: Mechanisms of Restriction and Drug Resistance Abstract APOBEC3 proteins are important for antiretroviral defense in mammals. The activity of these factors has been well characterized in vitro, identifying cytidine deamination as an active source of viral restriction leading to hypermutation of viral DNA synthesized during reverse transcription. These mutations can result in viral lethality via disruption of critical genes, but in some cases is insufficiento t completely obstruct viral replication. This sublethal level of mutagenesis could aid in viral evolution. A cytidine deaminase-independent mechanism of restriction has also been identified, as catalytically inactive proteins are still able to inhibit infection in vitro. Murine retroviruses do not exhibit characteristics of hypermutation by mouse APOBEC3 in vivo. However, human APOBEC3G protein expressed in transgenic mice maintains antiviral restriction and actively deaminates viral genomes. The mechanism by which endogenous APOBEC3 proteins function is unclear. The mouse provides a system amenable to studying the interaction of APOBEC3 and retroviral targets in vivo.
    [Show full text]
  • Supplementary Information.Pdf
    Supplementary Information Whole transcriptome profiling reveals major cell types in the cellular immune response against acute and chronic active Epstein‐Barr virus infection Huaqing Zhong1, Xinran Hu2, Andrew B. Janowski2, Gregory A. Storch2, Liyun Su1, Lingfeng Cao1, Jinsheng Yu3, and Jin Xu1 Department of Clinical Laboratory1, Children's Hospital of Fudan University, Minhang District, Shanghai 201102, China; Departments of Pediatrics2 and Genetics3, Washington University School of Medicine, Saint Louis, Missouri 63110, United States. Supplementary information includes the following: 1. Supplementary Figure S1: Fold‐change and correlation data for hyperactive and hypoactive genes. 2. Supplementary Table S1: Clinical data and EBV lab results for 110 study subjects. 3. Supplementary Table S2: Differentially expressed genes between AIM vs. Healthy controls. 4. Supplementary Table S3: Differentially expressed genes between CAEBV vs. Healthy controls. 5. Supplementary Table S4: Fold‐change data for 303 immune mediators. 6. Supplementary Table S5: Primers used in qPCR assays. Supplementary Figure S1. Fold‐change (a) and Pearson correlation data (b) for 10 cell markers and 61 hypoactive and hyperactive genes identified in subjects with acute EBV infection (AIM) in the primary cohort. Note: 23 up‐regulated hyperactive genes were highly correlated positively with cytotoxic T cell (Tc) marker CD8A and NK cell marker CD94 (KLRD1), and 38 down‐regulated hypoactive genes were highly correlated positively with B cell, conventional dendritic cell
    [Show full text]
  • Supplemental Table S1. Primers for Sybrgreen Quantitative RT-PCR Assays
    Supplemental Table S1. Primers for SYBRGreen quantitative RT-PCR assays. Gene Accession Primer Sequence Length Start Stop Tm GC% GAPDH NM_002046.3 GAPDH F TCCTGTTCGACAGTCAGCCGCA 22 39 60 60.43 59.09 GAPDH R GCGCCCAATACGACCAAATCCGT 23 150 128 60.12 56.52 Exon junction 131/132 (reverse primer) on template NM_002046.3 DNAH6 NM_001370.1 DNAH6 F GGGCCTGGTGCTGCTTTGATGA 22 4690 4711 59.66 59.09% DNAH6 R TAGAGAGCTTTGCCGCTTTGGCG 23 4797 4775 60.06 56.52% Exon junction 4790/4791 (reverse primer) on template NM_001370.1 DNAH7 NM_018897.2 DNAH7 F TGCTGCATGAGCGGGCGATTA 21 9973 9993 59.25 57.14% DNAH7 R AGGAAGCCATGTACAAAGGTTGGCA 25 10073 10049 58.85 48.00% Exon junction 9989/9990 (forward primer) on template NM_018897.2 DNAI1 NM_012144.2 DNAI1 F AACAGATGTGCCTGCAGCTGGG 22 673 694 59.67 59.09 DNAI1 R TCTCGATCCCGGACAGGGTTGT 22 822 801 59.07 59.09 Exon junction 814/815 (reverse primer) on template NM_012144.2 RPGRIP1L NM_015272.2 RPGRIP1L F TCCCAAGGTTTCACAAGAAGGCAGT 25 3118 3142 58.5 48.00% RPGRIP1L R TGCCAAGCTTTGTTCTGCAAGCTGA 25 3238 3214 60.06 48.00% Exon junction 3124/3125 (forward primer) on template NM_015272.2 Supplemental Table S2. Transcripts that differentiate IPF/UIP from controls at 5%FDR Fold- p-value Change Transcript Gene p-value p-value p-value (IPF/UIP (IPF/UIP Cluster ID RefSeq Symbol gene_assignment (Age) (Gender) (Smoking) vs. C) vs. C) NM_001178008 // CBS // cystathionine-beta- 8070632 NM_001178008 CBS synthase // 21q22.3 // 875 /// NM_0000 0.456642 0.314761 0.418564 4.83E-36 -2.23 NM_003013 // SFRP2 // secreted frizzled- 8103254 NM_003013
    [Show full text]
  • Molecular Signatures Differentiate Immune States in Type 1 Diabetes Families
    Page 1 of 65 Diabetes Molecular signatures differentiate immune states in Type 1 diabetes families Yi-Guang Chen1, Susanne M. Cabrera1, Shuang Jia1, Mary L. Kaldunski1, Joanna Kramer1, Sami Cheong2, Rhonda Geoffrey1, Mark F. Roethle1, Jeffrey E. Woodliff3, Carla J. Greenbaum4, Xujing Wang5, and Martin J. Hessner1 1The Max McGee National Research Center for Juvenile Diabetes, Children's Research Institute of Children's Hospital of Wisconsin, and Department of Pediatrics at the Medical College of Wisconsin Milwaukee, WI 53226, USA. 2The Department of Mathematical Sciences, University of Wisconsin-Milwaukee, Milwaukee, WI 53211, USA. 3Flow Cytometry & Cell Separation Facility, Bindley Bioscience Center, Purdue University, West Lafayette, IN 47907, USA. 4Diabetes Research Program, Benaroya Research Institute, Seattle, WA, 98101, USA. 5Systems Biology Center, the National Heart, Lung, and Blood Institute, the National Institutes of Health, Bethesda, MD 20824, USA. Corresponding author: Martin J. Hessner, Ph.D., The Department of Pediatrics, The Medical College of Wisconsin, Milwaukee, WI 53226, USA Tel: 011-1-414-955-4496; Fax: 011-1-414-955-6663; E-mail: [email protected]. Running title: Innate Inflammation in T1D Families Word count: 3999 Number of Tables: 1 Number of Figures: 7 1 For Peer Review Only Diabetes Publish Ahead of Print, published online April 23, 2014 Diabetes Page 2 of 65 ABSTRACT Mechanisms associated with Type 1 diabetes (T1D) development remain incompletely defined. Employing a sensitive array-based bioassay where patient plasma is used to induce transcriptional responses in healthy leukocytes, we previously reported disease-specific, partially IL-1 dependent, signatures associated with pre and recent onset (RO) T1D relative to unrelated healthy controls (uHC).
    [Show full text]
  • Implications of Endogenous Retroelements in the Etiopatho- Genesis of Systemic Lupus Erythematosus
    Preprints (www.preprints.org) | NOT PEER-REVIEWED | Posted: 4 January 2021 Review Implications of Endogenous Retroelements in the Etiopatho- genesis of Systemic Lupus Erythematosus Kennedy C. Ukadike 1 and Tomas Mustelin 2,* 1 Division of Rheumatology, Department of Medicine, University of Washington School of Medicine, 750 Republican Street, Seattle, WA 98109; [email protected] 2 Division of Rheumatology, Department of Medicine, University of Washington School of Medicine, 750 Republican Street, Seattle, WA 98109; [email protected] * Correspondence: [email protected]; Tel.: +1 (206) 313-6130 Abstract: Systemic lupus erythematosus (SLE) is a heterogenous autoimmune disease. While its eti- ology remains elusive, current understanding suggests a multifactorial process with contributions by genetic, immunologic, hormonal, and environmental factors. A hypothesis that combines several of these factors proposes that genomic elements, the L1 retrotransposons, are instrumental in SLE pathogenesis. L1 retroelements are transcriptionally activated in SLE and produce two proteins, ORF1p and ORF2p, which are immunogenic and can drive type I interferon (IFN) production by producing DNA species that activate cytosolic DNA sensors. In addition, these two proteins reside in RNA-rich macromolecular assemblies that also contain well-known SLE autoantigens like Ro60. We surmise that cells expressing L1 will exhibit all the hallmarks of cells infected by a virus, result- ing in a cellular and humoral immune response similar to those in chronic viral infections. However, unlike exogenous viruses, L1 retroelements cannot be eliminated from the host genome. Hence, dysregulated L1 will cause a chronic, but perhaps episodic, challenge for the immune system. The clinical and immunological features of SLE can be largely explained by this model.
    [Show full text]
  • Deaminase-Independent Mode of Antiretroviral Action in Human and Mouse APOBEC3 Proteins
    microorganisms Review Deaminase-Independent Mode of Antiretroviral Action in Human and Mouse APOBEC3 Proteins Yoshiyuki Hakata 1,* and Masaaki Miyazawa 1,2 1 Department of Immunology, Kindai University Faculty of Medicine, 377-2 Ohno-Higashi, Osaka-Sayama, Osaka 589-8511, Japan; [email protected] 2 Kindai University Anti-Aging Center, 3-4-1 Kowakae, Higashiosaka, Osaka 577-8502, Japan * Correspondence: [email protected]; Tel.: +81-72-367-7660 Received: 8 December 2020; Accepted: 9 December 2020; Published: 12 December 2020 Abstract: Apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3 (APOBEC3) proteins (APOBEC3s) are deaminases that convert cytosines to uracils predominantly on a single-stranded DNA, and function as intrinsic restriction factors in the innate immune system to suppress replication of viruses (including retroviruses) and movement of retrotransposons. Enzymatic activity is supposed to be essential for the APOBEC3 antiviral function. However, it is not the only way that APOBEC3s exert their biological function. Since the discovery of human APOBEC3G as a restriction factor for HIV-1, the deaminase-independent mode of action has been observed. At present, it is apparent that both the deaminase-dependent and -independent pathways are tightly involved not only in combating viruses but also in human tumorigenesis. Although the deaminase-dependent pathway has been extensively characterized so far, understanding of the deaminase-independent pathway remains immature. Here, we review existing knowledge regarding the deaminase-independent antiretroviral functions of APOBEC3s and their molecular mechanisms. We also discuss the possible unidentified molecular mechanism for the deaminase-independent antiretroviral function mediated by mouse APOBEC3. Keywords: APOBEC3; deaminase-independent antiretroviral function; innate immunity 1.
    [Show full text]
  • 1 APOBEC-Mediated Mutagenesis in Urothelial Carcinoma Is Associated
    bioRxiv preprint doi: https://doi.org/10.1101/123802; this version posted April 4, 2017. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. APOBEC-mediated mutagenesis in urothelial carcinoma is associated with improved survival, mutations in DNA damage response genes, and immune response Alexander P. Glaser MD, Damiano Fantini PhD, Kalen J. Rimar MD, Joshua J. Meeks MD PhD APG, DF, KJR, JJM: Northwestern University, Department of Urology, Chicago, IL, 60607 Running title: APOBEC mutagenesis in bladder cancer *Corresponding author: Joshua J. Meeks, MD PhD 303 E. Chicago Ave. Tarry 16-703 Chicago, IL 60611 Email: [email protected] Keywords (4-6): • Urinary bladder neoplasms • APOBEC Deaminases • Mutagenesis • DNA damage • Interferon Abbreviations and Acronyms: TCGA – The Cancer Genome Atlas ssDNA – single stranded DNA APOBEC –apolipoprotein B mRNA editing catalytic polypeptide-like GCAC – Genome Data Analysis Center MAF – mutation annotation format “APOBEC-high” – tumors enriched for APOBEC mutagenesis “APOBEC-low” – tumors not enriched for APOBEC mutagenesis 1 bioRxiv preprint doi: https://doi.org/10.1101/123802; this version posted April 4, 2017. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Abstract: Background: The APOBEC family of enzymes is responsible for a mutation signature characterized by a TCW>T/G mutation. APOBEC-mediated mutagenesis is implicated in a wide variety of tumors, including bladder cancer. In this study, we explore the APOBEC mutational signature in bladder cancer and the relationship with specific mutations, molecular subtype, gene expression, and survival.
    [Show full text]
  • ©Ferrata Storti Foundation
    Original Articles T-cell/histiocyte-rich large B-cell lymphoma shows transcriptional features suggestive of a tolerogenic host immune response Peter Van Loo,1,2,3 Thomas Tousseyn,4 Vera Vanhentenrijk,4 Daan Dierickx,5 Agnieszka Malecka,6 Isabelle Vanden Bempt,4 Gregor Verhoef,5 Jan Delabie,6 Peter Marynen,1,2 Patrick Matthys,7 and Chris De Wolf-Peeters4 1Department of Molecular and Developmental Genetics, VIB, Leuven, Belgium; 2Department of Human Genetics, K.U.Leuven, Leuven, Belgium; 3Bioinformatics Group, Department of Electrical Engineering, K.U.Leuven, Leuven, Belgium; 4Department of Pathology, University Hospitals K.U.Leuven, Leuven, Belgium; 5Department of Hematology, University Hospitals K.U.Leuven, Leuven, Belgium; 6Department of Pathology, The Norwegian Radium Hospital, University of Oslo, Oslo, Norway, and 7Department of Microbiology and Immunology, Rega Institute for Medical Research, K.U.Leuven, Leuven, Belgium Citation: Van Loo P, Tousseyn T, Vanhentenrijk V, Dierickx D, Malecka A, Vanden Bempt I, Verhoef G, Delabie J, Marynen P, Matthys P, and De Wolf-Peeters C. T-cell/histiocyte-rich large B-cell lymphoma shows transcriptional features suggestive of a tolero- genic host immune response. Haematologica. 2010;95:440-448. doi:10.3324/haematol.2009.009647 The Online Supplementary Tables S1-5 are in separate PDF files Supplementary Design and Methods One microgram of total RNA was reverse transcribed using random primers and SuperScript II (Invitrogen, Merelbeke, Validation of microarray results by real-time quantitative Belgium), as recommended by the manufacturer. Relative reverse transcriptase polymerase chain reaction quantification was subsequently performed using the compar- Ten genes measured by microarray gene expression profil- ative CT method (see User Bulletin #2: Relative Quantitation ing were validated by real-time quantitative reverse transcrip- of Gene Expression, Applied Biosystems).
    [Show full text]
  • Quantification of Ongoing APOBEC3A Activity in Tumor Cells by Monitoring
    ARTICLE https://doi.org/10.1038/s41467-020-16802-8 OPEN Quantification of ongoing APOBEC3A activity in tumor cells by monitoring RNA editing at hotspots Pégah Jalili 1, Danae Bowen 1, Adam Langenbucher2, Shinho Park 1, Kevin Aguirre 1, ✉ ✉ Ryan B. Corcoran 2, Angela G. Fleischman 3, Michael S. Lawrence 2,4,5 , Lee Zou 2,4 & ✉ Rémi Buisson 1,2 APOBEC3A is a cytidine deaminase driving mutagenesis, DNA replication stress and DNA 1234567890():,; damage in cancer cells. While the APOBEC3A-induced vulnerability of cancers offers an opportunity for therapy, APOBEC3A protein and mRNA are difficult to quantify in tumors due to their low abundance. Here, we describe a quantitative and sensitive assay to measure the ongoing activity of APOBEC3A in tumors. Using hotspot RNA mutations identified from APOBEC3A-positive tumors and droplet digital PCR, we develop an assay to quantify the RNA-editing activity of APOBEC3A. This assay is superior to APOBEC3A protein- and mRNA-based assays in predicting the activity of APOBEC3A on DNA. Importantly, we demonstrate that the RNA mutation-based APOBEC3A assay is applicable to clinical samples from cancer patients. Our study presents a strategy to follow the dysregulation of APOBEC3A in tumors, providing opportunities to investigate the role of APOBEC3A in tumor evolution and to target the APOBEC3A-induced vulnerability in therapy. 1 Department of Biological Chemistry, Center for Epigenetics and Metabolism, Chao Family Comprehensive Cancer Center, University of California Irvine, Irvine, CA, USA. 2 Massachusetts General Hospital Cancer Center, Harvard Medical School, Boston, MA, USA. 3 Department of Medicine, Chao Family Comprehensive Cancer Center, University of California Irvine, Irvine, CA, USA.
    [Show full text]