DOCSLIB.ORG

The Impact of Angio-Associated Migratory Cell Protein (AAMP) on Breast Cancer Cells in Vitro and Its Clinical Significance

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
The Impact of Angio-Associated Migratory Cell Protein (AAMP) on Breast Cancer Cells in Vitro and Its Clinical Significance ANTICANCER RESEARCH 33: 1499-1510 (2013) The Impact of Angio-associated Migratory Cell Protein (AAMP) on Breast Cancer Cells In Vitro and Its Clinical Significance YUKUN YIN1,2, ANDREW J. SANDERS1 and WEN G. JIANG1 1Metastasis and Angiogenesis Research Group, Institute of Cancer and Genetics, Cardiff University School of Medicine, Heath Park, Cardiff, U.K.; 2Department of Surgery, Shandong University of Traditional Chinese Medicine, Jinan, Shandong Province, P.R. China Abstract. Background/Aim: Angio-associated migratory cell of patients with high levels (p<0.05). Conclusion: AAMP has protein (AAMP), which belongs to the immunoglobulin a significant influence on the biological functions of breast superfamily, was found to be expressed in different human cell cancer cells and its high expression correlates with poor lines and exhibited a predominant cytosolic localization in prognosis and metastasis. epithelial cells. Previous studies show that the specific gene product is functional in cell migration and angiogenesis and Angio-associated migratory cell protein (AAMP), a 52-kDa can also be used as a marker of poor prognosis in invasive protein initially isolated from a human melanoma cell line gastrointestinal stromal tumours and ductal carcinoma in situ during a search for motility-associated cell surface proteins (DCIS) of the breast. However, the cellular role of AAMP in (1), is extensively expressed in different types of endothelial breast cancer is still unclear. The aim of the current study was cells and aortic smooth-muscle cells (human and bovine), to provide new insights into the implication of AAMP in human melanoma cells, activated T-lymphocytes, renal breast cancer. Materials and Methods: We knocked-down the proximal tubular cells, prostate and breast carcinoma cells, expression of AAMP through transfection of MCF-7 and dermal fibroblasts, glomerular mesangial cells, benign MDA-MB-231 breast cancer cells with a hammerhead mammary cells, and rat myocytes (1-7). The expression of ribozyme transgene (MCF-7AAMPrib and MDA-MB- AAMP was found to be increased in invasive gastrointestinal 231AAMPrib) and examined the impact on cell function using stromal tumours (8) and in ductal carcinoma in situ (DCIS) in vitro assays. Additionally, AAMP expression was examined of the breast with necrosis, where it is considered to be a in a cohort of breast specimens (normal, n=28; cancer, marker of poor prognosis (9). n=102) using quantitative-real-time polymerase chain The AAMP protein contains two immunoglobulin-like reaction (Q-PCR) and immunohistochemical methods. domains, the WD40 repeat motif, and a heparin-binding Results: AAMP knock-down dramatically reduced cell consensus sequence (1). The immunoglobulin superfamily adhesion and cell growth of MCF-7 cells (p<0.05), and relatives include proteins that either are known or are suppressed cell invasion of MDA-MB-231 cells (p<0.05). suspected to play a role in cell adhesion (8, 10, 11). Some Increased expression of AAMP in breast cancer was observed immunoglobulin superfamily members are multifunctional compared with that in normal tissues (p<0.05). High levels and participate in both cell binding and signalling (8, 12). of AAMP transcripts were associated with disease The WD40 repeat motif found in β-transducin and other progression, metastasis, and poor prognosis of the patients. proteins is speculated to represent a general protein-protein Disease-free and overall survival time of patients with lower recognition/binding site (13). The AAMP-derived peptide, levels of AAMP were significantly longer compared to those P189, contains a heparin-binding domain and mediates heparin-sensitive cell adhesion (1, 2, 14). A previous study identified a direct interaction of AAMP with nucleotide- binding oligomerization domain containing-2 (NOD2), but Correspondence to: Professor Wen G. Jiang, Institute of Cancer and declared that Ig domains in AAMP could not be confirmed Genetics, Cardiff University School of Medicine, Cardiff, CF14 (6). Therefore, AAMP sequence homologies indicate that it 4XN, U.K. Tel: +44 2920742895, Fax: +44 2920742896, e-mail: [email protected] may play a role in cell adhesion, migration and innate immune response. Key Words: Angio-associated migratory cell protein, AAMP, breast Functional studies show that anti-recombinant AAMP cancer, prognosis, MCF-7, MDA-MB-231 cells. (anti-rAAMP) inhibits tubule formation by endothelial cells 0250-7005/2013 $2.00+.40 1499 ANTICANCER RESEARCH 33: 1499-1510 (2013) cultured on Matrigel (3). Anti-rAAMP also inhibits Table I. Transcript levels of angio-associated migratory cell protein endothelial and smooth-muscle cell motility (11, 14, 15). It (AAMP) in breast cancer. has also been found that the extracellular form of AAMP Clinical data n AAMP Transcripts plays a positive role in angiogenesis and can be regulated by (copies/μl, median ± Q1) astrocytes, and has led to the hypothesis that the regulation of extracellular AAMP in endothelial cells by astrocytes may Tissue sample aid in the angiogenesis of the nervous system (14). The Tumor 102 10.9±0.6 peptide P189, derived from AAMP was also found to possess Normal 28 1.1±0.2 (**p=0.0077 vs. tumour) the ability to bind and cluster MCF-7 breast cancer cells and NPI human A2058 melanoma cells (5). 1 (NPI score <3.4) 49 12.1±1.4 AAMP was identified as a binding partner of NOD2 2 (NPI score =3.4-5.4) 36 17.3±0.8 through co-immunoprecipitation studies, using human 3 (NPI score >5.4) 14 3±2 embryonic kidney cells (HEK293T), and was found to have Tumor grade 1 18 76±7 functional implication in NOD2-mediated signalling, playing 2 33 20.8±1.6 a negative regulatory role in NOD2-mediated nuclear factor- 3 51 4.2±0.6 kappa B (NF-κB) pathways (6, 7). Studies have (**p=0.0054 vs. grade 1) demonstrated that AAMP causes the translocation and TNM stage activation of ras homolog gene family, member A (RhoA) in I 53 17.1±2.7 II 35 4.6±0.1 (* smooth muscle and endothelial cells. Activated RhoA III 6 71±4 subsequently interacts with its effector rho-kinase (ROCK), IV 3 91.8±1.5 generating the driving force for smooth muscle cells to Survival status migrate and to divide, leading to re-stenosis and Disease-free (DF) 70 8.0±1.4 atherosclerosis (11). AAMP has been identified as a novel With metastases (MT) 7 0.4±0.2 With local recurrence (LT) 5 34±2 interacting partner of both thromboxane A2 receptor-alpha Died of breast cancer (Died) 12 74±4 (TPα) and -beta (TPβ) through an interaction dependent on (*p=0.036 vs. disease-free) common and unique sequences within their carboxyl- Poor prognosis (PP) 24 32.1±0.9 terminal tail domains. The identification of a specific Histology interaction between TPα/β and AAMP is likely to have Ductal 82 10.9±1.4 Lobular 10 13.3±6.4 substantial functional implications for vascular pathologies Mucinous 3 3±0 in which they are both implicated (7). Medullary 1 0.56 Previous studies have shown that AAMP plays a role in Tubular 1 34.1 angiogenesis, one of the most important mechanisms of Other 5 3±0.3 tumour development and metastasis, and is involved in signal ER ERα-positive 32 13.5±2.6 transduction related to the cellular processes of adhesion, ERα-negative 63 10.8±0.8 migration and proliferation. AAMP is found to be expressed ERβ-positive 21 1.2±0.1 in many tumour tissues and cell lines. Together, these data ERβ-negative 77 20.8±2.3 suggest that AAMP may play a role in tumourigenesis, (**p=0.0017 vs. ERβ-positive) tumour development and/or spread. However, the potential contribution of AAMP to breast carcinogenesis and tumour progression has not been directly investigated. In this study, we examined the expression of AAMP in human breast cancer specimens and cell lines. An AAMP knockdown cell breast cancer patients. The pathologist verified normal background and cancer specimens and confirmed that the background samples model using hammerhead ribozymes was used to study the were free from tumour deposits. The median follow-up for the function of AAMP in vitro. cohort was 120 months. The relevant information is provided in Table I. Materials and Methods Immunohistochemical staining of AAMP. The Avidin-Biotin Human breast specimens. A total of 130 breast samples were Complex (ABC) method of immunohistochemistry staining was obtained from patients with breast cancer (28 were background used to assess the protein expression of AAMP in tissue sections. normal breast tissues, and 102 were breast cancer tissues). These Paraffin sections of mammary tissues (18 paired normal and 18 tissues were collected immediately after mastectomy and snap- matched tumour tissues, as well as dissected tumour tissues) were frozen in liquid nitrogen, following approval of a local Ethical cut at a thickness of 6 μm. The sections were first dewaxed using a Committee. A number of background normal mammary tissue series of gradient alcohol washes. Endogenous peroxidase activity samples were obtained from non-cancerous regions from the same was blocked with 0.3% hydrogen peroxide for 15 min before 1500 Yin et al: AAMP in Human Breast Cancer Table II. Primers used for reverse transcription-polymerase chain reaction (RT-PCR) and quantitative-polymerase chain reaction (Q-PCR) in the present study. Gene of interest Primer name Primer sequence (5’-3’) Optimal annealing temperature (˚C) Angio-associated migratory cell AAMP Ribozyme 1F CTGCAGACCCTCAGTCCCTTTCA 55 protein (AAMP) Ribozyme GTACATGCTGATGAGTCCGTGAGGA AAMP Ribozyme 1R ACTAGTGGGACCTGAAGCAGGGAA 55 GCCCTATTTCGTCCTCACGGACT Angio-associated migratory AAMP F11 TCGAGGTGGTAGAACTTGAT 55 cell protein (AAMP) AAMP R11 AGGTCTTGCAGTCACCATT 55 AAMP F12 ACTAAGGAGGAGGTCTGGTC 55 AAMP R12 ACTGATGCCTAAGAGTCTGC 55 Angio-associated migratory cell AAMP Zr11 ACTGAACCTGACCGTACATC 55 protein (AAMP) (Q-PCR) TTCCTCAAAGTCCACATC Glyceraldehyde 3-phosphate GAPDH F8 GGCTGCTTTTAACTCTGGTA 55 dehydrogenase (GAPDH) GAPDH R8 GACTGTGGTCATGAGTCCTT 55 Glyceraldehyde 3-phosphate GAPDH F2 CTGAGTACGTCGTGGAGTC 55 dehydrogenase (GAPDH) (Q-PCR) GAPDH ZR2 ACTGAACCTGACCGTACAC 55 AGAGATGACCCTTTG Z-sequence on Q-PCR primers (5’ ACTGAACCTGACCGTACA’3).
Load more

Recommended publications
  • Rhoa Promotes Epidermal Stem Cell Proliferation Via PKN1-Cyclin D1 Signaling
    RESEARCH ARTICLE RhoA promotes epidermal stem cell proliferation via PKN1-cyclin D1 signaling Fan Wang1, Rixing Zhan2, Liang Chen1, Xia Dai1, Wenping Wang1, Rui Guo1, Xiaoge Li1, Zhe Li1, Liang Wang1, Shupeng Huang1, Jie Shen1, Shirong Li1☯*, Chuan Cao1☯* 1 Department of Plastic and Reconstructive Surgery, Southwestern Hospital, Third Military Medical University, Chongqing, China, 2 School of Nursing, Third Military Medical University, Chongqing, China ☯ These authors contributed equally to this work. * [email protected] (LS); [email protected] (CC) a1111111111 Abstract a1111111111 a1111111111 a1111111111 a1111111111 Objective Epidermal stem cells (ESCs) play a critical role in wound healing, but the mechanism under- lying ESC proliferation is not well defined. Here, we explore the effects of RhoA on ESC pro- liferation and the possible underlying mechanism. OPEN ACCESS Citation: Wang F, Zhan R, Chen L, Dai X, Wang W, Methods Guo R, et al. (2017) RhoA promotes epidermal (+/+) (-/- stem cell proliferation via PKN1-cyclin D1 Human ESCs were enriched by rapid adhesion to collagen IV. RhoA (G14V), RhoA ) signaling. PLoS ONE 12(2): e0172613. (T19N) and pGFP control plasmids were transfected into human ESCs. The effect of RhoA doi:10.1371/journal.pone.0172613 on cell proliferation was detected by cell proliferation and DNA synthesis assays. Induction Editor: Austin John Cooney, University of Texas at of PKN1 activity by RhoA was determined by immunoblot analysis, and the effects of PKN1 Austin Dell Medical School, UNITED STATES on RhoA in terms of inducing cell proliferation and cyclin D1 expression were detected using Received: August 10, 2016 specific siRNA targeting PKN1. The effects of U-46619 (a RhoA agonist) and C3 transferase Accepted: February 6, 2017 (a RhoA antagonist) on ESC proliferation were observed in vivo.
    [Show full text]
  • Angio-Associated Migratory Cell Protein Interacts with Epidermal
    Cellular Signalling 61 (2019) 10–19 Contents lists available at ScienceDirect Cellular Signalling journal homepage: www.elsevier.com/locate/cellsig Angio-associated migratory cell protein interacts with epidermal growth factor receptor and enhances proliferation and drug resistance in human T non-small cell lung cancer cells Shun Yaoa, Feifei Shia, Yingying Wanga,b, Xiaoyang Suna, Wenbo Suna, Yifeng Zhanga, ⁎ ⁎ Xianfang Liuc, Xiangguo Liua,b, , Ling Sua,b, a Shandong Provincial Key Laboratory of Animal Cell and Developmental Biology, School of Life Sciences, Shandong University, Qingdao, China b Shandong Provincial Collaborative Innovation Center of Cell Biology, School of Life Sciences, Shandong Normal University, Jinan, China c The Department of Otolaryngology Head and Neck Surgery, Shandong Provincial Hospital, Affiliated to Shandong University, Jinan, China ARTICLE INFO ABSTRACT Keywords: Angio-associated migratory cell protein (AAMP) is expressed in some human cancer cells. Previous studies have AAMP shown AAMP high expression predicted poor prognosis. But its biological role in non-small cell lung cancer Proliferation (NSCLC) cells is still unknown. In our present study, we attempted to explore the functions of AAMP in NSCLC Tumorigenesis cells. According to our findings, AAMP knockdown inhibited lung cancer cell proliferation and inhibited lung EGFR cancer cell tumorigenesis in the mouse xenograft model. Epidermal growth factor receptor (EGFR) is a primary Icotinib receptor tyrosine kinase (RTK) that promotes proliferation and plays an important role in cancer pathology. We Doxorubicin found AAMP interacted with EGFR and enhanced its dimerization and phosphorylation at tyrosine 1173 which activated ERK1/2 in NSCLC cells. In addition, we showed AAMP conferred the lung cancer cells resistance to chemotherapeutic agents such as icotinib and doxorubicin.
    [Show full text]
  • Evidence for Differential Alternative Splicing in Blood of Young Boys With
    Stamova et al. Molecular Autism 2013, 4:30 http://www.molecularautism.com/content/4/1/30 RESEARCH Open Access Evidence for differential alternative splicing in blood of young boys with autism spectrum disorders Boryana S Stamova1,2,5*, Yingfang Tian1,2,4, Christine W Nordahl1,3, Mark D Shen1,3, Sally Rogers1,3, David G Amaral1,3 and Frank R Sharp1,2 Abstract Background: Since RNA expression differences have been reported in autism spectrum disorder (ASD) for blood and brain, and differential alternative splicing (DAS) has been reported in ASD brains, we determined if there was DAS in blood mRNA of ASD subjects compared to typically developing (TD) controls, as well as in ASD subgroups related to cerebral volume. Methods: RNA from blood was processed on whole genome exon arrays for 2-4–year-old ASD and TD boys. An ANCOVA with age and batch as covariates was used to predict DAS for ALL ASD (n=30), ASD with normal total cerebral volumes (NTCV), and ASD with large total cerebral volumes (LTCV) compared to TD controls (n=20). Results: A total of 53 genes were predicted to have DAS for ALL ASD versus TD, 169 genes for ASD_NTCV versus TD, 1 gene for ASD_LTCV versus TD, and 27 genes for ASD_LTCV versus ASD_NTCV. These differences were significant at P <0.05 after false discovery rate corrections for multiple comparisons (FDR <5% false positives). A number of the genes predicted to have DAS in ASD are known to regulate DAS (SFPQ, SRPK1, SRSF11, SRSF2IP, FUS, LSM14A). In addition, a number of genes with predicted DAS are involved in pathways implicated in previous ASD studies, such as ROS monocyte/macrophage, Natural Killer Cell, mTOR, and NGF signaling.
    [Show full text]
  • The Capacity of Long-Term in Vitro Proliferation of Acute Myeloid
    The Capacity of Long-Term in Vitro Proliferation of Acute Myeloid Leukemia Cells Supported Only by Exogenous Cytokines Is Associated with a Patient Subset with Adverse Outcome Annette K. Brenner, Elise Aasebø, Maria Hernandez-Valladares, Frode Selheim, Frode Berven, Ida-Sofie Grønningsæter, Sushma Bartaula-Brevik and Øystein Bruserud Supplementary Material S2 of S31 Table S1. Detailed information about the 68 AML patients included in the study. # of blasts Viability Proliferation Cytokine Viable cells Change in ID Gender Age Etiology FAB Cytogenetics Mutations CD34 Colonies (109/L) (%) 48 h (cpm) secretion (106) 5 weeks phenotype 1 M 42 de novo 241 M2 normal Flt3 pos 31.0 3848 low 0.24 7 yes 2 M 82 MF 12.4 M2 t(9;22) wt pos 81.6 74,686 low 1.43 969 yes 3 F 49 CML/relapse 149 M2 complex n.d. pos 26.2 3472 low 0.08 n.d. no 4 M 33 de novo 62.0 M2 normal wt pos 67.5 6206 low 0.08 6.5 no 5 M 71 relapse 91.0 M4 normal NPM1 pos 63.5 21,331 low 0.17 n.d. yes 6 M 83 de novo 109 M1 n.d. wt pos 19.1 8764 low 1.65 693 no 7 F 77 MDS 26.4 M1 normal wt pos 89.4 53,799 high 3.43 2746 no 8 M 46 de novo 26.9 M1 normal NPM1 n.d. n.d. 3472 low 1.56 n.d. no 9 M 68 MF 50.8 M4 normal D835 pos 69.4 1640 low 0.08 n.d.
    [Show full text]
  • Expression and Gene Regulation Network of Adenosine Receptor A2B in Lung Adenocarcinoma: a Potential Diagnostic and Prognostic Biomarker
    ORIGINAL RESEARCH published: 19 July 2021 doi: 10.3389/fmolb.2021.663011 Expression and Gene Regulation Network of Adenosine Receptor A2B in Lung Adenocarcinoma: A Potential Diagnostic and Prognostic Biomarker Yutong Sui 1†, Jiayin Liu 2†, Jing Zhang 1, Zena Zheng 1, Ziwei Wang 1, Zhenghu Jia 3* and Ziyu Meng 4* 1Shenzhen Hospital, Southern Medical University, Shenzhen, China, 2Department of Radiation Oncology, Harbin Medical University Cancer Hospital, Harbin, China, 3The First Affiliated Hospital, Biomedical Translational Research Institute and Guangdong Province Key Laboratory of Molecular Immunology and Antibody Engineering, Jinan University, Guangzhou, China, 4NHC Key Laboratory of Hormones and Development, Tianjin Key Laboratory of Metabolic Diseases, Chu Hsien-I Memorial Hospital and Tianjin Institute of Endocrinology, Tianjin Medical University, Tianjin, China – Edited by: Adenosine receptor A2B (ADORA2B) encodes a protein belonging to the G protein coupled Min Zhang, receptor superfamily. Abnormal expression of ADORA2B may play a pathophysiological role Shanghai First People’s Hospital, in some human cancers. We investigated whether ADORA2B is a potential diagnostic and China prognostic biomarker for lung adenocarcinoma (LUAD). The expression, various mutations, Reviewed by: Jiarong Chen, copy number variations, mRNA expression levels, and related network signaling pathways of Jiangmen Central Hospital, China ADORA2B were analyzed using bioinformatics-related websites, including Oncomine, Xiaoping Li, UALCAN, cBioPortal, GeneMANIA, LinkedOmics, KM Plotter, and TIMER. We found Jiangmen Central Hospital, China fi *Correspondence: that ADORA2B was overexpressed and ampli ed in LUAD, and a high ADORA2B Zhenghu Jia expression predicted a poor prognosis for LUAD patients. Pathway analyses of [email protected] ADORA2B in LUAD revealed ADORA2B-correlated signaling pathways, and the Ziyu Meng fi [email protected] expression level of ADORA2B was associated with immune cell in ltration.
    [Show full text]
  • Supplementary Table S4. FGA Co-Expressed Gene List in LUAD
    Supplementary Table S4. FGA co-expressed gene list in LUAD tumors Symbol R Locus Description FGG 0.919 4q28 fibrinogen gamma chain FGL1 0.635 8p22 fibrinogen-like 1 SLC7A2 0.536 8p22 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 DUSP4 0.521 8p12-p11 dual specificity phosphatase 4 HAL 0.51 12q22-q24.1histidine ammonia-lyase PDE4D 0.499 5q12 phosphodiesterase 4D, cAMP-specific FURIN 0.497 15q26.1 furin (paired basic amino acid cleaving enzyme) CPS1 0.49 2q35 carbamoyl-phosphate synthase 1, mitochondrial TESC 0.478 12q24.22 tescalcin INHA 0.465 2q35 inhibin, alpha S100P 0.461 4p16 S100 calcium binding protein P VPS37A 0.447 8p22 vacuolar protein sorting 37 homolog A (S. cerevisiae) SLC16A14 0.447 2q36.3 solute carrier family 16, member 14 PPARGC1A 0.443 4p15.1 peroxisome proliferator-activated receptor gamma, coactivator 1 alpha SIK1 0.435 21q22.3 salt-inducible kinase 1 IRS2 0.434 13q34 insulin receptor substrate 2 RND1 0.433 12q12 Rho family GTPase 1 HGD 0.433 3q13.33 homogentisate 1,2-dioxygenase PTP4A1 0.432 6q12 protein tyrosine phosphatase type IVA, member 1 C8orf4 0.428 8p11.2 chromosome 8 open reading frame 4 DDC 0.427 7p12.2 dopa decarboxylase (aromatic L-amino acid decarboxylase) TACC2 0.427 10q26 transforming, acidic coiled-coil containing protein 2 MUC13 0.422 3q21.2 mucin 13, cell surface associated C5 0.412 9q33-q34 complement component 5 NR4A2 0.412 2q22-q23 nuclear receptor subfamily 4, group A, member 2 EYS 0.411 6q12 eyes shut homolog (Drosophila) GPX2 0.406 14q24.1 glutathione peroxidase
    [Show full text]
  • Knockdown of AAMP Impacts on HECV Cell Functions in Vitro and Affects the Expression of VE-Cadherin
    Knockdown of AAMP Impacts on HECV Cell Functions In Vitro and Affects the Expression of VE-Cadherin Yukun Yin1,2,3, Andrew J Sanders1, Li Feng2 and Wen G Jiang1* 1Cardiff University-Peking University Cancer Institute, Cardiff University School of Medicine, Heath Park, Cardiff, UK 2Department of Oncology, Wangjing Hospital of China Academy of Traditional Chinese Medicine, Hua Jia Di Street, ChaoYang District, Beijing 100102, P.R. China 3China Academy of Traditional Chinese Medicine, Nan Xio Jie, Dong Cheng District, Beijing, 100700, P.R. China Abstract Background: Angio-Associated Migratory Cell Protein (AAMP) is a 52 kDa protein expressed in a variety of human cell lines. Previous studies have demonstrated that AAMP is involved in endothelial cell adhesion, migration, and tube formation and plays roles in signalling pathways, such as RhoA-ROCK Methods: In this study, we knocked down the expression of AAMP in HECV cells using hammerhead ribozymes and assessed the influence of AAMP on endothelial cells. In order to explore potential mechanisms, Wnt/β catenin inhibitors (FH535 or IWP2) were also used in a number of the functional assays and the immunofluorescent staining patterns of several key molecules were explored. Results: Knockdown of AAMP expression was observed in the HECV cell line following transfection with the ribozyme transgene. Cellular migration and attachment, assessed using ECIS methods, and tubule formation were significantly inhibited by the knockdown of AAMP. Additionally, cell growth and cell matrix adhesion was also substantially reduced following AAMP knockdown, though this did not reach significance. Cell aggregation levels showed no statistical difference between AAMP knockdown cells and control cells.
    [Show full text]
  • Additional Files
    ADDITIONAL FILES Additional file 1: Table S1: List of compounds Table S1. Compounds purchased. # Internal ID Mcule ID Systematic name Common Name N-(4-methyl-5-{2-[(3-nitrophenyl)amino]-1,3-thiazol-4-yl}-1,3-thiazol- 1 A1 MCULE-2510363079 2-yl)acetamide N.A. 2-(3,4-dihydroxyphenyl)-5-hydroxy-7-{[(2S,3R,4S,5S,6R)-3,4,5- 2 A2 MCULE-8191036162 trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy}-4H-chromen-4-one N.A. 3 A3 MCULE-8792621521 1-(4-acetylphenyl)-3-{2-[3-(prop-1-en-2-yl)phenyl]propan-2-yl}urea N.A. 3-{3-[4-(dimethylamino)phenyl]prop-2-enoyl}-4-hydroxy-2H-chromen- 4 A4 MCULE-6000022702 2-one N.A. 5 A5 MCULE-7249710756 1-(4-methylbenzenesulfonyl)-1H-1,3-benzodiazol-2-amine N.A. N-{3,5-dimethyl-1-[(2-methylphenyl)methyl]-1H-pyrazol-4-yl}-4H,5H- 6 A6 MCULE-8365251586 naphtho[2,1-d][1,2]oxazole-3-carboxamide N.A. [(4-carbamoylphenyl)carbamoyl]methyl 3-(2H-1,3-benzodioxol-5- 7 A7 MCULE-3618750171 yl)prop-2-enoate N.A. 3-amino-2-(2-{[5-(2H-1,3-benzodioxol-5-yl)-1,3,4-oxadiazol-2- 8 A8 MCULE-9291497335 yl]sulfanyl}acetyl)but-2-enenitrile N.A. 1-[2,5-dimethyl-1-(prop-2-en-1-yl)-1H-pyrrol-3-yl]-2-[(6-methyl-2- 9 A9 MCULE-9607341619 nitropyridin-3-yl)oxy]ethan-1-one N.A. 10 A10 MCULE-6560812611 3-(4-hydroxyphenyl)-1-phenylprop-2-en-1-one N.A. 5,5-dimethyl-2-{[(pyridin-3-yl)amino]methylidene}cyclohexane-1,3- 11 A11 MCULE-2266778062 dione N.A.
    [Show full text]
  • Breed Relationships Facilitate Fine-Mapping Studies: a 7.8-Kb Deletion Cosegregates with Collie Eye Anomaly Across Multiple Dog Breeds
    Downloaded from genome.cshlp.org on October 6, 2021 - Published by Cold Spring Harbor Laboratory Press Article Breed relationships facilitate fine-mapping studies: A 7.8-kb deletion cosegregates with Collie eye anomaly across multiple dog breeds Heidi G. Parker,1 Anna V. Kukekova,2 Dayna T. Akey,3 Orly Goldstein,2 Ewen F. Kirkness,4 Kathleen C. Baysac,1 Dana S. Mosher,1 Gustavo D. Aguirre,5 Gregory M. Acland,2 and Elaine A. Ostrander1,6 1Cancer Genetics Branch, National Human Genome Research Institute, National Institutes of Health, Bethesda, Maryland 20892, USA; 2Baker Institute for Animal Health, College of Veterinary Medicine, Cornell University, Ithaca, New York 14853, USA; 3Department of Genome Sciences, School of Medicine, University of Washington, Seattle, Washington 98195, USA; 4The Institute for Genomic Research, Rockville, Maryland 20850, USA; 5Department of Clinical Studies, School of Veterinary Medicine, University of Pennsylvania, Philadelphia, Pennsylvania 19104, USA The features of modern dog breeds that increase the ease of mapping common diseases, such as reduced heterogeneity and extensive linkage disequilibrium, may also increase the difficulty associated with fine mapping and identifying causative mutations. One way to address this problem is by combining data from multiple breeds segregating the same trait after initial linkage has been determined. The multibreed approach increases the number of potentially informative recombination events and reduces the size of the critical haplotype by taking advantage of shortened linkage disequilibrium distances found across breeds. In order to identify breeds that likely share a trait inherited from the same ancestral source, we have used cluster analysis to divide 132 breeds of dog into five primary breed groups.
    [Show full text]
  • AAMP CRISPR/Cas9 KO Plasmid (H): Sc-410673
    SANTA CRUZ BIOTECHNOLOGY, INC. AAMP CRISPR/Cas9 KO Plasmid (h): sc-410673 BACKGROUND APPLICATIONS The Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) and AAMP CRISPR/Cas9 KO Plasmid (h) is recommended for the disruption of CRISPR-associated protein (Cas9) system is an adaptive immune response gene expression in human cells. defense mechanism used by archea and bacteria for the degradation of foreign genetic material (4,6). This mechanism can be repurposed for other 20 nt non-coding RNA sequence: guides Cas9 functions, including genomic engineering for mammalian systems, such as to a specific target location in the genomic DNA gene knockout (KO) (1,2,3,5). CRISPR/Cas9 KO Plasmid products enable the U6 promoter: drives gRNA scaffold: helps Cas9 identification and cleavage of specific genes by utilizing guide RNA (gRNA) expression of gRNA bind to target DNA sequences derived from the Genome-scale CRISPR Knock-Out (GeCKO) v2 library developed in the Zhang Laboratory at the Broad Institute (3,5). Termination signal Green Fluorescent Protein: to visually REFERENCES verify transfection CRISPR/Cas9 Knockout Plasmid CBh (chicken β-Actin 1. Cong, L., et al. 2013. Multiplex genome engineering using CRISPR/Cas hybrid) promoter: drives expression of Cas9 systems. Science 339: 819-823. 2A peptide: allows production of both Cas9 and GFP from the 2. Mali, P., et al. 2013. RNA-guided human genome engineering via Cas9. same CBh promoter Science 339: 823-826. Nuclear localization signal 3. Ran, F.A., et al. 2013. Genome engineering using the CRISPR-Cas9 system. Nuclear localization signal SpCas9 ribonuclease Nat. Protoc. 8: 2281-2308.
    [Show full text]
  • 58 Accepted Abstracts, 26 Are Orals, 10 Are Snap Orals, 6 Are Electronic Posters and 16 Are General Posters
    Medical Physics UT Southwestern Radiation Oncology’s physics expertise will be strongly represented at the annual Ameri- can Association of Physicists in Medicine (AAPM) meeting in July in DC. Among 58 accepted abstracts, 26 are orals, 10 are snap orals, 6 are electronic posters and 16 are general posters. Notably, David Chiu has one abstract chosen as Best in Physics in Joint Imaging and Therapy (one of top five scored abstracts in that cat- egory). You Zhang has one abstract chosen as a Young Investigator Symposium finalist (one of top 10 scored abstracts from 391 submissions). Electronic posters A New Intra-Fractional Prostate Motion Tracking Method in Volumetric Y Chi, N Hassan Rezaeian , R Hannan, X Jia Modulated Arc Therapy (VMAT) Via 2D/3D Registration Multiple Penalties with Different Orders for Structure Adaptive CBCT Q Shi, P Cheng, J Wang, S Tan, S Tan Reconstruction Fast Processed 3D Printing-Aided Urethane Resin (PUR) Bolus in Radia- Tsuicheng D. Chiu*, Xuejun Gu, Pam H. Lee, Lucien Nedzi, Steve B. tion Therapy Jiang, Bo Zhao Modality-Specific Dose Gradient Modeling for Prostate IMRT Using Michael M. Folkerts*, Xuejun Gu, Weiguo Lu, Richard J. Radke, Steve Spherical Distance Maps of PTV and Isodose Contours B. Jiang Real-Time Image Guided Radiation Therapy for Heterotopic Ossification A Le*, S Jiang , R Timmerman , H Choy , A Pompos in Patients After Hip Replacement Fast Processed 3D Printing-Aided Urethane Resin (PUR) Bolus in Radia- Bo Zhao, Tsuicheng D. Chiu*, Xuejun Gu, Pam H. Lee, Lucien Nedzi, tion Therapy Steve B.
    [Show full text]
  • Table of Contents
    ANTICANCER RESEARCH International Journal of Cancer Research and Treatment ISSN: 0250-7005 Volume 33, Number 4, April 2013 Contents Reviews Aryl Hydrocarbon Receptor and Lung Cancer. J.J. TSAY, K.-M. TCHOU-WONG, A.K. GREENBERG, H. PASS, W.N. ROM (New York, NY, USA) ..................................................................................... 1247 A Review on Biomarkers for Prediction of Treatment Outcome in Gastric Cancer. F. PIETRANTONIO, F. DE BRAUD, V. DA PRAT, F. PERRONE, M.A. PIEROTTI, M. GARIBOLDI, G. FANETTI, P. BIONDANI, A. PELLEGRINELLI, I. BOSSI, M. DI BARTOLOMEO (Milan, Italy) ......................... 1257 The Influence of Glutamate Receptors on Proliferation and Metabolic Cell Activity of Neuroendocrine Tumors. H.S. HAAS, R. PFRAGNER, N.G. TABRIZI-WIZSY, K. ROHRER, I. LUEFTENEGGER, C. HORWATH, N. ALLARD, B. RINNER, A. SADJAK (Graz, Austria) .............................................. 1267 In Vitro and In Vivo Experimental Models as Tools to Investigate the Efficacy of Antineoplastic Drugs on Urinary Bladder Cancer. R. ARANTES-RODRIGUES, A. COLAÇO, R. PINTO-LEITE, P.A. OLIVEIRA (Vila Real, Portugal) ...................................................................................................................... 1273 Experimental Studies Evaluation of Quercetin as a Potential Drug in Osteosarcoma Treatment. K. BERNDT, C. CAMPANILE, R. MUFF, E. STREHLER, W. BORN, B. FUCHS (Zurich, Switzerland; Rochester, MN, USA) .............. 1297 PTEN Regulates Sensitivity of Melanoma Cells to RO4929097, the γ- Secretase Inhibitor. J.S. NAIR, T. SHEIKH, A.L. HO, G.K. SCHWARTZ (New York, NY, USA) ......................................................... 1307 Contents continued on the back cover Contents continued Characterization and Evaluation of Pre-clinical Suitability of a Syngeneic Orthotopic Mouse Ovarian Cancer Model. S. CHO, Y. SUN, A.P. SOISSON, M.K. DODSON, C.M. PETERSON, E.A. JARBOE, A.M. KENNEDY, M.M.
    [Show full text]