ANTICANCER RESEARCH 33: 1499-1510 (2013)

The Impact of Angio-associated Migratory Cell (AAMP) on Breast Cancer Cells In Vitro and Its Clinical Significance

YUKUN YIN1,2, ANDREW J. SANDERS1 and WEN G. JIANG1

1Metastasis and Angiogenesis Research Group, Institute of Cancer and Genetics, Cardiff University School of Medicine, Heath Park, Cardiff, U.K.; 2Department of Surgery, Shandong University of Traditional Chinese Medicine, Jinan, Shandong Province, P.R. China

Abstract. Background/Aim: Angio-associated migratory cell of patients with high levels (p<0.05). Conclusion: AAMP has protein (AAMP), which belongs to the immunoglobulin a significant influence on the biological functions of breast superfamily, was found to be expressed in different human cell cancer cells and its high expression correlates with poor lines and exhibited a predominant cytosolic localization in prognosis and metastasis. epithelial cells. Previous studies show that the specific product is functional in cell migration and angiogenesis and Angio-associated migratory cell protein (AAMP), a 52-kDa can also be used as a marker of poor prognosis in invasive protein initially isolated from a human melanoma cell line gastrointestinal stromal tumours and ductal in situ during a search for motility-associated cell surface (DCIS) of the breast. However, the cellular role of AAMP in (1), is extensively expressed in different types of endothelial breast cancer is still unclear. The aim of the current study was cells and aortic smooth-muscle cells (human and bovine), to provide new insights into the implication of AAMP in human melanoma cells, activated T-lymphocytes, renal breast cancer. Materials and Methods: We knocked-down the proximal tubular cells, prostate and breast carcinoma cells, expression of AAMP through transfection of MCF-7 and dermal fibroblasts, glomerular mesangial cells, benign MDA-MB-231 breast cancer cells with a hammerhead mammary cells, and rat myocytes (1-7). The expression of ribozyme transgene (MCF-7AAMPrib and MDA-MB- AAMP was found to be increased in invasive gastrointestinal 231AAMPrib) and examined the impact on cell function using stromal tumours (8) and in ductal carcinoma in situ (DCIS) in vitro assays. Additionally, AAMP expression was examined of the breast with necrosis, where it is considered to be a in a cohort of breast specimens (normal, n=28; cancer, marker of poor prognosis (9). n=102) using quantitative-real-time polymerase chain The AAMP protein contains two immunoglobulin-like reaction (Q-PCR) and immunohistochemical methods. domains, the WD40 repeat motif, and a heparin-binding Results: AAMP knock-down dramatically reduced cell consensus sequence (1). The immunoglobulin superfamily adhesion and cell growth of MCF-7 cells (p<0.05), and relatives include proteins that either are known or are suppressed cell invasion of MDA-MB-231 cells (p<0.05). suspected to play a role in cell adhesion (8, 10, 11). Some Increased expression of AAMP in breast cancer was observed immunoglobulin superfamily members are multifunctional compared with that in normal tissues (p<0.05). High levels and participate in both cell binding and signalling (8, 12). of AAMP transcripts were associated with disease The WD40 repeat motif found in β-transducin and other progression, metastasis, and poor prognosis of the patients. proteins is speculated to represent a general protein-protein Disease-free and overall survival time of patients with lower recognition/binding site (13). The AAMP-derived peptide, levels of AAMP were significantly longer compared to those P189, contains a heparin-binding domain and mediates heparin-sensitive cell adhesion (1, 2, 14). A previous study identified a direct interaction of AAMP with nucleotide- binding oligomerization domain containing-2 (NOD2), but Correspondence to: Professor Wen G. Jiang, Institute of Cancer and declared that Ig domains in AAMP could not be confirmed Genetics, Cardiff University School of Medicine, Cardiff, CF14 (6). Therefore, AAMP sequence homologies indicate that it 4XN, U.K. Tel: +44 2920742895, Fax: +44 2920742896, e-mail: [email protected] may play a role in cell adhesion, migration and innate immune response. Key Words: Angio-associated migratory cell protein, AAMP, breast Functional studies show that anti-recombinant AAMP cancer, prognosis, MCF-7, MDA-MB-231 cells. (anti-rAAMP) inhibits tubule formation by endothelial cells

0250-7005/2013 $2.00+.40 1499 ANTICANCER RESEARCH 33: 1499-1510 (2013) cultured on Matrigel (3). Anti-rAAMP also inhibits Table I. Transcript levels of angio-associated migratory cell protein endothelial and smooth-muscle cell motility (11, 14, 15). It (AAMP) in breast cancer. has also been found that the extracellular form of AAMP Clinical data n AAMP Transcripts plays a positive role in angiogenesis and can be regulated by (copies/μl, median ± Q1) astrocytes, and has led to the hypothesis that the regulation of extracellular AAMP in endothelial cells by astrocytes may Tissue sample aid in the angiogenesis of the nervous system (14). The Tumor 102 10.9±0.6 peptide P189, derived from AAMP was also found to possess Normal 28 1.1±0.2 (**p=0.0077 vs. tumour) the ability to bind and cluster MCF-7 breast cancer cells and NPI human A2058 melanoma cells (5). 1 (NPI score <3.4) 49 12.1±1.4 AAMP was identified as a binding partner of NOD2 2 (NPI score =3.4-5.4) 36 17.3±0.8 through co-immunoprecipitation studies, using human 3 (NPI score >5.4) 14 3±2 embryonic kidney cells (HEK293T), and was found to have Tumor grade 1 18 76±7 functional implication in NOD2-mediated signalling, playing 2 33 20.8±1.6 a negative regulatory role in NOD2-mediated nuclear factor- 3 51 4.2±0.6 kappa B (NF-κB) pathways (6, 7). Studies have (**p=0.0054 vs. grade 1) demonstrated that AAMP causes the translocation and TNM stage activation of ras homolog gene family, member A (RhoA) in I 53 17.1±2.7 II 35 4.6±0.1 (* smooth muscle and endothelial cells. Activated RhoA III 6 71±4 subsequently interacts with its effector rho-kinase (ROCK), IV 3 91.8±1.5 generating the driving force for smooth muscle cells to Survival status migrate and to divide, leading to re-stenosis and Disease-free (DF) 70 8.0±1.4 atherosclerosis (11). AAMP has been identified as a novel With metastases (MT) 7 0.4±0.2 With local recurrence (LT) 5 34±2 interacting partner of both thromboxane A2 receptor-alpha Died of breast cancer (Died) 12 74±4 (TPα) and -beta (TPβ) through an interaction dependent on (*p=0.036 vs. disease-free) common and unique sequences within their carboxyl- Poor prognosis (PP) 24 32.1±0.9 terminal tail domains. The identification of a specific Histology interaction between TPα/β and AAMP is likely to have Ductal 82 10.9±1.4 Lobular 10 13.3±6.4 substantial functional implications for vascular pathologies Mucinous 3 3±0 in which they are both implicated (7). Medullary 1 0.56 Previous studies have shown that AAMP plays a role in Tubular 1 34.1 angiogenesis, one of the most important mechanisms of Other 5 3±0.3 tumour development and metastasis, and is involved in signal ER ERα-positive 32 13.5±2.6 transduction related to the cellular processes of adhesion, ERα-negative 63 10.8±0.8 migration and proliferation. AAMP is found to be expressed ERβ-positive 21 1.2±0.1 in many tumour tissues and cell lines. Together, these data ERβ-negative 77 20.8±2.3 suggest that AAMP may play a role in tumourigenesis, (**p=0.0017 vs. ERβ-positive) tumour development and/or spread. However, the potential contribution of AAMP to breast carcinogenesis and tumour progression has not been directly investigated. In this study, we examined the expression of AAMP in human breast cancer specimens and cell lines. An AAMP knockdown cell breast cancer patients. The pathologist verified normal background and cancer specimens and confirmed that the background samples model using hammerhead ribozymes was used to study the were free from tumour deposits. The median follow-up for the function of AAMP in vitro. cohort was 120 months. The relevant information is provided in Table I. Materials and Methods Immunohistochemical staining of AAMP. The Avidin-Biotin Human breast specimens. A total of 130 breast samples were Complex (ABC) method of immunohistochemistry staining was obtained from patients with breast cancer (28 were background used to assess the protein expression of AAMP in tissue sections. normal breast tissues, and 102 were breast cancer tissues). These Paraffin sections of mammary tissues (18 paired normal and 18 tissues were collected immediately after mastectomy and snap- matched tumour tissues, as well as dissected tumour tissues) were frozen in liquid nitrogen, following approval of a local Ethical cut at a thickness of 6 μm. The sections were first dewaxed using a Committee. A number of background normal mammary tissue series of gradient alcohol washes. Endogenous peroxidase activity samples were obtained from non-cancerous regions from the same was blocked with 0.3% hydrogen peroxide for 15 min before

1500 Yin et al: AAMP in Human Breast Cancer

Table II. Primers used for reverse transcription-polymerase chain reaction (RT-PCR) and quantitative-polymerase chain reaction (Q-PCR) in the present study.

Gene of interest Primer name Primer sequence (5’-3’) Optimal annealing temperature (˚C)

Angio-associated migratory cell AAMP Ribozyme 1F CTGCAGACCCTCAGTCCCTTTCA 55 protein (AAMP) Ribozyme GTACATGCTGATGAGTCCGTGAGGA AAMP Ribozyme 1R ACTAGTGGGACCTGAAGCAGGGAA 55 GCCCTATTTCGTCCTCACGGACT Angio-associated migratory AAMP F11 TCGAGGTGGTAGAACTTGAT 55 cell protein (AAMP) AAMP R11 AGGTCTTGCAGTCACCATT 55 AAMP F12 ACTAAGGAGGAGGTCTGGTC 55 AAMP R12 ACTGATGCCTAAGAGTCTGC 55 Angio-associated migratory cell AAMP Zr11 ACTGAACCTGACCGTACATC 55 protein (AAMP) (Q-PCR) TTCCTCAAAGTCCACATC Glyceraldehyde 3-phosphate GAPDH F8 GGCTGCTTTTAACTCTGGTA 55 dehydrogenase (GAPDH) GAPDH R8 GACTGTGGTCATGAGTCCTT 55 Glyceraldehyde 3-phosphate GAPDH F2 CTGAGTACGTCGTGGAGTC 55 dehydrogenase (GAPDH) (Q-PCR) GAPDH ZR2 ACTGAACCTGACCGTACAC 55 AGAGATGACCCTTTG

Z-sequence on Q-PCR primers (5’ ACTGAACCTGACCGTACA’3).

washes. Sections were boiled using microwaves in antigen retrieval Generation of AAMP knock-down in breast cancer cell lines. solution (pH 6.0) to retrieve antigen. After three washes in tris- Hammerhead ribozyme transgenes were designed, based on the buffered salin (TBS), the samples were blocked in TBS containing secondary structure of AAMP and predicted using the Zuker RNA horse at room temperature for 30 min. The primary (used mFold program (16) to target the expression of human AAMP. The at dilution of 1:100), second antibody and Avidin biotin complex ribozymes were generated and inserted into the pEF6/V5-His-TOPO (Vector Laboratories Inc., Burlingame, USA) was added after every plasmid vector in accordance with the manufacturer’s instructions three TBS washes and successively incubated for 30 min, 30 min (Invitrogen, Paisley, UK). Following verification of correctly- and 45 min respectively. Diaminobenzidine chromogen (DAB; orientated inserts, plasmids were amplified in bacteria before being Vector Laboratories Inc.) was then added to the sections which were extracted using a Gen Elute plasmid extraction kit (Sigma). Plasmids then incubated in the dark for 5 min. Sections were subsequently containing the AAMP ribozyme transgenes or empty pEF6 control counter-stained in Gill’s haematoxylin and dehydrated in ascending plasmids were transfected into MCF-7 and MDA-MB-231 cells grades of methanol before clearing in xylene and mounting under a using electroporation as described previously (17-19). Cells were coverslip. Monoclonal mouse anti-AAMP (111-211) was obtained subjected to a selection period in the presence of blasticidn (5 μg/ml) from ABNOVA (Abnova Gmbh, Heidelberg, Germany), and anti- before being subsequently cultured in maintenance medium (0.5 Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) (SC-32233), μg/ml blasticidin) and the wild-type cells were cultured in normal was obtained from Santa Cruz Biotechnology Inc. (Santa Cruz, CA, media. Transfected cells were routinely tested to confirm knock- USA). The peroxidase-conjugated anti-mouse antibody was down of AAMP expression using reverse transcription-polymerase purchased from Sigma-Aldrich Ltd. (Poole, Dorset, UK). chain reaction (RT-PCR) or western blotting. Cells were respectively labelled as MCF-7AAMPrib and MCF-7pEF6, MDA-MB-231AAMPrib Cell culture. Breast cancer cell lines MDA-MB-231, MCF-7 and and MDA-MB-231pEF6, MCF-7WT and MDA-MB-231WT. ZR-751 were purchased from the European Collection of Animal Cell Cultures (Salisbury, UK). A highly invasive cell line, MDA- RNA extraction and RT-PCR. RNA was extracted from cells using MB-231, which is oestrogen receptor alpha (ERα)-negative and the TRI-reagent (Sigma). Reverse transcription was carried out to ERβ-positive, and a weakly-invasive cell line, MCF-7, that is ERα- generate a cDNA template from the extracted RNA, using the and ERβ-positive, were chosen for functional assays. These two cell iScript™ cDNA synthesis kit (Bio-Rad, Hercules CA, USA). PCR lines are both from ductal carcinoma, which is the main tumour conditions were: denaturing at 94˚C for 40 s, annealing at 55˚C for histological type of breast cancer and are also the most studied in 40 s and extension at 72˚C for 60 s. PCR was conducted over 32-36 recent research. The cells were routinely cultured in Dulbecco’s cycles and consisted of an initial denaturing step (94˚C, 5 min) and modified Eagle’s medium (DMEM)/Ham’s F12 with L-glutamine a final extension step (72˚C, 10 min) before a final hold at 4˚C. PCR medium (Sigma, Poole, Dorset, UK), supplemented with antibiotics products were subsequently separated electrophoretically on an and 10% foetal calf serum (Sigma), and incubated at 37.0˚C in an agarose gel, stained and visualised. Primer sequences are provided atmosphere of 5% CO2 and 95% humidity. in Table II.

1501 ANTICANCER RESEARCH 33: 1499-1510 (2013)

Figure 1. Angio-associated migratory cell protein (AAMP) expression in human breast tissues and breast cancer cell lines. A: Polymerase chain reaction (PCR) analysis of AAMP expression in a panel of breast cancer cell lines. B: Quantitative PCR analysis of AAMP expression in human breast tissues, showing significantly higher levels of AAMP in breast tumour tissues than normal background tissues.

Quantitative-polymerase chain reaction (Q-PCR). AAMP transcript In vitro Matrigel invasion assay (20). A 24-well plate was set up levels present in the breast cancer and control specimens and cell together with trans-well inserts containing 8.0 μm pores (Becton lines (shown as copies/μl based on internal standard) were assessed Dickinson Labware, NJ, USA) that had been previously coated with using real-time Q-PCR, as previously reported (18). Briefly, the 50 μg/insert of Matrigel Matrix Basement Membrane (BD number of AAMP transcripts in these samples were detected and Biosciences, Oxford, UK). A total of 15,000 cells were seeded into quantified by the iCycler IQ system. Transcript copy numbers were the trans-well inserts and incubated for three days. After the obtained based on an internal standard and normalized against incubation, cells which had invaded through the artificial basement GAPDH levels in the same samples. Conditions for Q-PCR were: membrane to the underside of the trans-well insert were fixed, 95˚C for 15 min, followed by 60 cycles at 95˚C for 20 s, 55˚C for stained and counted. 30 s and 72˚C for 20 s. In vitro Matrigel adhesion assay (20). A 96-well plate was pre- SDS-PAGE and western blotting. Proteins of control and transfected coated with 5 μg of Matrigel per well. Subsequently, 45,000 cells cells were obtained following lysis with a protein lysis buffer were seeded into each well. After 45 min of incubation, non- containing 0.5% sodium dodecyl sulphate (SDS), 1% Triton X-100, adherent cells were removed by vigorous washing with balanced salt 2 mM CaCl2, 100 mg/ml phenylmethylsulfonyl fluoride, 1 mg/ml solution (BSS). Adherent cells that remained were subsequently leupeptin, 1 mg/ml aprotinin and, 10 mM sodium orthovanadate. fixed, stained and counted. Samples were quantified using a Bio-Rad DC protein assay kit (Bio- Rad Laboratories, Hemel Hempstead, Hertfordshire, UK) and Electric cell-substrate impedance sensing (ECIS) based cellular standardized amounts of each sample were separated on a 10% motility assay. The ECIS instrument, together with the 96W1E array, acrylamide gel. The proteins were blotted onto a nitrocellulose (Applied Biophysics Inc, NJ, USA) was used in the current study to membrane (Santa Cruz Biotechnology) before being probed with the analyze migratory rates of control and transfected cell lines (18). specific primary (AAMP and GAPDH) at a concentration After stabilizing the array, identical numbers of MDA-MB-231wt, of 1:70, and specific peroxidase-conjugated secondary antibodies at MDA-MB-231pEF6, MDA-MB-231AAMPrib, MCF-7wt, MCF-7pEF6, a dilution of 1:350 in accordance with the SnapID protocol and MCF-7AAMPrib (200,000 per well) were seeded into the array (Millipore, Watford, UK). Protein bands were documented using a gel wells in 300 μl of medium. After 10 h, when a confluent monolayer documentation system (UVITech, Cambridge, UK). had formed in the wells, the monolayer was electrically wounded at 6 V for 30 s. Subsequently, the impedance and resistance change In vitro growth assay. Cell growth was measured using an in vitro within the array wells were recorded for a period of up to 20 h. cell growth assay. Briefly, 2,000 cells/well were seeded into triplicate 96-well plates (corresponding to day 1, day 3, and day 5). Statistical analysis. Experimental procedures were repeated Following the appropriate incubation period, the cells were fixed in independently as least three times. Statistical analysis was 4% formaldehyde (v/v) and stained with 0.5% (w/v) crystal violet. undertaken using the Minitab statistical software package (version The crystal violet stain was subsequently extracted using 10% acetic 14; Minitab Ltd, Coventry, UK). Non-normally distributed data were acid (v/v) and cell density was determined by measuring the assessed using the Mann Whitney test (median±SEM), whereas the absorbance at a wavelength of 540 nm using an ELx800 two-sample t-test was used for normally distributed data spectrophotometer (Bio-Tek Instruments Inc., Winooski, VT, USA). (mean±SEM). Kaplan Meier survival analysis was conducted using

1502 Yin et al: AAMP in Human Breast Cancer

Figure 2. Immunohistochemical staining of angio-associated migratory cell protein (AAMP) in human breast tissues. Left panel: the AAMP protein was found to be highly stained in breast cancer tissues; right panel: staining of AAMP in normal background breast tissue was found to be relatively low compared to levels seen in the cancerous tissue.

PSAW (version 18; SPSS. Chicago, IL, USA). Differences were analysis of AAMP expression in the human breast cancer considered to be statistically significant at p<0.05. tissue sections (n=18 pairs). Using a specific monoclonal antibody against AAMP. AAMP was detected in the Results cytoplasm, cell membrane and extracellular matrix. Upon the analysis of breast cancer tissues, the level of AAMP The expression of AAMP in breast cancer cell lines and human expression was found to be enhanced in comparison to that breast tissues. The presence of AAMP was examined in three seen in the normal background tissues (Figure 2). human breast cancer cell lines through RT-PCR. AAMP was expressed in the breast cell lines (MCF-7, MDA-MB-231 and Correlation of AAMP expression with histological type, ZR-75-1) (Figure 1A). To investigate the biological function of grade, tumour-node-metastasis (TNM) staging and ER AAMP in breast cancer, two of the examined cell lines were status. To assess the relation of AAMP expression with chosen for knock-down studies. We also quantified AAMP disease progression, AAMP transcript levels in breast cancer transcript levels in the breast cohort specimens using real-time samples were analyzed against histological type, histological quantitative PCR and discovered a significant increase in the grade, TNM staging and ER status (Table I). There were no levels of AAMP present in tumour tissues compared to normal statistical differences among the levels of AAMP transcripts background tissues (tumour, n=102, 10.9±1.4 copies/μl; in ductal, lobular and other types of breast cancer (Figure background, n=28, 1.1±0.2 copies/μl; p=0.0077) (all values are 3A). In relation to the histological grade of tumour tissues, displayed as median AAMP transcript copies/μl of cDNA from the AAMP expression was positively correlated with tumour 50 ng total RNA, Figure 1B). differentiation, and higher levels of AAMP were seen in the well-differentiated grade 1 tumours compared with the Immunohistochemical staining of human breast tissue moderately-differentiated grade 2 tumours and the poorly- specimens. To assess the expression pattern of AAMP at the differentiated grade 3 tumours (p=0.0054 vs. grade 1; Figure protein level, we performed immunohistochemical staining 3B).

1503 ANTICANCER RESEARCH 33: 1499-1510 (2013)

Figure 3. Quantitative-polymerase chain reaction (Q-PCR) analysis of angio-associated migratory cell protein (AAMP) expression in human breast cancer tissues. AAMP expression was quantified and examined alongside patients’ clinical pathological data. A: No significant differences in AAMP expression were seen in connection with histological type. B: Reduced levels of AAMP were observed in grade 3 tissues compared to grade 1 tissues. C: AAMP levels were found to be higher in the later compared to early TNM stages, although this did not reach statistical significance. D: AAMP was found to be more highly expressed in oestrogen receptor-β (ERβ)-negative samples than in ERβ-positive samples and did not demonstrate any differential expression between the ERα-positive and -negative samples.

The expression of AAMP was found to be increased in prognosis, respectively. Our data showed that there were no advanced breast cancer according to TNM stage grouping, in statistical differences among different NPI groups (Figure comparison with that of TNM1 and TNM2, AAMP expression 4A). In regard to the clinical outcomes, AAMP transcript was enhanced in TNM3 and TNM4 tissues, although these levels seemed to be increased in patients with poor prognosis, differences were not found to be significant (Figure 3C). including those with local recurrence, metastases and those Significant differences were also seen in AAMP expression who died of breast cancer (p=0.137) compared with that of between patients with ERβ-positive tumours and those ERβ- patients who remained disease-free (Figure 4B and C). It was negative tumours. However, no significant differences were found that patients with lower AAMP transcript levels had a observed between patients with ERα-positive tumours and longer overall survival (138.7±4.7 months; 95% confidence those with ERα-negative tumours (p= 0.24; Figure 3D). interval=129.6-147.8 months; p=0.01) compared with those with high levels (90.9±23.4 months; 95% confidence Prognostic relevance and clinical outcomes as related to interval=45.1-136.6 months; Figure 4D). It is interesting to AAMP in breast cancer. The prognostic potential of AAMP note that patients who developed local recurrence and who expression was firstly examined in accordance with the died of breast cancer (134.0±5.2 months; 95% confidence Nottingham prognostic index (NPI) of the patients. The NPI interval=123.9-144.2 months; p=0.005) exhibited 1-group (NPI score <3.4; n=49), NPI 2-group (NPI significantly high AAMP levels compared with those who score=3.4-5.4; n=36), and NPI 3-group (NPI score >5.4; remained disease-free (78.9±22.1 months; 95% confidence n=14) represent patients with good, moderate, and poor interval=35.6-122.1 months; Figure 4E).

1504 Yin et al: AAMP in Human Breast Cancer

Figure 4. The relationship between angio-associated migratory cell protein (AAMP) expression and prognostic clinical outcome. A: AAMP expression tended to be reduced in higher nottingham prognostic index (NPI)-staged samples than in comparison to the lower NPI stages, although this was not significant. B: In relation to survival status, significantly higher levels of AAMP were found in samples from patients who had died from breast cancer compared to those remaining disease-free. C: Elevated levels of AAMP, although not significant, were observed in patients who were considered to have a poorer prognosis that those remaining disease-free. D and E: Kaplan-Meier curves showing that patients with higher levels of AAMP had significantly reduced overall survival (D; p=0.01) and disease-free survival (E; p=0.005) than patients with lower AAMP expression.

1505 ANTICANCER RESEARCH 33: 1499-1510 (2013)

Figure 5. Knock-down of angio-associated migratory cell protein (AAMP) in breast cancer cell lines. Knock-down of AAMP in MCF-7 and MDA- MB-231 breast cancer cell lines was confirmed at the transcript level using quantitative polymerase chain reaction (Q-PCR) (A and B) and at the protein level, using western blot analysis (C and D), in comparison to the respective control cell lines.

Manipulation of AAMP expression by ribozyme transgene. AAMP has differing effects on cell function in MCF-7 and Q-PCR demonstrated that AAMP mRNA expression was MDA-MB-231 cell lines. The impact of AAMP on the growth successfully knocked-down in the breast cancer cell lines rate of MCF-7 and MDA-MB-231 was examined using an in that had been transfected with the AAMP ribozyme vitro tumour cell growth assay. Contrasting results for the transgene (MCF-7AAMPrib and MDA-MB-231AAMPrib), with effects of AAMP expression on tumour cell growth were dramatically reduced levels of AAMP observed in seen between the MCF-7 and MDA-MB-231 cell lines. In comparison to the level of expression in wild-type cells the MCF-7 cell line, knock-down of AAMP resulted in a (MCF-7WT and MDA-MB-231WT) and in empty-plasmid significant decrease in growth rate resulting in significant control cells (MCF-7pEF6 and MDA-MB-231pEF6) (Figure differences being observed between MCF-7AAMPrib and 5A and B). Additionally, western blotting was used to probe MCF-7pEF6 cell lines after 3- and 5-day incubation periods for the AAMP protein. Similar to the trends seen at the (p=0.002 and p=0.007 respectively, Figure 6A). Strangely, mRNA level, transfection with the AAMP ribozyme the MDA-MB-231 cell line did not follow a similar trend and transgene was able to bring about a reduction in AAMP no significant difference in growth was seen between the protein levels in both cell lines in comparison to the MDA-MB-231AAMPrib and MDA-MB-231pEF6 cell lines over respective empty-plasmid control cells (Figure 5C and D). the 3- or 5-day incubation period (p=0.529, Figure 6B).

1506 Yin et al: AAMP in Human Breast Cancer

Figure 6. Angio-associated migratory cell protein (AAMP) has differential effects on cell function in MCF-7 and MDA-MB-231 breast cancer cells. Knock-down of AAMP in MCF-7 cells significantly reduced cell growth (A) and cell matrix adhesion (C) but did not have any significant impact on cell invasion (E). In contrast, knock-down of AAMP in the MDA-MB-231 cell line significantly inhibited cell invasion (F) but did not have any significant impact on cell growth (B) or cell matrix adhesion (D). Knock-down of AAMP did not significantly impact on migration rates of either cell line detected using an ECIS model system.

1507 ANTICANCER RESEARCH 33: 1499-1510 (2013)

The capacity of MCF-7 and MDA-MB-231 breast cancer have metastases or who died from this disease. The long- cells to adhere to an artificial Matrigel basement membrane term survival function showed the same trend, namely that was examined using an in vitro Matrigel adhesion assay. In AAMP is a cancer-enhancing gene and that high expression the MCF-7 cell line, knock-down of AAMP also resulted in a can lead to shorter disease-free and overall survival rates. dramatic decrease in cell matrix adhesion and a significant Thus, our current study demonstrates a clinical association difference was seen between the MCF-7AAMPrib and MCF- between AAMP expression levels and breast cancer clinical 7pEF6 cell line (p=0.0097, Figure 6C). In contrast, no outcomes, indicating that high levels of AAMP expression significant difference in adhesive capacity was seen between are associated with poor clinical outcomes or shorter MDA-MB-231 cells containing the ribozyme transgene and survival, and contributes to the evidence highlighting the their respective pEF6 control cells (p=0.27, Figure 6D). potential of AAMP in playing a role in breast tumour Interestingly, over a three-day incubation, MCF-7 cells metastasis and progression. showed no changes in invasiveness following AAMP knock- AAMP expression was also observed in MCF-7, MDA- down (p=0.54), while targeting of AAMP in MDA-MB-231 MB-231 and ZR-751 breast cancer cell lines. To further cells resulted in a reduction of cellular invasion through the explore the role of AAMP in breast cancer we targeted the artificial Matrigel basement (p=0.017, Figure 6E and F). expression of AAMP in MCF-7 and MDA-MB-231 cell lines No significant differences in cell motility, assessed using using a ribozyme transgene system. In the present study, we the ECIS model system, were apparent in either cell line demonstrated that knock-down of AAMP leads a reduced following knock-down of AAMP. No significant alterations invasive potential of MDA-MB-231 cells, however, a similar in migration rates were seen over the course of the trend was not observed in the MCF-7 cell line. Additionally, experiment following electrical wounding of the monolayer AAMP knock-down reduces the cell matrix adhesion of MCF- (p>0.05; Figure 6G and H). 7 cells, while the same inhibition was not seen in MDA-MB- 231 cells. This differential impact of AAMP knock-down Discussion between the two cell lines was also seen in the growth rate analyses, where loss of endogenous AAMP resulted in a AAMP, a protein that was first isolated during a search for reduced growth rate of MCF-7 cells, but did not change the motility-associated proteins, has been shown to be expressed growth of MDA-MB-231 cells. The potential role of AAMP in different cell types, including endothelial cells, vascular in MCF-7 cells on adhesion is in agreement with other studies smooth muscle cells, human dermal fibroblasts, activated focusing on endothelial cell lines (1, 4), and may be related to T-lymphocytes, and also in the MCF-7 and MDA-MB-231 its immunoglobulin domain (1). AAMP does not change the breast cancer cell lines (1). Clinical studies showed that ability of migration in these two breast cancer cell lines, AAMP is highly-expressed in invasive gastrointestinal which is somewhat in contrast to the established role of stromal tumours (8) and in DCIS of the breast (9). Thus, the AAMP in endothelial cell lines (4), smooth-muscle cell lines role of AAMP in cancer has drawn scientific interest. In the (11) and melanoma cells (5), as previously reported. The present study, we report the increased expression of AAMP differential role of AAMP in the growth and invasiveness of in breast cancer tissues and its strong expression in breast MCF-7 and MDA-MB-231 cells is interesting and the reason cancer cell lines. The association of AAMP with clinical for this is currently unknown. Further study is required in outcomes of patients with breast cancer and its cellular order to explain this phenomenon and to offer further insight functions was tested, further highlighting its potential as an into the mechanisms of action of this molecule. indicator of poor prognosis in breast cancer. Our study firstly demonstrates the functional effects of In the current study, we demonstrated, using Q-PCR and AAMP in vitro in breast cancer cell lines, indicating that AAMP also immunohistochemical analysis, that AAMP expression may play a role in breast cancer invasion, adhesion and growth, levels are associated with clinical aspects of breast cancer in differently influencing these traits in different cell lines. Our our cohort of human breast cancer tissues. Higher transcript study also provides evidence that high levels of AAMP in levels or staining intensity of AAMP was revealed in breast clinical samples are associated with poorer prognosis. This cancer tissues compared with background mammary tissues. suggests a cancer-promoting influence of AAMP in breast The increasing expression of this gene was also seen in cancer, however, as with the in vitro data, its role and advanced disease according to TNM staging. The link importance may be dependent on the individual cancer type. between AAMP expression levels and ER status also suggests overexpression of AAMP is linked with poor Acknowledgements prognosis. From the clinical outcomes, we also observed a relationship between AAMP expressions and patient The Authors wish to thank the Albert Hung Foundation and Cancer prognosis, where AAMP is weakly expressed in the cancer Research Wales for supporting this work. Dr Yin is a recipient of tissues of disease-free patients compared with those who the China Medical Scholarship of the Cardiff University.

1508 Yin et al: AAMP in Human Breast Cancer

References 12 Adombi CM, Lelenta M, Lamien CE, Shamaki D, Koffi YM, Traore A, Silber R, Couacy-Hymann E, Bodjo SC, Djaman JA, 1 Beckner ME, Krutzsch HC, Stracke ML, Williams ST, Gallardo Luckins AG and Diallo A: Monkey CV1 cell line expressing the JA and Liotta LA: Identification of a new immunoglobulin sheep-goat SLAM protein: A highly sensitive cell line for the superfamily protein expressed in blood vessels with a heparin- isolation of peste des petits ruminants virus from pathological binding consensus sequence. Cancer Res 55: 2140-2149, 1995. specimens. J Virol Methods 173: 306-313, 2011. 2 Beckner ME, Krutzsch HC, Klipstein S, Williams ST, Maguire 13 Del Carratore R, Carpi A, Beffy P, Lubrano V, Giorgetti L, JE, Doval M and Liotta LA: AAMP, a newly identified protein, Maserti BE and Carluccio MA, Simili M, Iervasi G, Balzan S: shares a common epitope with alpha-actinin and a fast skeletal Itraconazole inhibits HMEC-1 angiogenesis. Biomed muscle fiber protein. Exp Cell Res 225: 306-314, 1996. Pharmacother 66: 312-317, 2011. 3 Beckner ME and Liotta LA: AAMP, a conserved protein with 14 Beckner ME, Jagannathan S and Peterson VA: Extracellular immunoglobulin and WD40 domains, regulates endothelial tube angio-associated migratory cell protein plays a positive role in formation in vitro. Lab Invest 75: 97-107, 1996. angiogenesis and is regulated by astrocytes in coculture. 4 Beckner ME, Peterson VA and Moul DE: Angio-associated Microvasc Res 63: 259-269, 2002. migratory cell protein is expressed as an extracellular protein by 15 Vogt F, Zernecke A, Beckner M, Krott N, Bosserhoff AK, blood vessel-associated mesenchymal cells. Microvasc Res 57: Hoffmann R, Zandvoort MA, Jahnke T, Kelm M, Weber C and 347-352, 1999. Blindt R: Blockade of angio-associated migratory cell protein 5 Beckner ME, Krutzsch HC, Tsokos M, Moul DE and Liotta LA: inhibits smooth muscle cell migration and neointima formation in The aggregated form of an AAMP derived peptide behaves as a accelerated atherosclerosis. J Am Coll Cardiol 52: 302-311, 2008. heparin sensitive cell-binding agent. Biotechnol Bioeng 54: 365- 16 Zuker M: Mfold web server for nucleic acid folding and 372, 1997. hybridization prediction. Nucleic Acids Res 31: 3406-3415, 6 Bielig H, Zurek B, Kutsch A, Menning M, Philpott DJ, 2003. Sansonetti PJ and Kufer TA: A function for AAMP in NOD2- 17 Jiang WG, Davies G and Fodstad O: COM-1/P8 in oestrogen mediated NF-κB activation. Mol Immunol 46: 2647-2654, 2009. regulated growth of breast cancer cells, the ER-β connection. 7 Reid HM, Wikstrom K, Kavanagh DJ, Mulvaney EP and Biochem Biophys Res Commun 330: 253-262, 2005. Kinsella BT: Interaction of angio-associated migratory cell 18 Jiang WG, Martin TA, Lewis-Russell JM, Douglas-Jones A, Ye L protein with the TPα and TPβ isoforms of the human and Mansel RE: Eplin-α expression in human breast cancer, the thromboxane A(2) receptor. Cell Signal 23: 700-717, 2011. impact on cellular migration and clinical outcome. Mol Cancer 8 Allander SV, Nupponen NN, Ringner M, Hostetter G, Maher 7: 71-80, 2008. GW, Goldberger N, Chen Y, Carpten J, Elkahloun AG and 19 Sanders AJ, Parr C, Mason MD and Jiang WG: Suppression of Meltzer PS: Gastrointestinal stromal tumors with KIT mutations hepatocyte growth factor activator inhibitor-1 leads to a more exhibit a remarkably homogeneous profile. aggressive phenotype of prostate cancer cells in vitro. Int J Mol Cancer Res 61: 8624-8628, 2001. Med 20: 613-619, 2007. 9 Adeyinka A, Emberley E, Niu Y, Snell L, Murphy LC, Sowter 20 Jiang WG, Hiscox S, Hallett MB, Scott C, Horrobin DF and Puntis H, Wykoff CC, Harris AL and Watson PH: Analysis of gene MC: Inhibition of hepatocyte growth factor-induced motility and expression in ductal carcinoma in situ of the breast. Clin Cancer in vitro invasion of human colon cancer cells by γ-linolenic acid. Res 8: 3788-3795, 2002. Br J Cancer 71: 744-752, 1995. 10 Balzan S, Del Carratore R, Nicolini G, Beffy P, Lubrano V, Forini F and Iervasi G: Proangiogenic effect of TSH in human microvascular endothelial cells through its membrane receptor. J Clin Endocrinol Metab 97: 1763-1770, 2012. 11 Holvoet P and Sinnaeve P: Angio-associated migratory cell protein and smooth muscle cell migration in development of Received January 1, 2013 restenosis and atherosclerosis. J Am Coll Cardiol 52: 312-314, Revised March 1, 2013 2008. Accepted March 4, 2013

1509