Identification of Gastric Cancer–Related Genes Using a Cdna Microarray Containing Novel Expressed Sequence Tags Expressed in Gastric Cancer Cells

Vol. 11, 473–482, January 15, 2005 Clinical Cancer Research 473

Identification of Gastric Cancer–Related Genes Using a cDNA Microarray Containing Novel Expressed Sequence Tags Expressed in Gastric Cancer Cells

Jeong-Min Kim,1,5 Ho-Yong Sohn,4 overexpressed in z68% of tissues and the MT2A gene Sun Young Yoon,1 Jung-Hwa Oh,1 Jin Ok Yang,1 was down-expressed in 72% of the tissues. Western blotting and immunohistochemical analyses for CDC20 and SKB1 Joo Heon Kim,2 Kyu Sang Song,3 Seung-Moo Rho,2 1 1 5 showed overexpression and localization changes of the Hyan Sook Yoo, Yong Sung Kim, Jong-Guk Kim, corresponding protein in human gastric cancer tissues. 1 and Nam-Soon Kim Conclusions: Novel genes that are related to human 1Genome Research Center, Korea Research Institute of Bioscience and gastric cancer were identified using cDNA microarray Biotechnology; 2Department of Pathology, Eulji University School of 3 developed in our laboratory. In particular, CDC20 and Medicine; and Department of Pathology, College of Medicine, MT2A represent a potential biomarker of human gastric Chungnam National University, Daejeon, Korea; 4Department of Food and Nutrition, Andong National University, Andong, Korea; and cancer. These newly identified genes should provide a 5Department of Microbiology, College of Natural Sciences, Kyungpook valuable resource for understanding the molecular mecha- National University, Daegu, Korea nism associated with tumorigenesis of gastric carcinogenesis and for the discovery of potential diagnostic markers of gastric cancer. ABSTRACT Purpose: Gastric cancer is one of the most frequently INTRODUCTION diagnosed malignancies in the world, especially in Korea and Japan. To understand the molecular mechanism associated Gastric cancer is one of the most frequently diagnosed with gastric carcinogenesis, we attempted to identify novel malignancies in the world (1). It is particularly prevalent in gastric cancer–related genes using a novel 2K cDNA micro- Korea and Japan and is one of the leading causes of cancer death array. in these regions (2). Although the incidence and mortality have Experimental Design: A 2K cDNA microarray was been decreasing during the last several years, gastric cancer still fabricated from 1,995 novel expressed sequence tags (ESTs) has a notorious position, with the first incidence and the second showing no hits or a low homology with ESTs in public cause of mortality in Korea (3). databases from our 143,452 ESTs collected from gastric Advances in diagnostic and treatment technologies have cancer cell lines and tissues. An analysis of the gene expression enabled us to offer excellent long-term survival results for early for human gastric cancer cell lines to a normal cell line was gastric cancer, but the prognosis of advanced gastric cancer still done using this cDNA microarray. Data for the different remains poor (4). Recent molecular analyses revealed that gastric expressed genes were verified using semiquantitative reverse cancers are closely related to genetic alterations in several genes, transcription-PCR, Western blotting, and immunohistochem- such as p53, APC, E-cadherin, b-catenin, TGF-a, c-met, trefoil ical staining in the gastric cell lines and tissues. factor 1, and Runx3 (5–7). However, the common pathways of Results: Forty genes were identified as either up- carcinogenesis and the subsequent progression of gastric cancer regulated or down-regulated genes in human gastric cancer remained to be elucidated. cells. Among these, genes such as SKB1, NT5C3, ZNF9, A cDNA microarray was used to simultaneously study p30, CDC20, and FEN1, were confirmed to be up-regulated the expression profiles of a number of genes at specific genes in nine gastric cell lines and in 25 pairs of tissue conditions in a single hybridization (8, 9). Many reports on samples from patients by semiquantitative reverse tran- gene expression profiles of various cancers and diseases using scription-PCR. On the other hand, genes such as MT2A cDNA microarray techniques have been reported (10–14). and CXX1 were identified as down-regulated genes. In Among them, changes in gene expression in gastric cancer particular, the SKB1, CDC20,andFEN1 genes were cell lines and malignant tissues have been reported. In gastric adenocarcinomas, genes such as S100A4, CDK4, MMP1, and b-catenin genes have been reported as being up-regulated genes, the GIF gene was reported to be a down- Received 4/20/04; revised 9/25/04; accepted 10/5/04. regulated gene (15). Ji et al. (16) has also reported the first Grant support: 21C Frontier Functional Human Genome Project from comprehensive review of gene expression patterns in gastric the Ministry of Science and Technology of Korea. cancer cell lines on a genomic scale. In this study, they The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked analyzed global gene expression patterns of 27 human cell advertisement in accordance with 18 U.S.C. Section 1734 solely to lines, including 12 gastric carcinoma cell lines and compared indicate this fact. heterogeneity between gastric cancer cell lines. In addition, a Requests for reprints: Nam-Soon Kim, Laboratory of Human Genomics, comparison of the gastric cancer–related genes using gastric Genome Research Center, Korea Research Institute of Bioscience and Biotechnology, P.O. Box 115, Yusong, Daejeon, Korea. Phone: 82-42- cancer tissues and surrounding gastric mucosa tissues has been 879-8112; Fax: 82-42-879-8119; E-mail: [email protected]. reported, as well as a connection between the clinical D2005 American Association for Cancer Research. phenotypes of patients (17).

In a previous study, we collected an entire set of genes that The novelty of these ESTs were reanalyzed by a BLAST are expressed in gastric cancer cell lines or tissues using full- search against human mRNA (Genbank release 138.0, down- length enriched cDNA libraries, subtracted cDNA libraries, and loaded on Dec. 2003), RefSeq (downloaded on Dec. 2003) under normalized cDNA libraries from gastric cancer cell lines and conditions of an identity of >90% for >50 bp with E V 1 tissues from Korean patients and identified the genes associated 1020. The remaining ESTs were analyzed by a BLAT search with gastric cancer by examining their expression profiles (18). against the human genome database (University of California Using this process for identifying novel gastric cancer-related Santa Cruz6 Golden Path genome database build 15) under the genes in which there were no hits or a low homology with known above conditions. Analysis of the ESTs that were not included in genes in public databases, we isolated 1,995 novel genes from the the above searches were done under conditions of an identity of collected gastric expressed sequence tags (ESTs) and fabricated a >90% for >50 bp with E =1 1020 to 1 103 against human cDNA microarray containing these genes. However, some of the mRNA and RefSeq databases and with E V 1 101 against the ESTs were identified as known genes in recent updated public NR database (downloaded on Dec. 2003). databases. Using the cDNA microarray, a gene expression analysis of these genes in gastric cancer cell lines and tissues was Fabrication and Hybridization of cDNA Microarray done. Here, we report on the identification of novel genes that are Clones containing the novel ESTs were grown in 96-well differentially expressed in gastric cancer cell lines and tissues. culture plates and plasmid DNAs were purified using a Millipore plasmid kit (Millipore Co., Bedford, MA). The inserts of cDNAs MATERIALS AND METHODS using purified plasmid DNAs were amplified by PCR with the sense primer 5V-GCAGAGCTCTCTGGCTAAC-3V, which is Cell Culture, Tissues, and RNA Preparation localized in the vector region and the antisense primer 5V- Human gastric cancer cell lines, SNU-1, SNU-16, SNU- CGTGCGGCCGCT21(G/A/C)-3V. After purifying the PCR 216, SNU-484, SNU-601, SNU-638, SNU-668, and SNU-719 products on Sephadex G-50 Superfine (Amersham Pharmacia were cultured in RPMI 1640 (Life Technologies, Grand Island, Biotech AB, Uppsala, Sweden), they were suspended in a NY) and human normal gastric cell lines Hs 677.St (ATCC CRL- Microspotting solution (ArrayItTM Brand Products, TeleChem, 7407) in DMEM (Life Technologies) supplemented with 10% Sunnyvale, CA) and spotted on CSS-100 Silyated Slides inactivated fetal bovine serum, 2 mg/mL sodium bicarbonate, (Aldehyde; CEL Associates, Pearland, TX) using a Carte- and 1% antibiotic-antimycotic solution (Invitrogen Life Tech- sian Prosys 5510 robot (Cartesian, Inc., Irvine, CA) with 32 nologies, Carlsbad, CA). The Hs 677.St cell line was derived printing tips. Our cDNA microarray contained a total of 6,912 from normal fetal stomach tissue and had a morphology similar spots in one slide including triplicates of 1,995 cDNA, control j to a fibroblast. All cultured cells were incubated at 37 Cina genes of GAPDH and b-actin, and empty spots for negative humidified incubator maintained with a 5% CO2 atmosphere controls. (19, 20). When the cells were about 80% to 90% confluent, they Twenty micrograms of total RNA from a normal cell line or were harvested and used for total RNA isolation. Fifty gastric cancer cell lines, respectively, were used in the cDNA micro- tissues containing the tumor and normal regions of 25 gastric array analysis. RNA of the normal cell line, labeled with Cy3, cancer patients were obtained from the College of Medicine, was used as a reference versus RNA with Cy5 from each of eight Chungnam National University, Korea with informed consent. cancer cell lines as a sample. Probe labeling and hybridization The tumors were staged according to tumor-node-metastasis were done using a 3DNA Array 50 kit (Genisphere, Inc., classification of Union Internationale Contre le Cancer. The Hatfield, PA) according to the manufacturer’s instructions. After obtained tissues were immediately frozen in liquid nitrogen. the hybridization procedure, the slide was scanned at a Total RNA was extracted from the cultured cells and tissues wavelength of 532 nm for Cy3 and at 635 nm for Cy5 using using a commercially available RNA isolation kit (Qiagen, a ScanArray 5000 scanner (Packard BioChip Technologies, Hilden, Germany) following the procedures recommended by Billerica, MA). To increase the accuracy of the experiment, the manufacturer. each experiment was done in duplicate using two different Isolation of Novel Genes from ESTs Collected in Gastric cDNA microarrays. Cancers Analysis of Data Obtained from cDNA Microarray The total 143,452 ESTs collected from human gastric The scanned images were analyzed using the GenePix Pro cancer cell lines and gastric tissues were analyzed by a BLAST 4.0 program (Axon Instruments, Inc., Union City, CA) and the search against human mRNA (Genbank release 126, down- subsequent data were normalized using the scaled print-tip group loaded on Oct. 2001), UniGene (UniGene build 143, down- Lowess method using the statistics for microarray analysis loaded on Oct. 2001) and NR databases (downloaded on Oct. package of the R7 statistics software to remove intensity 2001). To isolate novel ESTs in which there were no hits or a low variances between spots themselves that originate from spotted homology in public databases, ESTs having an identity of <90% locations. If the signal to background ratio was <1.4, the feature for <50 bp with E V 1 103 against the human mRNA and was processed as a null value to reduce bias. Using normalized UniGene databases, and having an identity of <85% for <20 M values [M =log(R/G)], we did a one class analysis using the amino acids with E V 1 105 against the NR database were 2 selected. E V 1 103 indicates that the probability that a query sequence have accidentally identity with a certain sequences in 3 database under given condition is V1 10 . These isolated 6 http://genome.ucsc.edu/ ESTs were used to fabrication the cDNA microarray. 7 http://www.maths.lth.se/help/R/com.braju.sma/

significance analysis of microarrays8 program with a median methylsulfonyl fluoride, 1 Amol/L Pepstatin A, 1 Amol/L false discovery rate of 0.10089 and D =1.40toselect Leupeptin, 1 Amol/L Aprotinin, and placed on ice for 1 hour. significantly expressed genes (21). Furthermore, to exclude The cells were then centrifuged at 15,000 g for 15 minutes spots having a low intensity, genes having an A >6[A = and the supernatant was harvested. Aliquots (50 Ag) of 0.5log2(RG)] were selected. In addition, redundant clones were soluble proteins were separated on SDS-polyacrylamide-gels removed, because our cDNA microarray had triplicate spots. and transferred to polyvinylidene difluoride membranes Finally, differentially expressed genes in gastric cancer cell lines (Millipore). The membranes were incubated with the mouse were selected for further study based on the significance analysis monoclonal antibody against CDC20 (Santa Cruz Biotechnol- of microarrays scores. ogy, Inc., Santa Cruz, CA), a rabbit polyclonal antibody to SKB1 (Cell Signaling Technology, Inc., Beverly, MA) and a Bioinformatic Analysis of Up-Regulated or Down-Regulated mouse monoclonal antibody to h-actin (Sigma, St. Louis, Genes MO) at a dilution of 1:1,000, 1:1,000, and 1:50,000, A homology search for the selected genes was done by a respectively. After the blots were incubated with peroxidase- BLASTn analysis against the NR database with the National conjugated goat anti-rabbit IgG (Jackson ImmunoResearch, 9 Center for Biotechnology Information default conditions. The WestGrove, PA) and horseradish peroxidase–conjugated goat search for the symbol and function of these genes were done by anti-mouse antibody (Promega, Madison, WI), immunoreactive 10 11 SOURCE and GeneCards. In addition, an analysis for the signals were detected using enhanced chemiluminescence kit chromosomal location of the selected genes was done using the (Amersham Pharmacia, Piscataway, NJ). University of California Santa Cruz Golden Path human genome database build 15 at conditions of 90% minimum identity. Immunohistochemistry Paraffin sections of gastric cancer tissue from patients Semiquantitative Reverse Transcription-PCR were deparaffinized with xylene and then rehydrated. The 1st cDNA was synthesized by the reverse transcription Antigenic retrieval was processed by submerging in citrate reaction with 5 Ag of isolated RNA, 2 pmol/L of oligo (dT)20, buffer (pH 6.0) and microwaving. The sections were then 1 ALof10Amol/L deoxynucleotide triphosphate, 4 ALof5 treated with 3% hydrogen peroxide in methanol to quench buffer, 2 AL of 100 mmol/L DTT, 1 AL of RNaseOUT (40 units/ endogenous peroxidase activity, followed by incubation with AL, Invitrogen Life Technologies), and 1 AL of SuperScript II 1% bovine serum albumin to block nonspecific binding. The j (200 units/AL, Invitrogen Life Technologies) at 42 C for 1 hour. primary anti-CDC20 (1:100 dilution) and anti-SKB1 (1:100 The 1st cDNA was quantified using a human b-actin competi- dilution) antibodies that are used in Western blotting were tive PCR kit (TaKaRa Co., Tokyo, Japan) according to the incubated for 60 minutes at room temperature. After washing, manufacturer’s instructions. The PCR conditions were 1 cycle of the tissue section was then reacted with the biotinylated anti- j j 2 minutes at 94 C, 25 cycles of 30 seconds at 94 C, and 1 mouse and anti-rabbit secondary antibodies, followed by j j minute at 68 C, and 1 cycle of 1 minute at 72 C with b-actin incubation with streptavidin-horseradish-peroxidase complex. primer sets (Table 1). After electrophoresis in a 2% agarose gel, The tissue section was immersed in 3-amino-9-ethyl carba- the DNA concentration of b-actin (275 bp) and actin competitor zole as a substrate, and counterstained with 10% Mayer’s (340 bp) were analyzed using the TotalLab software program hematoxylin, dehydrated, and mounted by crystal mount. In (Phoretix Co., Newcastle Upon Tyne, United Kingdom) and the the negative controls, the nonimmune mouse or rabbit IgG amount of the 1st cDNA of each sample was adjusted based on of the same isotype or the antibody dilution solution was the b-actin concentration. To quantify the expression level of replaced the primary antibody. the selected genes, the same volume of diluted 1st cDNAs synthesized from gastric cells was used as a template in a PCR reaction. Each gene was amplified by PCR which consisted of 27 RESULTS cycles of 40 seconds at 94jC, 50 seconds at 55jC, and 1 minute Analysis of cDNA Included in cDNA Microarray at 72jC with specific primer sets (Table 1). The PCR products of To isolate novel genes associated with stomach cancer, a each of the specific genes and b-actin (275 bp) were analyzed by cDNA microarray containing novel ESTs which have low 2% agarose gel electrophoresis and the expression ratio was homology or no hits in public databases was fabricated. A total calculated using the TotalLab software program (Phoretix). of 1,995 ESTs contained in microarray were selected as novel Western Blotting ESTs from our 143,452 ESTs collected from human gastric When human gastric normal and cancer cell lines which cancer cell lines and gastric tissues by analysis of public were cultured in media, were about 80% to 90% confluent, databases (collected on Oct. 2001, see MATERIALS AND they were rinsed with PBS, scrapped into 300 AL of cell lysis METHODS). A reanalysis of these selected genes against buffer containing 50 mmol/L Tris (pH 7.5), 150 mmol/L updated above databases, for novelty, (data collected on Dec. NaCl, 0.5% NP40, 1 mmol/L EDTA, 1 mmol/L phenyl- 2003) showed that 686 genes (34.4%) could be categorized into known human genes against the human mRNA and RefSeq databases with conditions of identity of >90% for >50 bp with E V 1 1020, and 559 genes (28%) without known human genes 8 http://www-stat.stanford.edu/ftibs/SAM/index.html 9 http://www.ncbi.nlm.nih.gov/BLAST/ were mapped only on the human genome against University of 10 http://source.stanford.edu/cgi-bin/sourceSearch California Santa Cruz Golden Path genome database build 15 11 http://bioinformatics.weizmann.ac.il/cards/ under above conditions (Table 2). In addition, 690 genes were

Table 1 Primer sequences and the product size of selected genes used in RT-PCR Gene Sense (5V!3V) Antisense (5V!3V) Size (bp) CKS1B ACGACGACGAGGAGTTTGAG CCGCAAGTCACCACACATAC 584 SKB1 CAAGTTGGAGGTGCAGTTCA GCCCACTCATACCACACCTT 1,074 NT5C3 TGATGCCAGAATTCCAGAAA CAACATTGGCCACTCCATCT 723 ZNF9 TTCAAGTGTGGACGATCTGG TTGCTGCAGTTGATGGCTAC 437 P30 CTTCTCGCTTCAAGCTCCTG TGTTCTTGATGGTCTTGTGCTC 249 CDC20 GTACCTGTGGAGTGCAAGC GTAATGGGGAGACCAGAGG 618 FEN1 CATGGACTGCCTCACCTTC CGGTCACCTTGAAGAAATC 508 LGALS1 GACGCTAAGAGCTTCGTGCT GTAGTTGATGGCCTCCAGGT 282 MT2A ATGGATCCCAACTGCTCCT CTTTGCAGATGCAGCCTTG 154 CXX1 GGAGGAGGACGAGGACTTCT TGGGCAGAATGATGTAGTCG 418 Actin CAAGAGATGGCCACGGCTGCT TCCTTCTGCATCCTGTCGGCA 275

categorized into ESTs of low homology and 60 genes (3.0%) Genes representing a down-regulated expression in gastric showing ‘‘no hits’’. Among known human genes, 289 genes cancer cells included known genes such as LGALS1, OAZ1, (14.5%) were functionally classified by the Gene Ontology PEA15, SEC61A1, LGP1, MT2A, MAGED2, NPDC1, CXX1, database.12 From these analyses, 1,309 ESTs excluding Known FKBP8, and PGR1 and functionally unknown genes such as human genes were thought to be novel ESTs, although only 60 DXS9879E, FLJ34386, FLJ20920, and FLJ30061 and five (3%) represented novel ESTs which were sacrificed by the first novel genes (Table 4). The functional analysis of these selected criteria, in which novel ESTs were defined as ESTs having an genes showed that the genes related with apoptosis (LGALS1), identity of <90% for <50 bp with E V 1 103 against the polyamine biosynthesis (OAZ1), protein targeting (SEC61A1), human mRNA and UniGene databases. and protein folding (FKBP8) were included. In addition, many of the down-regulated genes were localized in chromosome 17, Identification of Up-Regulated or Down-Regulated Genes in chromosome 19, and chromosome X. Among them, two genes Gastric Cancer Cells LGP1 and FLJ20920 were clustered in 17q21. We compared the gene expression profiles of eight gastric cancer cell lines with that of a normal gastric cell line using Verification of mRNA Levels for Selected Genes Using cDNA microarray. After cDNA microarray hybridization, Semiquantitative Reverse Transcription-PCR normalization, and data analysis, we finally selected a total of To more quantitatively verify the data obtained from our 40 genes, 20 genes for up-regulation and 20 genes for down- DNA microarray, we randomly selected seven up-regulated regulation, based on significance analysis of microarrays scores, genes (CKS1B, SKB1, NT5C3, ZNF9, p30, CDC20, and FEN1) that showed significant expression changes in gastric cancer and five down-regulated genes (LGALS1, OAZ1, DXS9879E, cells. MT2A, and CXX1) in gastric cancer and did semiquantitative As shown in Table 3, the up-regulated genes in gastric reverse transcription-PCR (RT-PCR) in nine normal and gastric cancer cells included known genes such as CKS1B, SCX, cancer cell lines, and in 25 pairs of gastric normal and tumor D1S155E, FKBP4, SKB1, NT5C3, p30, GPI, PRO2000, tissues in the I to IV stages. CDC20, FEN1, ZNF9, and RPS16 and functionally unknown As shown in Fig. 1A, the expression of all the up-regulated genes such as FLJ31196, FLJ39478, and FLJ90345.In genes were higher in most of the cancer cell lines than in addition, four novel genes NSG-21-D10, NSG-18-A07, NSG- normal cell lines, Hs 677.St. All of these genes were also highly 05-E12, and NSG-08-D09 were included. A search of the SOURCE and GeneCards database for the function of these selected genes indicated that their biological functions were Table 2 Contents of the cDNA microarray diverse and included genes related to a cell cycle regulator Categories Novel genes (%) (CKS1B, SKB1, and CDC20), transcription (SCX), develop- Known human genes* 289 (14.5) ment (D1S155E), protein folding (FKBP4), DNA repair Known functiony 397 (19.9) (FEN1), and biosynthesis (ZNF9, RPS16). Furthermore, a Unknown functiony 397 (19.9) Human genomez 559 (28.0) search of chromosomal locations for the up-regulated genes x was done by mapping the in University of California Santa ESTs (low homology) 690 (34.6) No hitsk 60 (3.0) Cruz Golden Path human genome database. The analysis Total 1,995 (100) showed that of the 20 genes, 13 were localized in 20 *An identity of >90% for >50 bp with a E V 1 10 against chromosome 1 (CKS1B, D1S155E, and CDC20), chromosome human mRNA and RefSeq databases. 8(SCX, FLJ39478, and PRO2000), chromosome 11 (FEN1 yAccording to the Gene Ontology consortium http://www.geneon- and NSG-18-A07), chromosome 17 (FLJ31196 and p30), and tology.org). z chromosome 19 (GPI, FLJ90345, and RPS16). The genes Not categorized in known human genes, but mapped on human Golden Path build 15 at condition of >90% identity. localized in chromosome 17 and chromosome 19 were xNot categorized in known human genes and human genome, but clustered in 17p11.2 and 19q13, respectively. have an identity of above 90% with E =1 1020 to 1 103 against human mRNA and RefSeq database and an E V 1 101 against NR database. 12 http://www.geneontology.org/ kNot found in any databases under the above conditions.

Table 3 Up-regulated genes in gastric cancer cells in comparison to gastric normal cell No.* Clone name Homology search Gene symbol Functiony Chromosome location Accession no.z 1 NSG-19-G11 Hypothetical protein FLJ31196 FLJ31196 — 17p11.2 BQ082434 2 NSG-03-F01 CDC28 protein kinase regulatory CKS1B cell cycle control 1q22 CB104710 subunit 1B 3 NSG-06-C08 Homo sapiens class II bHLH SCX transcription 8x — protein scleraxis (SCX) gene 4 NSG-11-H11 cDNA FLJ39478 FLJ39478 — 8q13.2 BM838262 5 NSG-11-H08 NRAS-related gene D1S155E development 1p13.2 BM749971 6 NSG-17-H01 FK506-binding protein 4 FKBP4 protein folding 12p13.33 — (59 kDa) 7 NSG-06-C12 SKB1 homologue SKB1 cell proliferation 14q11.2 — (Schizosaccharomyces pombe) 8 NSG-07-G05 5V nucleotidase, cytosolic III NT5C3 nucleotide metabolism 7p14.3 BQ082023 9 NSG-16-G09 nuclear proteinp30 p30 — 17p11.2 BM764481 10 NSG-14-A11 glucose phosphate isomerase GPI Glycolysis 19q13.11 BM837477 11 NSG-08-D03 cDNA clone FLJ90345 FLJ90345 — 19q13.32 BQ082182 12 NSG-21-D10 unknown — — 7q36.1 BM792256 13 NSG-13-A06 PRO2000 protein PRO2000 nucleotide binding 8q24.13 BM746835 14 NSG-11-G05 cell division cycle 20 homologue CDC20 regulation of cell cycle 1p34.2 BM742641 (Saccharomyces cerevisiae) 15 NSG-16-F01 flap structure–specific endonuclease 1 FEN1 DNA repair 11q12.2 — 16 NSG-14B06 zinc finger protein 9 ZNF9 cholesterol biosynthesis 3q21.3 BM837311 17 NSG-18-A07 unknown — — 11p15.5 BM826554 18 NSG-05-E12 Unknown — — — BM742807 19 NSG-12-F03 ribosomal protein 16 RPS16 protein biosynthesis 19q13.2 BM764565 20 NSG-08-D09 unknown — — — BM759098 *Number represents the order of genes selected from a significance analysis of microarrays. yGene function according to SOURCE and GeneCards. zGenbank accession no. xKnown as only the chromosome number. expressed in most of the tumor tissues compared with their cancer. Among these genes, the CDC20 gene was the most normal tissues (Fig. 1B). These genes were highly expressed in highly expressed in 22 tumor tissues of the 25 tissue pairs with tumor tissues with a frequency of 40% to 88% in 25 tissue pairs a high frequency of 88% which covered all stages of gastric that were classified as containing I to IV stages of gastric cancer. The SKB1 and FEN1 genes were also detected at high

Table 4 Down-regulated genes in gastric cancer cells in comparison to gastric normal cell No.* Clone name Homology search Gene symbol Functiony Chromosome location Accession no.z 1 NSG-18-B07 lectin, galactoside-binding, soluble, 1 LGALS1 apoptosis/cell differentiation 22q13.1 BM740571 2 NSG-05-G04 ornithine decarboxylase antizyme 1 OAZ1 polyamine biosynthesis 19p13.3 BM745727 3 NSG-21-C09 unknown — — 2q22.3 CB104881 4 NSG-03-B06 phosphoprotein enriched in PEA15 small molecular transport 1q23.2 — astrocytes 15 5 NSG-14-F03 DNA segment on chromosome X DXS9879E — Xq28 M827357 (unique) 9879 expressed sequence 6 NSG-15-D02 FLJ34386 fis, clone HCHON1000166 FLJ34386 — 12q13.2 BM763909 7 NSG-02-E05 protein transport protein SEC61 alpha SEC61A1 protein targeting 3q21.3 — subunit isoform 1 8 NSG-21-B09 H. sapiens D11lgp1e-like, fragment LGP1 — 17q21.2 BM790048 9 NSG-21-E10 hypothetical protein FLJ20920 FLJ20920 — 17q21.33 BM795358 10 NSG-15-D03 metallothionein-II gene MT2A metal ion binding 16q12.2 BQ082159 11 NSG-17-B05 melanoma antigen, family D, 2 MAGED2 — Xp11.21 BM790470 12 NSG-12-D11 neural proliferation, differentiation NPDC1 Integral to membrane 9q34.3 — and control, 1 13 NSG-05-G03 unknown — — — — 14 NSG-21-F08 unknown — — — — 15 NSG-15-C07 CAAX box 1 CXX1 — Xq26.3 BM763063 16 NSG-21-D05 FK506 binding protein 8 FKBP8 protein folding 19q13.11 BM790404 17 NSG-19-A04 T-cell activation protein PGR1 — 4p16.1 BM771674 18 NSG-08-C02 unknown — — — BM757441 19 NSG-07-F01 unknown — — — BQ081958 20 NSG-07-F02 cDNA FLJ30061 FLJ30061 — 7q32.3 BQ081959 *Number represents the order of genes selected from a significance analysis of microarrays. yGene function according to SOURCE and GeneCards. zGenbank accession no.

Fig. 1 Semiquantitative RT-PCR of selected genes from the cDNA microarray. Total RNAs isolated from gastric cell lines and tissues were used as templates for semiquantitative RT-PCR, according to the manufacturer’s instructions (for details, see MATERIALS AND METHODS). The RT-PCR products were electrophoresised on a 2% agarose gel. A, expression levels of target genes in gastric cell lines. Hs677.St, gastric normal cell line; SNU series, gastric cancer cell lines established from Korean patients. The b-actin gene was used as a reference. B, expression levels of target genes in gastric tumor and normal tissues. The transcriptional levels of the target genes were calculated relative to the amount of b-actin gene. a-f, up-regulated genes in the cancer cells; g-h, down-regulated genes in the cancer cells; 5, normal tissues from gastric cancer patients; n, tumor tissues from gastric tumor patients; IA, IB, II, IIIA/B, and IV: stages of gastric cancer tissues according to tumor-necrosis-metastasis classification of Union Internationale Contre le Cancer.

levels in the IB and II stages of tumor tissues for SKB1 and in semiquantitative RT-PCR are in relatively good agreement with II and III A/B stages for FEN1 with a frequency of 68% (17 the DNA microarray data. in 25 cases) and 72% (18 in 25 cases), respectively. All of the up-regulated genes detected in tissues were highly detected in Verification of Protein Levels for Selected Genes Using most of the II stage gastric cancers. However, CKS1B was not Western Blotting and Immunohistochemistry detected in any of the gastric tissues, though it was detected in We verified the protein levels for genes that had been very low amounts in cancer cell lines. On the other hand, three confirmed by RT-PCR using Western blotting for nine gastric down-regulated genes, except for OAZ1 and DXS9879E, were normal and cancer cell lines, and immunohistochemistry for six detected at low levels in many of the cancer cell lines compared gastric tissues. Because antibodies for only CDC20 and SKB1 with the normal cell line, Hs 677.St, as shown in Fig. 1A. When were available, these two proteins were selected as targets. the expression levels of three genes, LGALS1, MT2A, and As shown in the Western blotting of Fig. 2A, high levels of CXX1, were examined in gastric tissues, MT2A was found to be protein for CDC20 were detected in the gastric cancer cell lines detected at low levels in the tumor tissues, but had high in comparison with the normal cell line, especially for SNU-601, expression levels in normal tissues with a frequency of 72% (18 SNU-638, and SNU-719. The immunohistochemistry also of 25 cases). Its higher expression was detected over a wide stage from IB to IV in normal gastric tissues. The other gene, showed that CDC20 was highly detected in gastric tumor tissue, CXX1, was highly expressed in normal tissues with frequencies although it was present in normal tissue from the patient samples of about 32% in various stages. However, LGALS1 was not (Fig. 2B, a-c). However, differently from normal tissue, it was detected in any of the gastric tissues, because of very low localized in perinuclear region of the cell in tumor tissues and the amounts in tissues. These results indicate that the mRNA levels localization change was more strongly detected in poorly of target genes in gastric tissues were largely consistent with differentiated gastric tumors. Otherwise, when the protein level those of the cell lines. Additionally, these results from for SKB1 was checked by Western blotting, it was also detected

Fig. 2 Western blotting and immunohistochemistry for selected genes identified by the cDNA microarray. A, Western blot analysis of CDC20 and SKB1 in gastric cell lines. Equal amounts of cell lysates (50 Ag) were resolved by SDS-PAGE, transferred to PVDF membrane, and probed with specific antibodies (anti-CDC20 and anti-SKB1) and anti-h-actin antibody as control for protein level. B, immunohistochemical staining for CDC20 and SKB1 in the gastrointestinal tumor tissues. These photographs depict representa- tive areas from the normal gastrointestinal tissues (a and d), moderately differentiated (b and e) and poorly differentiated gastrointestinal tumor tissues (c and f ). a-c, CDC20; d- f, SKB1. Bars, 100 Am(a-f ).

at high levels in gastric cancer cell lines. In particular, the of two genes in gastric cancers was also detected by their protein amounts expressed were dramatically high in SNU-1, SNU-16, level using Western blotting and immunohistochemistry. These SNU-216, and SNU-638 (Fig. 2A). It is also noteworthy that a results indicate that the up-regulation of two genes coupled large band, higher than the 70 kDa band, corresponding to transcription to translation. These results also showed changes in SKB1, was detected for SNU-216, which is thought to be the the localization of these proteins in tumor tissues, from the cytosol to the perinuclear region for CDC20 and to the nucleus result of the post-modification of SKB1 or an alternative for SKB1, respectively. These findings indicate that the amount transcript. This band was also faintly detected in Hs 677.St. of change of these genes that encoded transcript and protein as Figure 2B (d-f) shows immunohistochemical results for SKB1 in well as the change in localization is correlated with the gastric normal and tumor tissues from the patient samples. As oncogenesis of human gastric cancer. predicted, it was highly expressed in gastric tumors compared CDC20 is known to directly bind to the anaphase- with normal tissue. As shown in CDC20, a change in promoting complex with hCDH1 and activates anaphase- localization for SKB1, mainly in the nuclear region, also promoting complex by which anaphase is initiated and mitosis detected in tumor tissues. These results indicate that an increase is terminated (23). The overexpression of CDC20 has previously in the mRNA level for CDC20 and SKB1 in gastric tumor been reported in human pancreatic cancer (24) and its alteration tissues coupled with that of the protein level and the change in has also been detected in early-stage lung adenocarcinoma (25). the amount produced and their localization are associated with The up-regulation of CDC20 in gastric cancer was confirmed by carcinogenesis in gastric tumors. gene expression data linked to SOURCE in which CDC20 and CKS1B has been reported to be up-regulated in gastroesophageal DISCUSSION adenocarcinomas (26). Meanwhile, the up-regulation of CDC20 has been reported to be related to apoptosis in Taxol-induced cDNA microarray technologies aid in analyses of the expression levels of several thousands of genes for multiple HeLa cells and NIH3T3 (27), myeloid cells (28, 29). Therefore, samples at the same time. Numerous attempts to identify genes it is likely that function of the CDC20 in cells may depend on the related to carcinogenesis of various cancers including gastric stage, type and environments of the cells. CKS1B has been cancer using a DNA microarray have been reported (10–17, 22). known to be a CDC28 protein kinase regulatory subunit 1B. The We selected ESTs having a low homology or no hits with ESTs overexpression of CKS1B has been previously reported in gastric in public databases from our Korean UniGene Information ESTs cancer (15, 22) and in pancreatic cancer (12). CKS1B has also clone bank and used this as a DNA source for the fabrication of a been proposed to facilitate the transcription of the CDC20 gene microarray in order to identify novel genes that are associated through the remodeling of transcriptional complexes or chroma- with gastric cancer. All of the selected 1,995 ESTs were novel tin that is associated with the CDC20 gene (30). These finding ESTs at the first stage. However, because a considerable amount suggest that CDC20 and CKS1B may act sequentially in the of EST data has been recently submitted to public databases by tumorigenesis of gastric cancer, although it has not been reported rapid advances in high-throughput sequencing, of these ESTs, that CDC20 is related to gastric cancer. It has previously been only 60 genes (3%), in a homology analysis against updated reported that SKB1 in fission yeast plays a role in the control of public databases represented novel ESTs which are sacrificed cell polarity (31), in the negative regulation of mitosis (32), and with the first criteria. However, as shown in Table 2, 1,309 ESTs in the coordination of cell cycle progression (33). It has also excluding known human genes were classified as novel genes. been proposed to act as a mediator of the hyperosmotic stress When 2K microarray experiments using 1,995 cDNA were done, response (34), but its relation to oncogenesis has not yet been the signal intensities obtained were generally lower than those of reported. a 14K cDNA microarray fabricated from our 143,452 ESTs (data not shown). In addition, the results of RT-PCR for the target Genes involving nucleotide metabolism, DNA repair, and genes indicated that the mRNA levels of many of the genes were cholesterol biosynthesis such as NT5C3, p30, FEN1, and very low or not detectable. These results indicate that the genes ZNF9 are also up-regulated in gastric cancer cells, as evidenced included in the 2K microarray were rarely expressed in cells and from the microarray data as well as semiquantitative RT-PCR. that the difference in expression of these genes also can be easily In particular, FEN1 was highly expressed with a high excluded, compared with those of abundantly expressed genes. frequency of 72% in gastric tumor tissues, compared with Therefore, our 2K microarray might be potentially useful in normal tissues. These observation are consistent with the identifying rare genes related to stomach cancer. finding that increased FEN1 expression leads to rapid tumor When the expression profiles of the gastric cancer cells and progression of mouse gastrointestinal tract cancer in a haplo- the normal cells were compared using our 2K microarray, 40 insufficient manner (35). The up-regulation of the gene has also genes showing significant differences were found. Difference in been reported in human lung cancer cell lines (36). It has been the expression of these genes was also confirmed by semiquan- reported that a deficiency in NT5C3 causes an autosomal titative RT-PCR data, collected from gastric cell lines and tissues recessive hemolytic anemia (37) and ZNF9 involve in from patients. Among the selected genes, several genes related to myotonic dystrophy 2 (38). p30 has been identified as a the cell cycle, CKS1B, CDC20, and SKB1, were identified as component of a purified nucleoporin fraction from rat liver nuclei up-regulated genes. Interestingly, the CDC20 and SKB1 genes (39). Although these genes have not been reported to be related to were highly represented with a very high frequency of 88% and human gastric cancer, they do, in fact, seem to be new candidates 68% in gastric tumor tissues in comparison with normal tissues, for gastric cancer, on based on the results herein, because the up- although the CKS1B transcript was not detected in gastric tissues regulation of these genes was detected in gastric tumor tissues because of the low expression. Furthermore, a higher expression with a high frequency of 40% to 72%.

On the other hand, of the down-regulated genes in gastric of hypoxia related proteins induced by HIF-1a, glycolytic cancer, MT2A was down-expressed with a high frequency of enzymes such as GAPD, ENO1, PKM2, PGK1, and LDHA have 72% in tumor tissues from the IB to IV stages. It is known to be been reported to up-regulated in gastric cancer (18, 60). GPI, an involved in the regulation of carcinogenesis and apoptosis such enzyme involved in glycolysis, is known to be a hypoxia- as an activator of cell proliferation and an inhibitor of apoptosis, inducible factor in other forms of cancer (61). The findings here as well as various other physiologic processes (40, 41). Although indicate that this gene is up-regulated in gastric cancer cell lines. this gene has been reported to be up-regulated in human breast From these results, one possibility is that the HIF-1a signaling cancers (42) and esophageal cancer (41), its expression is known pathway might be related to the pathogenesis and progression of to be down-regulated in gastroesophageal adenocarcinomas in gastric cancer. These newly identified genes should provide gene expression data linked to SOURCE (26). Thus, it is likely valuable resources for developing an understanding of the that MT2A expression in tumor cells may depend on the molecular mechanism associated with tumorigenesis of gastric developmental stage or the specific type of tumor. Genes such as cancer and for discovering potential diagnostic markers for LGALS1 and CXX1 were also down-regulated. LGALS1 is gastric cancer. known to regulate cell apoptosis and to act as an autocrine- negative growth factor that regulates cell proliferation. Our data ACKNOWLEDGMENTS indicated that it represents a high priority candidate among the We thank Dr. Young-il Yeom for spotting the DNAs on the slides. down-regulated genes in stomach cancer cell lines in comparison with normal cell lines, although it was not detected in stomach tissue because of its low abundance. However, contrary to our REFERENCES data, the up-regulation of LGALS1 has been reported in several 1. Mitelman F. Catalogue of chromosome aberrations in cancer. tumors such as head and neck squamous carcinoma (43), human Cytogenet Cell Genet 1983;36:1–515. colon cancer (44, 45), and human pancreatic cancer (46). These 2. Neugut AI, Hayek M, Howe G. Epidemiology of gastric cancer. Semin Oncol 1996;23:281–91. observations imply that the mechanism of LGALS1 in human 3. Lee HJ, Yang HK, Ahn YO. Gastric cancer in Korea. Gastric Cancer gastric cancer might be different from that reported for other 2002;5:177–82. cancers. Reports concerning CXX1 being down-regulated in 4. Roukos DH. Current status and future perspectives in gastric cancer tumor tissues with a frequency of about 32%, except having a management. Cancer Treat Rev 2000;26:243–55. CAAX box 1 have not yet appeared. 5. Werner M, Becker KF, Keller G, Hofler H. Gastric adenocarcinoma: Some tumor suppressor genes and oncogenes under the pathomorphology and molecular pathology. J Cancer Res Clin Oncol control of genomic change were clustered in specific chromo- 2001;127:207–16. somal regions. The data herein indicate that some of the up- 6. Park WS, Oh RR, Park JY, et al. Somatic mutations of the trefoil regulated genes were clustered in chromosome 17p11.2 and factor family 1 gene in gastric cancer. Gastroenterology 2000;119:691–8. chromosome 19q13, and some of the down-regulated genes 7. Li QL, Ito K, Sakakura C, et al. Causal relationship between the loss of RUNX3 expression and gastric cancer. Cell 2002;109:113–24. in chromosome 17q21. These observations are supported by 8. DeRisi J, Penland L, Brown PO, et al. Use of a cDNA microarray previous findings showing that the amplification and rearrange- to analyse gene expression patterns in human cancer. Nat Genet ment of chromosome 17p11.2 occurred at a high frequency in 1996;14:457–60. Birt-Hogg-Dube syndrome (47), osteosarcoma (48, 49), and 9. Duggan DJ, Bittner M, Chen Y, Meltzer P, Trent JM. Expression glioma (50), and the breakpoint of chromosomal abnormalities profiling using cDNA microarrays. Nat Genet 1999;21:10– 4. at band chromosome 19q13 is frequently found in primary 10. Ross DT, Scherf U, Eisen MB, et al. Systematic variation in gene gastric cancer (51). The presence of tumor suppressor genes on expression patterns in human cancer cell lines. Nat Genet 2000;24: 227–35. chromosome 17q21 is also supported by the proposal that chro- 11. Wikman H, Kettunen E, Seppanen JK, et al. Identification of mosome 17q21, including the BRCA1 locus, may contain a differentially expressed genes in pulmonary adenocarcinoma by using candidate for tumor suppressor genes in gastric cancer (52). cDNA array. Oncogene 2002;21:5804–13. These reports and our data imply that the up-regulated genes 12. Han H, Bearss DJ, Browne LW, Calaluce R, Nagle RB, Von Hoff DD. clustered on chromosome 17p11.2 and chromosome 19q13 Identification of differentially expressed genes in pancreatic cancer cells might be candidates for an oncogene, and the down-regulated using cDNA microarray. Cancer Res 2002;62:2890–6. genes on chromosome 17q21 candidates for a tumor suppressor. 13. Jiang Y, Harlocker SL, Molesh DA, et al. Discovery of differentially Several groups have recently reported on the results of expressed genes in human breast cancer using subtracted cDNA libraries and cDNA microarrays. Oncogene 2002;21:2270–82. expression profile analyses in gastric cancers using high-density 14. Yang SH, Kim JS, Oh TJ, et al. Genome-scale analysis of microarrays (15–17, 22, 53–59). The candidate genes reported resveratrol-induced gene expression profile in human ovarian cancer by these groups were mostly abundantly or intermediately cells using a cDNA microarray. Int J Oncol 2003;22:741–50. expressed genes in gastric cancers, whereas many of our 15. El-Rifai W, Frierson HF Jr, Harper JC, Powell SM, Knuutila S. candidate genes are rarely expressed genes or novel genes Expression profiling of gastric adenocarcinoma using cDNA array. Int J which were seldom selected by other groups. By combining Cancer 2001;92:832–8. these results, as mechanisms related to gastric cancer pathogen- 16. Ji J, Chen X, Leung SY, et al. Comprehensive analysis of the gene expression profiles in human gastric cancer cell lines. Oncogene esis and progression, we propose that up-regulated CKS1B in 2002;21:6549–56. gastric cancer cells might promote the expression of CDC20, the 17. Lee S, Baek M, Yang H, et al. Identification of genes differentially highly induced the CDC20 would also increase the activation of expressed between gastric cancers and normal gastric mucosa with anaphase-promoting complex and the initiation of anaphase and cDNA microarrays. Cancer Lett 2002;184:197–206. the progression of the cell cycle then be accelerated. In addition, 18. Kim NS, Hahn Y, Oh JH, et al. Gene cataloging and expression

profiling in human gastric cancer cells by expressed sequence tags. hepatocarcinoma in mice. Zhongguo Zhong Xi Yi Jie He Za Zhi Genomics 2004;83:1024–45. 2000;20:368–70. 19. Park JG, Frucht H, LaRocca RV, et al. Characteristics of cell lines 41. Cui Y, Wang J, Zhang X, et al. ECRG2, a novel candidate of tumor established from human gastric carcinoma. Cancer Res 1990;50:2773–80. suppressor gene in the esophageal carcinoma, interacts directly with 20. Park JG, Yang HK, Kim WH, et al. Establishment and characterization metallothionein 2A and links to apoptosis. Biochem Biophys Res of human gastric carcinoma cell lines. Int J Cancer 1997;70:443–9. Commun 2003;302:904–15. 21. Tusher VG, Tibshirani R, Chu G. Significance analysis of micro- 42.JinR,ChowVT,TanPH,DheenST,DuanW,BayBH. arrays applied to the ionizing radiation response. Proc Natl Acad Sci Metallothionein 2A expression is associated with cell proliferation in U S A 2001;98:5116–21. breast cancer. Carcinogenesis 2002;23:81–6. 22. Hippo Y, Taniguchi H, Tsutsumi S, et al. Global gene expression 43. Gillenwater A, Xu XC, Estrov Y, Sacks PG, Lotan D, Lotan R. analysis of gastric cancer by oligonucleotide microarrays. Cancer Res Modulation of galectin-1 content in human head and neck squamous 2002;62:233–40. carcinoma cells by sodium butyrate. Int J Cancer 1998; 75:217–24. 23. Fang G, Yu H, Kirschner MW. Direct binding of CDC20 protein 44. Ohannesian DW, Lotan D, Lotan R. Concomitant increases in family members activates the anaphase-promoting complex in mitosis galectin-1 and its glycoconjugate ligands (carcinoembryonic antigen, lamp-1, and lamp-2) in cultured human colon carcinoma cells by sodium and G1. Mol Cell 1998;2:163–71. butyrate. Cancer Res 1994;54:5992–6000. 24. Li D, Zhu J, Firozi PF, et al. Overexpression of oncogenic STK15/ BTAK/Aurora A kinase in human pancreatic cancer. Clin Cancer Res 45. Hittelet A, Legendre H, Nagy N, et al. Upregulation of galectins-1 2003;9:991–7. and -3 in human colon cancer and their role in regulating cell migration. 25. Singhal S, Amin KM, Kruklitis R, et al. Alterations in cell cycle Int J Cancer 2003;103:370–9. genes in early stage lung adenocarcinoma identified by expression 46. Berberat PO, Friess H, Wang L, et al. Comparative analysis of profiling. Cancer Biol Ther 2003;2:291–8. galectins in primary tumors and tumor metastasis in human pancreatic 26. Su AI, Welsh JB, Sapinoso LM, et al. Molecular classification of cancer. J Histochem Cytochem 2001;49:539–49. human carcinomas by use of gene expression signatures. Cancer Res 47. Schmidt LS, Warren MB, Nickerson ML, et al. Birt-Hogg-Dube 2001;61:7388–93. syndrome, a genodermatosis associated with spontaneous pneumothorax and kidney neoplasia, maps to chromosome 17p11.2. Am J Hum Genet 27. Makino K, Yu D, Hung MC. Transcriptional upregulation and 2001;69:876–82. activation of p55Cdc via p34(cdc2) in Taxol-induced apoptosis. Oncogene 2001;20:2537–43. 48. van Dartel M, Cornelissen PW, Redeker S, et al. Amplification of 28. Kao CT, Lin M, O’Shea-Greenfield A, Weinstein J, Sakamoto KM. 17p11.2 approximately p12, including PMP22, TOP3A, and MAPK7, in Over-expression of p55Cdc inhibits granulocyte differentiation and high-grade osteosarcoma. Cancer Genet Cytogenet 2002;139:91–6. accelerates apoptosis in myeloid cells. Oncogene 1996;13:1221–9. 49. Lau CC, Harris CP, Lu XY, et al. Frequent amplification and 29. Lin M, Mendoza M, Kane L, Weinstein J, Sakamoto KM. Analysis rearrangement of chromosomal bands 6p12-p21 and 17p11.2 in of cell death in myeloid cells inducibly expressing the cell cycle protein osteosarcoma. Genes Chromosomes Cancer 2004;39:11–21. p55Cdc. Exp Hematol 1998;26:1000–6. 50. van Dartel M, Leenstra S, Troost D, Hulsebos TJ. Infrequent but 30. Morris MC, Kaiser P, Rudyak S, Baskerville C, Watson MH, high-level amplification of 17p11.2 approximately p12 in human glioma. Cancer Genet Cytogenet 2003;140:162–6. Reed SI. Cks1-dependent proteasome recruitment and activation of CDC20 transcription in budding yeast. Nature 2003;424:1009–13. 51. Ochi H, Douglass HO Jr, Sandberg AA. Cytogenetic studies in 31. Wiley DJ, Marcus S, D’urso G, Verde F. Control of cell polarity in primary gastric cancer. Cancer Genet Cytogenet 1986;22:295–307. fission yeast by association of Orb6p kinase with the highly conserved 52. Semba S, Yokozaki H, Yasui W, Tahara E. Frequent microsatellite protein methyltransferase Skb1p. J Biol Chem 2003;278:25256–63. instability and loss of heterozygosity in the region including BRCA1 (171) in young patients with gastric cancer. Int J Oncol 1998;12: 32. Gilbreth M, Yang P, Bartholomeusz G, et al. Negative regulation of mitosis in fission yeast by the shk1 interacting protein skb1 and 1245–51. its human homolog, Skb1Hs. Proc Natl Acad Sci U S A 1998;95: 53. Kim B, Bang S, Lee S, et al. Expression profiling and subtype- 14781–6. specific expression of stomach cancer. Cancer Res 2003;63:8248–55. 33. Krapivinsky G, Pu W, Wickman K, Krapivinsky L, Clapham DE. 54. Tay ST, Leong SH, Yu K, et al. A combined comparative genomic pICln binds to a mammalian homolog of a yeast protein involved in hybridization and expression microarray analysis of gastric cancer regulation of cell morphology. J Biol Chem 1998;273:10811–4. reveals novel molecular subtypes. Cancer Res 2003;63:3309–16. 34. Bao S, Qyagng Y, Yang P, et al. The highly conserved protein 55. Boussioutas A, Li H, Liu J, et al. Distinctive patterns of gene methyltransferase, Skb1, is a mediator of hyperosmotic stress response expression in premalignant gastric mucosa and gastric cancer. Cancer in the fission yeast Schizosaccharomyces pombe. J Biol Chem 2001; Res 2003;63:2569–77. 276:14549–52. 56. Hasegawa S, FurukawaY, Li M, et al. Genome-wide analysis of 35. Kucherlapati M, Yang K, Kuraguchi M, et al. Haploinsufficiency of gene expression in intestinal-type gastric cancers using a complementary Flap endonuclease (Fen1) leads to rapid tumor progression. Proc Natl DNA microarray representing 23,040 genes. Cancer Res 2002;62: Acad Sci U S A 2002;99:9924–9. 7012–7. 36. Sato M, Girard L, Sekine I, et al. Increased expression and no 57. Inoue H, Matsuyama A, Mimori K, Ueo H, Mori M. Prognostic mutation of the Flap endonuclease (FEN1) gene in human lung cancer. score of gastric cancer determined by cDNA microarray. Clin Cancer Res Oncogene 2003;22:7243–6. 2002;8:3475–9. 37. Marinaki AM, Escuredo E, Duley JA, et al. Genetic basis of 58. Sakakura C, Hagiwara A, Nakanishi M, et al. Differential gene hemolytic anemia caused by pyrimidine 5V nucleotidase deficiency. expression profiles of gastric cancer cells established from primary Blood 2001;97:3327–32. tumour and malignant ascites. Br J Cancer 2002;87:1153–61. 38. Liquori CL, Ricker K, Moseley ML, et al. Myotonic dystrophy type 59. Chen X, Leung SY, Yuen ST, et al. Variation in gene expression 2 caused by a CCTG expansion in intron 1 of ZNF9. Science 2001; patterns in human gastric cancers. Mol Biol Cell 2003;14:3208–15. 293:864–7. 60. Meireles SI, Carvalho AF, Hirata R, et al. Differentially expressed 39. Cronshaw JM, Krutchinsky AN, Zhang W, Chait BT, Matunis MJ. genes in gastric tumors identified by cDNA array. Cancer Lett 2003; Proteomic analysis of the mammalian nuclear pore complex. J Cell Biol 190:199–211. 2002;158:915–27. 61. Naughton DP. Hypoxia-induced upregulation of the glycolytic 40. Huang G, Zhou S, Du H. Study on role of metallothionein in enzyme glucose-6-phosphate isomerase perpetuates rheumatoid arthritis. anticancer effect of copper green on treatment of experimental Med Hypotheses 2003;60:332–4.

Correction: Article on Identification of Gastric-Related Genes Using a cDNA Microarray

In the article on Identification of Gastric-Related Genes in the January 15, 2005 issue of Clinical Cancer Research, the name of an author, Hyang-Sook Yoo, was misspelled.

Kim JM, Sohn HY, Yoon SY, et al. Identification of gastric cancer-related genes using a cDNA microarray containing novel expressed sequence tags expressed in gastric cancer cells. Clin Cancer Res 2005:11:473–82.

www.aacrjournals.org3149 Clin Cancer Res 2005;11(8) April 15, 2005 Identification of Gastric Cancer−Related Genes Using a cDNA Microarray Containing Novel Expressed Sequence Tags Expressed in Gastric Cancer Cells

Jeong-Min Kim, Ho-Yong Sohn, Sun Young Yoon, et al.

Clin Cancer Res 2005;11:473-482.

Updated version Access the most recent version of this article at: http://clincancerres.aacrjournals.org/content/11/2/473

Cited articles This article cites 61 articles, 21 of which you can access for free at: http://clincancerres.aacrjournals.org/content/11/2/473.full#ref-list-1

Citing articles This article has been cited by 13 HighWire-hosted articles. Access the articles at: http://clincancerres.aacrjournals.org/content/11/2/473.full#related-urls

E-mail alerts Sign up to receive free email-alerts related to this article or journal.

Reprints and To order reprints of this article or to subscribe to the journal, contact the AACR Publications Subscriptions Department at [email protected].

Permissions To request permission to re-use all or part of this article, use this link http://clincancerres.aacrjournals.org/content/11/2/473. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC) Rightslink site.