THE USE OF A TISSUE ENGINEERED MEDIA EQUIVALENT IN

THE STUDY OF A NOVEL SMOOTH MUSCLE CELL

PHENOTYPE

A Dissertation Presented to The Academic Faculty

by

JoSette Leigh Briggs Broiles

In Partial Fulfillment of the Requirements for the Degree Doctor of Philosophy in Bioengineering

Georgia Institute of Technology April 2008

COPYRIGHT 2008 BY JOSETTE LEIGH BRIGGS BROILES

THE USE OF A TISSUE ENGINEERED MEDIA EQUIVALENT IN

THE STUDY OF A NOVEL SMOOTH MUSCLE CELL

PHENOTYPE

Approved by:

Dr. Robert M. Nerem, Advisor Dr. Thomas N. Wight School of Mechanical Engineering Hope Heart Program Georgia Institute of Technology Benaroya Research Institute at Virginia Mason Department of Pathology University of Washington

Dr. Raymond P. Vito Dr. Elliot Chaikof School of Mechanical Engineering Department of Biomedical Engineering Georgia Institute of Technology Georgia Institute of Technology and Emory University

Dr. W. Robert Taylor Department of Biomedical Engineering Georgia Institute of Technology and Emory University Date Approved: December 18, 2007

to Yvette Louise Briggs, the perfect example of a wife-mother-student

ACKNOWLEDGEMENTS

Before I proceed with my long list of thank-you’s, I must praise God for blessing

me with the opportunity to pursue a Ph.D. and surrounding me with wonderful people

that have encouraged me throughout this process.

My tenure at Georgia Tech has been quite a challenging voyage. This was the first

time I experienced repeated failures, was not at the top of the class, and not in complete

control of my fortune. I’ve often said that in high school I learned how to navigate social pressures and in undergrad I discovered the meaning of true friendship. But, it has been my graduate school experience that has taught me the most about myself. In the last 6.5 years, I’ve married my best friend and confidante, given birth to two beautiful boys, mourned the loss of nine loved ones, learned how to fail without being a failure, and became inspired to reach and teach others. These moments of joy and tests of faith have humbled me beyond explanation, mellowed my Type A personality, and put my life in proper perspective.

OK. Now that I’ve finished my testimony, I will begin my expressions of gratitude. I would like to thank Dr. Robert Nerem for welcoming me into his research lab and to his bottomless well of wisdom, advice, and optimism. I would also like to thank

Dr. Thomas Wight for readily providing his expertise and encouragement. Thank you to the members of my committee, Drs. Elliot Chaikof, W. Robert Taylor, and Raymond

Vito, for your research direction. I would also like to acknowledge my sources of funding: the National Science Foundation, The National Consortium for Graduate

Degrees for Minorities in Engineering and Science, Inc. (GEM), Facilitating Academic

- iv - - iv - Careers in Engineering and Science (FACES) Fellowship, George Family Foundation, and the Georgia Tech/Emory Center for the Engineering of Living Tissues.

To the Nerem lab members, past and present, thank you for the hundreds of hours of stimulating as well as mindless conversation. Special thanks to Steve Woodard, Dr.

Tabassum Ahsan, and Stacey Schutte for the brainstorming sessions and discussions about life philosophies. I would be remiss if I did not acknowledge the hardworking

IBB/GTEC staff. I must thank Tracey Couse, Aqua Asberry, Jonafel Crowe, Lisa Cox,

Kathy Huggins, Chris Ruffin, and Gloria at the Petit Café’ for your assistance with histology, training on core equipment, the last minute acquisition of signatures, student advisement, administrative assistance, and the hot cups of chicken noodle soup!

If it weren’t for my network of Georgia Tech friends, I probably would have made good on one of my many threats to quit school. To Dr. Lori Lowder, Dr. Onyi

Irrechukwu, Ima Ebong, Dr. Manu Platt, Drs. Brian and Annica Wayman, and Lola

Brown, I say a resounding THANK YOU for your friendship and patient ears. Thanks for providing motivation when I felt incompetent after a botched experiment. Thanks for the distractions when I really should have been working. HA!

I’d also like to thank Dr. Gilda Barabino, Dr. Andrew Williams, and Dr. Felicia

Benton-Johnson for your mentorship. Your visibility as African American PhDs has inspired me and many others. To my church family and Delta sorors, thanks for providing a balance in my life. Special thanks go to Cindy (Snow) Walker, childcare extraordinaire.

You are truly gifted when it comes to working with children. I want to thank your for giving me the peace of mind knowing that Winston was in capable, loving hands while I kept long hours at school. I must thank my sisters Michelle Omari, Crystal Johnson, and

v Brandy Nolan. Even though I don’t keep in touch like I should, I know that you “have my

back” and will be available whenever I need you. Thanks for being such great and

understanding friends.

To my extended family, thank you for your prayers and phone calls. Thank you

for the road trips to Atlanta and hot plates of mashed potatoes and macaroni-and-cheese

awaiting my return home. Thanks for bragging on me even if you don’t know what I do

exactly.

Finally, I conclude by thanking the most important people in my life. To my dad and brother, Joseph and Jarret Briggs, thanks for your prayers, support and the semiannual marathon phone calls to convince me that all of this is worth it. To my sons,

Winston and Solomon, you bring me immense joy and you are my motivation to do better and be better. Damon, you have always been my biggest cheerleader. From the day I

received my acceptance letter to those long days and nights I slaved at my laptop writing

this dissertation, you have been my rock! I love you more than words could convey. To

my mother, Yvette Louise Briggs, even though you are absent in body, I continue to carry

your spirit with me. Everyday I strive to emulate you by excelling in my roles as a

Christian wife, mother, and servant.

vi TABLE OF CONTENTS

Page

ACKNOWLEDGEMENTS iv

LIST OF FIGURES ix

LIST OF ABBREVIATIONS xii

SUMMARY xv

CHAPTER

1 INTRODUCTION 1

Motivation 1

Hypothesis and Specific Aims 3

Significance 4

2 BACKGROUND 5

Arterial Physiology 5

Smooth Muscle Cells 8

Medial Extracellular Matrix 9

Tissue Engineered Blood Vessels 19

3 EXTRACELLULAR MATRIX ARCHITECTURE AND COMPOSITION INFLUENCE TROPOELASTIN EXPRESSION IN SMOOTH MUSCLE CELLS THAT OVEREXPRESS VERSICAN V3 26

Introduction 26

Materials and Methods 28

Results 39

Discussion 64

vii 4 TROPOELASTIN SYNTHESIS BY SMOOTH MUSCLE CELLS THAT OVEREXPRESS V3 VERSICAN IS SENSITIVE TO STIMULATION BY MEDIUM ADDITIVES 68

Introduction 68

Materials and Methods 69

Results 76

Discussion 100

5 MECHANICAL STIMULATION INCREASES TROPOELASTIN SYNTHESIS BY VERSICAN V3 OVEREXPRESSING SMOOTH MUSCLE CELLS IN TISSUE ENGINEERED MEDIA EQUIVALENTS 104

Introduction 104

Materials and Methods 105

Results 115

Discussion 127

6 CONCLUSION AND RECOMMENDATIONS 132

APPENDIX A: SELECTED PROTOCOLS 139

Preparation of Type I Collagen Media Equivalents 140

Preparation of Fibrin Media Equivalents 141

Mechanical Stimulation of Tissue Engineered Media Equivalents 142

Intracellular Staining for Flow Cytometry 144

RNA Isolation from Media Equivalents 146

cDNA Synthesis for Quantitative RT-PCR 148

REFERENCES 150

VITA

viii LIST OF FIGURES

Page

Figure 2.1: Anatomy of the artery 6

Figure 2.2: Forces exerted within the blood vessel 7

Figure 2.3: Elastic fiber conformation 11

Figure 2.4: Elastin binding protein chaperones tropoelastin to the extracellular space 13

Figure 2.5: Tropoelastin incorporation into elastic fibers 14

Figure 2.6: Structure of versican isoforms 17

Figure 3.1: Schematic of TEME fabrication 31

Figure 3.2: Light microscopy images of LXSN and LV3SN cells 40

Figure 3.3: Confocal imaging of intracellular tropoelastin. 41

Figure 3.4: Disk shaped collagen and fibrin TEMEs have distinct appearances 43

Figure 3.5: Compaction of collagen TEMEs 44

Figure 3.6: Compaction of fibrin TEMEs 44

Figure 3.7: Modified Movat’s Pentachrome staining of collagen TEMEs 45

Figure 3.8: Orcein staining of collagen TEMEs 46

Figure 3.9: Immunohistochemical staining for tropoelastin in collagen TEMEs 47

Figure 3.10: Versican and tropoelastin gene expression varies with matrix structure and composition after one day in culture 50

Figure 3.11: Versican and tropoelastin gene expression varies with matrix structure and composition after seven days in culture 51

Figure 3.12: LXSN and LV3SN cells contain equal amounts of DNA per cell 52

Figure 3.13: DNA content in collagen TEMEs 54

Figure 3.14: DNA content in fibrin TEMEs 54

Figure 3.15: Changes in LXSN DNA content relative to matrix type 55

ix Figure 3.16: Changes in LV3SN DNA content relative to matrix type. 55

Figure 3.17: Western analysis of tropoelastin protein expression in whole lysates of cell monolayers, collagen TEMEs and fibrin TEMEs 58

Figure 3.18: Western analysis of tropoelastin secreted into the spent media of monolayer, collagen TEMEs, and fibrin TEMEs cultures 58

Figure 3.19: Flow cytometry assessment of versican and tropoelastin in monolayers 60

Figure 3.20: Flow cytometry assessment of versican and tropoelastin in collagen TEMEs 61

Figure 3.21: Flow cytometry assessment of versican and tropoelastin in fibrin TEMEs 62

Figure 4.1: Experimental timeline for stimulation with medium additives 71

Figure 4.2: Light microscopy of monolayers after one day of chondroitin sulfate and chondroitinase stimulation 77

Figure 4.3: Light microscopy of monolayers after one day of TGF-β1 stimulation. 78

Figure 4.4: DNA content in TEMEs after one day of exposure to medium additives 80

Figure 4.5: DNA content in TEMEs after seven days of exposure to medium additives 80

Figure 4.6: Versican gene expression in monolayers after one day of exposure to medium additives 82

Figure 4.7: Tropoelastin gene expression in monolayers after one day of exposure to medium additives 83

Figure 4.8: Confocal microscopy of intracellular tropoelastin in LV3SN monolayers treated with medium additives. 85

Figure 4.9: Orcein staining of LXSN TEMEs after one of stimulation with medium additives 88

Figure 4.10: Orcein staining of LV3SN TEMEs after one day of stimulation with medium additives 89

Figure 4.11: Orcein staining of TEMEs after 7 days of stimulation with medium additives 90

Figure 4.12: Histograms of versican protein content as determined by flow cytometry 92

Figure 4.13: Histograms of tropoelastin protein content as determined by flow cytometry 93

x Figure 4.14: Flow cytometry quantitation of tropoelastin protein expression in monolayers after one day of stimulation with medium additives 96

Figure 4.15: Flow cytometry quantitation of tropoelastin protein expression in TEMEs after one day stimulation with medium additives 97

Figure 4.16: Flow cytometry of protein expression in monolayers after seven days of stimulation with medium additives 98

Figure 4.17: Flow cytometry of protein expression in collagen TEMEs after seven days of stimulation with medium additives 99

Figure 5.1: Schematic of tubular TEMEs fabrication for mechanical stimulation 107

Figure 5.2: Bioreactor setup and mechanical stimulation timeline 109

Figure 5.3: Mechanical stimulation increases TEME compaction. 115

Figure 5.4: Live/Dead viability staining of TEMEs with and without mechanical stimulation 117

Figure 5.5: Hematoxylin and eosin staining of TEMEs with and without mechanical stimulation 117

Figure 5.6: DNA content in TEMEs after seven days of mechanical stimulation 119

Figure 5.7: Versican gene expression after seven days of mechanical stimulation 121

Figure 5.8: Tropoelastin gene expression after seven days of mechanical stimulation 121

Figure 5.9: Flow cytometry for versican protein expression after seven days of mechanical stimulation 124

Figure 5.10: Flow cytometry for tropoelastin protein expression after seven days of mechanical stimulation 125

Figure 5.11: Accumulation of tropoelastin in spent media after mechanical stimulation 126

xi LIST OF ABBREVIATIONS

2-D Two Dimensional

3-D Three Dimensional

ACA Amino Caproic Acid

ANOVA Analysis of Variance

BSA Bovine Serum Albumin

cDNA complementary Deoxyribonucleic Acid

CRP Complement-regulatory Protein

CSPG Chondroitin Sulfate Proteoglycan

CVD Cardiovascular Disease

DMEM Dulbecco’s Modified Eagle Medium

DMSO Dimethyl Sulfoxide

DNA Deoxyribonucleic Acid

DNase Deoxyribonuclease

DSPG Dermatan Sulfate Proteoglycan

EBP Elastin Binding Protein

ECM Extracellular Matrix

EDTA Ethylenediamine-tetraacetic Acid

EGF Epidermal Growth Factor

FBS Fetal Bovine Serum

FITC Fluorescein isothiocyanate

GAG Glycosaminoglycan

H2SO4 Sulfuric Acid

xii HBSS Hanks’ Balanced Salt Solution

HSPG Heparan Sulfate Proteoglycan

Hz Hertz

IGF-1 Insulin-like Growth Factor-1

IHC Immunohistochemistry

IL-1 Interleukin-1-beta

LV3SN Versican V3 Overexpressing Smooth Muscle Cell

LXSN Empty Vector Control Cell

ng nanogram

MAGP Microfibril-associated Glycoprotein

mL milliliter

mRNA messenger Ribonucleic Acid

MW Molecular Weight

NaCl Sodium Chloride

NaOH Sodium Hydroxide

PBS Phosphate Buffered Saline

PDGF Plate Derived Growth Factor

PGA Polyglycolic Acid

PLA Polylactone Acid

PLCL Poly(lactide-co-caprolactone)

PSI Pounds Per Square Inch

RASMC Rat Arterial Smooth Muscle Cell

RIPA Radioimmunoprecipitation Assay

RNA Ribonucleic Acid

RNase Ribonuclease

xiii RT Room Temperature

RT-PCR Reverse Transcriptase Polymerase Chain Reaction

RXN Reaction

SDS Sodium Dodecyl Sulfate

SEM Standard Error of the Mean

SIS Small Intestinal Submucosa

SMC Smooth Muscle Cell

TEBV Tissue Engineered Blood Vessel

TEM Transmission Electron Microscopy

TEME Tissue Engineered Media Equivalent

TGF-β1 Transforming Growth Factor Beta-1

T-PBS Phosphate Buffer Saline with Tween

VEGF Vascular Endothelial Growth Factor

µL Microliter

xiv SUMMARY

An increase in coronary disease prevalence and mortality highlights the growing need for therapies to treat atherosclerotic vessels. While current bypass procedures utilize autologous vessels for small caliber grafts, there is a big push towards the use of engineered tissues to bypass diseased portions of arteries. Cardiovascular tissue engineering is the emerging discipline that aims to create a functional substitute. Ideally, a tissue engineered blood vessel would possess the relevant cells and matrix proteins that interact in a physiologic manner and will respond to the environmental cues of the host.

A particular obstacle to achieving appropriate vessel structure is the inclusion of elastin in a tissue engineered media equivalent. Rat arterial smooth muscle cells that were retrovirally mediated to overexpress versican V3 have been shown to have an enhanced expression of tropoelastin in vitro as well as in injury models. The unique tropoelastin expression by these adult cells was studied in the context of tissue engineered media equivalents. Changes to the extracellular matrix architecture and composition, stimulation with medium additives, and cyclic distension, were shown to increase tropoelastin synthesis in V3 versican overexpressing cells. This study not only expanded the characterization of V3 versican overexpressing smooth muscle cells, it also explored the novel use of these cells as a tropoelastin source in a tissue engineered media equivalent.

xv CHAPTER 1

INTRODUCTION

1.1 Motivation

Cardiovascular disease (CVD) is the broad term used to describe a class of

diseases that affect the heart and blood vessels. The most common condition associated

with this broad term is atherosclerosis. Atherosclerosis is the slow, progressive

thickening and hardening of arteries caused by lipid accumulation in the vessel wall. This

condition may begin in early adulthood and culminates with vessel occlusion that

obstructs blood flow and eventually inhibits oxygen and nutrient transport to the

surrounding tissues. If this obstruction occurs in the coronary arteries, the vessels that nourish the heart muscle, a myocardial infarction may result.

In 2004, 79.4 million Americans had one or more forms of cardiovascular

disease.[1] Also during 2004, 1 of every 2.8 American deaths could be attributed to

CVD. This health concern is not only significant in developed countries, but is also

emerging as significant in the developing world. This year an estimated 1.2 million

Americans will encounter a “new or recurrent coronary attack caused by restricted

blood flow to the heart.[1] Current treatments for coronary blockages include

angioplasty, stent placement, and bypass grafting.

One future therapy is the use of a biologically-based graft for small diameter blood

vessel replacement. A purely biological graft could be used to bypass diseased portions

of an artery while having the ability to be remodeled by the host. Tissue engineering is an

emerging discipline being utilized to create such a vessel.

- 1 - In order to create a compositionally accurate arterial model in vitro, the medial component of tissue engineered blood vessels (TEBV) must contain the extracellular matrix (ECM) protein elastin, which is responsible for the vessel’s ability to elastically recoil. There have been many methods used to incorporate elastin into TEBVs. However, the ultimate challenge is to have adult smooth muscle cells (SMCs) synthesize and remodel elastin endogenously. Rat arterial smooth muscle cells that have been retrovirally transduced to overexpress the V3 isoform of versican were obtained through collaboration with Dr. Thomas Wight. The overexpression of V3 versican consequently increased synthesis of tropoelastin.[2] It is the hypothesis of this project that manipulation of the extracellular environment will further expand the characterization of these cells and provide a novel method to incorporate endogenous tropoelastin into a tissue engineered media equivalent.

The focus of this work is to enhance the compositional and structural properties of a tissue engineered media equivalent. This research builds upon the work of Dr. Tom

Wight and his colleagues who employed genetically modified smooth muscle cells to produce and assemble tropoelastin, a precursor to the extracellular matrix protein elastin.

Rat arterial smooth muscle cells transduced to overexpress the V3 isoform of versican have been shown to have an enhanced expression of tropoelastin in vitro as well as in

vivo in injury models. This work explored the influence of extracellular matrix

composition, medium additives, and mechanical stimulation on the expression of

tropoelastin by cells that overexpress V3 versican (LV3SN). This study described the

effect of three-dimensional (3D) culture conditions on tropoelastin synthesis by these

cells in the context of tissue engineered media equivalents.

- 2 - 1.2 Hypothesis and Specific Aims

The central hypothesis of this dissertation is that use of versican V3 overexpressing smooth muscle cells (LV3SN cells) will increase the amount of tropoelastin available for endogenous elastic fiber formation in tissue engineered media equivalents. This hypothesis will be explored by investigating the following specific aims.

Specific Aim 1

Specific Aim: Investigate the influence of substrate architecture and matrix

proteins on tropoelastin synthesis.

Working Hypothesis: Substrate architecture and biologic matrix proteins will

alter proliferation as well as tropoelastin gene and protein expressions by LV3SN

cells.

Specific Aim 2

Specific Aim: Investigate the influence of medium additives on the production of

tropoelastin.

Working Hypothesis: The introduction of additives to the culture medium will

affect tropoelastin synthesis.

Specific Aim 3

Specific Aim: Determine the effect of mechanical stimulation on tropoelastin

production.

Working Hypothesis: Mechanical stimulation will enhance tropoelastin

synthesis.

- 3 - 1.3 Significance

Previous studies conducted by the Wight group have shown the appeal of LV3SN cells in vascular biology research. The data generated from the following work will further expand the utility of these genetically modified cells in the field of tissue engineering. By determining the effects of culturing LV3SN cells in a three-dimensional environment, an improved understanding of the elastogenic phenotype of LV3SN cells can be achieved. This development will serve as a beneficial in vitro tool for vascular biology research and lead to a more physiologic blood vessel substitute.

- 4 - CHAPTER 2

BACKGROUND

2.1 Arterial Physiology

Arteries are the conduits through which oxygenated blood is pumped from the heart to tissues throughout the body. The anatomy of an artery consists of three primary layers; the tunica intima, tunica media, tunica adventitia (refer to figure 2.1). Each layer contains different cell and matrix components that provide a unique function. However, the constituent ratios within each layer vary with respect to the vessel’s size and proximity to the heart.

In general, the tunica intima contains a monolayer of endothelial cells on a basement membrane of elastin, laminin, and Type IV collagen. In response to normal and shear forces throughout the lumen, endothelial cells regulate vessel patency and tone, secretion of growth factors and other regulatory molecules, as well as lipid accumulation.

These cells serve as a permeability barrier and signal mediators between the blood and the smooth muscle cells (SMC) that occupy the layer below.[3-10]

The tunica media is the thickest layer which gives the blood vessel its tone. It is composed of concentric layers of smooth muscle cells which are enveloped in a matrix of

Type I and Type III collagens, wavy elastic lamellae, and numerous proteoglycans.

SMCs actively respond to alterations in wall strain while interacting with the endothelium and surrounding extracellular proteins via gap junctions and integrins to control vasoconstriction and dilation and matrix synthesis.[10-25]

- 5 - The outer most layer, the adventitia, is a loose assembly of Type I and Type III collagens and fibroblasts that tether the vessel to surrounding tissues and provides longitudinal tension. Until recently, the adventitia was believed to be a passive layer of the blood vessel. Adventitial fibroblasts have been seen in neointimal formations[26] and exaggerated collagen deposition has resulted in hypertension[27]. In vessels of greater size, vasa vasorum and nerves also reside in this layer.[28]

Tunica Intima

Basement Membrane & Internal Elastic Lamina

Tunica Media

Tunica Adventitia

Figure 2.1. Anatomy of the artery. Adapted from Fox, S.I. Human Physiology, 4th Ed., Wm. C. Brown Publishers.

As the heart pumps blood through the vascular tree, a number of forces are applied to the vessel wall. The propagation of pressure through the vessel creates both circumferential and longitudinal stresses and cyclic strains through the wall thickness in

- 6 - addition to shear stress across the endothelial monolayer (see figures 2.2).[7, 29] Arteries must be able to endure a wide magnitude of cyclic pressures and strains. The ultimate

tensile stress experienced by an artery can range between 1.72MPa and 3.64MPa.

[30]These vessels are also able to withstand between 2700mmHg and 5000mmHg burst

pressure depending upon the size of the vessel. [30]

Changes in strain profiles within vessels can lead to morphologic and phenotypic

adaptations throughout the wall leading to pathological conditions like atherosclerosis. In

areas of oscillatory or turbulent shear flow, endothelial cells misalign and permit the

deposition of lipids in the subintimal space.[3-5, 7, 10, 31] This can trigger a cascade of

events that can lead to atherosclerotic plaque buildup, thrombus formation, vessel

hardening, lumen occlusion and an eventual ischemic event and tissue death.

Longitudinal Longitudinal Normal Shear

Figure 2.2. Forces exerted within the blood vessel. Blood vessels experience longitudinal, normal and shear forces due to the pulsatile nature of blood flow through the lumen.

- 7 - 2.2 Smooth Muscle Cells

In vivo smooth muscle cells are surrounded by collagen types I and III, elastin, proteoglycans, and other glycoproteins.[32] They are responsible for synthesizing and remodeling these extracellular proteins. In response to dynamic environmental cues,

SMCs experience an increase in communication with the endothelial cells and sensitivity to vasoactive medium additives that initiate vascular dilation and contraction.[4, 10, 29,

32, 33]

Since smooth muscle cells do not terminally differentiate, two distinct phenotypes are frequently used to describe smooth muscle cell behavior during various stages of vasculogenesis, injury, or pathological development. During times of development and remodeling, SMCs are described as having a synthetic phenotype. The shape of the cell is irregular and increased amounts of ECM proteins are synthesized and secreted to develop and strengthen the vessel. As the tissue matures, the SMC differentiates into a contractile phenotype. In this condition, the cell shape becomes elongated and spindly and a contractile apparatus is developed. This apparatus consists of specialized contractile proteins such as calponin, myosin light chain kinase and the actin-myosin bundles that

enable the cell to perform their main function; contraction and dilation.[18, 19, 34, 35]

Also in this differentiated state, proliferation and secretion of ECM proteins

diminish.[32] At sites of injury or early pathogenesis, SMCs dedifferentiate to

quasisynthetic phenotype of increased migration, proliferation, and protein synthesis.[14,

19, 33, 36]

Once SMCs are removed from native tissue and expanded on culture dishes, the

phenotype returns to that of the synthetic state.[18, 19, 35] A confluent monolayer of

- 8 - SMCs has the appearance of a hill and valley topography.[37] When embedded in a hydrated collagen lattice, SMCs exhibit traits of both contractile and synthetic phenotypes (i.e. decreased cell proliferation and matrix synthesis together with reduced expression of phenotypic contractile markers).[35, 38-44] Also, it should be noted that phenotypic differences (i.e. integrin expression, cell proliferation, etc.) exists between smooth muscle cells isolated from various regions in the vascular tree.[13]

2.3 Medial Extracellular Matrix

The extracellular matrix is the scaffold in which cells reside, remodel, and

synthesize to provide stability in the tissue. It has been repeatedly demonstrated that cell

phenotype and morphology are greatly influenced by the extracellular matrix composition

and organization. Previous studies have observed significant differences in morphology

and phenotype when smooth muscle cells are offered a three-dimensional scaffold versus

a monolayer culture system.[38, 40, 45]

2.3.1 Structure

Vessel walls contain types I, III, and IV collagens, elastin, proteoglycans, and

other small molecular weight proteins. Matrix fibers (collagen and elastin) are surrounded

by water and ground substance (glycoproteins, glycosaminoglycans,

proteoglycans).[46]The content of each of these depend upon the vessel type, location

with in the vessel wall, and distance from the aortic arch.[47] The viscoelastic nature of

arterial ECM can be attributed to the collagen, elastin, and proteoglycans which provide

tensile stiffness, elasticity and compressibility, respectively.[17, 48-54] The behavior of

- 9 - most soft tissues under small applied forces is modulated by elastic fibers and interfibrillar matrix constituents while collagen fibers reduce plastic deformation and prevent tissue failure.[47]

2.3.2 Collagen

The most abundant protein in the animal kingdom is collagen. It is a triple helical structure made up of two α1(Ι) polypeptide chains and a single α2(Ι) polypeptide chain containing Gly-X-Y repeating motifs.[17, 45, 55] Collagen is able to self-assemble into hydrated lattices in the absence of cells if the temperature is raised above 370C or by the

simultaneous increase in pH and ionic strength.[46, 56, 57] Fibrillar Type I collagen provides the necessary tensile strength to withstand luminal pressure and longitudinal

strains. The presence and structure of collagen also influences the function of numerous

cells. [38, 45, 46, 51, 58-61]

2.3.3 Elastin

Elastic fibers are believed to be the energy storage units in the blood vessel

wall.[54, 62]Concentric waves of elastic fibers provide the vessel with the compliance

and viscoelasticity necessary to resist plastic deformation caused by arterial blood

pressure.[50, 63, 64] The fibers are comprised of two parts, an amorphous core of elastin protein encased by a sheath of microfibrils. [50, 65, 66] Figure 2.3 shows the structure of an elastic fiber.

- 10 - Elastic fibers with microfibrils and elastin

Elastic fibers composed of:

Microfibri

Microfibrils : Tropoelastin Fibrillin 1 & 2

Tropoelastin monomer

Figure 2.3 Elastic fiber composition. Elastic fibers are composed of amorphous, crosslinked tropoelastin monomers and microfibril associated glycoproteins (MAGPs) encased by fibrillin based microfibrils. Illustration is modified from www.unifr.ch/histologie.

“Elastin is the most linearly elastic biosolid material known”.[67] It is an extremely stable, hydrophobic protein that must be able to stretch and recoil more than a billion times in a lifespan.[50, 68, 69] Elastin is able to retain its elastic properties up to

140% strain.[70] It makes up 50% of the dry weight in large arteries and is responsible for mechanics at low strains before collagen fibers are aligned and engaged. [50, 68, 71].

Elastin, “newly evolved protein”, only exists in vertebrates and has a half-life of seventy years. [68, 70, 72-74]

2.3.3.1 Elastogenesis

Elastin is believed to be produced during the final stages of fetal development and

during the perinatal period.[50, 71, 75-78]However more recent studies have shown

- 11 - mRNA expression for the elastin precursor, tropoelastin, early in chick embryo development.[79-81] In humans, the gene to synthesize tropoelastin is turned off at puberty.

Tropoelastin transcription and elastin formation increases once smooth muscle cells exit the proliferative phase.[33] The 72kD soluble elastin precursor has alternating hydrophobic and crosslinking domains.[34, 50, 65, 82-87] Seventy-five percent of the peptide is composed of the hydrophobic sequence Val-Gly-Val-Ala-Pro-Gly.[23, 64, 68,

88] Tropoelastin monomers are synthesized in the rough endoplasmic reticulum and undergo very little posttranslational modifications.[68, 89] Interestingly, tropoelastin is not glycosylated. [72] It takes approximately 20 minutes for protein synthesis and expression.[50, 64] However, tropoelastin is metabolized quickly whereas the mature elastin molecule is highly insoluble and very stable.

Tropoelastin monomers must be chaperoned through the cytoplasm to the extracellular environment where it is deposited on a microfibril template, aligned and crosslinked to form insoluble elastin.[74, 90-92] The elastin binding protein (EBP) is a

67kD inactive variant of β-galactosidase that binds to the hydrophobic domain,

VGVAPG, on tropoelastin.[89, 93-95]Its role is to protect tropoelastin from intracellular proteolysis as well as chaperone the protein to the extracellular environment. Once the tropoelastin-bound EBP reaches the cell membrane, it complexes with 55kD and 61kD receptor subunits. Galactolectins then interact with EBP, changing its conformation to release tropoelastin to the extracellular space (figure 2.4).

- 12 - 55kD A. 61kD Plasma Membrane

TE Cytoplasm EBP

Nucleus

B. Sugar

TE EBP

55kD 61kD Plasma Membrane

Cytoplasm

TE C. Sugar

EBP

55kD 61kD Plasma Membrane

Cytoplasm

Figure 2.4 Elastin binding protein chaperones tropoelastin to the extracellular space. (A) Elastin binding protein (EBP; black) protects tropoelastin (TE; blue) from intracellular proteolysis and (B) chaperones it the cell surface where it complexes with two membrane bound receptor subunits. (C) Once galactolectin (sugar; red) binds to EBP, the conformation changes and tropoelastin is released to the extracellular space.

- 13 - It has been proposed that fibulins then guide tropoelastin to microfibrils. Fibulin-

1, fibulin-2, and fibulin-5 have all been found in tissues rich with elastic-fibers and

shown to interact with tropoelastin.[63, 96, 97] Specifically, fibulin-5, also known as

DANCE, has been shown to bind directly to tropoelastin as well as bridge cells and

elastic fibers.[91, 96, 98-100] Yet, it does not bind to microfibrillar proteins.[63, 91, 96,

99] Figure 2.5 shows the mechanism proposed by Midwood and Schwarzbauer.[98]

Elastic Fiber

Microfibril

Fibulin-5 TE

EBP Complex

Plasma Membrane

Cytoplasm

Figure 2.5 Tropoelastin incorporation into elastic fibers. After being released from the EBP complex, fibulin-5 escorts tropoelastin (TE) to nearby microfibrils. The microfibril acts as a template to align the tropoelastin monomers for proper crosslinking. The crosslinked protein is now termed elastin and forms the amorphous core of the elastic fiber.

- 14 - The influence of microfibrillar proteins and microfibril-associated glycoproteins

(MAGP) on elastic fiber development has been investigated thoroughly.[34, 63, 66, 70,

74, 76, 86, 87, 91, 93, 96, 98, 99, 101-107] Microfibrils are made up of fibrillin-1 and

fibrillin-2 and have diameters between 10- and 12-nm.[34, 72, 74, 104] Microfibrils

evolved before elastin and assemble independent of tropoelastin.[47, 69, 90, 97, 107] In

the earliest stages of elastic fiber formation, microfibrillar proteins accumulate near the

cell surface. [90] Once microfibrils are present, tropoelastin assembly occur without the

presence of cells.[68, 83]

Microfibrils are believed to assist in the alignment of tropoelastin monomers to

enable efficient crosslinking.[50, 76, 86, 102, 103] Amine groups on four lysine residues

become oxidized by copper-dependent lysyl oxidase forming cross-links between

adjacent tropoelastin monomers.[20, 50, 74, 108]The lysine derived crosslink groups,

desmosine and isodesmosine, are able to link up to four elastin molecules. These amino

acids, unique to mature elastin, are often used for elastin detection. [47, 72, 108, 109]

Several soluble factors modulate elastin synthesis. They include, but are not

limited to, transforming growth factor-beta-1 (TGF-β1), aldosterone, insulin-like growth

factor-1 (IGF-1), interleukin-1-beta (IL-1β), epidermal growth factor (EGF), and

minoxidil. [20, 24, 42, 99, 110-116]

Elastin peptides are also capable of stimulating biological activity.[68, 117, 118]

Elastin associates with the cell surface via an elastin-laminin receptor.[48, 82, 89, 94, 95,

119-121] Yet, additional receptors, like G protein-couple receptor(s)[118],

elastonectin[122], and integrin αvβ3[123], have been proposed to interact with elastin.[124] Upon binding to these surface receptors, elastin fragments influence

- 15 - tropoelastin synthesis, arterial smooth muscle cell proliferation, and matrix protease activity. [33, 68, 82, 91, 96, 121, 124, 125]

2.3.4 Proteoglycans

Proteoglycans are high molecular weight macromolecules comprised of a glycoprotein core decorated with hydrophilic glycosaminoglycan (GAG) side chains.[9,

47, 126, 127] They are especially hydrated and provide much of the ECM volume.

Proteoglycans also permit small molecule diffusion between cells and the surrounding matrix while enabling the tissue to resist compression. Proteoglycans are also referred to

as hormone reservoirs because they are able to bind hormones to cell-surface receptors

and initiate intracellular signaling cascades.[55]

Three of the four families of proteoglycans are found in the vasculature:

chondroitin sulfate proteoglycans (CSPGs), heparan sulfate proteoglycans (HSPGs), and

dermatan sulfate proteoglycans (DSPGs). Some common proteoglycans found in arterial

walls include biglycan, decorin, syndecan, perlecan and versican.[9, 126] These

proteoglycans influence collagen fibril diameter[9, 128], cell proliferation and

migration[126, 127, 129-131], as well as receptor-ligand binding affinity [2, 94, 95, 119,

120, 129]. Additionally, proteoglycan synthesis has been shown to increase in the early

stages of atherosclerosis and then attenuate as the disease progresses.[9, 17, 53, 127]

2.3.4.1 Versican

Versican (also known as PG-M and CSPG2) is a chondroitin sulfate proteoglycan

that is prevalent in blood vessels and localized to the smooth muscle cell surface and

- 16 - present in the extracellular matrix.[9, 131, 132] It binds hyaluronan thru the amino- terminal globular domain (G1) called the hyaluronan-binding region (HABR). The carboxy-terminus (G3) contains epidermal growth factor (EGF)–like, lectin-like, and complement-regulatory protein (CRP)-like domains. Between the G1 and G3 domains there is a protein core with two chondroitin sulfate (CS) binding subunits.[126, 127]

There are several splice variants with differing lengths in the CS binding domains as illustrated in figure 2.6. The V0 variant contains both αGAG and βGAG exons. The V1

variant contains the only the βGAG exon while the V2 variant contains only the αGAG

exon.[133] However, it should be noted that rat smooth muscle cells do not express the

V2 isoform.[127] The V3 variant does not contain any GAG binding domains. It has been

classified as a glycoprotein with just the G1 and G3 domains.[15, 120, 126, 127, 130,

133]

V0

V1 V2

V3

Hyaluronan Figure 2.6 Structure of versican isoforms. Each of the four splice variants of versican bind to hyaluronan via a hyaluronan binding region (G1). G1 domain (red), G3 domain (blue), αGAG (gold), βGAG (green), chondroitin sulfate (purple).

- 17 - Dr. Tom Wight and his colleagues have conducted extensive research on various isoforms of this CSPG.[126, 127] Male Fischer 344 rat arterial smooth muscle cells have been retrovirally transduced by the Wight lab to overexpress the V3 isoform. (Reference

131 outlines the transduction protocol) Morphological and phenotypical changes due to this overexpression include a thinner pericellular coat, increased cell spreading and adhesion, slower proliferation, and decreased migration.[2, 17, 126, 127, 130, 131, 133]

Interestingly, an increase in tropoelastin mRNA and protein has been also observed in these cells. [2, 120] This upregulation is due to the absence of the CS side chains.[94, 95]

Chondroitin sulfate is a negatively charged β-galactosugar moiety that interacts with a galactolectin domain on EBP. [127, 130, 131] This interaction changes the EBP conformation and consequently causes detachment from the cell surface, lowering the binding affinity for elastin, and ultimately disrupts elastic fiber assembly.[82, 89, 93-95,

119, 120] EBP’s propensity towards shedding in the presence of chondroitin sulfate may also diminish its capability to recycle as a tropoelastin chaperone.[82, 89, 94, 95, 119]

Chondroitin sulfate proteoglycans have also been suggested to play a role in microfibril assembly. There is data suggesting that versican contributes to elastic fiber formation. Versican has been shown to interact with elastic fibers in skin. It has also been shown to colocalize with microfibrils by directly interacting with fibulin-1, fibulin-2, and fibrillins. [106, 126, 134]

- 18 - 2.4 Tissue Engineered Blood Vessels

In 1988, the phrase “tissue engineering” was adopted to define the applications of engineering and life science toward understanding the structure-function relationships in normal and pathological tissues and the development of replacement tissues.[135]

Engineered tissues have been used for the replacement of skin, cartilage, blood vessels, and ligaments.[8, 44, 136-138]

The use of grafts to circumvent occluded regions of the coronary artery and restore oxygen and nutrients to ischemic heart tissue has become a common surgical practice. Bypass procedures for small caliber vessels have predominantly relied upon autologous vessels like internal mammary arteries and saphenous veins. [139] However, several drawbacks exist with the use of these autologous vessels. Donor site discomfort and limited availability due to disease or previous removal necessitate engineered vessels as a alternative technology.[41, 48, 140]

One of the first tissue engineered blood vessels was developed by Weinberg and

Bell. In their model, collagen gel layers were interspersed with vascular cells and supported with a Dacron mesh.[8] Currently three prevailing models are used to fabricate tissue engineered blood vessels (TEBVs). The hydrogel method first employed by

Weinberg and Bell continues to be used. Vascular cells are incorporated into hydrated biopolymer solutions and become entrapped during fibrillogenesis.[8] Another technique utilizes the self assembly approach where cells grown in monolayers generate their own matrix proteins. In this model, smooth muscle cells and fibroblasts are stimulated with ascorbate in order to secrete elevated amounts of collagen until cell-derived tissue sheets are formed and can be wrapped around a mandrel to form a tubular structure.[6, 137, 141]

- 19 - The third model utilizes polymer chemistry to engineer synthetic or biologically based

scaffolds on which cells are seeded.

The optimally designed graft should be biocompatible, vasoactive,

nonthrombogenic, have controlled biodegradation, and adequate mechanical

properties.[48, 142, 143] However, most TEBVs have inferior mechanical properties

compared to that of native tissue. Compliance mismatch and reduced burst strength are

two such issues. Most efforts to improve mechanical properties are focused on the ECM

components of the medial layer that are synthesized, arranged, and remodeled by

SMCs.[6, 30, 48, 140] Another obstacle is obtaining a functional TEBV that contains all

three critical media constituents; circumferentially aligned smooth muscle cells, collagen

fibers, and elastin lamellae.

There are several considerations that must be taken into account when

engineering a blood vessel. Some key elements to evaluate include cell type, source and

“age” in addition to substrate composition and material properties. [144]

2.4.1 Cell Sourcing

There are several sources to consider when selecting cells for cardiovascular

tissue engineering applications. Each has its advantages and disadvantages.

2.4.1.1 Neonatal

Cells derived from neonates are more biosynthetically active than cells derived from mature animals.[145] Neonatal smooth muscle cells express little versican while expressing large amounts of tropoelastin and form elastic fibers with extended culture.[2,

15, 146] In fibrin matrices, these cells produce three times more collagen than adult

- 20 - cells.[145] These cells have been suggested as a preferred cell source over autologous cells because they are a more viable option for prefabrication needs.[145] However, since

these cells would be allogeneic there is an increased chance of immune response.

2.4.1.2 Adult

By isolating smooth muscle cells from the host, an autologous graft can be

fabricated Yet, vascular disease is more prominent in the elderly population. The use of

these mature cells, which may have been exposed to pathological conditions, in TEMEs

proves to be challenging. [139] Furthermore, smooth muscle cell function alters as the

cell ages. A well-documented disadvantage is the virtual cessation of elastin

synthesis.[147, 148]

2.4.1.3 Stem Cells

Stem cells, whether embryonic or mesechymal, and progenitor cells have been viewed as the holy grail for cell sourcing. Culture conditions have been engineered to derive specific vascular cells from these “plastic” cells. Embryonic stem cells and progenitor cells exposed to laminar shear stress, VEGF, and basement membrane adhesive proteins have differentiated into endothelial-like cells.[149, 150] Biaxial strain,

PDGF, and three-dimensional culture in Type I collagen has been used to drive SMC differentiation.[151, 152] A significant disadvantage of this cell source is the social and ethical dilemmas associated with stem cell isolation. Additionally, there is much to be learned about stem cell biology. Nonetheless, new stem sources (i.e. amniotic fluid, umbilical cord blood, adult circulation) have been discovered and the show some potential.[139]

- 21 - 2.4.2 Substrate

Appropriate substrate selection is critical to tissue engineering because the scaffold must possess the necessary material properties to stimulate desired cell function, support tissue growth, and have minimal immune response in the host tissue. Some common graft failures that are linked to inadequate substrate selection include compliance mismatch, uncontrolled and untimely degradation, and undesirable side effects due to degradation products. [13, 48, 59, 153] A completely functional engineered blood vessel has yet to be fabricated using a biological, decellularized, or synthetic scaffold.

2.4.2.1 Biological polymers

2.4.2.1.1 Collagen

Type I collagen is a popular substrate for tissue engineering. Collagen interacts

with SMCs through β1 integrins on the cell’s surface.[154] In contrast to monomeric collagen, polymerized collagen causes SMC to reduce proliferation and induce collagenase-1 expression.[45, 59] Fibrillar collagen also regulates the pericellular accumulation of extracellular matrix proteins.[136, 137, 155, 156] Collagen is an advantageous scaffold option when compared to synthetic materials because it is a natural biopolymer that is conducive to cell spreading, binding of ECM components (i.e. fibronectin, laminin, etc), and can exhibit fiber alignment with mechanical constraints.[145] As an added incentive, it has been approved by the FDA for therapeutic use.[136]

- 22 - 2.4.2.1.2 Fibrin

Fibrin is the major structural protein in clots and can be readily remodeled into cell-derived ECM.[157] It is formed when thrombin proteolytically cleaves the 340kD fibrinogen protein to form fibers. Due to its role as a temporary clotting and wound stabilization protein, fibrin is rapidly degraded in the presence of plasmin. The degradation fragments released into the blood and surrounding tissue stimulate cell migration, proliferation, and matrix synthesis.[41] Fibrin also promotes angiogenesis and endothelial proliferation.[155] Fibrinogen can be isolated from patient blood to create autologous replacement tissues.[136, 158, 159] In vitro, fibrinolysis can be inhibited by

ACA which blocks the attachment of plasminogen and plasmin to fibrin.[41] The

inhibition can be modulated until the fibrin is completely remodeled into a stronger cell-

derived collagen.

Fibrin has been studied as a matrix material for blood vessel substitutes. Fibrin

binds to SMC through αvβ3 integrins and initiates a number of biological responses.[8]

SMCs have been shown to be more synthetically active when embedded in fibrin rather than collagen.[136, 155, 158, 160, 161] Neonatal SMCs secrete increased amounts of collagen and elastin in fibrin gels than collagen gels.[41] Other benefits to using fibrin as a scaffold have been illuminated in the literature. Swartz et al has shown that fibrin based

TEBVs were strong enough for in vivo implantation and capable of remodeling and integration with host tissue.[157] Additionally, crosslinked fibrin is relatively nonthrombogenic when compared to other materials used for grafts.[162]

- 23 - 2.4.2.2 Decellularized Tissues

Decellularized tissues are advantageous for tissue engineering because it is a non- immunogenic template for tissue regeneration. The suitable material composition and structure are already in place. Once the original cells are removed, vascular cells from the host can been seeded onto the tissue and begin matrix remodeling and reinforcement.

Vascular tissues can be decellularized then repopulated with autologous cells in vitro.[8] However, the aorta is not porous enough to support sufficient cell infiltration.

[30, 49, 140, 163-165] Small intestinal submucosa (SIS) and umbilical vein have been used in cardiovascular applications and successfully infused with the host cells.[165] SIS, is abundant with Type I, Type III, and Type V collagens, as well as proteoglycans and glycosaminoglycans.[166] On this substrate, SMC have been shown to maintain their spindle shape which is associated with a contractile phenotype. When cultured in a SIS- hydrogel, smooth muscle cells penetrate the matrix component and form organized multilayers.[167, 168]

2.4.2.3 Biomimetic, Synthetic, and Injectable Scaffolds

Polymer chemistry has been useful in developing biomimetic and synthetic scaffolds. [41, 48, 139, 140, 142, 143, 163, 169, 170]Polymer structure and degradation properties can be specially designed for specific applications. Degradable scaffolds such as Dacron, polyglycolic acid (PGA), polylactone acid (PLA), and poly(lactide-co- caprolactone) (PLCL) prove to be beneficial because they provide immediate mechanical strength and porosity which can be engineered to specification.[143, 163]. However,

PGA and PLA do not promote cell adhesion effectively. These scaffolds may also induce

- 24 - toxic or inflammatory reactions in the host tissue. [8, 41] Although some success has been attained using synthetic polymers, such as Dacron® and Poly(tetrafluoroethlylene)

(PTFE) to replace larger vessels (> 6mm), this is not the case in coronary arteries.[41,

49, 157] Small caliber synthetic vessels have a greater propensity for thrombus formation and eventual occlusion[171]

Injectable gels have also been considered for tissue engineering. These flowing materials can contain growth factors and fill defects without being preformed. These solutions may be polymerize upon changes in temperature, pH, ionic crosslinking, or shearing force.[136, 140, 144, 145, 158, 161]

The inclusion of elastin in TEMEs has proven to be a unique challenge to tissue engineering because it is produced in low quantities in adult cells and has a low rate of turnover. As a result, neonatal SMCs, which secrete substantial amounts of elastin, have been used as an elastogenic cell source.[30, 37, 172] Other methods embed isolated elastin scaffolds[37, 73, 143, 162, 173] in a collagen matrix as well as supplementing collagen solutions with soluble fragments before polymerization. [32] Ultimately, the ideal substitute would contain adult SMCs that produced and remodeled endogenous elastin without an extended culture period.

- 25 - CHAPTER 3

EXTRACELLULAR MATRIX ARCHITECTURE AND

COMPOSITION INFLUENCE TROPOELASTIN EXPRESSION IN

SMOOTH MUSCLE CELLS THAT OVEREXPRESS VERSICAN V3

3.1 Introduction

With cardiovascular disease being a leading cause of death in the Western world, there is a growing need for therapies to treat small caliber arteries occluded by atherosclerotic plaques and thrombi.[50, 91, 98, 99, 108] A tissue engineered blood vessel (TEBV) is a potential alternative to limited sources of autologous vessels used in coronary bypass procedures. However, in order to create a structurally accurate blood vessel substitute, the medial component of the TEBV must include smooth muscle cells

(SMCs), collagens type I & III, elastin and proteoglycans.

The inclusion of elastin in tissue engineered media equivalents (TEMEs) has proven to be a unique challenge because this protein is produced in low quantities by adult smooth muscle cells. Elastin is a highly insoluble hydrophobic protein that provides elasticity to blood vessels that must stretch and relax more than a billion times in a human lifespan.[69] It is believed to be produced during the final stages of fetal development and during the perinatal period.[50, 71, 75-78] Consequently, neonatal SMCs are commonly used as a cell source because these synthetically active cells secrete substantial amounts of elastin.[30, 37, 172] Other methods rely upon embedding isolated elastin scaffolds[37, 73, 143, 162, 173] in a hydrogel matrix or even supplementing collagen solutions with elastin fragments prior to polymerization. [130] However, to

- 26 - fabricate an autologous graft for an adult patient, mature SMCs must be stimulated to produce and remodel endogenous elastin.

Our approach to this challenge involves a novel use of versican. Versican is a large chondroitin sulfate proteoglycan (CSPG) found in arterial ECM. The basic structure of versican consists of a hyaluronan-binding region at the amino-terminus (G1) and a carboxy-terminus (G3) containing epidermal growth factor (EGF)–like, lectin-like, and

complement-regulatory protein (CRP)-like domains. Between these two globular

domains is a protein core with two glycosaminoglycan (GAG) binding subunits that are

decorated with chondroitin sulfate (CS) side chains.[126, 127] These side chains keep the

proteoglycan well hydrated, provide the matrix with its compressibility properties, and

allow diffusion of small molecules to the cell surface.

Versican has four splice variants with differing lengths of the CS-rich protein

core. The smallest versican isoform, V3, is devoid of both subunits that bind chondroitin

sulfate[94, 95, 120]. Interestingly, when rat arterial smooth muscle cells (RASMCs)

were retrovirally transduced to overexpress this isoform, an increase in tropoelastin was

observed. These cells, referred here as LV3SN cells, produced elastic fibers in extended

monolayer culture as well as in an in vivo carotid balloon injury model[35, 48, 170].

These cells were obtained through collaboration with Dr. Thomas Wight (Hope Heart

Program at the Benaroya Research Institute at Virginia Mason) and the behavior of these

cells in tissue engineered media equivalents was observed.

The aim of this chapter was to investigate the influence of extracellular matrix

structure and composition on tropoelastin synthesis. Therefore, LV3SN cells and the

empty vector control LXSN cells were cultured as monolayers and in tissue engineered

- 27 - media equivalents (TEMEs) composed of type I collagen or fibrin. The tested hypothesis was that substrate architecture and biologic matrix proteins would alter proliferation as well as tropoelastin gene and protein expressions by LV3SN cells. The cells’ response to changes in substrate composition and structure was measured by quantitating proliferation, gel compaction, tropoelastin mRNA regulation, and tropoelastin synthesis.

3.2 Materials and Methods

3.2.1 Cell Culture

Arterial smooth muscle cells from adult male Fischer 344 rats that were retrovirally transduced to overexpress versican V3, LV3SN cells, or an empty vector,

LXSN cells, were provided by Dr. Thomas N. Wight. The V3 cDNA cloning and transduction protocols have been described previously by Lemire et al.[60] Cells were

0 sterilely cultured at 37 C in 5% CO2 and Dulbecco’s modified Eagle medium (DMEM)

(Cellgro, Herndon,VA) supplemented with 10% fetal bovine serum (FBS)

(Mediatech/Cellgro, Herndon, VA), 1% penicillin-streptomycin (Mediatech Cellgro), and

1% L-glutamine (Mediatech Cellgro). Cells were cultured. All experiments were

conducted using cells between passage 8 and 11.

3.2.2 Substrate Fabrication

3.2.2.1 Monolayer culture

Monolayers were plated on either collagen coated glass slides or multi-well plates

for two-dimensional culture. For staining protocols, glass slides were coated with

50µg/mL type I bovine dermal collagen (MP Biomedicals, Irvine, CA), and seeded at a

- 28 - final concentration of 1x104 cells/cm2. For all other 2D studies, cells were plated in multi- well tissue-treated dishes. Culture medium was refreshed every two days until the end of experimentation.

3.2.2.2 Hydrogel Formation

Tissue engineered media equivalents were fabricated using two different biopolymers based upon techniques developed by Elsdale et al. [8], Weinberg and Bell

[160], Tuan et al[159], and Herbert et al [158-161]. Bovine Type I collagen (MP

Biomedicals, Irvine, CA) and bovine fibrinogen (Sigma, St. Louis, MO) were used to form porous hydrogels molded into either disk or tubular geometries. The disk geometry was formed by pouring the matrix solution into multiwell flat-bottom plates. Tubular hydrogels were formed by pouring the matrix solution into glass test tubes. A glass capillary tube with a 3mm outer diameter was flanked with two rubber stoppers and inserted into the test tube. This mandrel setup defined the lumen and ends of the vessels.

For collagen hydrogels, a 4mg/mL stock solution of type I collagen was mixed with 0.1M NaOH and 5X DMEM. To make fibrin hydrogels, fibrinogen (4mg/mL), ε- aminocaproic acid (ACA; 4mg/mL), and thrombin was prepared in plain DMEM. The final protein and cell concentrations achieved were 2mg/mL and 1x106cells/mL, respectively. Great care was taken to avoid introducing bubbles while thoroughly mixing all reagents before gelling occurred. After cells were homogeneously suspended, the mix was poured into the molds. Polymerization was initiated by pH and temperature modification and continued at 370C for one hour.

- 29 - After polymerization, the hydrogels were liberated from the walls of the wells

(disks) or removed from the test tubes (tubular vessels). Figure 3.1 is a schematic of the fabrication procedure. Collagen TEMEs were cultured in complete media (DMEM plus

10% FBS, 1% penicillin-streptomycin, and 1% L-glutamine). Fibrin TEMEs were cultured in complete media supplemented with ACA to inhibit fibrinolysis.[127, 130]

After one day of compaction, the tubular TEMEs were cut away from the stoppers to permit further longitudinal compaction. Medium in 6-well plates was refreshed every two days while medium in the suspension dishes was refreshed weekly.

- 30 -

Tubular Geometry

Gel Compaction 0 (1 hr, 37 C, 5% CO2)

Arterial Smooth Muscle Cells (1x106 /mL)

Type I Collagen or Fibrin (2 mg/mL)

Gel Compaction 0 (1 hr, 37 C, 5% CO2)

Disk Geometry

Figure 3.1 Schematic of TEME fabrication.

- 31 - 3.2.3 Immunofluorescence

Monolayers cultured on glass slides were washed with TPBS, fixed with 4% paraformaldehyde, and permeabilized with 0.1% Triton X-100. Tropoelastin was labeled with a polyclonal antibody against rat elastin (1:100; Elastin Products Co., Owensville,

MO) and a donkey anti-goat AlexaFluor 488 secondary antibody (1:200, Molecular

Probes, Carlsbad, CA). Cell nuclei were stained with Hoescht 33258. Fluorescence

images were taken with a Zeiss LSM 510 confocal microscope.

3.2.4 Histology

Tubular TEMEs were cut into rings and fixed in 4% paraformaldehyde for several

hours. The samples were processed in a Shandon Pathcentre Enclosed Tissue Processor

(Thermo Fisher Scientific, Waltham, MA) and paraffin embedded (Shandon Histocentre

2 Tissue Embedding System, Thermo Fisher Scientific). Embedded tissues were cut into

7µm sections, placed on superfrost slides, and dried overnight at 370C.

3.2.4.1 Movat’s Pentachrome

Deparaffinized tissues were mordant in Bouin’s for 1 hour at 560C then washed to remove the picric acid. Sections were then rinsed briefly with 3% acetic acid and incubated in alcian blue for 10 minutes at 600C. The following stains were applied at

room temperature; Verhoeff’s solution (6 minutes), plasma stain (3 minutes), and 2%

polyacid. Following a rinse in 1% acetic acid, sections were dehydrated in alcohol and

stained with saffron. Two changes of xylene were applied and slides were coverslipped.

- 32 - 3.2.4.2 Orcein

An orcein working solution was prepared by adding 1g orcein (Sigma, St. Louis,

MO) to 99mL 70% alcohol and 1mL hydrochloric acid (HCl). Immediately before use, the staining solution was filtered. Deparaffinized tissue samples were submerged in the orcein solution and incubated for 30 minutes in a 600C water bath. Slides were rinsed and

nuclei were counterstained with Harris’ hematoxylin.

3.2.4.3 Immunohistochemistry

Exogenous peroxidases were blocked using 0.3% hydrogen peroxide in methanol.

Samples were then pretreated with 100µg/mL Pronase A to fully expose the antigen.

General blocking with 1% gelatin-PBS was followed by an hour incubation with a

primary antibody against rat elastin (1:500; Cedarlane, Burlington, Ontario, Canada). A

biotinylated goat anti-rabbit secondary antibody (1:400, Vector Laboratories,

Burlingame, CA) was applied for 30 minutes at room temperature. Concurrently, a

working dilution of the ABC-peroxidase complex (Vectastain ABC-Peroxidase Elite Kit;

Vector Laboratories) was prepared and stored at 40C for 30 minutes. After a PBS wash,

the sections were incubated for one hour in the ABC complex. A filtered chromogenic

substrate, diaminobenzidine (DAB), was then applied to the sections.

The stained tissues were allowed to develop in the dark. The reaction was

stopped by blotting off the DAB substrate and thoroughly rinsing with PBS. Sections

were lightly counterstained with Gill’s hematoxylin, dehydrated with alcohol and xylene,

and coverslipped. Samples were viewed with a Nikon Eclipse E600 microscope and

images were captured using a Q Imaging Retiga 1300 imaging system.

- 33 -

3.2.5 Gene Expression Analysis

Gene expression was determined by means of a two-step, real time RT-PCR quantification method. The first step reverse transcribed 1µg of total RNA to complementary DNA (cDNA) using oligo(dT)16 primers. In the second step, the cDNA template, gene specific primers, and SYBR Green PCR Master Mix (Applied Biosystems,

Foster City, CA) were mixed and amplified using real time PCR.

3.2.5.1 RNA Isolation

Following the protocol provided with the RNeasy Mini Kit (Qiagen, Valencia,

CA), RLT buffer supplemented with β-mercaptoethanol was added directly to monolayers or TEMEs snapped frozen and diced finely. Monolayer and TEME lysates were collected and added to Qiashredder (Qiagen) columns to further homogenize the samples. Further RNA isolation and purification from monolayer and TEME samples proceeded as outlined in the RNeasy protocol for specific to heart, muscle and skin tissues.

RNA purity and quantity was determined by diluting 2 µL RNA in 58 µL dH2O in measuring absorbance. Samples with an absorbance ratio (A260nm/A280nm) greater than 1.8 were used for analysis.

3.2.5.2 Complementary DNA Synthesis

One microgram of total RNA was reverse transcribed to synthesize

complementary DNA (cDNA) templates according to the protocol provided in

- 34 - Invitrogen’s Superscript III First-Strand Synthesis Kit for RT-PCR (Invitrogen, Carlsbad,

CA). Briefly, one microgram of total RNA was mixed with 1µL each of 50mM oligo(dT) primers and 10mM dNTP mix. Denaturation of the RNA occurred at 650C for 5 minutes.

A synthesis mix (2µL 10X RT buffer + 4µL 25mM MgCl2 + 2µL 0.1M DTT + 1µL

RNase Out + 1µL SuperScript III RT), was then added to the denatured RNA. The synthesis mix and denatured RNA was heated to 500C for 50 minutes to allow annealing and cDNA synthesis. The reaction was terminated by increasing the temperature to 850C

for 5 minutes. Excess RNA was eradicated by the addition of 1µL of RNase H and 20

minute incubation at 370C.

3.2.5.3 Quantitative Real Time PCR

Our gene of interest was amplified and quantitated using real time PCR. Primers

for tropoelastin (sense – GAGCCCTGGGATATCAAGGTG, antisense -

GGGTCCCCAGAAGATCACTTTC) and versican V3 (sense –

AGCAGAGTGTGCAAACCGG, antisense - CCTCCAAGCTGCGTGAAGTT) were

designed using Primer Express software (Applied Biosystems, Foster City, CA) and

synthesized by Integrated DNA Technologies (Coralville, IA).

Primers (0.3µL each), cDNA template (1µL), water (13.4µL), and 2X SYBR

Green PCR Master Mix (15µL; Applied Biosystems, Foster City, CA) were mixed for

PCR amplification. An ABI Prism 7700 Sequence Detection System was used for thermal cycling, laser fluorescence induction, and detection. Gene expression was quantitated using the standard curve method to translate the Ct values of samples into

concentrations. [174]

- 35 -

3.2.6 DNA Assay

Monolayers and TEMEs were washed and digested overnight in 1mL 0.5mg/mL proteinase K solution (Sigma, St. Louis, MO) at 500C. A Hoechst solution was prepared by adding 10µL of 1mg/mL Hoechst 33258 stock (Invitrogen, Carlsbad, CA) in 100mL of tris-EDTA-NaCl buffer (TEN; 10mM Tris + 1mM EDTA + 0.1M NaCl). In a 96-well assay plate, 10µL of sample or calf thymus standard was mixed with 200µL of the

Hoechst/TEN solution. After 30 minute incubation at 370C protected from light, DNA concentration was determined by measuring fluorescence (365nm excitation/458nm emission) on a Spectra Max Gemini Microplate Spectrofluorometer.

3.2.7 Quantitative Protein Analysis

3.2.7.1 SDS-PAGE and Western Analysis

Cells in monolayers and TEMEs were lysed with cold RIPA buffer and treated with a proteinase inhibitor cocktail (Sigma, St. Louis, MO). The mixture was boiled at

95oC and passed through a 25-gauge syringe until completely homogenized. Spent media

was collected and immunoprecipitated with a Sigma’s Protein G Immunoprecipitation

Kit. The total protein in samples was determined using a bicinchoninic acid (BCA) total

protein assay kit (Pierce Biotechnology, Rockford, IL).

The protein concentration in each sample was normalized to achieve 1µg/µL.

Protein was electrophoresed in Novex precast 10% Tris-Glycine gels (Invitrogen,

Carlsbad, CA). Rat lung α-elastin standard (37ng; Elastin Products Co, Owensville, MO) was loaded into gels containing spent media samples. Protein transferred onto hybond

- 36 - nitrocellulose membranes (GE Healthcare Life Sciences, Piscataway, NJ) was blocked with 4% normal donkey serum (Sigma, St. Louis, MO), and probed for tropoelastin using a polyclonal goat anti-rat lung elastin antibody (1:10,000; Elastin Products Co,

Owensville, MO) and β-actin with a goat anti-mouse loading control antibody (1:2000;

Abcam, Cambridge, MA) overnight at 4oC. Blots were then washed three times with 4%

normal donkey serum and incubated with donkey anti-goat + HRP conjugated secondary antibodies (1:20,000 Jackson Immunoresearch Laboratory, West Grove, PA). Protein bands were detected with an ECL Plus chemiluminesce detection system (GE Healthcare

Life Sciences).

Scion Imaging software (Frederick, MD) was used to measure the densitometric intensity of the bands in blots. Tropoelastin protein in cell and tissue lysates was normalized to β-actin. Spent media samples were normalized to 37ng elastin standard.

3.2.7.2 Flow Cytometry

Cells were isolated by means of trypsinization or collagenase digestion (600U/mL type 2 collagenase; Worthington Biochemical Corp, Lakewood, NJ) and fixed in 4% paraformaldehyde (Tousimis, Rockville, MD). Cells were then permeabilized with 0.1%

Triton X-100 and blocked with 4% normal donkey serum. Primary antibodies

(tropoelastin 1:100; Elastin Products Co, Owensville, MO and versican 1µg/mL; Abcam,

Cambridge, MA) were added to the cells and incubated for one hour at 370C. Finally cells were labeled with fluorescently conjugated secondary antibodies (1:200 donkey anti-goat

+ AlexaFluor546 for elastin and 1:500 donkey anti-goat + AlexaFluor488 for versican;

Molecular Probes, Carlsbad, CA) for 30 minutes at 370C. Shifts in the geometric mean of

- 37 - relative fluorescence intensity were analyzed with a BD LSR flow cytometer (BD

Biosciences, San Jose, CA) and FCS Express (De Novo Software, Los Angeles, CA).

3.2.8 Statistical Analysis

At minimum, three experiments were performed to ensure reproducibility in the data. A minimum of three samples per experimental condition was evaluated. Statistical analysis was performed using the General Linear Model (GLM) of the Analysis of

Variance (ANOVA) method in Minitab® software (Release 14.12.0, Minitab Inc, State

College, PA). The difference between mean values was deemed significant if p<0.05.

Error bars in graphs represent the standard error of the mean.

- 38 - 3.3 Results

3.3.1 Qualitative Observations

3.3.1.1 Comparison between LXSN and LV3SN cells

As previously described by Wight [120, 129, 133], there are some morphological differences between SMCs that overexpress the V3 versican isoform (LV3SN) and cells that contain an empty control vector (LXSN). Figure 3.2 shows LXSN and LV3SN cells at passage six on tissue cultured plastic. LXSN cells were more rounded as evidenced by the refractive appearance under a light microscope. Using the same type of microscopy,

LV3SN cells appeared flatter, had more finger-like projections and were larger in size.

The use of a coulter counter also verified the increased diameter of LV3SN cells.

- 39 -

A.

B.

Figure 3.2 Light microscopy images of LXSN and LV3SN. Transduced smooth muscle cells (passage six) cultured on tissue culture plastic. (A) LXSN and (B) LV3SN have differing appearances in monolayer culture. 10X magnification

- 40 - Confocal microscopy shows that in monolayer culture there was a marked difference in the amounts tropoelastin protein expressed by LXSN and LV3SN cells. The smooth muscle cells were plated on collagen coated slides at a cell density of

1x104cells/cm2 and cultured for 7 days. The monolayers were fixed with 4%

paraformaldehyde and stained intracellularly for tropoelastin.

Figure 3.3 shows positive staining for tropoelastin in neonatal rat pup cells and

LV3SN cells. In the neonatal cell culture, large amounts of tropoelastin were dispersed

throughout the cytoplasm of these cells. This was to be expected since neonatal cells

consistently express tropoelastin. LV3SN cells also stained positively for tropoelastin.

However, there was diffuse intracellular labeling with noticeable areas of concentrated

staining. The punctate staining suggests that the protein was localized to intracellular

vesicles. Minimal staining was visible in the empty vector control cell. This staining

demonstrated that the LV3SN cells were still overexpressing tropoelastin relative to the

control cell type.

A. B. C.

Figure 3.3 Confocal imaging of intracellular tropoelastin. Confocal microscopy shows intracellular staining of tropoelastin in monolayer cultures of (A) neonatal rat smooth muscle cells, (B) LXSN, and (C) LV3SN. Nuclei appear blue and tropoelastin appears green. 63X magnification.

- 41 - 3.3.1.2 Comparison between different ECM substrates

Noticeable differences were observed when using different types of extracellular

matrices to make TEMEs. TEMEs made from collagen appeared more opaque and

smooth around the periphery while fibrin TEMEs had a translucent appearance with

fuzzy edges. Figure 3.4 shows the differences between collagen and fibrin TEMEs after

three days of culture. Figures 3.5 and 3.6 show the normalized volumetric compaction of

collagen and fibrin TEMEs over seven days. In collagen disks, LV3SN cells compact the

gel significantly more then LXSN cells after three days of culture. The disk size of each

cell type remained approximately the same size after this time point. At day seven,

LV3SN cell TEMEs had a normalized volume of 0.178 ± 0.012 and LXSN cell TEMEs

had a normalized volume of 0.325 ± 0.008. In fibrin disks, there was no significant

difference in compaction between the two cells types. The majority of the compaction

occurred during the first day with the volume again remaining steady after the third day

in culture. On the seventh day the normalized compactions of LXSN and LV3SN cell

TEMEs were 0.290 ± 0.026 and 0.303 ± 0.004, respectively.

- 42 -

A.

B.

Figure 3.4 Disk shaped collagen and fibrin TEMEs have distinct appearances. Hydrogels made from collagen and fibrin have distinct appearances after three days of culture in 6-well suspension culture dishes. The top wells of each image are collagen based hydrogels. The bottom wells are fibrin based. (A) LXSN, (B) LV3SN.

- 43 - Compaction of Collagen Hydrogels TEMEs LV3SN 1 LXSN 0.9 0.8 0.7 0.6 Volume d

/Vo) 0.5 * * *

(V 0.4 0.3 0.2 Normalize 0.1 0 1234567 Day in Culture

Figure 3.5 Compaction of collagen TEMEs. LV3SN compacts collagen TEMEs more so than LXSN. Compaction for both cell types appears to stabilize by the third day of culture. n=3, mean ± SEM, *p<0.05.

Compaction of Fibrin HTEMEsydrogels LV3SN 1.0 0.9 LXSN 0.8 0.7 0.6 Volume d

/Vo) 0.5

(V 0.4 0.3 0.2 Normalize 0.1 0.0 1234567 Day in Culture

Figure 3.6 Compaction of fibrin TEMEs. There is no significant difference in compaction between LV3SN and LXSN in fibrin TEMEs. The largest amount of compaction occurs during the first day. n=4, mean ± SEM

- 44 - After verifying the retained overexpression of tropoelastin, LV3SN cells were incorporated into tissue engineered media equivalents. Collagen hydrogels were fabricated with either LV3SN or LXSN cells. After an extended culture of five weeks, a cell capsule formed on the outer surface of the TEME. The modified Movat’s

Pentachrome stain was used to see general tissue morphology and elastic fibers (Figure

3.7). The pentachrome stains for five different entities; collagen (yellow), nuclei

(blue/black), cytoplasm/muscle (red), elastic fibers (dark brown), and glycosaminoglycans and mucins (blue).[175] Unlike the positive control rat aorta, the

TEMEs did not stain positively for elastin or elastic fibers. However, GAGs could be seen in each cell capsule.

Rat Aorta LXSN LV3SN

Figure 3.7 Modified Movat’s Pentachrome staining of collagen TEME. Five week old collagen TEME stain negatively for elastin (dark brown) while staining positively for collagen (yellow), GAGs and mucins (blue), nuclei (blue/black), and cytoplasm/muscle (red). The positive control is an adult rat aorta. LXSN stains more strongly for GAGs in the cell capsule. TEME are shown at 40X magnification and the rat aorta is at 20X magnification.

- 45 - Figure 3.8 shows the results of a more sensitive elastic stain on three week old

TEMEs. Orcein is commonly used to detect fine elastic fibers and tropoelastin deposits.

[176] In this stain, elastin appeared brown and nuclei were blue. Again, a cell capsule appeared after extended culture. It is within the capsule, that positive staining occurred.

The TEME containing LV3SN cells had a larger capsule and greater expression of tropoelastin. When these tissues were probed for elastin using immunohistochemistry, the cell capsules stained positively for elastin. LV3SN capsules stained more strongly than

LXSN capsules. The combined analysis of TEMEs using Movat’s Modified Pentachrome stain and immunohistochemistry illustrates the inverse relationship between GAG and elastin expression. In TEMEs containing LV3SN, the cell capsule stained lightly for

GAGs while staining more intensely for tropoelastin. The opposite was true for TEMEs containing LXSN cells. A higher magnification showed that more intense intracellular staining in LV3SN cells persisted in the cell capsule (Figure 3.9).

Rat LXSN LV3SN

Figure 3.8 Orcein staining of collagen TEME. Tropoelastin and elastin stains a reddish brown in areas of high cell density for LXSN and LV3SN collagen TEME. Mature elastic fibers are not visible in either TEME. Yet, there is more staining in the LV3SN collagen TEME. An adult rat aorta was stained as a positive control. Images are shown at 20X magnification.

- 46 - A) B) C)

D) E) F)

Figure 3.9 Immunohistochemical staining for tropoelastin in collagen TEME. Elastic fibers and intracellular tropoelastin appear brown when immunostained with a DAB chromogenic agent. The LV3SN capsule show more staining for tropoelastin than the LXSN capsule. A, D) Rat aorta – positive control. B, E) LXSN. C,F) LV3SN. Panels A – C at 20X magnification, panels D-F show at more stained tissues at 40X magnification

- 47 - 3.3.2 Gene Expression

Fluorescence imaging and histological staining has shown that LV3SN cells in collagen TEMEs expressed more tropoelastin than LXSN cells after extended culture.

More quantitative measures were explored to assess gene expression of both tropoelastin

and versican. Quantitative RT-PCR (qRT-PCR) was used to measure versican V3 and

tropoelastin mRNA expression as represented by concentration of cDNA in the PCR

product. Figures 3.10 - 3.11 show the expression levels of these genes in LV3SN and

LXSN monolayers as well as collagen and fibrin hydrogels after one and seven days of

culture. The figures illustrate the influence that matrix structure has on cell genotype.

After one day of culture, LV3SN cells expressed more versican V3 mRNA than

LXSN cells in monolayer and collagen cultures. LXSN cells exhibited no change in

versican V3 cDNA expression between monolayer and collagen culture conditions. There

were significant changes in expression between collagen and fibrin hydrogels. Versican

mRNA levels in LV3SN cells decreased significantly when cultured in monolayers

versus collagen and fibrin. Tropoelastin gene expression was greatly affected by substrate

structure. Even though there was not a significant difference between the two cell types,

the two-dimensional culture exhibited the greatest level of expression when compared to

a three-dimensional matrix. LXSN collagen and fibrin TEMEs exhibited a suppression of

protein expression. Tropoelastin gene expression by fibrin LV3SN cell TEMEs were

essentially silenced (0.001 ± 2.12 x 10-5 pM).

Gene expression was assessed again after seven days. The longer culture time

afforded a period of acclimation by the cells in the new substrate. After seven days,

versican expression remained at similar levels in LXSN monolayers, decreased in fibrin

- 48 - TEMEs, and significantly increased in collagen TEMEs. LV3SN samples showed similar trends. Again, LV3SN cells expressed higher levels of versican V3 relative to LXSN cells in both monolayers and collagen. After seven days in culture, tropoelastin gene expression in monolayers was 3 times higher than in TEMEs. LV3SN cells expressed more tropoelastin than LXSN cells in monolayers and collagen. Both cells exhibited a decrease in tropoelastin gene expression when moved from collagen to fibrin gels. Day

seven expression of tropoelastin in LXSN cells remained at a similar level to day one yet

expression in both collagen and fibrin increased. LV3SN cells showed an expression

increase in monolayers and fibrin after seven days. Although there were obvious

changes in versican gene expression after seven days in collagen and fibrin gels, the

changes in tropoelastin gene expression were not as discernible.

- 49 -

Versican Gene Expression - 1 Day Culture Monolayer Collagen 120 ** ) Fibrin M

p 100 * on ( i

t 80 * a r t

n 60

40 Conce A 20 cDN 0 LXSN LV3SN

Tropoelastin Gene Expression - 1 Day Culture Monolayer 0.16

) Collagen

M 0.14

p Fibrin 0.12 on ( i

at 0.1 r 0.08

oncent 0.06 C

A 0.04 N 0.02 cD 0 LXSN LV3SN

Figure 3.10 Versican and tropoelastin gene expression varies with matrix structure and composition after one day in culture. Versican gene expression (top graph) and tropoelastin gene expression (bottom graph) were evaluated after one day in monolayer, collagen, and fibrin culture. Expression levels are represented as a concentration of cDNA copies in the final PCR product. n=3-5, mean ± SEM, * p<0.05, **p<0.01.

- 50 -

Versican Gene Expression - Monolayer 7 Day Culture Collagen ** 250 Fibrin

) ** M p 200 on ( i at

r 150 t n 100 Conce A 50 cDN 0 LXSN LV3SN

Tropoelastin Gene Expression - 7 Day Culture Monolayer 0.25 Collagen ) M

p Fibrin

( 0.2 n o i t a

r 0.15 t n e c

n 0.1

0.05 DNA Co c 0 LXSN LV3SN

Figure 3.11 Versican and tropoelastin gene expression varies with matrix structure and composition after seven days in culture. Versican gene expression (top graph) and tropoelastin gene expression (bottom graph) were evaluated after seven days in monolayer, collagen, and fibrin culture. Expression levels are represented as a concentration of cDNA copies in the final PCR product. n=3-5, mean ± SEM, **p<0.01.

- 51 - 3.3.3 Proliferation

A Hoescht based DNA assay was performed to determine if cell proliferation changed with regard to matrix type. Figure 3.12 shows that there was no statistical difference in the amount of DNA present in one million LXSN or LV3SN cells.

Therefore, the amount of DNA in a sample directly correlated to the number of cells present in the sample.

DNA Content per Cell

) 16 l l e

c 14 / g p

( 12

n

o 10 i t a r

t 8 n e

c 6 n 4 2 DNA Co 0 LXSN LV3SN Cell Type

Figure 3.12 LXSN and LV3SN cells contain equal amounts of DNA per cell. There is no statistical difference in the amount of DNA present per cell. n=3, mean ± SEM.

Tissue engineered media equivalents were created with 2 mg/mL of collagen or fibrin formed into disks. Each disk had an initial volume of three milliliters of cell-matrix suspension with an initial cell concentration of one million cells per milliliter. After seven days culture in collagen, there was no difference in cell number between cell types. The

DNA concentration after the first day was 29.434 ± 0.534ug/mL for LXSN collagen

TEMEs and 28.165 ± 1.687ug/mL for LV3SN collagen TEMEs. The concentrations

- 52 - remained near this level throughout the seven days of culture (figure 3.13). There did not appear to be any significant cell loss after the initial drop between days 0 and 1. When similar culture conditions were applied to fibrin disks, there was an increase in LV3SN cells over the seven days. LXSN cell numbers fluctuated over the time course. Overall, more LV3SN cells were present in fibrin TEMEs (figure 3.14).

Figures 3.15 and 3.16 compared the influence of matrix type on cell number within a cell type. On days 1 and 3, there were significantly lower amounts of LXSN

DNA in fibrin disks compared to collagen disks. There was no discrepancy in LXSN cell numbers after seven days in culture. LV3SN cells numbers were unchanged after three days in either collagen or fibrin. A significant increase in DNA appeared after day 5 and remained elevated at 37.91 ± 1.278ug/mL on day 7. Fibrin had a greater effect on LV3SN cells than collagen. LXSN cells were more proliferatively stable in either matrix.

- 53 - DNA Content - Collagen TEMEsTEBV

LXSN ) 35

L ∗ LV3SN m 30 ug/ 25 on ( i 20 at r t

n 15 10 Conce

A 5

DN 0 1357 Days in Culture

Figure 3.13 DNA content in collagen TEME. Similar concentrations of DNA were found in collagen TEME made with LXSN and LV3SN at each time point except day five. By day seven, there is no statistical difference in DNA concentration between the two cells. n=3-5, mean ± SEM, * p<0.05

DNA Content - Fibrin TEMEsTEBV

LXSN ) 45 L LV3SN m 40 ∗ **

ug/ 35 30 on ( i

at 25 r t

n 20 15 10 Conce

A 5 DN 0 1357 Days in Culture

Figure 3.14 DNA content in fibrin TEME. DNA content in fibrin TEME vary with respect to time. LV3SN DNA content increased with time and is significantly higher by day seven. n=3 except for LV3SN at day 5, mean ± SEM, * p<0.05, **p<0.005.

- 54 - LXSN DNA Content

Collagen ) 35 L ∗∗ Fibrin m ∗∗ 30 ug/ 25 on ( i 20 at r t

n 15 10 Conce

A 5

DN 0 1357 Days in Culture

Figure 3.15 Changes in LXSN DNA content relative to matrix type. Fibrin caused more fluctuations in DNA concentration than collagen over a seven day time course. n=3-5, mean ± SEM, **p<0.005

LV3SN DNA Content

Collagen

) 45 L ∗∗ Fibrin m 40 ∗ g/

u 35 30 on ( i

at 25 r t

n 20 15 10 Conce

A 5 DN 0 1357 Days in Culture

Figure 3.16 Changes in LV3SN DNA content relative to matrix type. Fibrin hydrogels contained a higher concentration of DNA over time. The levels of DNA remained stable in collagen hydrogels. n=3 except for day 5, mean ± SEM, *p<0.05, **p<0.005

- 55 - 3.3.4 Protein Expression

Matrix structure and composition not only influenced gene expression it also affected protein synthesis. The effects of matrix structure and composition on protein expression were evaluated utilizing western analysis and flow cytometry. Collagen or fibrin TEMEs were cultured up to seven days before being assayed. Confluent monolayers were also evaluated after seven days of culture. Overall tropoelastin protein expression levels were evaluated using western analysis on homogenized cell and tissue lysates. Secreted tropoelastin was measured in the spent media after seven days as well.

Intracellular expression was determined by flow cytometry on whole cells isolated from digested TEMEs and monolayers.

Protein expression in the different matrix compositions was analyzed qualitatively using western analysis and scion imaging. For western analysis, monolayer and TEME total protein content was normalized before each sample was electrophoresed and blotted for tropoelastin. Figure 3.17 shows the normalized tropoelastin protein expression in whole lysates. The graph was generated using scion imaging software that measured the density of each band (blot not shown). Tropoelastin expression levels were normalized to a β-actin loading control. The β-actin bands were different sizes relative to the matrix types because of the varying cell concentrations per sample. However, equal amounts of total protein were loaded into each well.

LV3SN monolayers and fibrin samples contained more tropoelastin than LXSN samples. The highest ratio of tropoelastin per cell occurred in fibrin samples for both

LV3SN and LXSN cells. In collagen, there was a band present for tropoelastin but not

- 56 - for β-actin in LV3SN. This generated an artificially high ratio (indicated by the † symbol).

Figure 3.18 shows a blot and graph of tropoelastin expression in the spent media collected from each sample after the seventh day. Equal amounts of protein were loaded in each well. However, no loading control could be used because of the lack of normalizing proteins in the medium. The blot showed numerous molecular weights detected by the tropoelastin antibody. The accompanying graph showed the tropoelastin protein expression represented in arbitrary densitometric units generated by the scion imaging software. As expected, greater amount of tropoelastin was secreted in the medium of the monolayer culture. This was due to a higher concentration of cells to the volume of media. Similar amounts of tropoelastin protein were secreted into the media of collagen and fibrin TEMEs by both cells types. The majority of the protein may have bound to the matrix and was unable to diffuse readily through to the tissue. This was suggested by the higher molecular weight tropoelastin or elastin proteins eluted into the monolayer medium versus the TEME medium.

- 57 - Tropoelastin Protein Expression - Whole Lysate 7 Days Culture LXSN -

a 2.5 † LV3SN bet o 2 ed t z i

al 1.5 n i t m r o Ac 1 on N 0.5 essi pr x

E 0 Monolayer Collagen Fibrin

Figure 3.17 Western analysis of tropoelastin protein expression in whole lysates of cell monolayers, collagen TEMEs and fibrin TEMEs. Tropoelastin protein content in whole lysates was normalized to β-actin. (blot not shown) † β-actin band is not present in LV3SN collagen sample resulting in an erroneously high normalized expression level.

Tropoelastin Protein Expression - Spent Media after 7 Days Culture LXSN

s 12000 t LV3SN

Uni 10000 c i r t

e 8000 m o t i

s 6000 n

De 4000 y r a r t 2000 bi

Ar 0 Monolayer Collagen Fibrin

Std 1 2 3 4 5 6 83.6 kD 72 kD

Figure 3.18 Western analysis of tropoelastin secreted into the spent media of monolayer, collagen TEME, and fibrin TEME cultures. Protein in spent media is represented with arbitrary densitometric units generated using Scion Imaging software. Lanes: 1- LV3SN monolayer, 2- LXSN monolayer, 3- LV3SN collagen TEME, 4- LXSN collagen TEME, 5- LV3SN fibrin TEME, 6- LXSN fibrin TEME.

- 58 - While western analysis was used as a qualitative assessment of the overall presence of tropoelastin in the different culture conditions, flow cytometry was employed to display the amount of intracellular tropoelastin and versican synthesized in each matrix condition throughout the seven days of culture. The results from this technique indicated that protein expression was both time and matrix dependant. Figures 3.19 - 3.21 show the intracellular expression levels at 1-, 3-, 5- and 7-day time points. The accompanying histograms show the shift in the relative fluorescence emitted by the labeled protein.

Unlabelled cells from each sample emitted a baseline autofluorescence and were used as a negative control (filled curve) for each sample. This baseline was subtracted from the mean fluorescence emitted by the stained cells (line) to generate the relative mean fluorescence intensity of each sample.

In monolayers, LV3SN cells had more versican and tropoelastin expression than

LXSN cells after the first day of culture (figures 3.19a and 3.19b). LV3SN monolayer versican and tropoelastin protein expression dropped after the first day but then increased each day thereafter. The levels of these proteins in LXSN monolayers decreased with time. The divergence in intracellular versican and tropoelastin synthesis by LXSN and

LV3SN cells became greater with time.

For the two cell types, versican and tropoelastin expression was significantly reduced in collagen tissue engineered media equivalents relative to monolayer culture.

Figure 3.20a shows an initial increase in LXSN versican expression followed by a sharp descent. LV3SN versican protein expression showed a decreasing trend with time. Only day five was statistically different with LXSN cell TEMEs expressing more versican than

- 59 - LV3SN cell TEMEs. There was no statistical difference in tropoelastin expression between LXSN and LV3SN cell TEMEs.

In accordance with the whole lysate data from figure 3.17, fibrin TEMEs yielded higher amounts of tropoelastin protein than collagen TEMEs. In both cell types, versican expression rose sharply after the first day before slowly declining. LV3SN cell TEMEs expresses more versican than LXSN cell TEMEs. While versican expression modulated with time, tropoelastin levels in both cells remained steady over the seven days of culture.

Throughout the time course of the study, LV3SN tropoelastin expression remained higher

than that of LXSN cell TEMEs.

A) Versican Protein Expression - Monolayers B) Tropoelastin Protein Expression - Monolayers LXSN LXSN 450 * * ** LV3SN 200 400 y * LV3SN

t * * * *

nsity 350 n 150 e 300 Mea

Intensi 250 e ce Int Mean e 100 200 150 Relativ 50 rescen 100 Relative rescenc

o 50 Fluo

Flu 0 0 1357 1357 Days in Culture Days in Culture

Versican Elas tin 600 250

450 188 t t n n u 300 u 125 Co Co

150 63

0 0 0 1 2 3 4 10 10 10 10 10 100 101 102 103 104 FITC-A PE-A

Figure 3.19 Flow cytometry assessment of versican and tropoelastin in monolayers. Relative mean fluorescence intensity was used to show the change in intracellular protein expression with respect to time. The histograms at day seven show the shift indicating positive staining for protein in LXSN cells (black) and LV3SN cells (red). Unfilled curve is negative control. n=3-5, mean ± SEM, *p<0.05, **p<0.005

- 60 - A) Versican Protein Expression - Collagen B) Tropoelastin Protein Expression - Collagen

LXSN LXSN 60 120 LV3SN y LV3SN * t

50 100 nsi n e a an t e e 40 n 80 I M 30 e 60 ve i t enc a cence Intensity

20 l 40 e esc Relative M 10 R 20 uor Fluores 0 Fl 0 1357 1357 Days in Culture Days in Culture

Versican Elas tin 600 250

450 188 t t n un 300 u 125 Co Co

150 63

0 0 0 1 2 3 4 10 10 10 10 10 100 101 102 103 104 FITC- A PE- A Figure 3.20 Flow cytometry assessment of versican and tropoelastin in collagen TEME. Relative mean fluorescence intensity was used to show the change in intracellular protein expression with respect to time. The histograms at day seven show the shift indicating positive staining for protein in LXSN TEMEs (black) and LV3SN TEMEs (red). Unfilled curve is negative control. n=3-5, mean ± SEM, *p<0.05, **p<0.005

- 61 - A) Versican Protein Expression - Fibrin B Tropoelastin Protein Expression - Fibrin

LXSN LXSN 180 350 LV3SN y LV3SN t * * 160 * 300

nsi

n 140 e a an t 250 e e 120 n I M 100 e 200 ve 80 i 150 t enc a cence Intensity

60 l

e 100 esc Relative M 40 R 50

20 uor Fluores 0 Fl 0 1357 1357 Days in Culture Days in Culture

Versican Elas tin 400 390

300 293 t n

u 195 200 ount C Co

100 98

0 0 0 1 2 3 4 100 101 102 103 104 10 10 10 10 10 FITC-A PE- A Figure 3.21 Flow cytometry assessment of versican and tropoelastin in fibrin TEME. Relative mean fluorescence intensity was used to show the change in intracellular protein expression with respect to time. The histograms at day seven show the shift indicating positive staining for protein in LXSN TEME (black) and LV3SN TEME (red). Unfilled curve is negative control. n=3-5, mean ± SEM, *p<0.05, **p<0.005

- 62 - 3.4 Discussion

Although significant characterization of LV3SN cells has been performed by

Wight and his colleagues[2, 127, 130], there is still a great deal to discover about the cells’ behavior in an in vitro three-dimensional system. This chapter detailed the effects of changing the extracellular environment from that of a monolayer to either a collagen or fibrin TEME. LV3SN cells were able to express more tropoelastin than LXSN cells in monolayers as well as in collagen and fibrin TEMEs. However, overall protein levels

were reduced in TEMEs relative to monolayers. Extended culture in collagen showed the

formation of a cell capsule. In this cell dense region, LV3SN cells stained strongly for

tropoelastin yet showed little GAG staining. The inverse was true in the LXSN cell

capsule. Finally, it was shown that fibrin had a stimulatory effect on LV3SN cells. These

cells proliferated more in this matrix and protein expression levels were greater in fibrin

than collagen. This has also been shown to be true in neonatal rat smooth muscle cells.

[41, 49, 68, 69, 136, 145, 158, 161],

Stimulating adult smooth muscle cells to produce elastin in a tissue engineered

media equivalent has proven to be challenging for the cardiovascular tissue engineering

community. Therefore the LV3SN cell’s unique ability to secrete increased amounts of

tropoelastin makes this genetically modified cell a promising cell source for TEMEs.

While the inverse relationship between versican and tropoelastin expression did

not completely reveal itself as expected, LV3SN cells were still able to produce more

tropoelastin than LXSN cells. However, this soluble protein did not become integrated in

the surrounding matrix. The overall tropoelastin expression level was attenuated in

TEMEs containing LV3SN cells and the empty vector LXSN control cells. This was

- 63 - comparable to findings in the literature that suggest that matrix production is reduced

when SMCs are entrapped in collagen or fibrin. [84, 136, 158]

Microscopy showed the morphological differences between LXSN and LV3SN

cells. LV3SN cells appeared to be less refractive and more flattened than LXSN cells.

Confocal imaging highlighted the punctate tropoelastin staining within LV3SN cells

suggesting the protein was sequestered in vesicles. It is interesting to note that there

wasn’t any tropoelastin labeling in the extracellular space. One possible explanation

could be an insufficient supply of elastin-binding proteins required to chaperone

tropoelastin out of the cell. [177] Another reason could be that the soluble precursor did

not crosslink or bind tightly to the matrix and was washed away during media changes or

the staining process.

Cumulative histological and immunohistochemical results suggested the

colocalization of proteoglycans and tropoelastin in areas of high density. Modified

Movat’s Pentachrome stain appeared to be limited to detecting dense fibers of mature

elastin. This may explain the absence of tropoelastin staining in the cell capsule.

Although this stain was not successful in detecting tiny elastic fibers or tropoelastin

depositions, it was useful in observing glycosaminoglycan concentrations in the tissue

engineered media equivalent. Since LV3SN cells overexpress versican V3 it is possible

that this isoform competes with V0 and V1 isoforms on the SMC surface [39, 136]

resulting in decreased GAG staining. When this data was combined with the more

specific immunostaining for elastin, the colocalization illustrated the inverse relationship

between GAG presence and that of tropoelastin.

- 64 - Another interesting histological observation was the presence of the large cell capsule that formed on the periphery of collagen TEMEs after extended culture. Fibrin

TEMEs cultured for the same length of time did not exhibit this phenomenon (image not shown). The capsule formation may be due decreased matrix porosity resulting from an increase in collagen compaction, cell number and matrix deposition over the extended culture. As cells migrated to the periphery of the tissue, they were no longer surrounded by the collagen lattice which inhibits proliferation. On the tissue’s outer surface, these cells were exposed to nutrient rich medium and proliferated rapidly. Increased amounts of elastin have been observed in cell capsules or areas increased cell density[177]

Not only did tropoelastin and versican expression vary with change in architecture, it varied as the matrix was changed from collagen to fibrin. Cummings,

Stegemann, and Long have demonstrated a difference in matrix remodeling and mechanical properties between collagen and fibrin based TEMEs.[32, 41, 136, 144, 145,

157, 158, 161] Tranquillo, Swartz, and others have shown that neonatal smooth muscle cells are able to remodel fibrin more quickly than collagen and produce measurable amounts of elastin and elastic fibers. [41, 150, 158, 161] The findings presented here suggest that fibrin had a more stimulatory affect on LV3SN cells. Fibrin promoted cell clusters over time (data not shown) and LV3SN cell proliferation as seen in figure 3.16.

It is also possible that fibrin degradation fragments released during remodeling triggered a mechanism that increased versican and tropoelastin protein synthesis.

Interestingly, versican expression varied considerably with respect to time and culture conditions. These changes may explain the variable tropoelastin levels. While

LV3SN cells were transduced to overexpress the V3 isoform, the introduction of

- 65 - reconstituted collagen and fibrin may have affected the expression efficacy. It is possible that the presence of collagen and fibrin could change the relative expression of the other

versican isoforms. This would explain the time dependent changes in tropoelastin

expression.

There are several concerns that need to be addressed before LV3SN cells can be

utilized to its fullest potential as an elastin source in TEMEs. One area of concern was the

observation that trends in gene expression were not necessarily reciprocated on the

protein level as documented by others.[2, 120] This could be attributed to a lag between

gene transcription and translation. After a period of time, gene expression may cease

while protein synthesis is still in progress. While monitoring mRNA expression is

desirable, it is the synthesis and translocation of the protein that is critical to final elastin

production.

Another concern was the ability to document the immediate response of LV3SN

cells to changes in substrate structure. The literature reveals that the half-life of

tropoelastin mRNA from freshly isolated aortic SMC from 2 day old chicks is 25 hours.

[15, 128] It can be presumed that the half-life is dramatically reduced in mature animals.

Therefore, it would be advantageous to observe the immediate effect of substrate

structure and composition. However, in order to compare monolayers with TEMEs, a

culture period greater than 24 hours was needed to allow smooth muscle cells to recover

from the transition of being embedded in TEME matrices.

It has been shown that LV3SN cells expressed more tropoelastin than LXSN cells

in 2D and 3D culture. Yet, the relative tropoelastin expression by LV3SN cells compared

to control cells it was not comparable to what has been demonstrated previously.

- 66 - Merrilees has shown a greater degree of tropoelastin overexpression and even elastic fiber formation. This was not the case in this study. Increased passaging, culture length, and even possibly the TEME fabrication process could account for the suppressed expression. Upregulation of the other versican isoforms may have contributed to the inconsistencies as well. These issues could be addressed by transducing the cells immediately before experimentation to reduce the number of passages and culture time before TEME fabrication. By carefully monitoring versican expression, the culture conditions could be modulated to promote versican-mediate tropoelastin expression.

- 67 - CHAPTER 4

TROPOELASTIN SYNTHESIS BY SMOOTH MUSCLE CELLS

THAT OVEREXPRESS V3 VERSICAN IS SENSITIVE TO

STIMULATION BY MEDIUM ADDITIVES

4.1 Introduction

Biological function is profoundly dependent upon a series of molecular interactions that translate external biochemical stimuli into directives for cell behavior.

Cells undergo a constant bombardment of bioactive molecules and must relay signals to the nucleus where adaptations of cell function are initiated. Like other extracellular matrix proteins, elastin production is sensitive to soluble factors in the environment surrounding the cell.

An abundance of chondroitin sulfate at the cell surface causes the 67-kD elastin- binding protein (EBP) to shed and inhibits tropoelastin synthesis.[82, 94, 95] The glycocalyx of mature smooth muscle cells is composed of approximately 50-60% chondroitin sulfate. [11] This may explain the diminished tropoelastin production seen in adult smooth muscle cells. Adult smooth muscle cells that overexpress versican V3 synthesize increased amounts of tropoelastin.[2] The V3 isoform of versican does not contain chondroitin sulfate side chains[2, 126, 127]; therefore, the mechanism by which

LV3SN cells overexpress tropoelastin may be linked to the reduced amounts of chondroitin sulfate at the cell surface. The exploitation of this feature may prove to be beneficial to the incorporation of elastin in tissue engineered media equivalents (TEMEs).

- 68 - In order to promote elastin synthesis in TEMEs, the addition of transforming growth factor beta-1 (TGF-β1), platelet derived growth factor (PDGF), and gene manipulation have been recommended.[89, 94, 95, 120] SMC cultures are frequently supplemented with TGF-β1 in the literature [42, 43, 53, 115, 117, 145, 158, 161, 178].

TGF-β has been shown to increase extracellular matrix proteins synthesis. It has also

been shown to stabilize tropoelastin mRNA four- to six-hours after being introduced to monolayer cell culture. [86, 87, 89, 94, 95, 112, 113, 155, 161, 179] This stabilization results in an increased expression of tropoelastin protein. Although the greatest influence is observed in neonatal cells[114, 145, 158, 161], this study endeavored to elicit the same response in LV3SN cells.

The aim of this chapter was to investigate the influence of medium additives on the production of tropoelastin. It was hypothesized that the introduction of additives to the culture medium would affect tropoelastin synthesis. This hypothesis was tested by comparing the response of LV3SN and LXSN cells supplemented with chondroitin sulfate, chondroitinase, and TGF-β1 in order to ascertain its influence on tropoelastin synthesis.

4.2 Materials and Methods

Dr. Thomas Wight provided adult arterial smooth muscle cells that were retrovirally transduced to overexpress versican V3, LV3SN cells, or an empty vector,

LXSN cells. The V3 cDNA cloning and transduction protocols have been described previously by Lemire et al.[48, 95, 119, 120, 155, 161] Cells were expanded in control media consisting Dulbecco’s modified Eagle medium (DMEM) (Cellgro, Herndon,VA),

- 69 - 10% fetal bovine serum (FBS) (Mediatech/Cellgro, Herndon, VA), 1% penicillin- streptomycin (Mediatech Cellgro), and 1% L-glutamine (Mediatech Cellgro). Cells were

0 incubated at 37 C in 5% CO2. Cells between passage 8 and 11 were used for experiments.

4.2.1 Monolayer Culture

A cell solution of 1 x 104 cells/cm2 was plated in 6-well dishes or on glass slides coated with a type I collagen solution (50µg/mL; MP Biomedicals, Irvine, CA). Cells were cultured for 24 hours in control media before stimulation.

4.2.2 Tissue Engineered Media Equivalent Fabrication

Cells were incorporated into type I collagen hydrogels (2 mg/mL; MP

Biomedicals) with a final cell concentration of one million cells per milliliter. Disk shaped hydrogels were created by pouring three milliliters of the cell-substrate solution into a 6-well plate. The disks were allowed to polymerize at 370C for one hour before being liberated from the well wall. Disks were cultured for 24hrs in control media before being stimulated.

4.2.3 Stimulation with Medium Additives

Twenty-four hours after monolayer plating and collagen disk fabrication, culture medium was replaced with media supplemented with chondroitin sulfate (200µg/mL;

Sigma, St. Louis, MO), chondroitinase (0.02U/mL; Sigma), or transforming growth factor beta-1 (TGF-β1; 2- or 5-ng/mL; R&D Systems, Minneapolis, MN). Media was refreshed every other day. The concentrations selected for this study were chosen based

- 70 - upon similar experiments in the literature. [89, 95, 120, 145, 155, 158, 161] Figure 4.1

summarizes the experimental timeline with assessments being made after one and seven

days of stimulation.

2nd Timepoint Fabricate Begin 1st Begin TEME Stimulation Timepoint * * Assessment

0 1 2 3 4 5 6 7

Figure 4.1 Experimental timeline for stimulation with medium additives. * represents media changes.

4.2.4 DNA Assay

Tissue engineered media equivalents were washed with DPBS, lyophilized, and

digested overnight in 1mL 0.5mg/mL proteinase K solution (Sigma, St. Louis, MO) at

500C. Cells in monolayer culture were trypsinized, counted, and centrifuged into a pellet.

One milliliter of the proteinase K solution was added to the cell pellet. A Hoechst

solution was prepared by adding 10µL of 1mg/mL Hoechst 33258 (Invitrogen, Carlsbad,

CA) stock in 100mL of tris-EDTA-NaCl (TEN; 10mM Tris + 1mM EDTA + 0.1M NaCl)

buffer. In a 96-well assay plate, 10µL of sample or standard was mixed with 200µL of

the Hoechst/TEN solution. After 30 minutes in the dark at 370C, DNA concentration was determined by measuring fluorescence (365nm excitation/458nm emission) on a Spectra

Max Gemini Microplate Spectrofluorometer. Samples were tested in triplicates, with at least three monolayer or disks collected per experiment. Standard curves were generated using calf thymus stock (Sigma) with concentrations between 0 and 10 µg/mL.

- 71 - 4.2.5 Gene Expression Analysis

4.2.5.1 RNA Isolation

An RNeasy Mini Kit (Qiagen, Valencia, CA) was used to isolate RNA from monolayers and TEMEs. Briefly, RLT buffer supplemented with β-mercaptoethanol was added directly to either monolayers or diced TEMEs snapped frozen in liquid nitrogen.

Samples were passed through an 18-gauge syringe needle at least ten times before being homogenized through Qiashredder (Qiagen) columns. RNA was isolated from the homogenized lysate with a series of buffers and centrifugation through provided columns.

RNA purity and concentration was determined by measuring the absorbance of 2

µL RNA in 58 µL dH2O. RNA samples with an absorbance ratio (A260nm/A280nm) greater than 1.8 were used for PCR experiments.

4.2.5.2 cDNA Synthesis

Complementary DNA (cDNA) templates were synthesized from total RNA using

Invitrogen’s Superscript III First-Strand Synthesis Kit for RT-PCR (Invitrogen, Carlsbad,

CA). One microgram of total RNA was suspended in 8µL of RNase free water. RNA denaturation occurred by heating the RNA, oligo(dT) primers and dNTP mix at 650C for

5 minutes. A synthesis mix containing 10X RT buffer, 25mM MgCl2, 0.1M DTT, RNase

Out, and SuperScript III RT was then added to the solution. A minus reverse transcriptase (-RT) control was also created for each sample by replacing the RT enzyme with water. Only genomic DNA, if present, could be amplified in the control samples during the PCR process. cDNA annealing and synthesis was achieved by heating the mix

- 72 - to 500C for 50 minutes. The reaction was terminated by incubation at 850C for 5 minutes.

Excess RNA was removed by adding RNase H and incubating at 370C for 20 minutes.

4.2.5.3 Quantitative Real Time PCR

The cDNAs of tropoelastin (sense – GAGCCCTGGGATATCAAGGTG,

antisense - GGGTCCCCAGAAGATCACTTTC) and versican V3 (sense –

AGCAGAGTGTGCAAACCGG, antisense - CCTCCAAGCTGCGTGAAGTT) were

amplified and quantitated using real time PCR. Primers were designed with Primer

Express software (Applied Biosystems, Foster City, CA) and synthesized by Integrated

DNA Technologies (Coralville, IA).

In PCR compatible optical tubes, the cDNA template, primers, water, and 2X

SYBR Green PCR Master Mix (15µL; Applied Biosystems, Foster City, CA) were

mixed. An ABI Prism 7700 Sequence Detection System was used for thermal cycling,

laser fluorescence induction, and detection of amplified cDNA. Gene expression levels

were measured using the standard curve method[174] to plot known concentrations of

standards against threshold cycle (CT) values, then converting the Ct values of the tested samples into cDNA concentrations.

4.2.6 Immunofluorescence

Monolayers were washed, fixed with 4% paraformaldehyde, and permeabilized with 0.1% Triton X-100. Tropoelastin was labeled with a polyclonal antibody against elastin (1:100; Elastin Products Co., Owensville, MO) and a donkey anti-goat AlexaFluor

488 secondary antibody (1:200, Molecular Probes, Carlsbad, CA). Cell nuclei were

- 73 - stained with Hoescht33258. A Zeiss LSM 510 confocal microscope was used to view and capture the images.

4.2.7 Histology

Tissues were washed in DPBS, fixed in 4% paraformaldehyde, processed with a

Shandon Pathcentre Enclosed Tissue Processor (Thermo Fisher Scientific, Waltham,

MA) and paraffin embedded. Using a Microm HM 355S microtome (Mikron

Instruments Inc., San Marcos, CA), 7µm sections were generated. A filtered, 1% orcein solution (Sigma, St. Louis, MO) was applied to deparaffinized tissue samples for thirty minutes at 600C.

4.2.8 Flow Cytometry

Cells were isolated with either collagenase digestion (600U/mL type 2 collagenase; Worthington Biochemical Corp, Lakewood, NJ) or trypsinization, neutralized with serum supplemented DMEM, washed in PBS with Tween, and fixed for

10 minutes. Cells were then permeabilized for five minutes with 0.1% Triton X-100.

Next, 4% normal donkey serum was added to block cells for one hour at 370C. Cells were

incubated for one hour in antibodies against tropoelastin (1:100; Elastin Products Co,

Owensville, MO) and versican (1µg/mL; Abcam, Cambridge, MA) followed by thirty

minutes in Alexa Fluor conjugated secondary antibodies (1:200 donkey anti-goat +

AlexaFluor546 and 1:500 donkey anti-goat + AlexaFluor488; Molecular Probes,

Carlsbad, CA). An autofluorescence control for each sample was created by blocking

cells and staining with the secondary antibodies only. Samples were analyzed with a BD

- 74 - LSR flow cytometer (BD Biosciences, San Jose, CA) and FCS Express software (De

Novo Software, Los Angeles, CA). Protein expression levels were quantitated by measuring shifts in the geometric mean of relative fluorescence intensity.

4.2.9 Statistical Analysis

Statistical analysis was performed using the General Linear Model (GLM) of the

Analysis of Variance (ANOVA) method. Experiments were performed at least three times with samples assayed in triplicate to generate mean values. The standard error of the mean was represented as error bars. Data comparisons with p-values less than 0.05 were considered to be statistically significant.

- 75 - 4.3 Results

The addition of soluble factors to smooth muscle cells can yield a rapid response.

Changes in cell morphology, proliferation, mRNA expression and protein expression often result. Chondroitin sulfate, chondroitinase ABC, and TGF-β1 elicited different responses from LXSN and LV3SN cells after just one day of treatment. However, after several days of exposure to chondroitinase, LXSN and LV3SN cells were no longer viable. Therefore, the experiment could not be continued out to seven days with this treatment.

Figures 4.2 and 4.3 show the morphology of LXSN and LV3SN monolayers after one day of stimulation with medium additives. Cells were initially seeded in a six-well plate at a concentration of 1x104 / cm2. After one day of stimulation, LV3SN monolayers treated with chondroitin sulfate became overconfluent. These cells had large nuclei and a cobblestone appearance. LXSN cells formed clusters in the presence of both chondroitin sulfate and chondroitinase. In the presence of 2- and 5ng/mL of TGF-β1, LXSN and

LV3SN monolayers appeared to have less cell projections, clusters, or enlarged nuclei.

LXSN and LV3SN cells had a similar rounded appearance after one day of TGF-β1 treatment. Moreover, there was no apparent change in monolayer morphology when treated with 2ng/mL versus 5ng/mL of the growth factor.

- 76 - A) C)

B) D)

Figure 4.2 Light microscopy of monolayers after 24 hours of chondroitin sulfate and chondroitinase stimulation. LXSN cells (A and B), LV3SN cells (C and D). Treated with either 200µg/mL chondroitin sulfate (A,C) or 0.02U/mL chondroitinase ABC (B,D). 20X magnification

- 77 - A) B)

C) D)

E) F)

Figure 4.3 Light microscopy of monolayers after 24 hours of TGF-β1 stimulation. LXSN cells (A, C, E), LV3SN cells (B, D, F). Stimulated with either no treatment (A,B) 2ng/mL TGF-β1 (C,D) or 5ng/mL TGF-β1(E,F). 5Xmagnification

- 78 - 4.3.1 Proliferation

Medium additives had marked effects on proliferation in collagen LXSN cell

TEMEs and LV3SN cell TEMEs after one and seven days as assessed with Hoechst DNA assay. After one day of stimulation, there was no difference between untreated LXSN and

LV3SN cell TEMEs or those treated with chondroitin sulfate (figure 4.4). When exposed to 5ng/mL TGF-β1, LV3SN cell TEMEs had more DNA; however the trend was not

statistically significant. The number of LXSN cells in TEMEs treated with 2ng/mL TGF-

β1 was significantly lower than TEMEs without stimulation and those treated with

chondroitin sulfate or chondroitinase. LXSN cell TEMEs treated with 5ng/mL TGF-β1 had significantly fewer cells than those cultured in control medium. LV3SN cell TEMEs treated with 2ng/mL TGF-β1 had fewer cells than the chondroitin sulfate treated TEMEs.

Overall, after one day of stimulation, TGF-β1 had a greater effect on LXSN cells than

control medium or other treatments. LV3SN DNA content in TEMEs did not change

when exposed to chondroitin sulfate.

When treated for seven days, DNA content in TEMEs remained unchanged in

control media and chondroitin sulfate (figure 4.5). Yet, chondroitinase treatment proved

to be lethal to cells in TEMEs. Unlike the effect after one day, TGF-β1 promoted cell

proliferation in LXSN and LV3SN cells after seven days. LXSN cell TEMEs exhibited a

four-fold increase in DNA content when cultured in 2ng/mL of TGF-β1. LV3SN cell

TEMEs treated with 5ng/mL of TGF-β1 had a significantly greater amount of DNA when

compared to all other treatments. There was no difference in LV3SN DNA content after

seven days of culture with control media, chondroitin sulfate, or 2ng/mL TGF-β1.

- 79 - DNA Content - LXSN BMediumiochemi calTre Sattmenimulatt1io Dan 1y Day LV3SN % 35

) 30 L

m * 25 g/ u (

t 20 * n e t

n 15 o 10 A C †

DN 5 #

0 No Treatment Chondroitan Chondroitinase 2ng/mL TGF-b1 5ng/mL TGF-b1 Sulfate Treatment

Figure 4.4 DNA content in TEME after one day of exposure to medium additives. n=3-8, mean ± SEM, * p< 0.05 LXSN vs. LV3SN; % p<0.05 LXSN vs. LXSN; # p<0.05 vs. LXSN no treatment, chondroitin sulfate, chondroitinase; † p<0.05 vs. LV3SN chondroitin sulfate.

DNA Content - LXSN BMediumiochemic Treal Satimtmenulatio 7n Da 7 yDsa ys LV3SN 50 # 45 * )

L 40 m 35 g/ u † ( 30 t n

e 25 nt

o 20 15 A C

DN 10 5 0 No Treatment Chondroitan Sulfate 2ng/mL TGF-b1 5ng/mL TGF-b1 Treatment

Figure 4.5 DNA content in TEME after seven days of exposure to medium additives. n=3-8, mean ± SEM, * p< 0.05 LXSN vs. LV3SN, # p<0.05 LXSN vs. LXSN, † p<0.05 vs. LV3SN no treatment, chondroitin sulfate, 2ng/mL TGF-β1.

- 80 - 4.3.2 Gene Expression

Gene expression in stimulated monolayers was assessed using qRT-PCR on lysed cells. Gene expression after one day of stimulation was represented in terms of cDNA concentration generated from one microgram of total RNA (figures 4.6 and 4.7, respectively). Sufficient quantities of quality RNA could not be collected from stimulated

TEMEs therefore the gene expression was not shown.

After one day, significant differences in versican mRNA levels between LXSN and LV3SN monolayers were evident in samples treated with control media, chondroitinase, and 2ng/mL TGF-β1. LV3SN cells expressed more versican mRNA than

LXSN cells in untreated conditions only. Chondroitinase treatment of LXSN cells elicited

the highest expression of versican mRNA relative to all other treatments. The amount of

versican in this sample was at least five times higher than any treatment in both LXSN

and LV3SN cells. Two nanograms per milliliter of TGF-β1 significantly increased LXSN

versican expression when compared to chondroitin sulfate and 5ng/mL TGF-β1 treatment

or no treatment at all. There was no difference in versican expression in any of the treated

LV3SN monolayers.

Figure 4.6 shows the effects of medium additives on tropoelastin gene expression.

Tropoelastin cDNA concentration was lower in LV3SN cells than LXSN cells in all

treated conditions. The difference in tropoelastin expression was statistically significant

in all treated monolayers. LXSN cells treated with 2ng/mL TGF-β1 exhibited higher

levels of tropoelastin mRNA than nontreated cells and those treated with 5ng/mL TGF-

β1. Although higher than non-treated cells, there was no difference tropoelastin gene

- 81 - expression in LXSN cells treated with chondroitin sulfate and chondroitinase. LV3SN cells treated with chondroitin sulfate experienced an increase in mRNA expression when compared all other treatments except 2ng/mL TGF-β1. Conversely, LV3SN cells treated with 5ng/mL TGF-β1 showed a significantly lower expression of tropoelastin than cells undergoing all other stimulation except chondroitinase.

After seven days of stimulation, LXSN cells continued to have an elevated level of tropoelastin gene expression when compared to LV3SN cells (data not shown).

Versican Gene Expression - Biochemical Stimulation of Monolayers 1 Day Medium Treatment of Monolayers 1 Day LXSN 6 LV3SN ** ) M

p 5 ( on i 4 at r 3 # **

oncent ** 2 C A

N 1 % cD 0 No Treatment Chondroitan Chondroitinase 2ng TGF-b1 5ng TGF-b1 Sulfate Treatment

Figure 4.6 Versican gene expression in monolayers after one day of exposure to medium additives. n=4, mean ± SEM, ** p<0.001 LXSN vs. LV3SN; # p< 0.001 vs. LXSN no treatment, chondroitin sulfate, 2ng/mL TGF-β1, 5ng/mL TGF-β1; % p<0.05 vs. LXSN no treatment, chondroitin sulfate, chondroitinase, 5ng/mL TGF-β1

- 82 -

Tropoelastin Gene Expression - Biochemical Stimulation of Monolayers 1 Day Medium Treatment of Monolayers 1 Day LXSN LV3SN 14 # )

M 12 # p ( n

o 10 * ** ** ** i at r

t 8 en

c 6 § n o

C 4 A

N † 2 cD 0 No Treatment Chondroitan Chondroitinase 2ng TGF-b1 5ng TGF-b1 Sulfate Treatment

Figure 4.7 Tropoelastin gene expression in monolayers after one day of exposure to medium additives. n=4, mean ± SEM, * p<0.05 LXSN vs. LV3SN; ** p<0.001 LXSN vs. LV3SN; # p< 0.005 LXSN vs. LXSN;§ p<0.001 vs. LV3SN no treatment, chondroitinase, 5ng/mL TGF-β1; † p<0.001 vs. LV3SN no treatment, chondroitin sulfate, 2ng/mL TGF-β1.

- 83 - 4.3.3 Qualitative assessment and morphology

Qualitative assessments revealed that the soluble tropoelastin protein remained largely in the cytoplasmic domain in both monolayer and TEME cultures after stimulation. At the end of stimulation, monolayers were fixed, permeabilized and fluorescently probed for tropoelastin. Immunofluorescence labeling in LV3SN monolayers after one day of stimulation is shown in Figure 4.8. The protein was localized

near the nucleus, in a similar perinuclear pattern observed by Grosso et al.[180]

Chondroitinase treated cells had a slight increase in tropoelastin labeling relative to cell

treated with chondroitin sulfate. Tropoelastin was more uniformly dispersed throughout

the cell in the presence of TGF-β1. The higher dosage of the growth factor elicited an

elevated synthesis of the protein. Similar staining patterns were observed in stimulated

LXSN monolayers (not shown).

- 84 - A) B)

C) D)

E)

Figure 4.8 Confocal microscopy of intracellular tropoelastin in LV3SN monolayers treated with medium additives. Cells on collagen-coated slides after 24 hours of stimulation with no treatment (A), 200µg/mL chondroitin sulfate (B), 0.2U/mL chondroitinase (C), 2ng/mL TGF-β1 (D), 5ng/mL TGF-β1 (E). Nuclei appear blue, tropoelastin appears green. 40X magnification.

- 85 - Orcein staining was used to observe cell morphology and tropoelastin distribution[176] in TEMEs after stimulation. Fixed TEMEs were paraffin embedded and sectioned thinly before staining. Treatment with chondroitin sulfate, chondroitinase, and

TGF-β1 had different effects on cell shape and distribution throughout the collagen disks.

Following one day of stimulation, modest tropoelastin staining was visible in LXSN cells

(figure 4.9). LXSN cells appeared to cluster when treated with chondroitin sulfate, while remaining as single cells under other treatment conditions. In the presence of TGF-β1, the nucleus occupied much of the oddly shaped diminutive cells.

LV3SN cells in TEMEs fared better than LXSN cells after one day of stimulation

(figure 4.10). Like the control cells, clusters formed in the chondroitin sulfate treated disks. However, unlike the control cells, more intracellular tropoelastin was detectable with orcein. Cell clusters also formed in TGF-β1 stimulated TEMEs. The clustering cells also formed long finger-like processes unlike LXSN or LV3SN cells treated with control medium (not shown), chondroitin sulfate, or chondroitinase. Additionally, the TGF-β1 treated cells exhibited more diffuse cytoplasmic staining similar to the treated LV3SN monolayers.

After seven days of stimulation, the cell clusters common after the first day of treatment were no longer apparent (figure 4.11). Orcein staining intensity was

comparable in both LXSN and LV3SN cell TEMEs. Chondroitin sulfate caused the cells

to maintain a rounded morphology with prominently nuclei. Transforming growth factor

beta-1 treated TEMEs exhibited a higher concentration of cells throughout the disk. This increase was quantitatively confirmed in figure 4.4. The lower dosage of TGF-β1

- 86 - produced cells that were more elongated and preferentially aligned in the disk. The higher dosage did not have this affect although LV3SN cells were less rounded in shape.

- 87 - A) B)

C)

D) E)

Figure 4.9 Orcein staining of LXSN TEMEs after one day of stimulation with medium additives. Tropoelastin, appearing reddish-brown, is visible within the cells in the TEME but not in the surrounding matrix. Cells appear to be sparse and oriented randomly. A) No treatment, B) 200µg/mL Chondroitin sulfate, C) 0.2U/mL Chondroitinase, D) 2ng/mL TGF-β1, E) 5ng/mL TGF-β1. 20X magnification

- 88 - A) B)

C)

D) E)

Figure 4.10 Orcein staining of LV3SN TEMEs after one day of stimulation with medium additives. Tropoelastin appears reddish-brown. Cells cluster in the presence of chondroitin sulfate and TGF-β1. A) No treatment, B) 200µg/mL Chondroitin sulfate, C) 0.2U/mL Chondroitinase, E) 2ng/mL TGF-β1, F) 5ng/mL TGF-β1. 20X magnification

- 89 - A) B)

C) D)

E F

G H

Figure 4.11 Orcein staining of TEME after seven days of stimulation with medium additives. Tropoelastin stains brown. LXSN (A,C,E,G), LV3SN (B,D,F,H). no treatment (A and B), 200µg/mL Chondroitin sulfate (C and D), 2ng/mL TGF-β1(E and F), 5ng/mL TGF-β1 (G and H). 20X Magnification

- 90 - The effects of medium additives on versican and tropoelastin protein associated with cells in monolayer and TEME conditions were quantitated using flow cytometry.

After one and seven days of stimulation, monolayers were trypsinized and TEMEs were collagenase digested to collect cells for assessment. Cells were then fixed, permeabilized, and stained for cell associated versican and tropoelastin.

Histograms showing the shift in mean fluorescence intensity after treatment are shown for versican and tropoelastin proteins (figure 4.12 and 4.13, respectively). Shifts in fluorescence were more pronounced in cells that were stimulated as monolayers than those stimulated in TEMEs. The amount of expression in intracellular and surface associated proteins was quantitated by subtracting the geometric mean fluorescence of unlabelled cells from the geometric mean fluorescence of the stained sample. The quantified results are shown in figures 4.14 – 4.17.

- 91 - VERSICAN

Day 1 Day 7 Monolayer TEM Monolayer TEM

A) Versican Versican Versican Versican 150 50 500 600

120 40 400 450

t 90 30 300 t t n n u u 300 oun ount C C Co 60 20 Co 200

150 30 10 100

0 0 0 0 0 1 2 3 4 0 1 2 3 4 0 1 2 3 4 10 10 10 10 10 10 10 10 10 10 0 1 2 10 10 10 10 10 FITC-A 10 10 10 FITC-A FITC-A FITC-A

B) Versican Versican Versican Versican 250 200 300 250

250 200 200 150 200

t 150 t t

t 150 n n n n u u u 100 150 u Co Co Co 100 Co 100 100 50 50 50 50

0 0 0 0 100 101 102 103 104 100 101 102 103 104 100 101 102 103 104 100 101 102 103 104 FITC-A FITC-A FITC-A FITC-A

C) Versican Versican 200 300

250 150 200 t t n n u u 100 150 Co Co 100 50 50

0 0 100 101 102 103 104 100 101 102 103 104 FITC-A FITC-A

D) Versican Versican Versican Versican 150 300 300 50

125 250 250 40 100 200 200 t t t

t 30 n n n n u u u 75 150 150 u Co Co Co Co 20 50 100 100

10 25 50 50

0 0 0 0 100 101 102 103 104 100 101 102 103 104 100 101 102 103 104 100 101 102 103 104 FITC-A FITC-A FITC-A FITC-A

E) Versican Versican Versican Versican 150 300 400 100

250 120 300 75 200 t t

90 t t n n n n u u u u 150 200 50 Co Co Co Co 60 100 100 25 30 50

0 0 0 0 100 101 102 103 104 100 101 102 103 104 100 101 102 103 104 100 101 102 103 104 FITC-A FITC-A FITC-A FITC-A

Figure 4.12 Histograms of versican protein content as determined by flow cytometry. LXSN cells (black) LV3SN cells (red) Unfilled curve is negative control. A) No treatment, B) Chondroitin sulfate, C) Chondroitinase, D) 2ng/mL TGF-β1, E) 5ng/mL TGF-β1

- 92 - TROPOELASTIN

Day 1 Day 7 Monolayer TEM Monolayer TEM

Elas tin Elas tin Elas tin A) Elas tin 200 200 500 350

300 160 400 150 250 120 300 t 200 n t n u u

ount 100 ount Co C Co C 150 80 200 100 50 40 100 50

0 0 0 0 0 1 2 3 4 0 1 2 3 4 10 10 10 10 10 0 1 2 3 4 0 1 2 3 4 10 10 10 10 10 FITC-A 10 10 10 10 10 10 10 10 10 10 PE- A PE- A PE- A

B) Elas tin Elas tin Elas tin Elas tin 250 200 287 300

200 250 150 215 200 150 100 ount ount 144

ount 150 ount C C C 100 C 100 50 72 50 50

0 0 0 0 0 1 2 0 1 2 0 1 2 10 10 10 10 10 10 10 10 10 100 101 102 103 104 PE- A PE- A PE- A PE- A

C) Elas tin Elas t in 200 300

250 150 200 t n 100 u 150 ount Co C 100 50 50

0 0 0 1 2 3 4 100 101 102 103 104 10 10 10 10 10 PE- A PE- A

D) Elas tin Elas tin Elas tin Elas tin 150 350 300 300

300 125 250 250 250 100 200 200 200 75 150 ount ount ount 150 ount C C C

150 C 50 100 100 100

25 50 50 50

0 0 0 0 0 1 2 3 4 0 1 2 3 4 0 1 2 10 10 10 10 10 10 10 10 10 10 100 101 102 103 104 10 10 10 PE- A PE- A PE- A PE- A

E) Elas tin Elas tin Elas tin Elas tin 150 350 353 100

300 120 265 75 250 90 200 177 50 ount ount ount ount C C C C 150 60 100 88 25 30 50

0 0 0 0 100 101 102 103 104 100 101 102 103 104 100 101 102 103 104 100 101 102 103 104 PE- A PE- A PE- A PE- A

Figure 4.13 Histograms of tropoelastin protein content as determined by flow cytometry. LXSN cells (black) LV3SN cells (red) Unfilled curve is negative control. A) No treatment, B) Chondroitin sulfate, C) Chondroitinase, D) 2ng/mL TGF-β1, E) 5ng/mL TGF-β1

- 93 - Figure 4.14 shows the effect of medium additives on monolayers after one day of treatment. In the presence of chondroitin sulfate and chondroitinase, versican protein levels were significantly diminished in both LXSN and LV3SN monolayers when compared TGF-β1 and no treatment. LV3SN cells showed significantly greater amounts of versican than LXSN cells in control media as well as media supplemented with

chondroitinase. Within LXSN monolayers, the TGF-β1 stimulated cells had the most

versican protein expression. However, LV3SN monolayers stimulated with TGF-β1

expressed similar amounts of versican as those cultured without stimulation.

Tropoelastin expression was only statistically different between the two cell types

for chondroitinase treatment conditions. Similar to versican protein, tropoelastin

expression was lower in cells treated with chondroitin sulfate and chondroitinase when

compared to other treatments. Additionally, TGF-β1 increased tropoelastin expression in

both cell types relative to their respective controls after one day of stimulation.

The effects of treatment on versican in TEME cultured cells were analogous to

those seen in monolayer culture (figure 4.15). LV3SN tropoelastin expression was

greater than LXSN tropoelastin expression in untreated conditions as well as TEMEs

treated with chondroitin sulfate and chondroitinase. Interestingly, LXSN cells had

significantly more tropoelastin labeled in TEMEs stimulated with 2ng/mL TGF-β1 than

any other sample. There was no difference between LXSN and LV3SN cell TEME

tropoelastin levels after the 5ng/mL TGF-β1 treatment. Overall, TGF−β1 elevated

tropoelastin expression in each cell type.

- 94 - Following a week of stimulation, LXSN and LV3SN cells expressed similar levels of the versican and tropoelastin protein for virtually all treatments of the monolayers as shown in figure 4.16. The only exception was the significantly increased versican expression by LV3SN cells treated by chondroitin sulfate. Regardless of treatment, LV3SN cells did not express greater amounts of tropoelastin than LXSN cells after seven days of exposure. Within each cell type, there was no difference in versican expression in cells that experienced no treatment and those cultured in TGF-β1.

However, tropoelastin was significantly higher in LXSN cells treated with 5ng/mL TGF-

β1 than LXSN cells in other conditions. LV3SN cells treated with the higher TGF-β1 dosage had more tropoelastin than those cultured with other treatments. However the increase was only statistically significant when compared to the chondroitin sulfate treated cells.

Collagen TEMEs stimulated for seven days exhibited greater variation in protein expression between cell types than stimulated monolayer cultures (figure 4.17). Once more, chondroitin sulfate treated samples expressed lower amounts of versican protein.

LXSN cell TEMEs stimulated with TGF-β1 expressed more versican than LV3SN cell

TEMEs in the same conditions. LV3SN cell TEMEs stimulated with 2ng/mL TGF-β1 had a surprisingly low expression of versican (one third of the expression seen in control medium). This level was comparable to LV3SN cell TEMEs treated with chondroitin sulfate. LV3SN tropoelastin expression followed the same trend as versican expression when cultured in the same conditions. In the case of LXSN cell TEMEs, tropoelastin expression was higher than LV3SN cell TEMEs that were stimulated with chondroitin

- 95 - sulfate or TGF-β1. Furthermore, there was no difference in the effect of control medium and chondroitin sulfate treatment on the LXSN cell TEME tropoelastin expression.

Versican Protein Expression - Monolayer Day 1 LXSN

y 100 * LV3SN

n ensit 80 * * e Int Mea 60 enc c

lative 40 res Re o 20

Flu # † # † 0 no treatment Chondroitan Chondroitinase 2ng TGF b1 5ng TGF b1 Sulfate Treatment

Tropoelastin Protein Expression - Monolayer Day 1 LXSN 80 LV3SN

* nsity 60 Inte 40 ence tive Mean ††

resc 20 Rela # # § Fluo 0 no treatment Chondroitan Chondroitinase 2ng TGF b1 5ng TGF b1 Sulfate Treatment

Figure 4.14 Flow cytometry quantitation of tropoelastin protein expression in monolayers after one day of stimulation with medium additives. n= 3-5, Mean ± SEM, *p > 0.05, **p > 0.001, #p > vs no treatment, 2ng/mL TGF-β1, 5ng/mL TGF-β1; §p > 0.05 vs. no treatment, †p > 0.05 vs. no treatment, 2ng/mL TGF-β1, 5ng/mL TGF- β1; ††p>0.001 vs. no treatment.

- 96 - Versican Protein Expression - TEMETEBV DaDayy 1 LXSN 20 * LV3SN 18

16 nsity * * 14

Inte 12

10 ## ##

tive Mean 8 6 rescence Rela

o 4 † 2 † Flu 0 no treatment Chondroitan Chondroitinase 2ng TGF b1 5ng TGF b1 Sulfate Treatment

Tropoelastin Protein Expression - TEMETEBVDa Dayy 1 1 LXSN 60 LV3SN * * * * * * 50 nsity 40 Inte 30 # ence tive Mean 20 § #

resc #

Rela † 10 # Fluo 0 no treatment Chondroitan Chondroitinase 2ng TGF b1 5ng TGF b1 Sulfate Treatment

Figure 4.15 Flow cytometry quantitation of tropoelastin protein expression in TEMEs after one day of stimulation with medium additives. n= 3-5, Mean ± SEM, *p > 0.05, **p > 0.001, ## p>0.001 vs. no treatment, chondroitin sulfate, chondroitinase; † p>0.05 vs. no treatment, 2ng/mL TGF-β1, 5ng/mL TGF-β1; # p >0.05 vs. no treatment, chondroitin sulfate, chondroitinase; § p>0.05 vs. 2ng/mL TGF-β1, 5ng/mL TGF-β1

- 97 - Versican Protein Expression - Monolayer Day 7 LXSN 50 LV3SN ity s 40 * *

Inten 30 nce tive Mean 20 resce Rela 10 † Fluo # 0 no treatment Chondroitan Sulfate 2ng TGF b1 5ng TGF b1 Treatment

Tropoelastin Protein Expression - Monolayer Day 7 LXSN 70 LV3SN 60

an 50 40 30 % § 20 Relative Me 10 Fluorescence Intensity 0 no treatment Chondroitan Sulfate 2ng TGF b1 5ng TGF b1 Treatment

Figure 4.16 Flow cytometry of protein expression in monolayers after seven days of stimulation with medium additives. n= 3-5, Mean ± SEM, *p > 0.05, **p > 0.001, # p >0.05 vs. no treatment, 2ng/mL TGF-β1, 5ng/mL TGF-β1; † p > 0.05 vs. no treatment, 2ng/mL TGF-β1, 5ng/mL TGF-β1; % p> 0.05 vs. no treatment, chondroitin sulfate, 2ng/mL TGF-β1; § p > 0.05 vs. no treatment, chondroitin sulfate, 2ng/mL TGF- β1

- 98 -

Versican Protein Expression - LXSN TEMETEBV Day 7 50 LV3SN y * * * 40 n ensit 30 e Int Mea

enc 20 c lative # † res Re

o 10 Flu 0 No Treatment Chondroitan 2ng TGF b1 5ng TGF b1 Sulfate Treatment

Tropoelastin Protein Expression - TEMETEBV Day 7 LXSN 50 LV3SN ** ** 40

30

20 † Relative Mean 10 #

Fluorescence Intensity 0 No Treatment Chondroitan 2ng TGF b1 5ng TGF b1 Sulfate Treatment

Figure 4.17 Flow cytometry of protein expression in collagen TEMEs after seven days of stimulation with medium additives. n= 3-5, Mean ± SEM, *p > 0.05, **p > 0.001, † p >0.05 vs. chondroitin sulfate, 2ng/mL TGF-β1; # p >0.05 vs. 2ng/mL TGF- β1, 5ng/mL TGF-β1

- 99 - 4.4 Discussion

Soluble factors within tissues augment cell-matrix interactions. These bioactive

proteins and molecules regulate cell function and response capability. The addition of

cupric sulfate, retinoic acid, insulin, aldosterone, transforming growth factor beta-1

(TGF-β1) and lysyl oxidase has been demonstrated to encourage tropoelastin synthesis

and elastic fiber formation in monolayers as well as in engineered tissues. [110, 112-114,

130] It is this increase in tropoelastin that was sought in the fabrication of a tissue

engineered media equivalent using LV3SN cells as a source.

In this chapter, the effects of chondroitin sulfate, chondroitinase and TGF-β1 on cell morphology and tropoelastin expression were explored. It was shown that changes in

chondroitin sulfate concentration negatively impacted SMC function in monolayer and

TEME culture. Abnormal cell morphology and decreased protein synthesis resulted from

these treatment. Meanwhile, TGF-β1 produced a rounded cell shape in monolayers and

increased cell proliferation and elongation in TEMEs. Diffuse labeling of tropoelastin

was observed in the presence of TGF-β1, contrary to the punctate staining seen in

untreated cells. The most significant finding was the direct correlation between cell

proliferation and tropoelastin protein expression in response to the factors added to the

medium.

Exogenous chondroitin sulfate was added to culture determine if cells would

become sensitized and reduce tropoelastin production. It has been demonstrated

repeatedly that the addition of β-galactosugars like chondroitin sulfate to elastogenic cells

causes elastin binding proteins to shed and disturb elastic fiber formation.[72, 108, 112,

113, 181] Conversely, chondroitinase ABC was added to see if even greater tropoelastin

- 100 - synthesis would result from digesting the remaining GAGs in the culture. Finally, TGF-

β1 was selected due findings indicating increased elastic fiber formation in tissues treated with this growth factor. [32, 40, 42, 161]

It was demonstrated that chondroitin sulfate affected cell proliferation and tropoelastin production. Even though LXSN and LV3SN cells were seeded at the same density, LV3SN cells proliferated more rapidly in chondroitin sulfate after 24 hours of treatment. This was a surprisingly different response than what has been described in the literature.[2, 120, 127, 130, 133] This increase in proliferation, however, did not translate to the stimulated TEMEs. Chondroitin sulfate also had an inhibitory effect on tropoelastin

synthesis. [9, 11, 126, 130, 131] The current studies corroborated this finding in

monolayers. However after seven days of exposure, versican and tropoelastin protein

expression remained at control levels in TEMEs.

To further test the effects of chondroitin sulfate on cell behavior, chondroitinase

ABC was added to remove existing GAGs from the cell surface. An increase in

tropoelastin was expected, but this did not occur. The response to chondroitinase was

remarkably similar to that of the chondroitin sulfate treated cells. Although experiments

could not be extended to seven days with chondroitinase treatment, a decrease in versican

and tropoelastin protein synthesis was observed in both cell types regardless of the

substrate. A possible explanation for this unexpected outcome could be the nonspecific

digestion by chondroitinase ABC. This enzyme indiscriminately digests chondroitin

sulfate in the glycocalyx of the cell, including that which is found on decorin and

biglycan. The excessive removal of these GAGs could have altered cell adhesion,

migration, and proliferation, [22, 32] and many other functions. These effects were

- 101 - evidenced in the morphological changes seen in monolayer and TEME cultures. While the addition of chondroitin sulfate reduced tropoelastin synthesis, the removal of this and other sugars may have created a negative effect on tropoelastin protein synthesis as well.

TGF-β1 has been shown to stimulate tropoelastin synthesis. This growth factor stabilizes tropoelastin mRNA by increasing its half-life. [22, 89, 95]Thus, an increase in tropoelastin production is more likely. LXSN and LV3SN cells treated with TGF-β1 were shown to have an increase in tropoelastin production. In TEMEs, both cells responded to extended culture in TGF-β1 with increased proliferation, elongation, and alignment relative to the first day of treatment. Yet, it is the control cell that exhibited a more dramatic response in proliferation, gene expression, and protein expression. The increase in tropoelastin synthesis due to TGF-β1 treatment correlates to the increase in cell number. This correlation has also been shown by others.[155, 158] However, there is

more evidence showing that TGF-β1 inhibits proliferation.[40, 42, 178] The

contradictory response to TGF-β1 can be attributed to many factors. One reason may be

the length of exposure and the time point selected for assessment. Our study also showed

a decrease in DNA content after one day of treatment. Yet, on the final day culture, 48

hours after the last stimulation, a significant increase in DNA content was observed.

While protein was modulated by factors added to the medium, the overall

expression levels in TEMEs were lower than those in monolayers. Reconstituted collagen

has been shown to suppresses SMC response to soluble growth factors [53, 112, 178,

182] and possibly other stimulatory molecules. Despite this fact, the change in expression

of the treated samples followed similar a trend in 2D and 3D.

- 102 - The discrepancy between gene and protein expression may be due to the timing of assessment. Elastin mRNA expression in confluent monolayers has been shown to peak after sixteen hours of TGF-β1 exposure.[16, 40, 44, 115, 169, 170, 183] However, in

order to compare monolayers with TEMEs, a longer culture period was needed to allow

the smooth muscle cells to acclimate to the collagen matrix. This factor, along with the

previously described challenges, illustrates the importance of additive specificity, dosage,

and length of exposure.

- 103 -

CHAPTER 5

MECHANICAL STIMULATION INCREASES TROPOELASTIN

SYNTHESIS BY VERSICAN V3 OVEREXPRESSING SMOOTH

MUSCLE CELLS IN TISSUE ENGINEERED MEDIA

EQUIVALENTS

5.1 Introduction

The artery is a physically dynamic tissue and the cells that reside there actively respond to stress and changes in the extracellular matrix.[32, 121] An extensive amount of research has been conducted examining the mechanical forces within the artery and the effects upon its population of cells. [41, 138, 139, 184-186] It has been shown that cyclic mechanical strain that results from normal forces exerted radially through the vessel wall can affect smooth muscle cell (SMC) phenotype. [36, 115, 128, 140, 187] The forces transmitted through matrix proteins influence cell proliferation, migration, protein synthesis, as well as matrix remodeling and alignment.

Varying modes of mechanical stimulation have been utilized to induce cell alignment, increase elastin content as well as improve mechanical strength in tissue engineered blood vessels. [21, 32, 42, 138, 157, 169, 170, 177, 185] Stimulation in the form of cyclic distension has been shown to promote extracellular matrix synthesis and remodeling by SMCs. Seliktar et al. demonstrated that collagen hydrogels seeded with rat arterial smooth muscle cells exhibited increased stiffness and ultimate tensile strength

- 104 - - 104 - after four days of 10% cyclic strain at 1 Hz frequency.[188] It has also been shown that mechanically conditioned SMCs maintain a contractile phenotype.[44, 140, 170]

The objective of this chapter was to observe the effects of mechanical stimulation

on adult smooth muscle cells that have been retrovirally mediated to overexpress V3

versican. These LV3SN cells express an isoform of the versican proteoglycan that does

not contain the signature chondroitin sulfate side chains. As a result, they produce an

increased amount of tropoelastin, which is an uncommon function for mature SMCs. It

was hypothesized that mechanical stimulation would enhance this tropoelastin synthesis

by LV3SN cells. This hypothesis was tested applying 10% cyclic strain to TEMEs for

seven days. Cell viability, proliferation, and tropoelastin expression were assessed at the

end of stimulation.

5.2 Materials and Methods

5.2.1 Cell Culture

Smooth muscle cells retrovirally transduced to overexpress versican V3, LV3SN

cells, or an empty vector, LXSN, were provided by Dr. Thomas N. Wight. [138] Cells

were cultured in Dulbecco’s modified Eagle medium (DMEM) (Cellgro, Herndon,VA)

supplemented with 10% fetal bovine serum (FBS) (Mediatech/Cellgro, Herndon, VA),

1% penicillin-streptomycin (Mediatech Cellgro), and 1% L-glutamine (Mediatech

0 . Cellgro) at 37 C and 5% CO2 . Cells between passage 8 and 11 were used in all

experiments.

- 105 - 5.2.2 Tissue Engineered Media Equivalent Fabrication

One before fabrication (day -1), silicone tubing (Vesta, Inc., Franklin, WI) with a double wall thickness of 0.38 mm was cut approximately 4 cm long and etched for several hours in 10N H2SO4. The tubes were washed thoroughly in dH2O and air-dried before being sterilized and stored overnight in a 50µg/mL collagen solution (MP

Biomedicals, Irvine, CA). This etching and coating procedure improved adhesion between the TEME and silicone sleeve. On day 0, hollow glass mandrels (5 inches long,

3 mm outer diameter) were sheathed with the collagen coated sleeves and flanked with rubber stoppers at both ends (figure 5.1).

A concentrated cell solution was resuspended in a 2 mg/mL type I bovine collagen solution (MP Biomedicals). Final cell concentration of the cell-substrate mixture was 1x106cells/mL. Five milliliters of the hydrogel solution was then poured into

13x100mm test tubes. In order to create the tubular geometry, the glass mandrel sheathed with the silicone sleeve was inserted into the test tube. After sterilely capping the tube and incubating for one hour at 370C, the molded hydrogel was removed from the tube and

place in a 150mm suspension culture dish filled with 120mL supplemented media. After

24 hours of incubation, the tubular TEMEs were cut away from the stoppers to permit

further longitudinal compaction.

- 106 -

Figure 5.1 Schematic of tubular TEME fabrication for mechanical stimulation.

- 107 - 5.2.3 Mechanical Stimulation

The pulsatile bioreactor design and mechanical stimulation protocol applied to tubular TEMEs were developed previously in the Nerem research group. [177] TEMEs molded on silicon sleeves were slid off of the glass mandrels and statically cultured for

48 hours permitting further gel compaction. Tubes were then moved to a bioreactor filled with media and affixed to the inlet/outlet ports with ligator o-rings (Miltex Inc, York,

PA). After attachment, the seals were tested by cyclically inflating the tubes for ten cycles at an elevated pressure (~9psi). Luminal pressure was applied by an air compressor (Jun-Air Model 6-35 Oil Lubricated, Wheeling, IL) regulated by a digital

controller that managed pressure output and pulse frequency. If the tight seal persisted,

then the lumen was filled with media and chamber was sealed. The pressure was reduced

to produce a 10% radial distension (approximately 8psi) for the duration of the

experiment. The ports on the bioreactor lid were fitted with 0.2µm syringe filters to allow

sterile gas exchange. Stimulated TEMEs were incubated in a closed, sterile environment

0 (37 C, 5% CO2). An equal number of control TEMEs were statically cultured in the same

environmental conditions. Mechanical stimulation in the form of cyclic distension was

applied for seven days. Figure 5.2 illustrates the setup and time course of stimulation.

- 108 -

Air Compressor Controller

Bioreactor with TEMEs

Prepare Liberate End Experiment & Silicone Fabricate TEME from Begin Begin Assessment Sleeves TEME Stoppers Stimulation

-1 0 1 2 9

Figure 5.2 Bioreactor setup and mechanical stimulation timeline.

- 109 - 5.2.4 Qualitative Assessment of TEME Morphology

5.2.4.1 Viability Assay

Cell viability in TEMEs was ascertained with a Live/Dead Viability/Cytotoxicity kit for mammalian cells (Molecular Probes, Carlsbad, CA). Tissues were thoroughly washed and cut into short rings. In a 1.7mL microcentrifuge tube, rings were submerged in a PBS solution containing 4µM ethidium homodimer-1 and 2µM calcien AM. Tissues were protected from light and incubated for 45 minutes at room temperature. Viable cells appeared green while nuclei acids in nonviable cells appeared red with fluorescence microscopy.

5.2.4.2 Hematoxylin and Eosin Staining

Tissues were washed with PBS, fixed for several hours in 4% paraformaldehyde,

processed (Shandon Pathcentre Enclosed Tissue Processor, Thermo Fisher Scientific,

Waltham, MA) and paraffin embedded (Shandon Histocentre 2 Tissue Embedding

System, Thermo Fisher Scientific).Tissues were cut into 7µm sections, deparaffinized

and stained with hematoxylin and eosin (H&E) using a Leica autostainer (Leica

Microsystems, Bannockburn, IL).

5.2.5 DNA Assay

Whole tubes were lyophilized and digested overnight in 1mL 0.5mg/mL

proteinase K solution (Sigma, St. Louis, MO) at 500C. In a 96-well assay plate, 10µL sample or calf thymus standard (Sigma) was mixed with 200µL of Hoechst/TEN solution

(Tris-EDTA-NaCl buffer; 10mM Tris + 1mM EDTA + 0.1M NaCl with 0.1µg/mL

- 110 - Hoechst 33258). Following half hour incubation at 370C, sample fluorescence was measured and DNA concentration was determined using a standard curve.

5.2.6 Gene Expression Analysis

5.2.6.1 RNA Isolation and cDNA synthesis

Tissue engineered media equivalents were washed, snapped frozen in liquid

nitrogen, and diced finely. Following the protocol provided with the RNeasy Mini Kit

(Qiagen, Valencia, CA), RLT buffer supplemented with β-mercaptoethanol was added to

the diced tissue and passed through an 18-gauge syringe needle ten times before being

completely homogenized with Qiashredder (Qiagen) columns. RNA isolation proceeded

as outlined in the RNeasy protocol. Sample purity and RNA concentration was

determined by diluting 2 µL of the eluted RNA in 58 µL dH2O and measuring absorbance. Samples with an absorbance ratio (A260nm/A280nm) greater than 1.8 were used to synthesis cDNA templates.

One microgram of total RNA was reverse transcribed to create complementary

DNA (cDNA) templates with Invitrogen’s Superscript III First-Strand Synthesis Kit for

RT-PCR (Invitrogen, Carlsbad, CA). Total RNA, 50mM oligo(dT) primers, and 10mM dNTP (deoxynucleoside triphosphate) mix were combined and heated at 650C for 5

minutes to initiate denaturation. A synthesis mix was created with 10X RT buffer, 25mM

MgCl2, 0.1M DTT, RNase Out , and SuperScript III RT. This mix was added to the

denatured solution and incubated at 500C for 50 minutes. At the same time, minus reverse

transcriptase (-RT) control samples were created by replacing the reverse transcriptase

enzyme with water. The reaction was terminated by heating the sample to 850C for 5

- 111 - minutes. Finally, RNase H was added to digest any remaining RNA. Templates were stored at -800C or used in PCR.

5.2.6.2 qRT-PCR

Tropoelastin and versican V3 cDNAs were amplified and quantitated using real

time PCR. Primers for tropoelastin (sense – GAGCCCTGGGATATCAAGGTG,

antisense - GGGTCCCCAGAAGATCACTTTC) and versican V3 (sense –

AGCAGAGTGTGCAAACCGG, antisense - CCTCCAAGCTGCGTGAAGTT) were

designed with Primer Express (Applied Biosystems, Foster City, CA) and synthesized by

Integrated DNA Technologies (Coralville, IA).

Sense and antisense primers, water, and 2X SYBR Green PCR Master Mix

(Applied Biosystems, Foster City, CA) were added to 1µL cDNA template in optical

tubes (MicroAmp Optical 8-Tube Strip, Applied Biosystems) designed for PCR. An ABI

Prism 7700 Sequence Detection System was used for thermal cycling, laser fluorescence

induction, and emission detection. As double stranded DNA was generated, the SYBR

Green fluorescent signal increased until saturation. Gene expression levels, represented in

terms of cDNA concentrations, were calculated using the standard curve method.[174]

- 112 - 5.2.7 Protein Quantitation

5.2.7.1 Flow Cytometry

Collagenase digestion (600U/mL type 2 collagenase; Worthington Biochemical

Corp, Lakewood, NJ) was used to isolate cells from TEMEs. The reaction was neutralized with serum supplemented DMEM and cells were washed with 0.1% Tween-

PBS, fixed in 4% paraformaldehyde (Tousimis, Rockville, MD), and permeabilized with

0.1% Triton X-100 for five minutes. Cells were blocked with 4% normal donkey serum and divided into two groups. One group was not stained with a primary antibody and was utilized as an autofluorescence control. The remaining cells were treated with antibodies against tropoelastin and versican (tropoelastin 1:100; Elastin Products Co, Owensville,

MO and versican 1µg/mL; Abcam, Cambridge, MA) for one hour at 370C. Next, control

and sample groups were washed with TPBS and incubated with fluorescently conjugated

antibodies (1:200 donkey anti-goat + AlexaFluor546 for elastin and 1:500 donkey anti-

goat + AlexaFluor488 for versican; Molecular Probes, Carlsbad, CA). Finally, cells were

pelleted, resuspended in PBS, filtered into siliconized test tubes, and analyzed with a BD

LSR flow cytometer. Differences in the geometric mean of relative fluorescence intensity

of control and stained cells were analyzed with FCS Express (De Novo Software, Los

Angeles, CA).

5.2.7.2 SDS-PAGE and Western Analysis

Tropoelastin was immunoprecipitated from spent media with Sigma’s Protein G

Immunoprecipitation Kit (Sigma, St. Louis). A bicinchoninic acid (BCA) total protein assay (Pierce Biotechnology, Rockford, IL) was used to normalize each eluted protein

- 113 - sample to 1µg/mL. Then, equal amounts of protein and 37ng rat lung α-elastin standard

(Elastin Products Co, Owensville, MO) were electrophoresed in a Novex precast 10%

Tris-Glycine gels (Invitrogen, Carlsbad, CA). Hybond nitrocellulose membranes (GE

Healthcare Life Sciences, Piscataway, NJ) were used for protein transfer. Blocking and antibody solutions were made with normal donkey serum (Sigma, St. Louis, MO)

Membranes were probed with a polyclonal goat anti-rat lung elastin antibody (1:10,000;

Elastin Products Co, Owensville, MO) overnight at 4oC, followed by an hour incubation

with donkey anti-goat IgG + HRP (1:20,000 Jackson Immunoresearch Laboratory, West

Grove, PA). Bands were detected with the ECL Plus chemiluminesce detection system

(GE Healthcare Life Sciences). Blots were developed on blue x-ray film (Phenix

Research Products, Candler, CA) in a dark room. Densitometric intensities of sample

bands were determined with Scion Imaging software (Frederick, MD). Since spent media

samples do not contain normalizing proteins, normalization to 37ng elastin standard was

employed.

5.2.8 Statistical Analysis

Experiments were repeated four times with at least three samples per experiment

collected to generate a mean value. Error bars in graphs were created using the standard error of the mean. The General Linear Model (GLM) of the Analysis of Variance

(ANOVA) method was used to determine statistical significance of the data. P-values less than 0.05 were determined to be significant.

- 114 - 5.3 Results

After seven days of mechanical stimulation, there were marked differences between TEMEs that were cultured dynamically versus those that remained in a static environment. There were also variations in the extent to which LXSN and LV3SN cells respond to the conditioning. Figure 5.3 shows the difference in LXSN (A) and LV3SN

(B) TEME appearance with and without mechanical stimulation. In each panel, the left tube was dynamically cultured while the right tube remained in static culture. The conditioned TEMEs appeared to be more compacted as indicated by the decreased wall thickness and shorter length. In a tubular geometry, LXSN cells compacted the hydrogel more than LV3SN cells with significant shortening of the vessel as well as an overall thinner wall.

A) B)

Figure 5.3 Mechanical stimulation increases TEME compaction. After seven days of cyclic distension of 10% strain, collagen TEME are more compacted in length and wall thickness. A) LXSN TEME, B) LV3SN TEME. In each panel the conditioned tube is on the left and the static tube is on the right.

- 115 - The effects of stimulation on cell alignment and protein density was observed using confocal and light microscopy. A live-dead assay performed on conditioned

TEMEs revealed cell viability, cell distribution and tissue morphology. Figure 5.4 shows that cells remained viable (green) after cyclic distension. However, there were more dead cells (red) present in the conditioned TEMEs relative to the static vessels. In figure 5.5, the hematoxylin and eosin (H&E) staining of the conditioned TEME showed darker staining of collagen at the lumen indicating the protein as densely packed in this region.

The cells on the luminal side of the wall were more elongated and aligned circumferentially. Cell alignment was more pronounced in the more compacted wall of the conditioned TEME. The degree of cell organization and elongation decreased as the distance from the lumen increased.

Other changes in the cells’ response to mechanical stimulation were assessed by

Hoechst DNA assay, qRT-PCR, flow cytometry, western analysis, and transmission electron microscopy.

- 116 - A) B)

Figure 5.4 Live/Dead viability staining LV3SN TEME with and without mechanical stimulation. Live/Dead staining of LV3SN cells in a collagen TEME after seven days of mechanical stimulation shows cell viability. Viable cells appear green and nonviable cells appear red. (A) The statically cultured tissue has cells with a rounded shape. (B) Dynamically cultured tissue has more dead cells than statically cultured TEME. The cells also appear more spread. 20X magnification.

A) B)

Figure 5.5 Hematoxylin and eosin staining of LXSN TEME with and without mechanical stimulation. H&E of collagen LXSN TEMEs after seven days of mechanical stimulation shows differences in tissue morphology. The statically cultured tissue (A) has a more random cell orientation and a thicker wall than the dynamically cultured tissue (B). 5X magnification.

- 117 - 5.3.1 Proliferation

A DNA assay was performed on TEMEs to determine the difference, if any, in cell number with respect to stimulation. A single TEME from each culture condition was washed, lyophilized, and digested in 1 mL of proteinase K buffer. The concentration of

DNA in 10uL of each digested sample was determined using the Hoechst based assay described in chapter three. As shown in Chapter 4, there was no difference in the amount

of DNA per cell in LXSN and LV3SN cells. Therefore, the concentration of DNA per

TEME was correlated to the number of cells in each TEME.

Figure 5.6 shows that the DNA concentration remained the same for both cell

types throughout the experiment. There was no significant difference in DNA

concentration (i.e. cell number) in LXSN cell TEMEs (static - 57.38 ± 12.75 µg/mL,

conditioned – 51.38 ± 9.34 µg/mL) and LV3SN cell TEMEs (static – 48.33 ± 9.39,

conditioned – 52.38 ± 10.19) as a result of stimulation. This was contrary to most

findings describing enhanced proliferation. [32, 42, 169, 170] The dissimilarity in

proliferation response to mechanical stimulation may be due to many factors such as cell

source, substrate type, culture length, and strain magnitude.

- 118 - DNA Content - Mechanical Stimulation 7 Days LXSN 80 LV3SN 70 60 50

ation (ug/mL) 40 30 20 10

DNA Concentr 0 Static Condition

Figure 5.6 DNA content in TEME after seven days of mechanical stimulation. There is no difference in the DNA content of TEMEs with or without stimulation. There is also no difference in DNA content between LXSN and LV3SN in static or conditioned TEME after seven days culture. Mean ± SEM, n=3-4

- 119 - 5.3.2 Gene Expression

While the overall cell proliferation for both cells remained the same in response to mechanical stimulation, there were significant differences in mRNA expression between cell types and culture conditions. The levels of versican and tropoelastin mRNA expression were represented as concentrations of cDNA in figures 5.7 and 5.8 One microgram of total RNA was isolated from each sample and reverse transcribed to synthesize complementary DNA (cDNA). One microliter of cDNA was then amplified using polymerized chain reaction (PCR) with probes for versican V3 (Forward –

AGCAGAGTGTGCAAACCGG, Reverse - CCTCCAAGCTGCGTGAAGTT) and tropoelastin (Forward – GAGCCCTGGGATATCAAGGTG, Reverse-

GGGTCCCCAGAAGATCACTTTC). After 40 thermal cycles, the cDNA concentration of each sample was determined with the assistance of versican V3 and tropoelastin standard curves.

After seven days of static culture, versican gene expression in LXSN cell TEMEs was significantly higher than in LV3SN cell TEMEs (figure 5.7). The effect of cyclic distension on versican mRNA expression was not significant. However, a slight increase occurred in both cell types. The variation between conditioned LXSN and LV3SN cell

TEMEs was not significant either. Figure 5.8 shows that LXSN cell TEMEs continued to have higher gene expression than LV3SN cell TEMEs. This time it was tropoelastin mRNA that was quantitated. There was statistical significance between the two cell types irrespective of distension. There was also an increase in tropoelastin mRNA expression in both cell types after conditioning relative to their static controls. Conditioned LXSN cell

- 120 - TEMEs exhibited a three-fold increase in tropoelastin while conditioned LV3SN cell

TEMEs exhibited a four-fold increase.

Versican Gene Expression

LXSN

) 14

M ** LV3SN p

( 12 on

i 10 t a r

t 8 en 6 4 Conc A

N 2 D c 0 Static Conditioned Treatment

Figure 5.7 Versican gene expression after seven days of mechanical stimulation. Versican gene expression in each cell remains unchanged after seven days of 10% cyclic distension. n=3-5 Mean ± SEM. ** p<0.001

Tropoelastin Gene Expression

LXSN

) * 70 * #

M LV3SN p

( 60 n o

i 50 t a r

t 40 n e

c 30 † n 20 10 DNA Co

c 0 Static Conditioned Treatment

Figure 5.8 Tropoelastin gene expression after seven days of mechanical stimulation. Cyclic distension of 10% over seven days significantly increases tropoelastin expression in collagen TEME. n=3-5, Mean ± SEM. * p<0.05 LXSN vs LV3SN for each treatment, # p<0.05 vs. LXSN static culture, † p <0.05 vs. LV3SN static culture.

- 121 - 5.3.3 Protein Expression

Versican and tropoelastin protein expressions were also affected by the cyclic distension. Cells were isolated from a TEME by means of collagenase digestion at the end of culture. The cells were washed, fixed, permeabilized, and stained for the protein of interest. Flow cytometry was used to assess the amounts of cell associated versican and tropoelastin. Protein expression changes were quantitatively represented by the shift in the relative mean fluorescence intensity between the unstained cells utilized as an autofluorescence control and those that were labeled with antibodies specific to versican and tropoelastin. Additionally, western analysis was used as a qualitative measure of tropoelastin that accumulated in the spent media during stimulation.

Flow cytometry determined that LXSN and LV3SN cells expressed similar levels of versican in statically cultured TEMEs after seven days. The cells exposed to seven days of cyclic strain exhibited an increase in expression. Figure 5.9 shows that while there was no significant difference in the protein expression between LXSN and LV3SN cells, the empty vector cells appeared to have less versican associated with them than the

V3 versican overexpressing cells. Mechanical stimulation significantly increased versican expression in LV3SN cells relative to the static specimen.

Similar expression trends were revealed when staining for tropoelastin (figure

5.10). Tropoelastin expression levels were similar in static LXSN and LV3SN cell

TEMEs. Increased amounts of protein were labeled after conditioning in both cell types.

Conditioned V3 overexpressing cells synthesized more tropoelastin than the conditioned empty vector control cells and the V3 overexpressing cells in static culture.

- 122 - Mechanical stimulation appeared to have a greater impact on cell associated protein levels in LV3SN cells than LXSN cells.. Culture medium from each sample was collected at the end of stimulation. Protein content was evaluated with Scion Imaging software (Scion Corp.) which represents band intensity with arbitrary densitometric units.

Since loading control proteins were not options for normalization, the band intensity of each sample was represented as a ratio of the band intensity from 37ng of tropoelastin standards.

Figure 5.11 shows the relative amounts of tropoelastin collected in the spent medium after stimulation of LXSN and LV3SN cells. Densitometric measurement of the blots determined that there was more protein in the spent medium collected from TEMEs made with LXSN. Additionally, the amount of tropoelastin secreted by LV3SN cells into the spent media decreased with mechanical stimulation.

- 123 - Versican Protein Expression - 7 Days Stimulation LXSN e 120 † LV3SN 100 escenc 80 uor ity s

n 60 te ean Fl In 40 ve M i

t 20 a l e 0 R Static Conditioned

Versican Versican 100 100 Conditioned 75 Static 75 t t n n u 50 u 50 Co Co

25 25

0 0 100 101 102 103 104 100 101 102 103 104 FITC-A FITC-A Figure 5.9 Flow cytometry for versican protein expression after seven days of mechanical stimulation. Mean ± SEM, n=4, † p <0.05 vs. LV3SN static culture. For histograms, black =LXSN, red= LV3SN, unfilled curve = negative control.

- 124 - Tropoelastin Protein Expression - 7 Days Stimulation LXSN e 300 † LV3SN * 250 escenc 200 uor ity s

n 150 te ean Fl In 100 ve M i t 50 a l e

R 0 Static Conditioned

Elas tin Elas tin 100 100 Conditioned 75 Static 75 t t n n u u 50 50 Co Co

25 25

0 0 100 101 102 103 104 100 101 102 103 104 PE- A PE- A Figure 5.10 Flow cytometry for tropoelastin protein expression after seven days of mechanical stimulation. n=4, Mean ± SEM, * p<0.05 LXSN vs. LV3SN, † p <0.05 vs. LV3SN static culture. For histograms, black =LXSN, red= LV3SN, unfilled curve = negative control.

- 125 - Tropoelastin Protein Expression - Spent Media after 7 Days Stimulation

LXSN 0.8 LV3SN 0.6 alized to 37ng 0.4

0.2 Elastin Standard 0 Static Conditioned Expression Norm

12 3 4 72 kD

Figure 5.11 Accumulation of tropoelastin in spent media after mechanical stimulation. Band intensity is normalized to 37ng of tropoelastin standard (MW 72 kD). 1- LXSN static, 2- LV3SN static, 3- LXSN conditioned, 4- LV3SN conditioned. n=1

- 126 - 5.4 Discussion

Cells within tissues are sensitive to strains transmitted through the surrounding extracellular matrix. This chapter examined the changes in tropoelastin gene expression and protein synthesis when TEMEs were exposed to seven days of 10% cyclic radial distension. The resultant data corroborated the findings that mechanical conditioning enhances compaction, cell and matrix alignment[138, 177, 185, 188], and tropoelastin synthesis.[63, 74] Cyclic distension increased overall tropoelastin in TEMEs containing

LV3SN. However, initial observations made with immunogold labeling and transmission electron microscopy determined that tropoelastin accumulated in intracellular vesicles was not incorporated into the surrounding matrix (data not shown). This observation illustrated that increased tropoelastin synthesis alone is not sufficient for elastic fiber formation.

An interesting relationship between TEME geometry and matrix alignment should be noted here. The material properties of free floating TEMEs (i.e. disk-shaped hydrogels) are different from those that are constrained in one or more dimensions. Free- floating hydrogels do not form stress fibers, therefore the matrix and cells are randomly oriented. Tubular TEMEs used in this study were released from the stoppers one day after fabrication, yet the tissue was still constrained by the silicone sleeve and glass mandrel through the lumen. This generated a circumferential alignment around the silicone sleeve.

[136]Consequently, even the static tubular TEME was prestressed much like an artery.

[84, 89, 103]

The prestressed condition in tubular TEMEs may have contributed to the increased compaction observed. Although SMCs were able compact a hydrogel without

- 127 - any external mechanical stimuli, the addition of mechanical strain increased the extent to which the hydrogel is compacted. [32, 40, 42, 44, 48, 138, 169, 177, 185] This response may be due in part to a positive feedback loop that involves aligned collagen fibers creating a stiff matrix that stimulates cytoskeletal filament polymerization and an enhanced contractile apparatus. The contractile force generated by the cell aligns and stiffens the matrix even more and reinitiates the process. This mechanism has been demonstrated in myofibroblasts cultures.[189-192]

Further confirmation that mechanical stimulation enhanced cell-mediated matrix reorganization was observed with histological staining. The degree of cell orientation correlates to the amplitude of the applied strain.[184] Although the bioreactor system was calibrated to administer a 10% distension to the sleeve, this strain was not transmitted uniformly throughout the tissue because of matrix heterogeneity and randomly oriented cells and collagen fibers. The cells nearest the lumen experience greater distension than the cells near the tissue periphery. As a result, the cells lining the lumen are more elongated and aligned. Moreover, the matrix nearest the lumen stained darker with eosin

indicating increased protein density.

While the cell shape and orientation changed with respect to mechanical

stimulation, the overall number of cells within the tissue remained unaffected. Although more nonviable cells were present in conditioned TEMEs, the viable cells spread extensively in response to mechanical strain. This mimics the behavior described by

Engler et al.[193]

- 128 - The neutral effect on cell proliferation did not persist when analyzing versican and tropoelastin mRNA expression. The introduction of mechanical strain significantly increased tropoelastin gene expression in both cells. However, LXSN cell gene expression was more responsive to the stimulation. One explanation for this exaggerated response is the mechanotransduction capability of glycosaminoglycans. [11]

Overexpressed V3 versican may compete with the highly sulfated V0 and V1 isoforms on the LV3SN cell surface, inhibiting the full extent that strain changes can be communicated to the cell, whereas LXSN cells do not experience this competition and can fully benefit from the stimulatory effects at the mRNA level.

Nevertheless, the gene expression trends did not correlate directly to protein expression. Although a command (messenger RNA) was sent, many factors can influence the execution of that command (protein synthesis). LXSN cell versican and tropoelastin gene expressions were greater than that of LV3SN cells for static and dynamic conditions. Yet, this advantage was not translated into protein expression. Contrary to what mRNA data would suggest, mechanical stimulation significantly increased LV3SN cell tropoelastin production over that of LXSN cells.

This discord between mRNA and protein expression could be due the timing of assessment. Cessation of mRNA transcription in the LV3SN samples could have begun near the end of experimentation, while the previously transcribed mRNA continued to be translated into protein. It is unclear why increased amounts of protein were not found in

LXSN cell TEMEs.

- 129 - Another interesting development was the simultaneous increase in versican expression in response to mechanical conditioning. Proteoglycans cushion against mechanical forces and reduce excessive matrix deformation.[192, 194] This would indicate that the strain experienced by the cells would trigger the upregulation of versican synthesis to offset matrix deformation. Lee et al. revealed a 3.2-fold increase in versican mRNA in vascular smooth muscle cells as result of biaxial strain.[128]

It has been shown that mechanical stimulation regulates vascular SMC function in a three dimensional culture.[11, 21, 32, 42, 128, 169, 170, 177, 184, 185] A literature review for changes in SMC phenotype as a result stimulation has yielded conflicting results. Some data indicate a more synthetic phenotype (increased proliferation and matrix deposition) as a result of cyclic distension.[177] While other data describe an increased expression of contractile protein expression associated with more differentiated cells.[32]This diversity in observations can be attributed to differences in the cell types that were studied , cell maturity, stimulation apparatus, or strain amplitude, duration, and frequency.[16, 40, 44, 169, 170, 183]

Isenberg and Tranquillo were able to produce large quantities of insoluble elastin in stimulated collagen media equivalents. [177] However, these tissues were fabricated with neonatal SMC and cultured for over five weeks. This study endeavored to stimulate elastin production in adult SMC in an abbreviated amount of time. Although insoluble elastin did not result in these culture conditions, LV3SN cells increased tropoelastin synthesis in response to cyclic distension. This reinforces the fact that mechanical stimulation is merely one component of the multifaceted approach needed to increase elastin in tissue engineered media equivalents. Coupling this stimulation with the addition

- 130 - of other proteins associated with elastic fiber formation and elastogenic growth factors may encourage the formation of insoluble elastin and successful incorporation into the tissue.

- 131 - CHAPTER 6

CONCLUSIONS AND RECOMMENDATIONS

The increase in bypass procedures performed annually highlights the growing

need for autologous grafts. In many cases, the patient’s mammary artery or saphenous

vein would normally suffice. However, if these vessels are unavailable for some reason, then another alternative must be sought. Biomedical scientists and engineers are working steadfastly to develop a functional tissue engineered blood vessel to be that alternative.

In vitro production and assembly of insoluble elastin has proven to be a challenge in the fabrication of TEMEs. Several approaches have been tried, but no one has been able to stimulate adult smooth muscle cells to form elastic fibers in a biopolymer without extended culture. The research presented here suggests a novel approach to incorporating elastin in tissue engineered media equivalents using an adult smooth muscle cell that has been retrovirally mediated to overexpress versican V3.

This work is significant because it expands the body of knowledge concerning V3 versican overexpressing cells in an engineered tissue. The overexpression of versican V3 has been characterized in many cell types in order to understand several elastin-related pathologies. However, this study attempted to further characterize the phenotype of V3 overexpressing smooth muscle cells in response to collagen and fibrin matrices, medium additives, and mechanical stimulation. LV3SN cells have the potential to behave as elastogenic cells and produce the elastic fibers desired in a tissue engineered media equivalent. Although elastic formation was not evident in these studies, significant increases in tropoelastin expression by these adult cells were observed.

- 132 - Several of the findings that were presented here will be beneficial in designing future tissue engineering experiments using LV3SN cells as a source. By changing the substrate microstructure from 2D to 3D, overall protein expression was reduced. Yet, changing the matrix from collagen to fibrin increased biological activity in LV3SN cells.

Another interesting discovery was the observation that tropoelastin synthesis was correlated to cell proliferation when cells were exposed to factors added to the culture medium. The addition of exogenous chondroitin sulfate decreased overall protein expression in LXSN and LV3SN cells while TGF-β1 enhanced proliferation and tropoelastin expression in a time- and dose-dependent manner. Finally, the application of

10% cyclic distension was shown to simultaneously increase versican and tropoelastin expression by LV3SN cells. Mechanical strain increases proteoglycan production to prevent permanent tissue deformation. Strain also increases TGF-β1 mRNA expression which subsequently stimulates tropoelastin.

Although the discoveries made in this research are promising for cardiovascular tissue engineering, there are some limitations to the current design. The overexpression of

V3 versican in the smooth muscle cells studied here was retrovirally mediated. This method of transduction, while stable and long-lasting, limits the ability to use these cells in human autologous grafts. There are several other phenotypic changes (reduced migration, proliferation, and pericellular coat) associated with these cells. The long-term effect of these changes in an animal requires further investigation. The constant overexpression of tropoelastin and elastin formation in a healthy vessel can lead to increased cell migration and other pathological events. Excess elastin may stimulate protease activity which may increase the number of elastin peptides in circulation. Elastin

- 133 - peptides have been shown to influence cell proliferation and migration in rats. Also, it

will be quite difficult to get FDA approval for the use of retrovirally transduced cells in

human therapies. Even though the retrovirus cannot replicate, there are concerns about

immune response, tumorigenesis and long term safety. Based on these considerations,

LV3SN cells may be better utilized in the fabrication of a more physiologic in vitro blood

vessel model used to understand elastogenesis by adult SMCs in a 3D environment.

Since this study only begins to look at the behavior of LV3SN cells in tissue

engineered media equivalents, there are many experimental conditions that are worth

exploring. The data reported here did not agree completely with data generated by others

who study this cell. Merrilees showed the presence of elastic fiber formation in a rat

injury model. The cells that were injected into the damaged vessel were exposed to the

plethora of signals that are available in vivo. The presence of soluble factors, the native

structure of the extracellular matrix, existing elastic fibers and elastin fragments, as well

as communication with neighboring endothelial cells all contribute to the elastogenic

response of the LV3SN cells. While the TEME model is advantageous because of the

ability to control a particular stimulus and study its the effects, this model is also limited

by the number of stimuli that can be added to achieve the delicate interplay that yields the

results seen in vivo.

Other in vitro dissimilarities can be attributed to increased cell passaging. Since

these cells were already transduced and plated in at passage five upon arrival, an

extensive expansion was necessary to build up a cell bank. With each TEME requiring

1x106 cells, LXSN cells and LV3SN cells had to be used at an elevated passage. While the transduction was stable, this overexpansion may have altered the overexpression in

- 134 - some way. Northern analysis or PCR could be performed on the cells upon arrival and after each passage to determine the level of versican V3 overexpression with respect to passage. Additionally, transduction of the SMCs just before TEME fabrication would reduce repeated passaging and aging of the cells.

Another concern is the possible contamination of the culture with myofibroblasts.

Although, the cell isolation was carefully executed, morphological differentiation of myofibroblasts and smooth muscle cells is often indistinguishable. Both cell types stain positively for contractile proteins like smooth muscle α-actin and calponin. Yet, only

SMCs would be able to form microfilaments after 30 minutes incubation with an anti- actomyosin antibody.[195]This test could be performed to verify the purity of the smooth muscle cell population.

While Versican V3 mRNA overexpression can be easily measured, the quantification and localization of the actual protein is quite difficult to determine.

Antibodies specific to versican V3 are not available because this isoform is composed solely of the G1 and G3 globular domains that are found on every other versican variant.

The lack of antibody availability is a common problem that can be resolved by fusing the protein of interest with a tagging peptide. The V3 versican DNA sequence could be ligated to a FLAG DNA sequence. The resultant product would be a FLAG-tagged V3 versican protein. Using an anti-flag antibody, the location and quantity of V3 versican can be verified. Immunofluorescence could be used to reveal whether the protein is membrane bound or trapped intracellularly. Flow cytometry could be used to ascertain the amount of V3 versican being expressed. These techniques would also be useful in determining the effect of cell expansion and extended culture on V3 overexpression.

- 135 - Improved regulation of V3 overexpression is also recommended. An inducible promoter would allow activation or deactivation the V3 gene as needed during culture.

For instance, ascorbate could be added to the culture to increase collagen synthesis then removed once V3 overexpression was activated in conjunction with other factors to produce elastin.

The elevated expression of tropoelastin protein without the accompanying formation of elastic fibers or crosslinked elastin was an intriguing finding. The logical progression of this research would be to determine a method generate elastic fibers that would add a mechanical benefit to tissue engineered media equivalents. Several elastin associated proteins and supplements could be added to the culture system to encourage fiber formation. Cay Kielty has successfully synthesized and isolated recombinant fibrillin-1 and fibrillin-2, the two proteins that form microfibrils.[196] The addition of these microfibrillar proteins along with microfibril associated glycoproteins (MAGP) and fibulin-5, a protein that chaperones tropoelastin to the microfibrillar template, may facilitate the maturation of elastin and the formation of elastic fibers. Additional stimulation with lysyl oxidase would promote crosslinking and increase elastin retention in the extracellular matrix.

Further investigation into matrix composition effects is recommended. It would be worthwhile to compare signaling mechanisms initiated by fibrillar collagen and fibrin.

The fact that LV3SN cells are more bioactive in fibrin leads one to consider medium and mechanical stimulation of fibrin TEMEs. Reconstituted collagen and fibrin matrices may alter the expression of the other versican splice variants in extended culture. A thorough expression analysis of these variants would also be informative. To counteract the

- 136 - suppressive properties of 3D culture, LV3SN cells should be modified to increase V3

overexpression. This could be accomplished by inserting more V3 cDNA copies into the

cells.

Smooth muscle cells respond to growth factors and other biomolecules in a matter

of minutes or even a few hours. However, the nature of TEME fabrication in this research

requires at least twenty-four hours before assessment. In order to look at the initial

response to soluble factors added to the culture medium, a new method of TEME design must be developed. This new design would reduce the time needed for hydrogel polymerization and cell acclimation.

The effect of extended culture on LV3SN cells in the presence of TGF-β1 and mechanical stimulation were not measured in this study. However, five week static culture of LXSN cells and LV3SN cells in collagen TEMEs showed the formation of a large cell capsule. Seven days of TGF-β1 supplementation led to an increase in cell number, cell elongation, cell alignment, and tropoelastin synthesis. Mechanical stimulation also increased tropoelastin expression and TEME compaction.. The capsule formation can be attributed to nutrient transport limitations due to the TEME wall thickness. Increased compaction as a result of mechanical stimulation would decrease in wall thickness thus preventing the capsule formation. While prolonged stimulation of

LV3SN cells in a collagen TEME may not result in the formation of a cell capsule, tropoelastin content would most likely elevate. However, the accumulation and incorporation this soluble protein into the extracellular matrix can not be assured.

The recommendations outlined here would advance the development of the

LV3SN cell as an experimental tool for in vitro studies. A combinatorial approach to

- 137 - matrix selection, medium treatment, and mechanical stimulation would enhance tropoelastin expression and possible elastic fiber formation in tissue engineered media equivalents. Further characterization of this cell would also provide insight into the regulation of elastogenesis by mature SMCs. Controlling elastin synthesis in TEMEs would benefit in vitro studies of vascular biology and bring the field of cardiovascular tissue engineering one step closer to creating a more physiologic blood vessel substitute.

- 138 - APPENDIX A

SELECTED PROTOCOLS

PREPARATION OF COLLAGEN TISSUE ENGINEERED MEDIA EQUIVALENTS 140

PREPARATION OF FIBRIN TISSUE ENGINEERED MEDIA EQUIVALENTS 141

MECHANICAL STIMULATION OF TISSUE ENGINEERED MEDIA EQUIVALENTS 142

INTRACELLULAR STAINING FOR FLOW CYTOMETRY 144

RNA ISOLATION FROM TISSUE ENGINEERED MEDIA EQUIVALENTS 146

CDNA SYNTHESIS FOR QUANTITATIVE RT-PCR 148

- 139 - Preparation of Collagen Tissue Engineered Media Equivalents

Reagents and Equipment: Trypsin Invitrogen 25200-114 Bovine Dermal Collagen, Type I from calf skin MP Biomedicals 15000026 5X Dulbecco’s Modified Eagle Medium (DMEM) Invitrogen12800-082 Complete Culture Medium 0.1M Sodium Hydroxide (NaOH) 0.02 Acetic Acid 10N Sulfuric Acid (H2SO4) Silicone Tubing Vesta Inc.

Solutions Collagen Stock (4mg/mL) Dissolve 250mg of lyophilized collagen in 62.5mL 0.02N acetic acid

Procedure If making tubular TEMEs, perform the following one day before fabrication. a. Cut silicone tubing and Etch in H2SO4 for several hours. b. Rinse sleeves thoroughly to remove all the H2SO4 . c. Dry and autoclave the sleeve. Space out the sleeves in the sterilization pouch to prevent the sleeves from sticking together. d. Place the sleeves in a weak collagen solution (50µg/mL)

1. Wash and trypsinize cells. 2. Count cells and remove volume required to have enough cells for a final concentration of 1x106 cells/TEME. 3. Centrifuge to pellet cells 4. Resuspend in 2mL complete medium. 5. Add the reagents listed below to the cell solution. Be sure to thoroughly suspend cells in mixture while minimize bubbles.

Fabrication of 2mg/mL Collagen TEME Total Hydrogel Volume: 40mL REAGENTS Volume (mL) Notes Cell Suspension 2 This volume is constant 1X DMEM 10.5 =Total volume – (Cell suspension volume + 5X DMEM + Collagen stock solution + NaOH volume) 5X DMEM 5 =0.25* collagen volume Collagen Stock Solution 20 =0.5 * total volume 0.1M NaOH 2.5 =0.125* Collagen volume

6. Pour the mixture into the desired mold 7. Incubate at 370C for one hour before liberating from mold 8. Add complete culture medium to TEMEs 9. If creating tubular TEMEs, release gels from the stopper after 24 hours

- 140 - Preparation of Fibrin Tissue Engineered Media Equivalents

Reagents: Trypsin Invitrogen 25200-114 Fibrinogen from Bovine Plasma Sigma F4753 Fetal Bovine Serum Mediatech 35-011-CV 1X DMEM VWR 5000-314 Thrombin Sigma T9549 ε-Aminocaproic Acid (ACA) Sigma A2504

Solutions (Kept on Ice) Fibrinogen Solution (4mg/mL) -Add ACA to 1X DMEM to obtain a 4mg/mL solution. Sterile filter this solution and place on ice -Calculate the amount of fibrinogen needed using the following equation: Fibrinogen needed (mg) = (2mg/mL Fibrinogen)*(TEME volume)*(# of TEME) -Dissolve fibrinogen in cold ACA to obtain a 4mg/mL fibrinogen solution. -Place on ice Thrombin Solution (25 U/mL) Dissolve thrombin in PBS to get a 25U/mL stock solution. Aliquot into 1mL Calculate the amount of thrombin need using the following equation: Thrombin needed (mL) = 0.1 * (total TEME volume)*(thrombin stock concentration)*(2mg/mL fibrinogen) Dilute this volume in 1X DMEM Total dilution volume (mL) = [(# of TEME)*(TEME volume)] – (final FBS volume) – (final fibrinogen volume)

Procedure 1. Wash and trypsinize cells. 2. Count cells and remove volume required to have enough cells for a final concentration of 1x106 cells/TEME. 3. Centrifuge to pellet cells 4. In the order listed below, add each solution to cells (final cell concentration should be 1x106 cells/mL)

Fabrication of 2mg/mL Fibrin TEME Total Hydrogel Volume: 25mL REAGENTS VOLUME (mL) NOTES Fetal Bovine Serum 2.5 0.1 * Total Volume Fibrinogen Solution 12.5 0.5 * Total Volume Thrombin Solution 10 DMEM. Mix thoroughly by gently

5. Pour the mixture into the desired mold. 6. Incubate at 370C for 1 hour before liberating TEME from the mold 7. Add complete culture medium to TEME

- 141 - Mechanical Stimulation of Tissue Engineered Media Equivalent

Purpose: To apply 10% cyclic distension to engineered tissues. Be sure to wear sleeves and gloves.

Reagents and Equipment: McGivney Ligator Rings Miltex 28.151 Tissue Engineered Media Equivalents Complete Culture Medium Bioreactor w/Lid and Gasket Bubble trap and metal stand Glass Beaker Filter 0.2µm filters Serrated Forceps with rounded tip Fine Surgical Forceps

Bioreactor Calibration Silicone sleeves should be calibrated to determine the pressure required to produce 10% distension. The tubing length, bioreactor conditions and pressure readings should be identical to the conditions applied during experiments.

Set-Up of Bioreactor

1) Bioreactor and tubing should be thoroughly cleaned. 2) Autoclave the following: a. Bioreactor and lid with gasket b. Ligator O-rings c. Filter d. Metal tray with instruments (hemostat, serrated forceps, fine surgical forceps) e. Glass Beaker 3) Mount bubble trap on a metal stand with female connector pointed up. Attach bubble trap to bioreactor tubing and filter to bubble trap tubing. 4) Clamp exit ports from metal mandrels and fill bioreactor with ~300 mL of culture medium. Aspirate bubbles from the surface of the medium in the bioreactor to increase better visibility when mounting and securing the constructs in the bioreactor. 5) Using the fine surgical forceps, place a ligator ring over each metal mandrel inside the bioreactor. 6) Mount constructs in bioreactor by pulling ends of silicone sleeves onto metal tubing. Use rounded, serrated forceps to grip the silicone sleeves. Be careful not to puncture the sleeve and maintain sterility. 7) Switching back to the fine forceps, pull ligator rings over the ends of each sleeve to secure to the mandrels.

- 142 - 8) Bioreactor can be leak-tested by applying air pressure (~9psi) through lumen of sleeves. Sleeves should hold this pressure for 10 cycles. Any leakage will be evidenced by air bubbles escaping from the mandrel sleeve connection point. 9) Fill the bubble trap reservoir and bioreactor tubing by unclamping the exit tubes (one at a time) from the metal mandrels and injecting medium through the ports. Bubble trap should be ~3/4 full, to the same point as was used during sleeve calibration. There should be no bubbles in the system when done. 10) Put lid on bioreactor and seal using fittings. Affix 0.2µm filters to air vents in lid. Ensure that all fittings are tightened to prevent leakage. 11) Arrange bioreactor and bubble trap on metal tray and transfer to incubator. 12) Ensure that pressurizing system is functioning correctly and at the appropriate pressure. Attach pressure tubing to open end of tubing from filter. Check pressure again using gage attached to other arm of pressure tubing. 13) Check for leaks and visually ensure that constructs are being stretched appropriately. Check system again after several minutes to ensure that the liquid level in the bioreactor is steady. Check system periodically thereafter to ensure that there are no leaks or other problems.

Acknowledgements This protocol is adapted from the procedures developed by Dror Seliktar, Ph.D. and Jan Stegemann, Ph.D.

- 143 - Intracellular Staining for Flow Cytometry

Reagents: Formaldehyde: 20% aqueous Tousimis 1008A (Ultrapure TEM grade) Prelubricated Microcentrifuge Tubes Costar #3207 Donkey Anti-Rabbit Alexafluor 488 Molecular Probes A21206 Donkey Anti-Rabbit AlexaFluor 546 Molecular Probes A11056 Normal Donkey Serum Sigma D9663 Bovine Serum Albumin (BSA) Sigma A1470 Tween-20 Sigma P7949 Phosphate Buffered Saline Sigma P3813 Collagenase, Type CLS 2 Worthington Biochemical Corp 4176 Polyclonal Antibody to Rat Lung alpha-Elastin Elastin Products Co. RA75 Versican Antibody Abcam AB19345

Solutions: Collagenase Solution Dissolve collagenase at a concentration of 600U/mL in DMEM WITHOUT serum TPBS PBS pH 7.4 0.1% Tween-20 1 ml Water 99 mL 4% Formaldehyde Fixative 20% Formaldehyde 10 ml PBS 40 ml Blocking Buffer (4% Serum) Water 48 ml Normal Donkey Serum 2 ml Working Buffer BSA 0.15g TPBS 15 ml Triton X-100 Stock Solution, 10% Triton X-100 10 ml Water 90 ml Stir for 30-60 minutes at RT to completely dissolve Permeabilization Buffer, 0.1% Triton X-100 10% Stock 0.05 ml PBS 5 ml

- 144 - Procedure: 1. Remove media and isolate cells (either by trypsinization or collagenase digestion). 2. Neutralize cell solution with media containing serum. 3. Centrifuge cell solution (2000 rpm for 3 min) to pellet and aspirate supernatant. 4. Wash cells gently with TPBS.

(For each wash, suspend the cells in TPBS and agitate gently, then spin down at 2000 rpm for 3 min and aspirate supernatant.)

5. Fix cells by adding formaldehyde to pellet in dropwise manner to resuspend cell while avoiding clumping. 6. Incubate for 10 min at RT. 7. Spin and aspirate. 8. Wash cells twice in TPBS. 9. Resuspend pellet in permeabilization solution. Place in prelubricated tubes. 10. Incubate for 5 min at RT. 11. Spin and aspirate

If you want to store and collect samples, resuspend in working buffer and store at 40C until ready to complete staining.

12. Wash cells gently twice in TPBS. 13. Incubate cells in blocking buffer for 1 hour at 370C. 14. Spin and aspirate 15. Incubate with 200µL primary antibody for 1 hour at 370C. (1:100 – elastin antibody, 1µg/mL –versican antibody) 16. Spin and aspirate 17. Wash cells gently 2 times in TPBS, centrifuge 3 min at 2000 rpm 18. Incubate with 200µL appropriate secondary antibody diluted in 1% normal donkey serum for 30 minutes at 370C. Protect from light!!! (1:200-donkey anti-goat, 1:500-donkey anti-rabbit) 19. Spin and aspirate 20. Wash cells gently 2 times in TPBS by centrifuging cells for 3 min at 2000 rpm 21. For flow cytometric analysis, resuspend cell pellet in 300µL of TPBS.

Samples should be analyzed within 24 hours.

Acknowledgements: This protocol was adapted from procedures developed by Tabassum Ahsan, Ph.D. and Ann Ensley, Ph.D.

- 145 - RNA Isolation from Tissue Engineered Media Equivalents

Purpose: To isolate total RNA from cells embedded in tissue engineered media equivalents.

Reagents & Supplies: RNeasy Mini Isolation kit Qiagen 74104 Qiashredders Qiagen 79654 RNase-free DNase kit Qiagen 79254 RNase/DNase free water Sigma W-4502 Ethanol – molecular biology Sigma E702-3 RNase/DNase free B-mercaptoethanol Sigma M3148 Proteinase K Sigma P2308 Liquid Nitrogen RNase/DNase free tubes Agilent UV-Vis Quartz Cuvette (50µL) 20-gauge syringe needles

Solutions: Lysis Buffer Mix RLT buffer (10mL) with 100 µL B-ME; protect from light and store at room temp for up to a month (can scale down i.e. 5ml RLT + 50µL B-ME) Liquid Nitrogen Collect LN2 in a styrofoam cup immediately before use Proteinase K Solution Suspend proteinase K in nanopure water to create 20mg/ml solution. Aliquot and store at -200C DNase stock Mix lyophilized DNase powder with water in kit to get DNase stock solution, then aliquot 100 µL and store at -20C DNase mix Add 10 µL DNase stock to 70 µL RDD to get 80 µL mix per sample.

Procedure: Prepare Tissues Lysate 1. Rinse tissues thoroughly with PBS. 2. Snap freeze tissue in liquid nitrogen. 3. While frozen, chop tissue as finely as possible. 4. Place frozen pieces in 1.7mL RNase/DNase free tubes and place on ice. 5. Add 300 µL of lysis buffer to the tube pass through syringe needle at least 10 times 6. Transfer lysate to qiashredder homogenizer column and spin in centrifuge at max for 2 minutes.

- 146 - (Sample can be stored at -700C this point)

Isolate RNA If using frozen samples, thaw at 370C for 10 minutes 1. Add 590µL double-distilled water to the homogenate. Then add 10 µL proteinase K solution and mix thoroughly by pipetting. 2. Incubate at 550C for 10 minutes. 3. Add 350 µL of 70% ethanol and mix well by pipetting 4. Centrifuge for 3 minutes at 10,000 rpm. 5. Pipet the supernatant into a new tube (not provided in RNeasy Kit). 6. Add 0.5 volumes (approximately 450 µL) of ethanol to the cleared lysate. Mix well by pipetting. Do not centrifuge. 7. Transfer 700 µL of the sample to the RNeasy mini column placed in a 2mL collection tube. 8. Centrifuge at 10,000 rpm for 20 seconds and discard the flow-through. 9. Repeat steps 7 and 8, using the remainder of the sample. Discard the flow- through. 10. Add 350 µL Buffer RW1 solution to the RNeasy column. Centrifuge at 10,000 rpm for 20 sec and discard the flow-through. 11. Add 80 µL DNase mix directly to the membrane in the column and incubate at room temp for 15 minutes. 12. Add 350 µL Buffer RW1 solution to the RNeasy column. Centrifuge at 10,000 rpm for 20 sec and discard the flow-through. 13. Transfer the RNeasy column into a new 2 mL collection tube (supplied in the kit). 14. Add 500 µL of RPE Buffer; centrifuge at 10,000 rpm for 20 sec and discard the flow-through. 15. Add another 500 µL RPE Buffer and centrifuge at MAX speed for 2 minutes. Discard the flow-through. 16. To elute, transfer RNeasy column to a new 1.5 mL collection tube (supplied in kit). 17. Pipet 30 µL RNase-free water directly to the column membrane. 18. Centrifuge for 1 minute at 10,000 rpm.

Spec Samples to Determine Concentration and Purity 1. Prepare and label a small tube for each sample 2. Aliquot 58µL water into each tube 3. Put 2µL of RNA sample into corresponding tube 4. Read at 260nm and 280nm. Samples with a 260nm/280nm ratio between 1.8 and 2.1 is considered pure enough for PCR 5. Calculate concentration: (Absorbance260nm)*(dilution factor)*(RNA quantification value) = Concentration (µg/mL) Concentration (µg/mL)*(volume of sample remaining) = Total RNA in sample

- 147 - cDNA Synthesis for Quantitative RT-PCR

Reagents: SuperScript III First-Strand Synthesis System for RT-PCR Invitrogen 18080-051 RNase/DNase Free Water Sigma W-4502 RNase/DNase free tubes RNA samples

Procedure: Be sure to follow ALL steps as detailed in the SuperScript III procedure outline. This protocol is intended to be a supplement only.

Controls: Be sure to create –RT controls. These are samples which contain sample RNA and all reagents for cDNA synthesis MINUS the reverse transcriptase enzyme (therefore no cDNA will be created and these samples will check for genomic DNA during the PCR amplification steps)

Before preparing samples, turn on thermal cycler and load program to heat to 65°C

Preparing RNA Samples 1. Determine concentration and quality of RNA samples prior to cDNA synthesis. You will need 1µg of RNA in NO MORE than 8µL of water for each tube (cDNA tube as well as –RT tube). 2. Based on spec readings and concentration calculations, determine volume of RNA for each sample which gives 1µg. 3. Calculate appropriate volumes of RNA and water for each sample for a total volume of 10µL. The components for the first step are in the following proportions:

Component Amount (µL) RNA (1µg) n Primer (50µM oligo dT) 1 10mM dNTP mix 1 RNase/DNase free 10-(2+n) water

cDNA Synthesis

Denaturation step: 1. Mix and briefly centrifuge RNA samples, oligo(dT), and dNTP mix

- 148 - 2. Label 2 RNase/DNase free tubes for every RNA sample. One will be the cDNA template the other will be the corresponding –RT control. 3. Add correct volume of RNA to each tube, then add correct volume of water to each tube (total at this point should be 8µL) 4. Add 1µL oligo(dT) to each tube 5. Add 1µL dNTP mix to each tube 6. Vortex briefly and centrifuge to collect total volume 7. Place in tubes in thermal cycler to heat at 65°C for 5 minutes 8. Remove tubes and place on ice for at least 1 minute.

Annealing and cDNA synthesis step: 1. Mix and briefly centrifuge 10X RT buffer, 25mM MgCl2, 0.1M DTT, RNase out and Superscript III RT. 2. Change temperature on thermal cycler to 50°C. 3. Prepare enough cDNA mix for all samples + 0.1 extra for pipetting error 4. Create one tube for cDNA synthesis reactions and one tube for –RT reactions. 5. Always mix reagents together into one tube in the following order:

Component 1 cDNA 1 –RT rxn rxn 10X RT buffer 2 µL 2 µL 25mM MgCl2 4 µL 4 µL 0.1 M DTT 2 µL 2 µL RNase Out 1 µL 1 µL SuperScript III RT 1 µL 0 RNase free water 0 1 µL

6. Vortex and centrifuge to collect total volume of mixture 7. Add 10ul of cDNA mix or –RT mix to each tube, then mix gently and centrifuge briefly to collect 8. Incubate at 50°C for 50 minutes.

Terminate Reaction and Remove RNA: 1. Terminate the reactions at 85°C for 5 minutes and then chill on ice. 2. Collect reactions by brief centrifugation and then add 1ul of RNase H to each tube. 3. Incubate at 37°C for 20 minutes. 4. Store cDNA samples at -20°C or use in PCR immediately

Acknowledgements: This protocol was originally developed by Tiffany Johnson, Ph.D.

- 149 - REFERENCES

1. Rosamond, W., et al., Heart disease and stroke statistics--2007 update: a report from the American Heart Association Statistics Committee and Stroke Statistics Subcommittee. Circulation, 2007. 115(5): p. e69-171.

2. Merrilees, M.J., et al., Retrovirally mediated overexpression of versican v3 by arterial smooth muscle cells induces tropoelastin synthesis and elastic fiber formation in vitro and in neointima after vascular injury. Circ Res, 2002. 90(4): p. 481-7.

3. Helmlinger, G., et al., Effects of pulsatile flow on cultured vascular endothelial cell morphology. J Biomech Eng, 1991. 113(2): p. 123-31.

4. Kladakis, S.M. and R.M. Nerem, Endothelial cell monolayer formation: effect of substrate and fluid shear stress. Endothelium, 2004. 11(1): p. 29-44.

5. Levesque, M.J. and R.M. Nerem, The elongation and orientation of cultured endothelial cells in response to shear stress. J Biomech Eng, 1985. 107(4): p. 341-7.

6. L'Heureux, N., et al., A completely biological tissue-engineered human blood vessel. Faseb J, 1998. 12(1): p. 47-56.

7. Nerem, R.M. and P.R. Girard, Hemodynamic influences on vascular endothelial biology. Toxicol Pathol, 1990. 18(4 Pt 1): p. 572-82.

8. Weinberg, C.B. and E. Bell, A blood vessel model constructed from collagen and cultured vascular cells. Science, 1986. 231(4736): p. 397-400.

9. Wight, T.N., Cell biology of arterial proteoglycans. Arteriosclerosis, 1989. 9(1): p. 1-20.

10. Ziegler, T., R.W. Alexander, and R.M. Nerem, An endothelial cell-smooth muscle cell co-culture model for use in the investigation of flow effects on vascular biology. Ann Biomed Eng, 1995. 23(3): p. 216-25.

11. Ainslie, K.M., et al., Vascular smooth muscle cell glycocalyx influences shear stress-mediated contractile response. J Appl Physiol, 2005. 98(1): p. 242-9.

12. Asanuma, K., et al., Uniaxial strain upregulates matrix-degrading enzymes produced by human vascular smooth muscle cells. Am J Physiol Heart Circ Physiol, 2003. 284(5): p. H1778-84.

- 150 - 13. Davenpeck, K.L., et al., Regional differences in integrin expression: role of alpha(5)beta(1) in regulating smooth muscle cell functions. Circ Res, 2001. 88(3): p. 352-8.

14. Halayko, A.J. and J. Solway, Molecular mechanisms of phenotypic plasticity in smooth muscle cells. J Appl Physiol, 2001. 90(1): p. 358-68.

15. Lemire, J.M., et al., Distinct rat aortic smooth muscle cells differ in versican/PG- M expression. Arterioscler Thromb Vasc Biol, 1996. 16(6): p. 821-9.

16. Nikolovski, J., B.S. Kim, and D.J. Mooney, Cyclic strain inhibits switching of smooth muscle cells to an osteoblast-like phenotype. Faseb J, 2003. 17(3): p. 455- 7.

17. Raines, E.W., The extracellular matrix can regulate vascular cell migration, proliferation, and survival: relationships to vascular disease. Int J Exp Pathol, 2000. 81(3): p. 173-82.

18. Shanahan, C.M. and P.L. Weissberg, Smooth muscle cell heterogeneity: patterns of gene expression in vascular smooth muscle cells in vitro and in vivo. Arterioscler Thromb Vasc Biol, 1998. 18(3): p. 333-8.

19. Sobue, K., K. Hayashi, and W. Nishida, Expressional regulation of smooth muscle cell-specific genes in association with phenotypic modulation. Mol Cell Biochem, 1999. 190(1-2): p. 105-18.

20. Sugitani, H., et al., Nitric oxide stimulates elastin expression in chick aortic smooth muscle cells. Biol Pharm Bull, 2001. 24(5): p. 461-4.

21. Sutcliffe, M.C. and J.M. Davidson, Effect of static stretching on elastin production by porcine aortic smooth muscle cells. Matrix, 1990. 10(3): p. 148-53.

22. Thie, M., et al., Responsiveness of aortic smooth muscle cells to soluble growth mediators is influenced by cell-matrix contact. Arterioscler Thromb, 1993. 13(7): p. 994-1004.

23. Tummalapalli, C.M. and S.C. Tyagi, Responses of vascular smooth muscle cell to extracellular matrix degradation. J Cell Biochem, 1999. 75(3): p. 515-27.

24. Wen, J.K., et al., Comparison of gene expression patterns and migration capability at quiescent and proliferating vascular smooth muscle cells stimulated by cytokines. Life Sci, 2002. 70(7): p. 799-807.

25. Johnson, T.L. and R.M. Nerem, Endothelial connexin 37, connexin 40, and connexin 43 respond uniquely to substrate and shear stress. Endothelium, 2007. 14(4): p. 215-26.

- 151 - 26. Li, G., et al., Direct in vivo evidence demonstrating neointimal migration of adventitial fibroblasts after balloon injury of rat carotid arteries. Circulation, 2000. 101(12): p. 1362-5.

27. Jenkins, C., et al., A cell culture model using rat coronary artery adventitial fibroblasts to measure collagen production. BMC Cardiovasc Disord, 2007. 7: p. 13.

28. Fox, S.I., Human Physiology. 4th ed. 1993, Dubuque, IA: William C. Brown Publishers.

29. Jackson, Z.S., A.I. Gotlieb, and B.L. Langille, Wall tissue remodeling regulates longitudinal tension in arteries. Circ Res, 2002. 90(8): p. 918-25.

30. Berglund, J.D., et al., A biological hybrid model for collagen-based tissue engineered vascular constructs. Biomaterials, 2003. 24(7): p. 1241-54.

31. Platt, M.O., R.F. Ankeny, and H. Jo, Laminar shear stress inhibits cathepsin L activity in endothelial cells. Arterioscler Thromb Vasc Biol, 2006. 26(8): p. 1784- 90.

32. Stegemann, J.P., H. Hong, and R.M. Nerem, Mechanical, biochemical, and extracellular matrix effects on vascular smooth muscle cell phenotype. J Appl Physiol, 2005. 98(6): p. 2321-7.

33. Aoyagi, M., et al., Smooth muscle cell proliferation, elastin formation, and tropoelastin transcripts during the development of intimal thickening in rabbit carotid arteries after endothelial denudation. Histochem Cell Biol, 1997. 107(1): p. 11-7.

34. Brown-Augsburger, P., et al., Functional domains on elastin and microfibril- associated glycoprotein involved in elastic fibre assembly. Biochem J, 1996. 318 ( Pt 1): p. 149-55.

35. Thyberg, J., Differentiated properties and proliferation of arterial smooth muscle cells in culture. Int Rev Cytol, 1996. 169: p. 183-265.

36. Owens, G.K., Role of mechanical strain in regulation of differentiation of vascular smooth muscle cells. Circ Res, 1996. 79(5): p. 1054-5.

37. Buijtenhuijs, P., et al., Tissue engineering of blood vessels: characterization of smooth-muscle cells for culturing on collagen-and-elastin-based scaffolds. Biotechnol Appl Biochem, 2004. 39(Pt 2): p. 141-9.

- 152 - 38. Redecker-Beuke, B., et al., Aortic smooth muscle cells in a three-dimensional collagen lattice culture. Evidence for posttranslational regulation of collagen synthesis. Arterioscler Thromb, 1993. 13(11): p. 1572-9.

39. Thie, M., et al., Aortic smooth muscle cells in collagen lattice culture: effects on ultrastructure, proliferation and collagen synthesis. Eur J Cell Biol, 1991. 55(2): p. 295-304.

40. Stegemann, J.P. and R.M. Nerem, Altered response of vascular smooth muscle cells to exogenous biochemical stimulation in two- and three-dimensional culture. Exp Cell Res, 2003. 283(2): p. 146-55.

41. Swartz, D.D., J.A. Russell, and S.T. Andreadis, Engineering of fibrin-based functional and implantable small-diameter blood vessels. Am J Physiol Heart Circ Physiol, 2005. 288(3): p. H1451-60.

42. Stegemann, J.P. and R.M. Nerem, Phenotype modulation in vascular tissue engineering using biochemical and mechanical stimulation. Ann Biomed Eng, 2003. 31(4): p. 391-402.

43. Stegemann, J.P., et al., Genetic modification of smooth muscle cells to control phenotype and function in vascular tissue engineering. Tissue Eng, 2004. 10(1-2): p. 189-99.

44. Kanda, K. and T. Matsuda, Mechanical stress-induced orientation and ultrastructural change of smooth muscle cells cultured in three-dimensional collagen lattices. Cell Transplant, 1994. 3(6): p. 481-92.

45. Pickering, J.G., Regulation of vascular cell behavior by collagen : form is function. Circ Res, 2001. 88(5): p. 458-9.

46. Hsu, S., A.M. Jamieson, and J. Blackwell, Viscoelastic studies of extracellular matrix interactions in a model native collagen gel system. Biorheology, 1994. 31(1): p. 21-36.

47. Silver, F., Biological Materials: Structure, Mechanical Properties, and Modeling of Soft Tissues. 1987, New York: New York University Press. 228.

48. Heydarkhan-Hagvall, S., et al., Production of extracellular matrix components in tissue-engineered blood vessels. Tissue Eng, 2006. 12(4): p. 831-42.

49. Ratcliffe, A., Tissue engineering of vascular grafts. Matrix Biol, 2000. 19(4): p. 353-7.

50. Rosenbloom, J., W.R. Abrams, and R. Mecham, Extracellular matrix 4: the elastic fiber. Faseb J, 1993. 7(13): p. 1208-18.

- 153 - 51. Viidik, A., C.C. Danielson, and H. Oxlund, On fundamental and phenomenological models, structure and mechanical properties of collagen, elastin and glycosaminoglycan complexes. Biorheology, 1982. 19(3): p. 437-51.

52. Fung, Y.C., Elasticity of soft tissues in simple elongation. Am J Physiol, 1967. 213(6): p. 1532-44.

53. Schonherr, E., et al., Effects of platelet-derived growth factor and transforming growth factor-beta 1 on the synthesis of a large versican-like chondroitin sulfate proteoglycan by arterial smooth muscle cells. J Biol Chem, 1991. 266(26): p. 17640-7.

54. Shadwick, R.E., Mechanical design in arteries. J Exp Biol, 1999. 202(Pt 23): p. 3305-13.

55. Lodish, H., Molecular Cell Biology. 4th ed. 1999, New York: W.H. Freeman & Company.

56. Gross, J., J.H. Highberger, and F.O. Schmitt, Collagen Structures Considered as States of Aggregation of a Kinetic Unit. the Tropocollagen Particle. Proc Natl Acad Sci U S A, 1954. 40(8): p. 679-88.

57. Highberger, J.H., J. Gross, and F.O. Schmitt, The interaction of mucoprotein with soluble collagen; an electron microscope study. Proc Natl Acad Sci U S A, 1951. 37(5): p. 286-91.

58. Sheu, M.T., et al., Characterization of collagen gel solutions and collagen matrices for cell culture. Biomaterials, 2001. 22(13): p. 1713-9.

59. Ichii, T., et al., Fibrillar collagen specifically regulates human vascular smooth muscle cell genes involved in cellular responses and the pericellular matrix environment. Circ Res, 2001. 88(5): p. 460-7.

60. Elsdale, T. and J. Bard, Collagen substrata for studies on cell behavior. J Cell Biol, 1972. 54(3): p. 626-37.

61. Bessea, L., et al., Production of ordered collagen matrices for three-dimensional cell culture. Biomaterials, 2002. 23(1): p. 27-36.

62. Dunn, M.G. and F.H. Silver, Viscoelastic behavior of human connective tissues: relative contribution of viscous and elastic components. Connect Tissue Res, 1983. 12(1): p. 59-70.

63. Sasaki, T., et al., Tropoelastin binding to fibulins, nidogen-2 and other extracellular matrix proteins. FEBS Lett, 1999. 460(2): p. 280-4.

- 154 - 64. Vrhovski, B. and A.S. Weiss, Biochemistry of tropoelastin. Eur J Biochem, 1998. 258(1): p. 1-18.

65. Rosenbloom, J., et al., Structure of the elastin gene. Ciba Found Symp, 1995. 192: p. 59-74; discussion 74-80.

66. Tsuruga, E., T. Yajima, and K. Irie, Induction of fibulin-5 gene is regulated by tropoelastin gene, and correlated with tropoelastin accumulation in vitro. Int J Biochem Cell Biol, 2004. 36(3): p. 395-400.

67. Fung, Y.C., S.Q. Liu, and J.B. Zhou, Remodeling of the constitutive equation while a blood vessel remodels itself under stress. J Biomech Eng, 1993. 115(4B): p. 453-9.

68. Daamen, W.F., et al., Elastin as a biomaterial for tissue engineering. Biomaterials, 2007. 28(30): p. 4378-98.

69. Faury, G., Function-structure relationship of elastic arteries in evolution: from microfibrils to elastin and elastic fibres. Pathol Biol (Paris), 2001. 49(4): p. 310- 25.

70. Kielty, C.M., M.J. Sherratt, and C.A. Shuttleworth, Elastic fibres. J Cell Sci, 2002. 115(Pt 14): p. 2817-28.

71. Robert, L., Cell-elastin interaction and signaling. Pathol Biol (Paris), 2005. 53(7): p. 399-404.

72. Starcher, B.C., Lung elastin and matrix. Chest, 2000. 117(5 Suppl 1): p. 229S- 34S.

73. Franzblau, C., et al., Role of tropoelastin fragmentation in elastogenesis in rat smooth muscle cells. J Biol Chem, 1989. 264(25): p. 15115-9.

74. Trask, T.M., et al., Interaction of tropoelastin with the amino-terminal domains of fibrillin-1 and fibrillin-2 suggests a role for the fibrillins in elastic fiber assembly. J Biol Chem, 2000. 275(32): p. 24400-6.

75. Swee, M.H., W.C. Parks, and R.A. Pierce, Developmental regulation of elastin production. Expression of tropoelastin pre-mRNA persists after down-regulation of steady-state mRNA levels. J Biol Chem, 1995. 270(25): p. 14899-906.

76. Mecham, R.P., Elastin synthesis and fiber assembly. Ann N Y Acad Sci, 1991. 624: p. 137-46.

77. Davidson, J.M., et al., Developmental regulation of elastin synthesis. Connect Tissue Res, 1981. 8(3-4): p. 209-12.

- 155 - 78. Parks, W.C., et al., Developmental regulation of tropoelastin isoforms. J Biol Chem, 1988. 263(9): p. 4416-23.

79. Holzenberger, M., C.A. Lievre, and L. Robert, Tropoelastin gene expression in the developing vascular system of the chicken: an in situ hybridization study. Anat Embryol (Berl), 1993. 188(5): p. 481-92.

80. Hurle, J.M., et al., Elastin exhibits a distinctive temporal and spatial pattern of distribution in the developing chick limb in association with the establishment of the cartilaginous skeleton. J Cell Sci, 1994. 107 ( Pt 9): p. 2623-34.

81. Selmin, O., D. Volpin, and G.M. Bressan, Changes of cellular expression of mRNA for tropoelastin in the intraembryonic arterial vessels of developing chick revealed by in situ hybridization. Matrix, 1991. 11(5): p. 347-58.

82. Hinek, A., Biological roles of the non-integrin elastin/laminin receptor. Biol Chem, 1996. 377(7-8): p. 471-80.

83. Kozel, B.A., et al., Domains in tropoelastin that mediate elastin deposition in vitro and in vivo. J Biol Chem, 2003. 278(20): p. 18491-8.

84. Davis, E.C. and R.P. Mecham, Intracellular trafficking of tropoelastin. Matrix Biol, 1998. 17(4): p. 245-54.

85. Foster, J.A., et al., Proelastin. Synthesis in cultured smooth muscle cells. J Biol Chem, 1978. 253(8): p. 2797-803.

86. Mecham, R.P., Modulation of elastin synthesis: in vitro models. Methods Enzymol, 1987. 144: p. 232-46.

87. Robb, B.W., et al., Characterization of an in vitro model of elastic fiber assembly. Mol Biol Cell, 1999. 10(11): p. 3595-605.

88. Sandberg, L.B., J.G. Leslie, and B.W. Oakes, In vitro studies of elastin metabolism. Connect Tissue Res, 1981. 8(3-4): p. 219-25.

89. Hinek, A. and M. Rabinovitch, 67-kD elastin-binding protein is a protective "companion" of extracellular insoluble elastin and intracellular tropoelastin. J Cell Biol, 1994. 126(2): p. 563-74.

90. Cleary, E.G., J.C. Fanning, and I. Prosser, Possible roles of microfibrils in elastogenesis. Connect Tissue Res, 1981. 8(3-4): p. 161-6.

91. Nakamura, T., et al., Fibulin-5/DANCE is essential for elastogenesis in vivo. Nature, 2002. 415(6868): p. 171-5.

- 156 - 92. Bunda, S., N. Kaviani, and A. Hinek, Fluctuations of intracellular iron modulate elastin production. J Biol Chem, 2005. 280(3): p. 2341-51.

93. Mecham, R.P., et al., Elastin binds to a multifunctional 67-kilodalton peripheral membrane protein. Biochemistry, 1989. 28(9): p. 3716-22.

94. Hinek, A., et al., Impaired elastin fiber assembly related to reduced 67-kD elastin-binding protein in fetal lamb ductus arteriosus and in cultured aortic smooth muscle cells treated with chondroitin sulfate. J Clin Invest, 1991. 88(6): p. 2083-94.

95. Hinek, A., J. Boyle, and M. Rabinovitch, Vascular smooth muscle cell detachment from elastin and migration through elastic laminae is promoted by chondroitin sulfate-induced "shedding" of the 67-kDa cell surface elastin binding protein. Exp Cell Res, 1992. 203(2): p. 344-53.

96. Timpl, R., et al., Fibulins: a versatile family of extracellular matrix proteins. Nat Rev Mol Cell Biol, 2003. 4(6): p. 479-89.

97. Reinhardt, D.P., et al., Fibrillin-1 and fibulin-2 interact and are colocalized in some tissues. J Biol Chem, 1996. 271(32): p. 19489-96.

98. Midwood, K.S. and J.E. Schwarzbauer, Elastic fibers: building bridges between cells and their matrix. Curr Biol, 2002. 12(8): p. R279-81.

99. Yanagisawa, H., et al., Fibulin-5 is an elastin-binding protein essential for elastic fibre development in vivo. Nature, 2002. 415(6868): p. 168-71.

100. Spencer, J.A., et al., Altered vascular remodeling in fibulin-5-deficient mice reveals a role of fibulin-5 in smooth muscle cell proliferation and migration. Proc Natl Acad Sci U S A, 2005. 102(8): p. 2946-51.

101. Mecham, R.P., Effects of extracellular matrix upon elastogenesis. Connect Tissue Res, 1981. 8(3-4): p. 241-4.

102. Mecham, R.P., ELastin biosynthesis: a look at the current scene. Connect Tissue Res, 1981. 8(3-4): p. 155-60.

103. Mecham, R.P., et al., Elastic fibre assembly: macromolecular interactions. Ciba Found Symp, 1995. 192: p. 172-81; discussion 181-4.

104. Penner, A.S., et al., Microfibril-associated glycoprotein-2 interacts with fibrillin-1 and fibrillin-2 suggesting a role for MAGP-2 in elastic fiber assembly. J Biol Chem, 2002. 277(38): p. 35044-9.

- 157 - 105. Kuang, P.P., et al., Coordinate expression of fibulin-5/DANCE and elastin during lung injury repair. Am J Physiol Lung Cell Mol Physiol, 2003. 285(5): p. L1147- 52.

106. Isogai, Z., et al., Versican interacts with fibrillin-1 and links extracellular microfibrils to other connective tissue networks. J Biol Chem, 2002. 277(6): p. 4565-72.

107. Kielty, C.M., et al., Fibrillin-rich microfibrils: elastic biopolymers of the extracellular matrix. J Muscle Res Cell Motil, 2002. 23(5-6): p. 581-96.

108. Elbjeirami, W.M., et al., Enhancing mechanical properties of tissue-engineered constructs via lysyl oxidase crosslinking activity. J Biomed Mater Res A, 2003. 66(3): p. 513-21.

109. Starcher, B.C. and R.P. Mecham, Desmosine radioimmunoassay as a means of studying elastogenesis in cell culture. Connect Tissue Res, 1981. 8(3-4): p. 255-8.

110. Bunda, S., et al., Aldosterone induces elastin production in cardiac fibroblasts through activation of insulin-like growth factor-I receptors in a mineralocorticoid receptor-independent manner. Am J Pathol, 2007. 171(3): p. 809-19.

111. Hayashi, A., et al., Minoxidil stimulates elastin expression in aortic smooth muscle cells. Arch Biochem Biophys, 1994. 315(1): p. 137-41.

112. Kucich, U., et al., Stabilization of elastin mRNA by TGF-beta: initial characterization of signaling pathway. Am J Respir Cell Mol Biol, 1997. 17(1): p. 10-6.

113. Kucich, U., et al., Transforming growth factor-beta stabilizes elastin mRNA by a pathway requiring active Smads, protein kinase C-delta, and p38. Am J Respir Cell Mol Biol, 2002. 26(2): p. 183-8.

114. McGowan, S.E., et al., Exogenous and endogenous transforming growth factors- beta influence elastin gene expression in cultured lung fibroblasts. Am J Respir Cell Mol Biol, 1997. 17(1): p. 25-35.

115. O'Callaghan, C.J. and B. Williams, Mechanical strain-induced extracellular matrix production by human vascular smooth muscle cells: role of TGF-beta(1). Hypertension, 2000. 36(3): p. 319-24.

116. Okragly, A., Balwit, J.M., Haak-Frendscho, M., Transforming Growth Factor beta-1 (TGF-beta-1): A Biological Paradox, in Promega Notes Magazine. 1994. p. 10-16.

- 158 - 117. Simionescu, A., K. Philips, and N. Vyavahare, Elastin-derived peptides and TGF- beta1 induce osteogenic responses in smooth muscle cells. Biochem Biophys Res Commun, 2005. 334(2): p. 524-32.

118. Karnik, A critical role for elastin signaling in vascular morphogenesis and disease. 2003.

119. Hinek, A., et al., Decreased elastin deposition and high proliferation of fibroblasts from Costello syndrome are related to functional deficiency in the 67- kD elastin-binding protein. Am J Hum Genet, 2000. 66(3): p. 859-72.

120. Hinek, A., et al., Retrovirally mediated overexpression of versican v3 reverses impaired elastogenesis and heightened proliferation exhibited by fibroblasts from Costello syndrome and Hurler disease patients. Am J Pathol, 2004. 164(1): p. 119-31.

121. Spofford, C.M. and W.M. Chilian, The elastin-laminin receptor functions as a mechanotransducer in vascular smooth muscle. Am J Physiol Heart Circ Physiol, 2001. 280(3): p. H1354-60.

122. Hornebeck, W., J.M. Tixier, and L. Robert, Inducible adhesion of mesenchymal cells to elastic fibers: elastonectin. Proc Natl Acad Sci U S A, 1986. 83(15): p. 5517-20.

123. Rodgers, U.R. and A.S. Weiss, Integrin alpha v beta 3 binds a unique non-RGD site near the C-terminus of human tropoelastin. Biochimie, 2004. 86(3): p. 173-8.

124. Rodgers, U.R. and A.S. Weiss, Cellular interactions with elastin. Pathol Biol (Paris), 2005. 53(7): p. 390-8.

125. Urban, Z., et al., Connection between elastin haploinsufficiency and increased cell proliferation in patients with supravalvular aortic stenosis and Williams- Beuren syndrome. Am J Hum Genet, 2002. 71(1): p. 30-44.

126. Wight, T.N., Versican: a versatile extracellular matrix proteoglycan in cell biology. Curr Opin Cell Biol, 2002. 14(5): p. 617-23.

127. Lemire, J.M., et al., Versican/PG-M isoforms in vascular smooth muscle cells. Arterioscler Thromb Vasc Biol, 1999. 19(7): p. 1630-9.

128. Lee, R.T., et al., Mechanical strain induces specific changes in the synthesis and organization of proteoglycans by vascular smooth muscle cells. J Biol Chem, 2001. 276(17): p. 13847-51.

- 159 - 129. Serra, M., et al., V3 versican isoform expression alters the phenotype of melanoma cells and their tumorigenic potential. Int J Cancer, 2005. 114(6): p. 879-86.

130. Lemire, J.M., et al., Overexpression of the V3 variant of versican alters arterial smooth muscle cell adhesion, migration, and proliferation in vitro. J Cell Physiol, 2002. 190(1): p. 38-45.

131. Evanko, S.P., J.C. Angello, and T.N. Wight, Formation of hyaluronan- and versican-rich pericellular matrix is required for proliferation and migration of vascular smooth muscle cells. Arterioscler Thromb Vasc Biol, 1999. 19(4): p. 1004-13.

132. Wight, T.N., et al., Selective deposits of versican in the extracellular matrix of restenotic lesions from human peripheral arteries. Am J Pathol, 1997. 151(4): p. 963-73.

133. Miquel-Serra, L., et al., V3 versican isoform expression has a dual role in human melanoma tumor growth and metastasis. Lab Invest, 2006.

134. Zimmermann, D.R., et al., Versican is expressed in the proliferating zone in the epidermis and in association with the elastic network of the dermis. J Cell Biol, 1994. 124(5): p. 817-25.

135. Badylak, S.F., Regenerative medicine and developmental biology: the role of the extracellular matrix. Anat Rec B New Anat, 2005. 287(1): p. 36-41.

136. Grassl, E.D., T.R. Oegema, and R.T. Tranquillo, Fibrin as an alternative biopolymer to type-I collagen for the fabrication of a media equivalent. J Biomed Mater Res, 2002. 60(4): p. 607-12.

137. L'Heureux, N., et al., In vitro construction of a human blood vessel from cultured vascular cells: a morphologic study. J Vasc Surg, 1993. 17(3): p. 499-509.

138. Seliktar, D., et al., Dynamic mechanical conditioning of collagen-gel blood vessel constructs induces remodeling in vitro. Ann Biomed Eng, 2000. 28(4): p. 351-62.

139. Mitchell, S.L. and L.E. Niklason, Requirements for growing tissue-engineered vascular grafts. Cardiovasc Pathol, 2003. 12(2): p. 59-64.

140. Niklason, L.E., et al., Functional arteries grown in vitro. Science, 1999. 284(5413): p. 489-93.

141. L'Heureux, N., et al., Human tissue-engineered blood vessels for adult arterial revascularization. Nat Med, 2006. 12(3): p. 361-5.

- 160 - 142. Stock, U.A., et al., Dynamics of extracellular matrix production and turnover in tissue engineered cardiovascular structures. J Cell Biochem, 2001. 81(2): p. 220- 8.

143. Lu, Q., et al., Novel porous aortic elastin and collagen scaffolds for tissue engineering. Biomaterials, 2004. 25(22): p. 5227-37.

144. Tranquillo, R.T., The tissue-engineered small-diameter artery. Ann N Y Acad Sci, 2002. 961: p. 251-4.

145. Grassl, E.D., T.R. Oegema, and R.T. Tranquillo, A fibrin-based arterial media equivalent. J Biomed Mater Res A, 2003. 66(3): p. 550-61.

146. Lemire, J.M., et al., Characterization of cloned aortic smooth muscle cells from young rats. Am J Pathol, 1994. 144(5): p. 1068-81.

147. McCloskey, K.E., et al., Purified and proliferating endothelial cells derived and expanded in vitro from embryonic stem cells. Endothelium, 2003. 10(6): p. 329- 36.

148. McCloskey, K.E., S.L. Stice, and R.M. Nerem, In vitro derivation and expansion of endothelial cells from embryonic stem cells. Methods Mol Biol, 2006. 330: p. 287-301.

149. Huang, H., et al., Differentiation of human embryonic stem cells into smooth muscle cells in adherent monolayer culture. Biochem Biophys Res Commun, 2006. 351(2): p. 321-7.

150. Liu, J.Y., et al., Functional tissue-engineered blood vessels from bone marrow progenitor cells. Cardiovasc Res, 2007. 75(3): p. 618-28.

151. Delo, D.M., et al., Amniotic fluid and placental stem cells. Methods Enzymol, 2006. 419: p. 426-38.

152. Zisch, A.H., Tissue engineering of angiogenesis with autologous endothelial progenitor cells. Curr Opin Biotechnol, 2004. 15(5): p. 424-9.

153. Cukierman, E., R. Pankov, and K.M. Yamada, Cell interactions with three- dimensional matrices. Curr Opin Cell Biol, 2002. 14(5): p. 633-9.

154. Mauch, C., et al., Collagenase gene expression in fibroblasts is regulated by a three-dimensional contact with collagen. FEBS Lett, 1989. 250(2): p. 301-5.

155. Neidert, M.R., et al., Enhanced fibrin remodeling in vitro with TGF-beta1, insulin and plasmin for improved tissue-equivalents. Biomaterials, 2002. 23(17): p. 3717- 31.

- 161 - 156. Grinnell, F. and C.R. Lamke, Reorganization of hydrated collagen lattices by human skin fibroblasts. J Cell Sci, 1984. 66: p. 51-63.

157. Cummings, C.L., et al., Properties of engineered vascular constructs made from collagen, fibrin, and collagen-fibrin mixtures. Biomaterials, 2004. 25(17): p. 3699-706.

158. Ross, J.J. and R.T. Tranquillo, ECM gene expression correlates with in vitro tissue growth and development in fibrin gel remodeled by neonatal smooth muscle cells. Matrix Biol, 2003. 22(6): p. 477-90.

159. Herbert, C.B., G.D. Bittner, and J.A. Hubbell, Effects of fibinolysis on neurite growth from dorsal root ganglia cultured in two- and three-dimensional fibrin gels. J Comp Neurol, 1996. 365(3): p. 380-91.

160. Tuan, T.L. and F. Grinnell, Fibronectin and fibrinolysis are not required for fibrin gel contraction by human skin fibroblasts. J Cell Physiol, 1989. 140(3): p. 577-83.

161. Long, J.L. and R.T. Tranquillo, Elastic fiber production in cardiovascular tissue- equivalents. Matrix Biol, 2003. 22(4): p. 339-50.

162. Goissis, G., et al., Preparation and characterization of collagen-elastin matrices from blood vessels intended as small diameter vascular grafts. Artif Organs, 2000. 24(3): p. 217-23.

163. Niklason, L.E., et al., Morphologic and mechanical characteristics of engineered bovine arteries. J Vasc Surg, 2001. 33(3): p. 628-38.

164. Huynh, T., et al., Remodeling of an acellular collagen graft into a physiologically responsive neovessel. Nat Biotechnol, 1999. 17(11): p. 1083-6.

165. Sandusky, G.E., G.C. Lantz, and S.F. Badylak, Healing comparison of small intestine submucosa and ePTFE grafts in the canine carotid artery. J Surg Res, 1995. 58(4): p. 415-20.

166. Voytik-Harbin, S.L., et al., Identification of extractable growth factors from small intestinal submucosa. J Cell Biochem, 1997. 67(4): p. 478-91.

167. Jordan, S.W. and E.L. Chaikof, Novel thromboresistant materials. J Vasc Surg, 2007. 45 Suppl A: p. A104-15.

168. Jordan, S.W., et al., The effect of a recombinant elastin-mimetic coating of an ePTFE prosthesis on acute thrombogenicity in a baboon arteriovenous shunt. Biomaterials, 2007. 28(6): p. 1191-7.

- 162 - 169. Williams, C. and T.M. Wick, Perfusion bioreactor for small diameter tissue- engineered arteries. Tissue Eng, 2004. 10(5-6): p. 930-41.

170. Jeong, S.I., et al., Mechano-active tissue engineering of vascular smooth muscle using pulsatile perfusion bioreactors and elastic PLCL scaffolds. Biomaterials, 2005. 26(12): p. 1405-11.

171. Gutowska, A., B. Jeong, and M. Jasionowski, Injectable gels for tissue engineering. Anat Rec, 2001. 263(4): p. 342-9.

172. Berglund, J.D., R.M. Nerem, and A. Sambanis, Incorporation of intact elastin scaffolds in tissue-engineered collagen-based vascular grafts. Tissue Eng, 2004. 10(9-10): p. 1526-35.

173. Stone, P.J., et al., Building Elastin. Incorporation of recombinant human tropoelastin into extracellular matrices using nonelastogenic rat-1 fibroblasts as a source for lysyl oxidase. Am J Respir Cell Mol Biol, 2001. 24(6): p. 733-9.

174. Larionov, A., A. Krause, and W. Miller, A standard curve based method for relative real time PCR data processing. BMC Bioinformatics, 2005. 6: p. 62.

175. Carson, F., Histotechnology: A Self-Instructional Text. 2nd ed. 1997: American Society of Clinical Pathologists.

176. Mallory, F., Pathological Technique. 1961, New York: Hafner Publishing. 168.

177. Isenberg, B.C. and R.T. Tranquillo, Long-term cyclic distention enhances the mechanical properties of collagen-based media-equivalents. Ann Biomed Eng, 2003. 31(8): p. 937-49.

178. Chen, J.K., H. Hoshi, and W.L. McKeehan, Transforming growth factor type beta specifically stimulates synthesis of proteoglycan in human adult arterial smooth muscle cells. Proc Natl Acad Sci U S A, 1987. 84(15): p. 5287-91.

179. Park, P.W., et al., Lysozyme binds to elastin and protects elastin from elastase- mediated degradation. J Invest Dermatol, 1996. 106(5): p. 1075-80.

180. Grosso, L.E., L.A. Whitehouse, and R.P. Mecham, Immunohistochemical detection of intracellular tropoelastin: an assay for elastin production and its use in the detection and assessment of elastogenic factors. Am J Respir Cell Mol Biol, 1990. 3(1): p. 45-9.

181. Gosline, J.M., The physical properties of elastic tissue. Int Rev Connect Tissue Res, 1976. 7: p. 211-49.

- 163 - 182. Bassols, A. and J. Massague, Transforming growth factor beta regulates the expression and structure of extracellular matrix chondroitin/dermatan sulfate proteoglycans. J Biol Chem, 1988. 263(6): p. 3039-45.

183. Nerem, R.M., Role of mechanics in vascular tissue engineering. Biorheology, 2003. 40(1-3): p. 281-7.

184. Seliktar, D., R.M. Nerem, and Z.S. Galis, The role of matrix metalloproteinase-2 in the remodeling of cell-seeded vascular constructs subjected to cyclic strain. Ann Biomed Eng, 2001. 29(11): p. 923-34.

185. Seliktar, D., R.M. Nerem, and Z.S. Galis, Mechanical strain-stimulated remodeling of tissue-engineered blood vessel constructs. Tissue Eng, 2003. 9(4): p. 657-66.

186. Swartz, M.A., et al., Mechanical stress is communicated between different cell types to elicit matrix remodeling. Proc Natl Acad Sci U S A, 2001. 98(11): p. 6180-5.

187. Humphrey, J.D. and S. Na, Elastodynamics and arterial wall stress. Ann Biomed Eng, 2002. 30(4): p. 509-23.

188. Gonen-Wadmany, M., L. Gepstein, and D. Seliktar, Controlling the cellular organization of tissue-engineered cardiac constructs. Ann N Y Acad Sci, 2004. 1015: p. 299-311.

189. Goffin, J.M., et al., Focal adhesion size controls tension-dependent recruitment of alpha-smooth muscle actin to stress fibers. J Cell Biol, 2006. 172(2): p. 259-68.

190. Hinz, B., Masters and servants of the force: the role of matrix adhesions in myofibroblast force perception and transmission. Eur J Cell Biol, 2006. 85(3-4): p. 175-81.

191. Hinz, B. and G. Gabbiani, Mechanisms of force generation and transmission by myofibroblasts. Curr Opin Biotechnol, 2003. 14(5): p. 538-46.

192. Tomasek, J.J., et al., Myofibroblasts and mechano-regulation of connective tissue remodelling. Nat Rev Mol Cell Biol, 2002. 3(5): p. 349-63.

193. Engler, A., et al., Substrate compliance versus ligand density in cell on gel responses. Biophys J, 2004. 86(1 Pt 1): p. 617-28.

194. Hinz, B., et al., Alpha-smooth muscle actin expression upregulates fibroblast contractile activity. Mol Biol Cell, 2001. 12(9): p. 2730-41.

- 164 - 195. Hofmann, W. and D. Goger, A simple method for differentiating vascular smooth muscle cells and fibroblasts in tissue culture. Virchows Arch A Pathol Anat Histol, 1976. 370(1): p. 77-83.

196. Ashworth, J.L., et al., Fibrillin assembly: dimer formation mediated by amino- terminal sequences. J Cell Sci, 1999. 112 ( Pt 20): p. 3549-58.

- 165 - VITA

JOSETTE L.B. BROILES

JoSette Leigh Briggs Broiles was born to Joseph and Yvette Briggs on June 4,

1979 in Oklahoma City, Oklahoma. She graduate from Midwest City High School in

1997 and received a B.S. in Mechanical Engineering from the University of Oklahoma in

2001. Following graduation, JoSette married J. Damon Broiles and began graduate study at the Georgia Institute of Technology. In 2003, she received a M.S. in Bioengineering.

Following the successful defense of her dissertation, JoSette will begin a postdoctoral fellowship in the area of myofibroblasts differentiation in the Cell Biology Department at the University of Oklahoma Health Sciences Center. JoSette and Damon have two sons,

J. Winston and J. Solomon.

- 166 -