Molecular Phylogenetics of Pristimantis (Anura: Strabomantidae) and the Origin and Diversification of Central American Species

Molecular Phylogenetics of Pristimantis (Anura: Strabomantidae) and the origin and diversification of Central American species

Nelsy Rocío Pinto Sánchez

Trabajo de grado presentado para optar al título de M aestría en Ciencias Biológicas

Director Santiago Madriñán, Ph.D. Profesor Asociado del Departamento de Ciencias Biológicas Universidad de los Andes

Codirector Andrew J. Cra wford, Ph.D. Investigador Instituto Smithsonian de Investigaciones Tropicales

Bogotá D. C., Noviembre 2008

ABSTRACT

Pristimantis (Anura: Strabomantidae) represents an exceptionally diverse group among Neotropical anurans, but the evolutionary relationships among subgeneric groups are poorly known. Using both original and published multilocus DNA sequence data, we developed a novel phylogenetic hypothesis for this genus. Ingroup sampling included 30.9% of the described species (265 individuals from 132 species, of which 156 individuals from 34 species are new data). Genetic data included three mitochondrial (COI, 12S, 16S) and two nuclear markers (Rag-1 and Tyr) for a total of ~4279 base pairs. Phylogenies were inferred using parsimony, maximum likelihood and Bayesian analyses of individual genes and combined data sets. The new phylogenetic hypothesis conflicts with most recognized taxonomic groupings. Within Pristimantis, the peruvianus group was the only group recovered, whereas the "conscipillatus”, “curtipes”, “devillei”, “frater”, “lacrimosus”, “myersi”, “orestes”, “surdus”, and “unistrigatus” were not supported as natural groups. The molecular phylogeny suggests that the colonization of Central America by South American Pristimantis involved perhaps 13 independent events. Our results suggest alternative interpretations of Pristimantis taxonomy, character evolution, and biogeography, topics that now demand more extensive evaluation in future studies.

Keywords: Anura, Strabomantidae, Pristimantis, Terrarana, Colombia, Central America, Great American Biotic Interchange, M olecular phylogenetics.

INTRODUCTION

Pristimantis Hedges et al. (2008) is a Strabomantidae genus which has been assigned to Terrarana (sensu Hedges et al. 2008), with 427 species is the genus of amphibian with the greatest number of species in the Americas (Lynch 1986, Lynch & Duellman 1997, Campbell 1999, Duellman 1999, Hedges 1999, Frost 2008, AmphibiaWeb 2008, Hedges et al. 2008). However, from an evolutionary and taxonomic viewpoint, this clade of frogs is one of the least known of the major groups of vertebrates. Although new species are recognized and described annually, taxonomists have been incapable of agreeing for the most part on how to organize those species to better reflect their evolutionary history (e.g., Lynch 1976, Savage 1987, Lynch & Duellman 1997, Frost et al. 2006; Hedges et al. 2008). The taxonomic confusion in part shows the insufficiency of characters available for studying the group and the plasticity of the few “useful” characters (Hedges et al. 2008).

During the past five years Terrarana systematics has undergone something of a revolution as the molecular work has been joined by newly developed methods of analysis. Until recently, nine studies using DNA sequences have been undertaken with these frogs, Darst & Cannatella (2004), Crawford & Smith (2005), Frost et al. (2006), Padial et al. (2007), Padial et al. (2008), Heinicke et al. (2007), Crawford et al. (2007), Hedges et al. (2008), and Wang et al. (2008). Excluding the Heinicke et al. (2007) and Hedges et al. (2008) studies, the majority of these investigations have had limited taxon sampling, including less than 5% of all “eleutherodactylines.” Lynch & Duellman (1997) based exclusively on inspection of morphological characters, such as relative length of digits assigned the species of “Eleutherodactylus” to 12 groups: myersi, sulcatus, cerasinus, conspicillatus, curtipes, dolops, devillei, loustes, orestes, surdus, diastema and unistrigatus. Although they considered each species group as monophyletic, they did not present a formal phylogenetic analysis. Subsequently, based on molecular data and phylogenetic analyses Crawford & Smith (2005) elevated to Craugastor to the generic rank, leaving the remaining eleutherodactylines species as a monophyletic group. Afterward Heinicke et al. (2007) restricted “Eleutherodactylus” to the South American clade of 87 species

-3-

(representing 397 species) as Pristimantis. Hedges et al. (2008) proposed the South American clade division in three subgenera (Hypodyction, Pristimantis and Yunganastes) and 427 species.

Pristimantis sensu Hedges et al. (2008) is distributed in Central American (eastern Honduras, Panamá, Honduras and Costa Rica), South America (Colombia, Ecuador, Peru, Bolivia, Amazonian Brazil and the Guianas), Trinidad and Tobago, Grenada, and the Lesser Antilles (AmphibiaWeb 2008). This genus is most diverse in northwestern South America, where its distribution includes the lowlands to elevations of about 4000 m in the Andes in Colombia, Ecuador, and Peru (Frost 2008).

Studying the fauna shared between Colombia and Central American is motivated by the role of the Panamá Isthmus as a land bridge and a driver of expansion, extinction, and the Great American Biotic Interchange (Marshall et al. 1982, Marshall 1988, Simpson 1940, Webb 1978, Webb & Rancy 1996) roughly three million years ago (Coates et al. 2004). M olecular data have been used to investigate the impact the origin of the Isthmus of Panama on marine organisms (Lessios 1979, Bermingham & Lessios 1993, Knowlton et al. 1993), aquatic organisms (Bermingham & Martin 1998) and terrestrial organisms (Zamudio & Greene 1997, Zeh et al. 2003, Weigt et al. 2005, Wang et al. 2008). An interesting model to study the role of Isthmus of Panama is the genus Pristimantis, because it is a terrestrial organism distributed in Central American and South America, intolerant of salt water, unable to fly, and restricted to forested habitats. The geographic distribution of Pr is tim antis has showed that it was originated in South America (Vanzolini & Heyer 1985, Duellman 2001, Savage 2002, Heinicke et al. 2007, Hedges et al. 2008, Wang et al. 2008). Therefore, we could distinguish one biogeographical hypothesis by focusing on one important questions concerning to Central American samples. (1) Do all endemic Central American samples form a monophyletic clade relative to South American samples?. To answer this question, we inferred the spatial and genealogical history based on mitochondrial and nuclear genes of Pristimantis and compared our results to previous work as well as the geological history of Central America isthmo.

-4-

METHODS

Taxon sampling

Throughout this work, we used the taxonomic classification proposed by Hedges et al. (2008). In total, we sampled 156 individuals representing 34 species (Appendix 1). Additional sequences representing 98 species and 109 individuals were downloaded from GenBank (NCBI; Appendix 2). We include 10 species as outgroups, Craugastor daryi, C. longirostris (Craugastoridae); Agalychnis callidryas, Litoria caerulea (Hylidae); and Lynchius flavomaculatus, L. nebulanastes Oreobates cruralis, O. saxatilis, Phrynopus auriculatus, P. bracki (Strabomantidae). Recent studies based on molecular data (Hedges et al. 2008) support the hypothesis that Lynchius, Oreobates and Phrynopus genus are the sister species of Pristimantis. Other group proposed to be closely related to Strabomantidae is Craugastoridae. We used some species of Hylidae as more divergent outgroups to root the phylogeny.

Specimens were collected in 7 countries (Appendix1). Museum material was made available for morphological and molecular examination by the Circulo Herpetológico, Panama (CH); Colección herpetológica, Universidad Industrial de Santander, Colombia (UIS-H), Museum Bolivia Herpetology, Bolivia (MBH); Museo de Herpetología de la Universidad de Antioquia, Colombia (MHUA), and the Museo de Zoología de la Pontificia Universidad Católica del Ecuador, Ecuador (QCAZ). Tissue samples were obtained from specimens listed in Appendix 1. Tissues were collected in the field and preserved in 99% ethanol or a 20% solution of dimethylsulfoxide (DMSO) saturated with NaCl (Amos &Hoelzel 1991, cited in Amos et al. 1992) with the addition of 0.125 M EDTA. Specimens were deposited at public research institutions. Voucher numbers, locality information, and GenBank accession numbers for each specimen are listed in Appendix 1.

-5-

Laboratory techniques

We sequenced the following three mitochondrial genes: 16S rRNA (16S), 12SrRNA (12S), and COI. For a subset of samples we also obtained DNA sequence data from two nuclear exon gene regions: the recombination activating gene 1 (Rag-1) and the tyrosinase gene (Tyr) (Table1). The mitochondrial genes were chosen because they display a slower rate of evolution in an attempt to avoid saturation problems (Heinicke et al. 2007). The fragment of the nuclear gene Tyr was chosen because it has been useful in other studies (Bossuyt & Milinkovitch 2001, Frost et al. 2006, Hedges et al. 2008, Heinicke et al. 2007). The fragment of the nuclear gene Rag-1 is from the relatively faster-evolving first half of the gene (Hedges et al. 2008, Heinicke et al. 2007).

The molecular procedure was performed at the Instituto de Genética, Universidad de los Andes (Colombia) and the Instituto Smithsonian de Investigaciones Tropicales (Panamá). Genomic DNA was extracted from liver and/or thigh muscle tissue using Qiagen QIAamp tissue kit. PCR amplification of gene fragments was performed in 12.5-ml reactions using 0.125 Qiagen Taq, 1.25 µl Buffer 10X with 1.5mM of MgCl2, 1.25µl dNTPs at 2mM, 0.625 µl forward and reverse primers at 10 mM, and 1 ml of extracted DNA (more for low-quality tissue). Standard reaction conditions were an initial hold for 5 min at 94°C; followed by 29 cycles of 94°C/30 s, 55°C (for 16S and 12S) 52°C (for COI) and 60°C (Rag-1 and Tyr) for 30 s and 72°C/60 s. After 29 cycles, a final hold of 72°C/7 min was performed before terminating the reaction at 4°C. For low- or nonyielding samples, annealing temperature was dropped from 60°C to 46°C. Primers used in PCR reactions were obtained from the literature or designed in the lab (see Table 1). Polymerase chain reaction (PCR) products were cleaned by gel slicing and agarose digest, or Exo I/SAP digest. For each individual, both H (heavy) and L (light) strands were sequenced directly. Cycle sequencing reactions were completed using the corresponding PCR primers and BigDye Terminator (Applied Byosciences), with a standard cycle sequencing profile (96°C/60 s; 30 cycles of 96°C /10 s, 50°C/15 s and 60°C/4 min; and 72°C/7min). DNA sequencing was performed with an ABI Prism 3100 sequencher (PE Applied Biosystems).

-6-

The DNA sequences were analyzed with Sequencher 4.2 (Gene Codes Corporation) and Geneious 3.7.0 (Biomatters Ltda). The alignments were conducted initially using MAFFT version 6 (Katoh 2002) under default parameters. Manual adjustments using MacClade ver. 4.07 (Maddison & Maddison 2000) were particularly important in protein coding genes (COI, Rag-1 and Tyr) to maintain reading frames. The 16S and 12S gen es are a highly conserved mitochondrial marker but mutations are common in some variable regions, corresponding to loops in the ribosomal RNA structure. Therefore these alignments were inspected for errors and compared against secondary structure models available from the European ribosomal RNA database. Regions of uncertain homology were excluded from preliminary analysis using G-block 0.91b (Castresana 2000), and manual pruning guided by the results obtained therein. GenBank accession numbers will be provided for all DNA sequences obtained for this study upon acceptance of this manuscript, and all alignments will be made available at TreeBase (http://www.treebase.org) (accession numbers: xxxxxxxxx)

Phyl ogene tic anal yse s

With our data and Gen-Bank information, we constructed four matrices, the first one with 243 individuals and 2503 ribosomal base pairs, the second one with 243 individuals and 3115 mitochondrial base pairs, the third one with 80 individuals and 4279 mitochondrial and nuclear characters), the last one 132 species (265 individuals and 4279 mitochondrial base pairs).

Phylogenetic analyses were conducted using maximum parsimony (MP), maximum likelihood (ML), and Bayesian methods for individual genes, as well as for the concatenated dataset (see data partitions). For M P analysis we performed a heuristic search with 10000 replicates of random taxon-addition and TBR branch swapping, with gaps treated as missing characters, using PAUP* version 4.0b10 (Swofford 2002) as implemented in CIPRES portal. Non-parametric bootstrap values (Felsenstein 1985) were

-7-

obtained with 5000 replicates, each having ten replicates of random taxon-addition.

For ML and Bayesian analysis, we used Modeltest version 3.7 (Posada & Crandall 1998) to evaluate different models of evolution. We selected the model obtained by means of the criterion of Akaike or AIC (Akaike 1973) as this allowed us to simultaneously compare non-nested models, assess model selection uncertainty, and allowed for the estimation of model parameters using all available models (Posada & Buckley 2004). Maximum likelihood analyses were run in RAxML 7.0.0 (Randomized Axelerated M aximum Likelihood, available at http://www.phylo.org/) (Stamatakis et al. 2008), which uses GTRCAT as an approximation for GTR+Gamma. Node support was assessed via 1000 bootstrap replicates.

We conducted Bayesian phylogenetic analyses using MrBayes, version 3.1 (Ronquist & Huelsenbeck 2003) as implemented in CIPRES portal, under the same model as in the ML analysis. We conducted two parallel runs of the MCMC algorithm for 10 million generations each, sampled one tree per 1000 generations. All runs employed four chains with Metropolis coupled MCMC heating. In all searches stationarity of the Markov Chain was determined as the point when sampled log likelihood values plotted against generation time reached a stable mean equilibrium value; "burn-in" data sampled from generations preceding this point were discarded (Huelsenback & Ronquist 2001). The graphics were visualized using Tracer 1.3 (Rambaut & Drummond 2003).

Initially each gene fragment was analyzed individually. Topologies resulting from each gene were compared to detect areas of incongruence that were strongly supported by bootstrap values and/or posterior probabilities (Wiens 1998). We did not employ the Incongruence Length Difference (ILD) test because its power to detect incongruence is extremely low when the incongruence is caused by different topologies, when the number of informative sites is small, and the heterogeneity of among-site substitution rate is

-8-

large. Besides the incongruence caused by unequal branch lengths does not appear to be detected easily by the ILD test (Barker & Lutzoni 2002, Darlu & Lecointre 2002).

Our goal was to analyze the data jointly. Because our combined data set is comprised of one protein-coding mitochondrial gene (COI), two ribosomal genes with secondary structure (12S and 16S), and two nuclear genes (Rag-1 and Tyr), we suspected that application of a single nucleotide substitution model was unlikely to provide a particularly good fit to the data (e.g., Nylander et al. 2004, Brandley et al. 2005). Therefore, we partitioned the data set by gene (12S, 16S, COI, Rag-1 and Tyr), but analyze the data jointly.

Divergence times

Times of divergence were estimated for the 80-species data set by using the program BEAST v1.4.6 (Drummond & Rambaut 2007). The assumed topology was from the five- gene ML analysis. The dataset was analyzed under the GTR+Gamma model with a relaxed clock, allowing branch lengths to vary according to an uncorrelated Lognormal distribution (Drummond et al. 2006). This program co-estimates phylogeny and divergence times under a new class of relaxed clock models. For species-level phylogenies, the Yule tree prior that assumes a constant speciation rate per lineage was used, as suggested by Drummond et al. (2006).

The “treeModel.RootHeight” prior (i.e., the age at the root of the tree) was set to 57 million years (with a standard deviation of 14 million years), in accordance with results from Roelants et al. (2007). We used the Central American clade (Craugastor) as calibration point (42 million years with a standard deviation of 11 million years) according to Heinicke et al. (2007). All other priors were left to the defaults in BEAST. Parameters were estimated using 2 independent runs of 1 million generations each (with a pre-run burn-in of 10000 generations), with parameters sampled every 1000 generations. Convergence was checked in the Tracer v1.4.6 program and summary trees were

-9-

generated using TreeAnnotator v1.4.6, both part of the BEAST package.

Hypothesis testing

Phylogenetic Predictions: We tested predictions from the possibility that the taxonomic groups "conscipillatus”, “curtipes” “devillei”, “frater”, “lacrimosus”, “myersi” “orestes”, and “unistrigatus” amon g Pristimantis genus were monophyletic. Seven a priori tree topologies were constructed with MacClade ver. 4.07 (Maddison & Maddison 2000). Every one topology presented each individual group as monophyletic, without any relationship among the groups. With the topologies with constrain is running a new M L search. The significance of the difference in the sum of site-wise log-likelihoods for all trees is evaluated by bootstrap sampling of site scores with 1000 replicates and then calculating how far the observed differences are from the mean of the bootstrap replicates (Shimodaira & Hasegawa 1999).

Biogeographic Predictions: We generated a biogeographical hypothesis from distributional data for Pristimantis and from geological data on the formation of the Isthmus (Coates & Obando 1996, Coates et al. 2004). Pristimantis is thought to have origin in South America (Vanzolini & Heyer 1985, Duellman 2001, Savage 2002, Heinicke et al. 2007, Hedges et al. 2008, Wang et al. 2008). Today Pristimantis is distributed on Central American and South America. However, the incomplete isthmus upheaval before 3.1 Mya (Coates & Obando 1996) could represent a significant dispersal barrier between South America and Central America. Therefore, to achieve its present distribution we assume that the ancestor of Centroamerica Pristimantis likely had one dispersal history. It may have dispersed along Panamá Isthmus and invaded the Central America land. Therefore our a priori hypothesis is that all Central America species form a monophyletic clade relative to South American samples.

-10-

This hypothetical topology was compared to the topology obtained with ML using the paired-sites test (SH) of Shimodaira & Hasegawa (1999) as implemented in PAUP version 4.0b10 (Swofford 2002). The SH tests whether a ML phylogenetic tree estimated under a topological constraint is significantly worse than the optimal (unconstrained) tree.

RESULTS AND DISCUSSION

Phyl ogene tic anal ysi s

The final data set for all five gene regions comprised 4279 base pairs (612 from COI, 1543 from 16S, 960 from 12S, 633 from Rag-1 and 531 from Tyr), from 265 individuals and 132 species(Figure 4, 5).

We show Maximum parsimony (MP) and likelihood (ML) trees for 80-data set (Figs. 1 and 2) because it is the data set with the complete data (4279 characters), except for COI gene and include bootstrap confidence values and Bayesian confidence values (posterior probabilities) on nodes. Bayesian inference analyses yielded trees very similar in topology to those obtained from Maximum likelihood. The data set was combined because strongly supported conflicts were absent when comparing the individual gene trees.

For ML and Bayesian analyses, ModelTest selected in the majority of cases the GTR+I+G model as optimal for each gene (Table 2). Base composition, gamma parameters, and a proportion of invariant sites for each of the data sets are presented in Table 2. The A−G and C−T substitution (see Table 2, bold letter) rate parameters have higher relative importance values than the transversion parameters. This indicates that for these data it is important to allow the two transition types to have different rates, more so than the transversion types. As expected, mitochondrial genes presented more variability among taxa than nuclear genes (Table 3).

-11-

In general in all topologies we observe that Pristimantis was a monophyletic genus with significant support (100%) in the MP, ML and Bayesian analysis. In all trees, it appears as a close relative of the clade containing Lynchius, Oreobates, and Phrynopus, wit h support (100%) in the MP, ML and Bayesian analysis (Figure 1-2). Hedges et al. (2008) proposed that there are three subgenera named as Hypodictyon, Pristimantis and Yunganastes within Pristimantis. Based on our preliminary topologies (figures 1-4) these clades are not recovered.

Within Pristimantis, the peruvianus group was the only group recovered and well supported (100%) (Figure 1-2) while "conscipillatus”, “curtipes”, “ devillei”, “frater”, “lacrimosus”, “myersi”, “orestes”, “surdus”, and “unistrigatus” appear as non-natural group s. For t he chalceus, galdi, and orcesi groups, we only have one species representing each one of these groups; therefore we cannot infer anything about monophyly of these groups. Comparing the Figure 1 hypothesis with the a priori topology with each one of the groups as monophyletic is possible concluded that each topology with each one of the groups as monophyletic was rejected with P<0.05.

Based on our molecular phylogenies (Figs. 1–2 and supplementary material Figs. 3-8) many of the species groups recovered here are demonstrably not monophyletic. Our hypotheses disagree with the previously defined morphological species groups (Lynch & Duellman 1997).

Our results show that the Pristimantis groups proposed by Lynch & Duellman (1997) based on morphological characters are phenetic groups. Therefore, is necessary to search for morphological homologous characters that allow the definition of the groups proposed by the molecular data. These discrepancies and the limited taxon sampling (132 species) make it difficult to define subdivisions within Pristimantis. We refrain from defining other groups until DNA sequence data become available for a larger proportion of the Pristimantis genus.

-12-

Divergence Times and Biogeographical history

Dat es of divergen ce were obt ain ed by using t he 80 dat a set (Figure 2). Our result s indicate that the Pristimantis genus diverged from other eleutherodactylines in the Eocene 44 Mya (with credibility interval CI of 32-60 Mya) and began an explosive diversification 34 Mya (CI=26-44 Mya). The geologic epoch is concordant with the times presented by Heinicke et al. (2007). Most of the basal branches of eleutherodactylines with some dating to the early Cenozoic (49.79 Mya, CI=37.18-68.67 Mya) occur in South America (Heinicke et al. 2007). This shows that South America was the place of origin for the genus Pristimantis, according to Vanzolini & Heyer (1985), Duellman (2001), Savage (2002), Heinicke et al. (2007), Hedges et al. (2008), and Wang et al. (2008). The rapid diversification within this genus began 34 Mya and has continued to the present (Figure 2). The enormous diversity of species within this clade (427 species) according to Hedges et al. (2008) is linked with the beginning Andean uplift (Lynch 1986), which occurred in the last 10-20 million years (Gregory-Wodzicki 2002, M acFadden 2006). During this period, mountain building and associated climatic changes resulted in repeating patterns of habitat isolation and speciation in these amphibians (Lynch & Duellman 1997).

An amazing pattern in our results is the apparent successful colonization of some species of the Pristimantis genus into Central American. The molecular data suggest a complex history at least of 13 separate invasions from South America to Central American (Figure 2). Comparing this hypothesis with the hypothetical topology with all Central American groups monophyletic using SH tests it is possible to conclude that the topology which assumes only one dispersal event from South America to Central American can be rejected with P<0.05.

These invasions occurred mainly 5-25 Mya in the Miocene epoch, which show that the Centroamerican Pristimantis species already occupied the isthmian landscape prior to the completion of the isthmian land bridge 2.8-3.1 Mya (Coates & Obando 1996). Although

-13-

these divergence times of Centroamerican species seem very great, it corresponds with divergence times calculated for other groups as túngara frogs (Weigt et al. 2005), P. ockendeni (Elmer et al. 2007), P. ridens (Wang et al. 2008), freshwater fishes (Bermingham & Martin 1998), and vipers (Zamudio & Greene 1997). Actually, there is geological information that supports the dispersion towards Centroamerica from Southamerican Pristimantis. The fossilized mammals of raccons and giant ground sloths suggest that southern Central America had a dry-land connection (continuous peninsula) to North America during the middle Miocene (Whitmore & Stewart 1965, Kirby & MacFadden 2005). This peninsula may have received in the late M iocene anuran colonist from South America, such as P. ridens (Wang et al. 2008), and the túngara frog (Weigt et al. 2005). Pristimantis could have arrived in Central America before the completion of the land bridge by rafting (Vences et al. 2004), or through a period of low sea levels in the end of the Miocene when the sea level was approximately 60 m below today’s level (Bermingham & Martin 1998). However, the actual distribution of some species such as P. taeniatus (L clade) is also compatible with dispersal over land after the emergence of the Isthmus of Panamá (aprox. 3 Mya). Other scenario although unlikely is that these dispersal events probably occurred over water along islands in the West Indies (Heinicke et al. 2007; Hedges et al. 2008). Traditionally the colonization of a continent by an insular linage has been considered rare, and subsequent diversification is thought to be even rarer. Several explanations based on faunal saturation on the mainland and competitive disadvantage of island species have been advanced to explain this pattern (Nicholson et al. 2005). The model of one-way colonization from continent to islands, and the ecological hypotheses designed to explain it, must be revised as more studies reveal more than one invasion (Raxworthy et al. 2002, Filardi & Moyle 2005, Dávalos 2007). However according to our results the colonization through the western islands is less possible, because this hypothesis require the migration of the species through the islands and then admit several events of extinction. Thus, in order to clarify the groups and the relationship among the species groups, additional studies are needed, including more taxa and morphological and molecular approaches (microsatellites). Although our results are preliminary, the phylogenetic and

-14-

biogeographic hypotheses are based in the most parsimonious cladogram, which is the less refuted with the current evidence, and “this cladogram is only the focus of the next round of testing, and so it goes” (Kluge 1997:93).

ACKNOWLEDGMENTS

We are grateful to the many individuals and institutions who provided the specimens, permits, and tissue necessary for this study Roberto Ibañez, Cesar Jaramillo, Circulo Herpetológico, Panama (CH); Martha Patricia Ramirez, Colección Herpetológica, Universidad Industrial de Santander, Colombia (UIS-H); Eliana Muñoz, Vivian Páez, Museo de Herpetología de la Universidad de Antioquia, Colombia (MHUA), Julio Mario Hoyos, Museo Javeriano de Historia Natural de la Pontificia Universidad Javeriana and Luis Coloma, Museo de Zoología de la Pontificia Universidad Católica del Ecuador, Ecuador (QCAZ).

Research permits in Colombia were issued by the Ministerio del Medio Ambiente (No. 13 del 21 de Diciembre 2006) and in Panamá by authoritation XXXXX. This study is included in the “Contrato para el Acceso del Recurso Genético No. 0040, del 11 de Enero de 2008” suscribed betweeen Nelsy Rocio Pinto Sánchez and the Ministerio del Medio Ambiente, Colombia. We are in debt with J. D. Lynch by corroboration in the determination of specimens. For help in the laboratory, we would like to thank Grethel Grajales, Maribel Gonzalez, and Oris Sanjur.

This work was supported by grants from the Institute Francisco José de Caldas, Colombia, for the advancement of Science and Technology (Colciencias) (Convenio No. 074 de 2006), Smithsonian Tropical Institution (Adelante Fellow), Research Committe of the Faculty of Sciences at Universidad de los Andes. Useful comments on the manuscript were provided by X, X, and X. This research is part of the first author’s master’s thesis presented at the Universidad de los Andes, Departamento de Ciencias Biológicas.

-15-

REFERENCES

Amos W, Whitehead H, Ferrari MJ, Glockner-Ferrari DA, Payne R, Gordon J. 1992. Restrictable DNA from sloughed cetacean skin-its potential for use in population analysis. Marine Mammal Science 8: 275-283. Akaike H. 1973. Information Theory and an Extension of the Maximum Likelihood Principle. In : Petrov BN, Csaki F, (eds). Second International Symposium on Information Theory. Budapest: Akademiai Ki-ado, pp. 267–281. AmphibiaWeb: Information on amphibian biology and conservation [web application]. 2008. Berkeley, California: AmphibiaWeb. Available from: http://amphibiaweb.org/. Barker FK, Lutzoni FM. 2002. The utility of the Incongruence Length Difference Test. Systematic Biology 51: 625-637. Bermingham E, Lessios H. 1993. Rate variation of protein and mitochondrial DNA evolution as revealed by sea urchins separated by the Isthmus of Panama. Proceeding of the National Academy of Sciences 90: 2734-2738. Bermingham E, Martin AP. 1998. Comparative mtDNA phylogeography of Neotropical freshwater fishes: testing shared history to infer the evolutionary landscape of lower Central America. Molecular Ecology 7: 499-517. Bossuyt F, Milinkovitch MC. 2001. Amphibians as indicators of early Tertiary ‘‘out-of- India’’ dispersal of vertebrates. Science 292: 93-95.

Brandley MC, Schmitz A, Reeder TW. 2005. Partitioned Bayesian analyses, partition choice, and the phylogenetic relationships of scincid lizards. Systematic Biology 54: 373–390.

Campbell JA. 1999. Distribution patterns of amphibians in Middle America. Pp. 111– 210. In: Duellman, W.P.(Eds.). Patterns of Distribution of Amphibians: A Global Perspective. Johns Hopkins University Press, Baltimore, MD.

Castresana J. 2000. Selection of conserved blocks from multiple alignments for their use

-16-

in phylogenetic analysis. Molecular Biology and Evolution 17: 540 –552.

Coates AG, Obando JA. 1996. The geologic evolution of the Central American Isthmus. In: Jackson JBC, Budd AF, Coates AG (Eds.). Evolution and Environment in Tropical America. University of Chicago Press, Chicago, IL, pp. 21-56.

Coates AG, Collins LS, Aubry M P, Berggren WA. 2004. The geology of the Darien, Panama, and the late M iocene-Pliocene collision of the Panama arc with northwestern South America. Geological Society of America Bulletin 116: 1327- 1344.

Crawford AJ, Smith E. 2005. Cenozoic biogeography and evolution in direct-developing frogs of Central America (Leptodactylidae : Eleutherodactylus) as inferred from a phylogenetic analysis of nuclear and mitochondrial genes. Molecular Phylogenetics and Evolution 35: 536-555.

Crawford AJ, Bermingham E, Polanía C. 2007. The role of tropical dry forest as long term barrier to dispersal: a comparative phylogeographical analysis of dry forest tolerant and intolerant frogs. Molecular Ecology 16: 4789-4807.

Darlu P, Lecointre G. 2002. When does the incongruence length difference test fail? . Molecular Biology and Evolution 19: 432–437.

Darst CR, Cannatella DC. 2004. Novel relationships among hyloid frogs inferred from 12S and 16S mitochondrial DNA sequences. Molecular Phylogenetics and Evolution 31: 462–475.

Dávalos LM. 2007. Short-faced bats (Phyllostomidae: Stenodermatina): a Caribbean radiation of strict frugivores. Journal of Biogeography 34: 364-375.

Drummond AJ, Ho SYW, Phillips MJ, Rambaut A. 2006. Relaxed phylogenetics and dating with confidence. Plos Biology 4: 699-710.

Drummond AJ, Rambaut A. 2007. BEAST: Bayesian evolutionary analysis by sampling trees. BMC Evolutionary Biology 7: 214. Duellman WE.1999. Distribution patterns of amphibians in South America. Pp. 255–328.

-17-

In: Duellman WP.(Eds.). Patterns of Distribution of Amphibians: A Global Perspective. Johns Hopkins University Press, Baltimore, MD.

Duellman WE 2001. The hylid frogs of Middle America. Contributions herpetology 18: 695-1158.

Elmer KR, Dávila JA, Lougheed SC. 2007. Cryptic diversity and deep divergence in an upper Amazonian frog, Eleutherodactylus ockendeni. BMC Evolutionary Biology. doi: 10.1186/1471-2148-7-24.

Felsenstein J. 1985. Confidence limits in phylogenies: an approach using the bootstrap. Evolution 39: 783-791.

Filardi CE, Moyle RE. 2005. Single origin of a pan-Pacific bird group and upstream colonization of Australasia. Nature 438: 216-219.

Frost DR, Grant T, Faivovich J, Bain RH, Haas A, Haddad CFB, De Sa RO, Channing A, Wilkinson M, Donnellan SC, et al. 2006. The Amphibia tree of life. Bulletin of the American Museum of Natural History 297: 1-371.

Frost DR. 2008. Amphibian Species of the World: an Online Reference.Version 3.0 (22 August, 2004). Electronic Database accessible at http://research.amnh.org/herpetology/amphibia/index.html. American Museum of Natural History, New York, USA.

Gregory-Wodzicki KM. 2002. A late Miocene subtropical-dry flora from the northern Altiplano, Bolivia. Paleogeography Palaeoclime Palaeoecology 180: 331-348.

Hedges SB. 1999. Distribution patterns of amphibians in the West Indies. Pp. 211-254. In: Duellman, W.P. (Eds.), Patterns of Distribution of Amphibians: A Global Perspective. Johns Hopkins University Press, Baltimore, MD.

Hedges SB, Duellman WE, Heinicke MP. 2008. New World direct-developing frogs (Anura: Terrarana): M olecular phylogeny, classification, biogeography, and conservation. Zootaxa (1737): 1-182.

-18-

Heinicke MP, Duellman WE, Hedges SB. 2007. Major Caribbean and Central American frog faunas originated by oceanic dispersal. Proceedings of the National Academy of Sciences (USA) 104: 10092-10097.

Huelsenbeck JP, Ronquist F. 2001. MRBAYES: Bayesian inference of phylogeny. Bioinformatics 17: 754-755.

Kirby MX, MacFadden B. 2005. Was southern Central America an archipelago or a p eninsula in the middle M iocene ? A t est using land-ma mma l body siz e. Palaeogeography Palaeoclimatology Palaeoecology. 228: 193-202.

Kluge AG. 1997. Testability and the refutation and corroboration of cladistic hypotheses. Cladistics 13: 81-96.

Knowlton N, Weight LA, Solórzano LA, Mills DK, Bermingham E. 1993. Divergence in proteins, mitochondrial ADN, and reproductive compatibility across the Isthmus of Panama. Science 260: 1629-1631. Lessios H. 1979. Use of Panamanian sea urchins to test the molecular clock. Nature 280: 599-601. Lynch JD. 1976. The species groups of the South American frogs of the genus Eleutherodactylus (Leptodactylidae). Occasional Papers of the Museum of Natural History, the University of Kansas 61: 1–24.

Lynch JD. 1986. Origins of the high Andean Herpetological fauna. Pp. 478-499. In: Vuilleumier F, Monasterio M. (Eds.).High altitude tropical biogeography. Oxford university press. 649pp.

Lynch JD, Duellman WE. 1997. Frogs of the genus Eleutherodactylus in western Ecuador Systematics, ecology, and biogeography. University of Kansas Museum of Natural History Special Publications 23: iv+236 pp.

MacFadden, BJ. 2006. Extinct mammalian biodiversity of. the ancient New World tropics. Trends in Ecology and Evolution. 21: 157-165

Maddison DR, Maddison WP. 2000. MacClade: analysis of phylogeny and character

-19-

evolution. Vers. 4.0. Sinauer, Sunderland, M. A.

MAFFT version 6, Multiple alignment program for amino acid or nucleotide sequences. Available at: http://align.bmr.kyushu-u.ac.jp/mafft/online/server/.

Katoh K, Misawa K, Kuma K, Miyata T. 2002. “MAFFT: a novel method for rapid multiple sequence alignment based on fast Fourier transform.” Nucleic Acids Research 30: 3059-3066.

Marshall LG, Webb SD, Sepkoski JJ, Raup DM. 1982. Mammalian evolution and the great American interchange. Science 215: 1351-1357.

Marshall LG. 1988. Land mammals and the great American interchange. American Scientist 76: 380-388.

Nylander JAA, Ronquist F, Huelsenbeck JP, Nieves-Aldrey JL. 2004. Bayesian phylogenetic analysis of combined data. Systematic Biology 53: 47–67.

Padial JM, Castroviejo-Fisher S, Köhler J, Domic E, De la Riva I. 2007. Systematics of the Eleutherodactylus fraudator species group (Anura: Brachycephalidae). Herpetological Monographs 21: 213-240.

Padial JM , Chaparro JC, De la Riva I. 2008. Systematics of Oreobates and the Eleutherodactylus discoidalis species group (Amphibia, Anura) based on two mtDNA genes and external morphology. Zoological Journal of the Linnean Society 152: 737–773.

Posada D, Buckley TR. 2004. Advantages of AIC and Bayesian approaches over likelihood ratio tests for model selection in phylogenetics. Systematic Biology 53: 793-808.

Posada D, Crandall KA. 1998. ModelTest: Testing the model of DNA substitution. Bioinformatics 14: 817-818.

Rambaut A, Drummond AJ. 2003-2005. Tracer. Available at

-20-

Raxworthy, CJ, Forstner MRJ, Nussbaum RA. 2002. Chamaleon radiaton by oceanic dispersal. Nature 415: 784-787.

Roelants K, Gower DJ, Wilkinson M , Loader SP, Biju SD, Guillaume K, M oriau L, Bossuyt F. 2007. Global patterns of diversification in the history of modern amphibians. Proceedings of the National Academy of Science (USA) 104: 887- 892. Ronquist FL, Huelsenbeck P. 2003. MRBAYES 3.12: Bayesian phylogenetic inference under mixed models. Bioinformatics 19: 1572-1574.

Savage JM. 1987. Systematics and distribution of the Mexican and Central American rainfrogs of the Eleutherodactylus gollmeri group (Amphibia: Leptodactylidae). Fieldiana: Zoology 33: 1–57.

Savage JM. 2002. The Amphibians and Reptiles of Costa Rica: A Herpetofauna between Two Continents, between Two Seas. University of Chicago Press, Chicago, IL.

Shimodaira H, Hasegawa M.1999. Multiple comparisons of log-likelihoods with applications to phylogenetic inference. Molecular Biology and Evolution 16: 1114- 1116.

Simpson GG. 1940. Mammals and land bridges. Journal of the Washington Academy of Sciences 30: 137-163.

Stamatakis A, Hoover P, Rougemont J. 2008. A Rapid Bootstrap Algorithm for the RAxML Web-Servers Systematic Biology 75: 758-771.

Swofford DL. 2002. PAUP* Phylogenetic Analysis Using Parsimony (*and Other Methods), Version 4. Sinauer Associates, Sunderland, MA.

Vanzolini PE, Heyer WR. 1985. The American herpetofauna and the interchange. In: Stehli FG, Webb SD (Eds.). The Great American Biotic Interchange. Plenum Press, New York, NY, pp. 475-487.

Vences M, Kosuch J, Rodel M-O, Lotters S, Channing A, Glaw F, Bohme W. 2004. Phylogeography of Ptychadena mascareniensis suggests transoceanic dispersal in

-21-

a widespread African-M alagasy frog lineage. Journal of Biogeogrphy 31; 593-601.

Wang IJ, Crawford AJ, Bermingham E. 2008. Phylogeography of the Pygmy Rain Frog (Pristimantis ridens) across the lowland wet forest of isthmian Central America. Molecular Phylogenetic and Evolution 47: 992-1004.

Webb SD. 1978. A history of savanna vertebrates in the new world. Part II: South America and the great interchange. Annual Review of Ecology and Systematics 9: 393-426.

Webb SD, Rancy A. 1996. Late Cenozoic evolution of the Neotropical mammal fauna. In: Jackson JBC, Budd AF, Coates AG (eds.) Evolution and Environment in Tropical America, pp. 335-358. University of Chicago Press, Chicago, Illinois, USA.

Weigt LA, Crawford AJ, Rand AS, Ryan MJ. 2005. Biogeography of the túngara frog. Physalaemus pustulosus: a molecular perspective. Molecular Ecology 14: 3857- 3876.

Whitmore Jr, Stewart RH. 1965. Miocene mammals and Central American seaways. Science 148: 180-185.

Wiens JJ. 1998. Combining data sets with different phylogenetic histories. Systematic Biology 47: 568-581.

Zamudio KR, Greene HW. 1997. Phylogeography of the bushmaster (Lachesis muta: Viperidae): implications for Neotropical biogeography, systematics, and conservation. Biological Journal of the Linnean Society 62: 421-442.

Zeh DA, Zeh JA, Bonilla MM . 2003. Phylogeography of the giant harlequin beetle (Acrocinus longimanus). Journal of Biogeography 30: 747-753.

-22-

TAB LES

Tabl e 1. Genes and primers employed in this study.

Primer Primer sequence (5’----3’) Source Mitochondrial COI dgLCO-1490 GGTCAACAAATCATAAAGAYATYGG dgHCO-2198 TAAACTTCAGGGTGACCAAARAAYCA LCO-1490 GGTCAACAAATCATAAAGATATTGG Folmer et al. (1994) HCO-2198 TAAACTTCAGGGTGACCAAAAAATCA Folmer et al. (1994) Mitochondrial 16S 16Sar-L CGCCTGTTTATCAAAAACAT Palumbi et al. (1991) 16Sbr-H CCGGTCTGAACTCAGATCACGT Palumbi et al. (1991) Mitochondrial 12S 12H10 CACYTTCCRGTRCRYTTACCRTGTTACGACTT Heinicke et al. (2007) 12.1L4E TACACATGCAAGTYTCCGC Heinicke et al. (2007) Nuclear RAG1 R182 GCCATAACTGCTGGAGCATYAT Heinicke et al. (2007) R270 AGYAGATGTTGCCTGGGTCTTC Heinicke et al. (2007) Nuclear Tyr Tyr1C GGCAGAGGAWCRTGCCAAGATGT Bossuyt & Milinkovitch (2000) Tyr1G T GCT GGGCRT CT CTCCARTCCCA Bossuyt & Milinkovitch (2000)

Table 2. Estimated parameters for Bayesian analyses. Parameters were calculated using Mr. ModelTest 3.7 (Posada & Crandall, 1998). AIC= Akaike information criterion; I=Proportion of invariable sites; Gamma= Gamma distributed rate variation among sites.

Gen Best-fit AIC -ln likelihood I Gamma Rate Matrix Base frecuency Model score AC AG AT CG CT GT A C G T COI GTR+I+G 27593.7 13786.9 0.4311 0.5459 0.5680 11.2552 0.4570 0.4277 6.3348 1.0000 0.3069 0.3028 0.1010 0.2893 12S GTR+I+G 63217.2 31598.6 0.2627 0.7028 2.6346 9.1316 2.6776 0.4414 20.9307 1.0000 0.3888 0.2278 0.1621 0.2213 16S GTR+I+G 84298.7 42139.3 0.2706 0.6188 3.3087 8.6510 3.3805 0.7856 23.7068 1.0000 0.4110 0.2126 0.1459 0.2305 Rag_1 GTR+I+G 8824.5 4402.3 0.3280 1.6718 1.2761 4.1305 0.6188 1.4669 5.6222 1.0000 0.3329 0.2123 0.1756 0.2793 Tyr HKY+I+G 8914.6 4451.3 0.3356 1.1107 Ti/tv ratio 2.5277 0.2560 0.2399 0.2111 0.2931

Table 3. Proportion of invariable, variable un-informative and parsimony informative (PI) characters.

Gen Alignment No. of Proportion of No. of variable Proportion of No. of Proportion positions invariable invariable sites sites are un-PI variable sites are PI of PI sites un-PI COI 612 286 0.47 19 0.03 307 0.50 12S 960 287 0.30 105 0.11 568 0.59 16S 1543 496 0.32 142 0.09 905 0.59 Rag_1 633 299 0.47 79 0.13 255 0.40 Tyr 531 253 0.48 67 0.12 211 0.40

APPENDICES

Appendix 1. For each specimen, extraction number or tissue collection number, museum voucher, source, locality and GenBank accession number are reported. Acronyms for museums are: CH = Circulo Herpetologico, Panama; MBH= Museum Bolivia Herpetology, Bolivia; MHUA= Museo de Herpetología de la Universidad de Antioquia, Colombia, QCAZ= Museo de Zoología de la Pontificia Universidad Católica del Ecuador, Ecuador; UIS-H= Colección herpetológica, Universidad Industrial de Santander, Colombia. The abbreviations for the individuals field series are as follows: AJC=Andrew Jackson Crawford; CJD= Claudia Juliana Dulcey; DL= David Laurencio; EMM= Eliana Maria Muñoz; ENS= Eric N. Smith; KRL= Karen R. Lips; NRPS= Nelsy Rocio Pinto Sanchez; RC= Rances Caicedo; SMG= Sandra M. Gallo.

Extraction Museum Department/Pr Species Origin Country Municipality Mitochondrial genes Nuclear genes number voucher ovince COI 16S 12S Rag1 Tyr (614 (621 (806 (620 (500 bp) bp) bp) bp) bp) Craugastor bufoniformis AJC 1144 This study P anamá P anamá Altos del María, ~7.5 km NE de El Valle de Anton, X X X 0 0 corregimiento de Chamé Craugastor cf. longirostris E-76 AJC 1336 This study Colombia Antioquia Maceo X X X 0 0 Craugastor cf. longirostris E-78 AJC 1193 This study Colombia Chocó Nuqui X X X 0 0 Diasporus diastema AJC 0540 This study Costa Rica Puntarenas Finca Sergio Jimenez, 6.5 km por air SSE de X X 0 0 X Aguitas, Drake, Osa Diasporus gularis E-77 AJC 1187 This study Colombia Chocó Nuqui X X 0 0 X

Diasporus hylaeformis AJC 0468 This study Costa Rica Alajuela Estación Biológica Alberto Ml. Brenes, Reserva Biológica San 0 X X 0 0 Ramón

Diasporus hylaeformis AJC 0474 This study Costa Rica Cartago Tapantí, Cantón Paraíso X 0 0 0 Diasporus vocator AJC 0127 This study Costa Rica Puntarenas Las Cruces X X X X X Diasporus vocator CH 4784 This study X X X X X Pristimantis achatinus AJC 0573 This study Panamá Darién Cana main camp, Sendero Boca de Cupe X X X X X Pristimantis affinis E-50 NRPS 0031 This study Colombia Cundinamarca Parque Nacional Natural Chingaza X X X X 0 Pristimantis altae AJC 0398 This study Costa Rica Alajuela Monumento Natural Histórico La Paz (MINAE), ~16km por rd. X X X X 0 NW de San Ramón, Canton La Paz

Pristimantis bogotensis E-51 NRPS 0033 This study Colombia Cundinamarca Parque Nacional Natural Chingaza X X X X X Pristimantis caryophyllaceus AJC 0187 This study P anamá Chiriquí Fortuna X X X X X Pristimantis caryophyllaceus AJC 0486 This study Costa Rica San José Rio Gacho, Los Juncos, Cascajal, Cantón Vázquez X X X X 0 de Coronado Pristimantis caryophyllaceus CH 6367 This study Panamá Darién Cana, Laguna X X X X X Pristimantis cerasinus AJC 0071 This study Costa Rica Heredia La Selva X X X X X Pristimantis cerasinus AJC 0527 This study Costa Rica Limón "Vuelta de Queque" Rio Siquirres trail, Guayacan, X X X X 0 Siquirres Pristimantis cerasinus AJC 1132 This study P anamá P anamá Altos del María, ~7.5 km NE de El Valle de Anton, 0 X X X 0 corregimiento de Chamé

App. p. -2-

Pristimantis cerasinus (white on AJC 1142 This study P anamá P anamá Altos del María, ~7.5 km thighs) NE de El Valle de Anton, 0 X X 0 X corregimiento de Chamé Pristimantis cruentus AJC 0234 This study P anamá Chiriquí Fortuna X X X X X Pristimantis cruentus AJC 0394 This study Costa Rica Alajuela Monumento Natural Histórico La Paz (MINAE), ~16km por rd. 0 0 0 0 0 NW de San Ramón, Canton La Paz

Pristimantis cruentus AJC 0460 This study Costa Rica Alajuela Estación Biológica Alberto Ml. Brenes, Reserva Biológica San X X X X 0 Ramón

Pristimantis cruentus AJC 0475 This study Costa Rica Cartago Tapantí, Cantón Paraíso X X X X X Pristimantis cruentus AJC 0480 This study Costa Rica Heredia La Paz Waterfall Gardens X X X X 0 Pristimantis cruentus AJC 0524 This study Costa Rica Limón Base de Volcan Turrialba, along rd. Guácimo, X X X X 0 Canton Guácimo Pristimantis cruentus AJC 1204 This study P anamá P anamá Altos del María, Río María, Distrito de Chamé 0 X X 0 0 Pristimantis cruentus KRL 0685 This study Panamá Coclé Parque Nacional Omar Torrijos H., El Copé X X PristimantIs cruentus (big & AJC 0603 This study Panamá Darién Cana, Pirre high camp plain) 0 X X 0 0 Pristimantis cruentus (cf. rojo CH 6721 This study Panamá Panamá Refugio ANAM, Cerro tomate) Brewster "hacia Cerro Guajaral". Límite P.N. X X X X X Chagres, Pristimantis cruentus (golden AJC 0581 This study Panamá Darién Cana, Pirre high camp, venter) kitchen. 0 X 0 X X

App. p. -3-

Pristimantis cruentus AJC 1128 This study P anamá P anamá Altos del María, ~7.5 km (museosus? ) NE de El Valle de Anton, X X X 0 X corregimiento de Chamé Pristimantis cruentus (pop-eyed) AJC 0985 This study Panamá Panamá Burbayar Lodge, Km 15 on El Llano-Cartí Road, Distrito de Chepo, 0 0 0 0 X Corregimiento El Llano Pristimantis cruentus (pop-eyed) AJC 1133 This study P anamá P anamá Altos del María, ~7.5 km NE de El Valle de Anton, 0 X 0 0 X corregimiento de Chamé Pristimantis cruralis MBH 5699 This study Bolivia 0 0 0 0 X Pristimantis elegans E-53 NRPS 0052 This study Colombia Cundinamarca Parque Nacional Natural Chingaza 0 0 0 0 X Pristimantis fenestratus MBH 5712 This study Bolivia 0 0 0 0 X Pristimantis gaigeae E-32 AJC 1360 This study Colombia Tolima Ruinas Falan X 0 0 0 X Pristimantis gaigeae E-79 AJC 1339 This study Colombia Antioquia Maceo X X 0 0 X Pristimantis gaigeae CH 6471 This study X X X 0 X Pristimantis gaigeae KRL 8880 This study Panamá Coclé Parque Nacional Omar Torrijos H., El Copé 0 0 X 0 X Pristimantis grupo diastema E-75 AJC 1335 This study Colombia Antioquia Maceo 0 X X X X Pristimantis latidiscus (morfo1) E-54 NRPS 0054 This study Colombia Valle del Cauca El Cairo X X X X X Pristimantis latidiscus (morfo1) E-56 NRPS 0056 This study Colombia Valle del Cauca El Cairo X X X X X Pristimantis librarius E-6 QCAZ This study Ecuador Napo X X X 0 0 25852 Pristimantis cruentus E-80 AJC 1344 This study Colombia Antioquia Maceo X X X 0 0 Pristimantis martiae E-5 QCAZ This study Ecuador Napo X X X X X 17998 Pristimantis martiae E-9 QCAZ This study Ecuador Napo X X 0 X X 18018 Pristimantis medemi E-44 NRPS 0087 This study Colombia Villavicencio Restrepo X X 0 X X Pristimantis mercedesae MBH 4695 This study Bolivia Chuquisaca Vecindad deEl Palmar 0 0 0 X X

Pristimantis miyatai E-11 RC 610 This study Colombia Santander Floridablanca X X X X X

App. p. -4-

Pristimantis miyatai E-12 RC 613 This study Colombia Santander Floridablanca X X X X X Pristimantis sp. (morfo1) E-42 NRPS 0083 This study Colombia Villavicencio X X X X X Pristimantis sp. ( morfo2) E-43 NRPS 0085 This study Colombia Villavicencio Restrepo X X X X X Pristimantis sp. ( morfo3) E-45 NRPS 0090 This study Colombia Villavicencio Restrepo X X X X X Pristimantis moro AJC 1753 This study Panamá Panamá Urbanizacion de los Altos de Cerro Azul, Distrito de X X X 0 0 Chilibre Pristimantis moro AJC 1860 This study Panamá Darién Serrania de Pirre X X X 0 X Pristimantis museosus AJC 1143 This study P anamá P anamá Altos del María, ~7.5 km NE de El Valle de Anton, 0 0 0 X X corregimiento de Chamé Pristimantis museosus AJC 1210 This study P anamá P anamá Altos del María, Río María, Distrito de Chamé X X 0 0 X Pristimantis nervicus E-52 NRPS 0048 This study Colombia Cundinamarca Parque Nacional Natural Chingaza X X 0 0 X Pristimantis ockendeni E-4 QCAZ This study Ecuador Napo X X 0 X X 25766 Pristimantis ockendeni E-10 QCAZ This study Ecuador Orellana X X 0 0 X 25428 Pristimantis paisa E-60 NRPS 0060 This study Colombia Antioquia Caldas X X 0 0 X Pristimantis paisa E-72 NRPS 0062 This study Colombia Antioquia Caldas 0 0 0 0 0 Pristimantis pardalis AJC 0188 This study P anamá Chiriquí Fortuna X X 0 X X Pristimantis pardalis AJC 1208 This study P anamá P anamá Altos del María, Río María, Distrito de Chamé X X 0 X X Pristimantis pardalis CH 6284 This study Panamá Darién Tent camp, Reserva Natural P rivada Chucanti, Corregimiento Rio Congo X X 0 X X Arriba, Distrito de Ch epi g an a Pristimantis pardalis KRL 0690 This study Panamá Coclé Parque Nacional Omar Torrijos H., El Copé X X 0 X X Pristimantis pirrensis AJC 0594 This study Panamá Darién Cana, Pirre high camp X X X X X

App. p. -5-

Pristimantis pirrensis AJC 1863 This study Panamá Darién Serrania de Pirre X X X X X Pristimantis platydactylus MBH 5746 This study Bolivia X X X X X Pristimantis ptochus E-58 NRPS 0058 This study Colombia Valle del Cauca El Cairo X X X 0 X Pristimantis quaquaversus E-7 QCAZ This study Ecuador Sucumbíos X X X X X 16150 Pristimantis quaquaversus E-8 QCAZ This study Ecuador Pastaza X X X X X 25676 Pristimantis rhabdolaemus MBH 5589 This study Bolivia 0 0 X 0 0 Pristimantis ridens E-31 AJC 1359 This study Colombia Tolima llanito, cerca a Falan 0 0 X 0 0 Pristimantis ridens E-71 AJC 1373 This study Colombia Tolima 0 0 X 0 0 Pristimantis ridens AJC 0126 This study Costa Rica Puntarenas Rio Claro, lado Pacifico X X X X X

Pristimantis ridens AJC 0216 This study P anamá P anamá Altos de Campana X X X X X Pristimantis ridens AJC 0336 This study P anamá P anamá Altos de Campana National Park (Sendero de X X 0 X X Interpretación) Pristimantis ridens AJC 0356 This study Costa Rica Limón "Utopia" En el borde Occidental del Rio Blanco, 3.2 km (~ 6 km W X X X X X de Guápiles) Pristimantis ridens AJC 0522 This study Costa Rica Heredia S. Holdridge, EB La Selva, Puerto Viejo, X X 0 X X Sarapiquí Pristimantis ridens DL 401 This study Costa Rica San José Parque Nacional Carara, Bajo Carara. X X X X X Pristimantis ridens ENS 10647 This study Honduras Olancho Sierra de Bataderos 0 0 X 0 0 Pristimantis ridens ENS 10722 This study Honduras Olancho Sierra de Agalta X X 0 X X Pristimantis ridens (cf. molinoi) AJC 0211 This study Panamá Kuna Yala Nusagandi X X X X X Pristimantis signifer E-55 NRPS 0055 This study Colombia Valle del Cauca El Cairo X X 0 0 X Pristimantis sp E-18 EMM-232 This study Antioquia San Rafael Sector Papayos, Central Hidroeléctrica Jaguas X X X X X Pristimantis sp E-21 EMM-233 This study Colombia Antioquia San Rafael X X X X X

App. p. -6-

Pristimantis sp E-22 EMM-247 This study Colombia Antioquia San Rafael X X X X X Pristimantis sp E-26 EMM/ This study Colombia Antioquia San Rafael 0 X X X X Pristimantis sp E-46 NRPS 0016 This study Colombia Cundinamarca Yacopí X X X X X Pristimantis sp E-47 NRPS 0017 This study Colombia Cundinamarca Yacopí X X X X X Pristimantis sp E-48 NRPS 0019 This study Colombia Cundinamarca Yacopí X X X 0 X Pristimantis sp E-49 NRPS 0022 This study Colombia Cundinamarca Yacopí X 0 X X X Pristimantis sp E-57 NRPS 0057 This study Colombia Valle del Cauca El Cairo X X X X X Pristimantis sp E-59 NRPS 0059 This study Colombia Valle del Cauca El Cairo X X X X X Pristimantis sp E-61 NRPS 0067 This study Colombia Antioquia Caldas X X 0 X X Pristimantis sp E-62 NRPS 0001 This study Colombia Antioquia Anori X 0 X X X Pristimantis sp E-63 NRPS 0002 This study Colombia Antioquia Anori X X X X X Pristimantis sp E-64 NRPS 0007 This study Colombia Antioquia Anori X X X X X Pristimantis sp E-65 NRPS 0010 This study Colombia Antioquia Amalfi X X 0 X X Pristimantis sp E-66 NRPS 0011 This study Colombia Antioquia Amalfi X X X 0 0 Pristimantis sp E-67 NRPS 0013 This study Colombia Antioquia Amalfi 0 X X 0 0 Pristimantis sp E-68 NRPS 0016 This study Colombia Antioquia Amalfi X 0 X 0 0 Pristimantis sp E-69 NRPS 0017 This study Colombia Antioquia Amalfi 0 X X X X Pristimantis sp E-70 NRPS 0019 This study Colombia Antioquia Amalfi 0 X X 0 X Pristimantis sp E-73 NRPS 0072 This study Colombia Antioquia Urrao X X X 0 X Pristimantis sp. AJC 1670 This study Panamá Darién Tent camp, Reserva Natural P rivada Chucanti, Corregimiento Rio Congo 0 0 X X X Arriba, Distrito de Ch epi g an a

Pristimantis sp. ( cf. cruentus) AJC 0217 This study P anamá Chiriquí X X 0 X X Pristimantis sp. ( cf. ridens) E-74 AJC 1191 This study Colombia Chocó Nuqui X X X X X Pristimantis suetus E-3 MHUA This study Colombia Antioquia Guatapé X X X 0 0 0440 Pristimantis taeniatus E-1 MHUA This study Colombia Antioquia Maceo 0 X X X 0 0426 Pristimantis taeniatus E-2 MHUA This study Colombia Antioquia Amalfi X X X 0 0 0455

App. p. -7-

Pristimantis taeniatus E-13 CJD 069 This study Colombia Santander X X X 0 X Pristimantis taeniatus E-14 SMG 325 This study Colombia Antioquia San Rafael X X 0 X 0 Pristimantis taeniatus E-16 CJD-070 This study Colombia Santander Floridablanca X X X X X Pristimantis taeniatus E-19 CJD-068 This study Colombia Santander X X X X X Pristimantis taeniatus E-23 CJD-067 This study Colombia Santander X X 0 X X Pristimantis taeniatus E-24 CJD-071 This study Colombia Santander X X X 0 X Pristimantis taeniatus E-29 AJC 1353 This study Colombia Tolima Falan, no ruins X 0 X X 0 Pristimantis taeniatus E-33 AJC 1363 This study Colombia Tolima Falan, no ruins X X X 0 X Pristimantis taeniatus E-34 AJC 1368 This study Colombia Tolima Falan, no ruins X X X X X Pristimantis taeniatus E-35 AJC 1372 This study Colombia Tolima Ruinas Falan X X X X X Pristimantis taeniatus E-36 RC 611 This study Colombia Santander Floridablanca X 0 X X 0 Pristimantis taeniatus E-37 RC 612 This study Colombia Santander Floridablanca X 0 X X X Pristimantis taeniatus AJC 1126 This study P anamá Colón Occidente de Gatun X X X X X

Pristimantis taeniatus AJC 1683 This study Panamá Darién Cana, Campo Principal X X X X X Pristimantis taeniatus AJC 1782 This study Panamá Panamá Urbanizacion de los Altos de Cerro Azul, Distrito de X X 0 X X Chilibre Pristimantis taeniatus AJC 1839 This study Panamá Darién Cana, Sendero Mina X X X X X Pristimantis taeniatus AJC 1961 This study Panamá Panamá Refugio ANAM, Cerro Brewster "hacia Cerro Guajaral". Límite P.N. X X X 0 0 Chagres, Pristimantis taeniatus AJC 1977 This study Panamá Panamá Estación Río Chico de la ACP, Río Chagres norte, arriba del lago Alajuela. Corregimiento de Chilibre, X X 0 0 0 Distrito de Panamá.

App. p. -8-

Pristimantis taeniatus AJC 1993 This study Panamá Panamá Estación Río Chico de la ACP, Río Chagres sur, arriba del lago Alajuela. Corregimiento de Chilibre, X X X X X Distrito de Panamá.

Pristimantis taeniatus AJC 1994 This study Panamá Panamá Estación Río Chico de la ACP, Río Chagres sur, arriba del lago Alajuela. Corregimiento de Chilibre, X X 0 0 0 Distrito de Panamá.

Pristimantis taeniatus AJC 1995 This study Panamá Panamá Estación Río Chico de la ACP, Río Chagres sur, arriba del lago Alajuela. Corregimiento de Chilibre, X X X X X Distrito de Panamá.

Pristimantis taeniatus CH 4945 This study Panamá Panamá X X X X X Pristimantis taeniatus CH 4999 This study Panamá Panamá X X X X X Pristimantis taeniatus CH 5067 This study Panamá Panamá X X X X X Pristimantis taeniatus CH 5585 This study Panamá Panamá X X X X X Pristimantis taeniatus CH 6796 This study Panamá Panamá Urbanizacion de los Altos de Cerro Azul, Distrito de X X X X X Chilibre Pristimantis taeniatus (cf. P. AJC 1835 This study Panamá Darién Cana, Sendero Mina X X X X X quidditus) Pristimantis taeniatus (cf. P. CH 6393 This study Panamá Darién Serrania de Pirre 0 X X X X diastema) Pristimantis viejas E-15 EMM-250 This study Colombia Antioquia San Rafael X X X X X Pristimantis viejas E-17 EMM-248 This study Colombia Antioquia San Rafael X 0 X 0 0 Pristimantis viejas E-20 EMM-249 This study Colombia Antioquia San Rafael X 0 X 0 0 Pristimantis viejas E-25 SMG 326 This study Colombia Antioquia San Rafael X 0 X 0 0

App. p. -9-

Pristimantis viejas E-28 AJC 1352 This study Colombia Tolima Falan, no ruins X 0 X 0 0 Pristimantis viejas E-30 AJC 1355 This study Colombia Tolima Falan, no ruins X 0 X 0 0 Pristimantis zophus E-39 NRPS 0071 This study Colombia Antioquia Urrao X X X X X Pristimantis zophus E-38 NRPS 0070 This study Colombia Antioquia Urrao X X X X X Pristimantis zophus E-40 NRPS 0074 This study Colombia Antioquia Urrao X X 0 0 0 Pristimantis zophus E-41 NRPS 0076 This study Colombia Antioquia Urrao X X 0 0 0

App. p. -10-

Appendix 2.

GenBank accession numbers for downloaded sequences. All sequences were obtained from GenBank.

Mitochondrial genes Nuclear genes Extraction Species voucher Museum vocher COIbp 12S bp16S Rag_1 Tyr Origin

Pristimantis pluvicanorus AMNH-A 165195 n/a AY843586 n/a AY844035 Faivovich et al., 2005

Pristimantis pluvicanorus n/a n/a n/a AY843586 n/a n/a Faivovich et al., 2005

Pristimantis malkini 267642 QCAZ28296 n/a EU186663 n/a n/a Hedges et al., 2008

Pristimantis terraebolivaris 102301 n/a n/a EU186650 n/a n/a Hedges et al., 2008

Pristimantis zeuctotylus 268013 ROM43978 n/a EU186678 n/a n/a Hedges et al., 2008

Pristimantis galdi 267975 QCAZ32368 n/a EU186670 EU186746 EU186767 Hedges et al., 2008

Pristimantis cf_mendax 267140 MTD45080 n/a EU186659 n/a n/a Hedges et al., 2008

Pristimantis simonsii 267961 KU212350 n/a EU186665 n/a n/a Hedges et al., 2008

Pristimantis albertus 171100 KU291675 n/a EU186695 n/a n/a Hedges et al., 2008

Pristimantis cf_rhabdolaemus 267143 MTD45073 n/a EU186660 n/a n/a Hedges et al., 2008

Pristimantis altamazonicus 267204 KU215460 n/a EF493670 EF493441 EU186778 Hedges et al., 2008

Pristimantis ardalonychus 267959 KU212301 n/a EU186664 n/a n/a Hedges et al., 2008

Pristimantis caryophyllaceus 268029 MVZ203810 n/a EU186686 n/a n/a Hedges et al., 2008

App. p. -11-

Pristimantis crucifer 268105 KU177733 n/a EU186736 EU186718 n/a n/a Hedges et al., 2008

Pristimantis cruciocularis 171097 KU291673 n/a EU186656 n/a n/a Hedges et al., 2008

Pristimantis diadematus 267967 KU221999 n/a EU186668 n/a n/a Hedges et al., 2008

Pristimantis eriphus 267976 QCAZ32705 n/a EU186671 n/a n/a Hedges et al., 2008

Pristimantis inguinalis 268010 ROM40164 n/a EU186676 n/a n/a Hedges et al., 2008

Pristimantis jester 268091 ROM43302 n/a EU186734 EU186716 n/a n/a Hedges et al., 2008

Pristimantis marmoratus 268090 ROM43913 n/a EU186692 n/a n/a Hedges et al., 2008

Pristimantis minutulus 171117 KU291677 n/a EU186657 n/a n/a Hedges et al., 2008

Pristimantis prolatus 268107 KU177433 n/a EU186701 n/a n/a Hedges et al., 2008

Pristimantis rhabdocnemus 171063 KU291651 n/a EU186724 EU186706 n/a n/a Hedges et al., 2008

Pristimantis saltissimus 268092 ROM43310 n/a EU186693 n/a n/a Hedges et al., 2008

Pristimantis dendrobatoides 268093 ROM43318 n/a EU186735 EU186717 n/a n/a Hedges et al., 2008

Pristimantis pulvinatus 268114 KU181015 n/a EU186741 EU186723 n/a n/a Hedges et al., 2008

Pristimantis chalceus 267865 KU177638 n/a EF493675 n/a n/a Heinicke et al., 2007

Pristimantis bipunctatus 171021 KU291638 n/a EF493702 EF493492 Heinicke et al., 2007

Pristimantis caprifer 267880 KU177680 n/a EF493391 n/a n/a Heinicke et al., 2007

Pristimantis citriogaster 267201 KU212278 n/a EF493700 n/a n/a Heinicke et al., 2007

Pristimantis condor 267212 KU217857 n/a EF493701 EF493443 EF493504 Heinicke et al., 2007

Pristimantis conspicillatus 267636 QCAZ28448 n/a EF493529 EF493437 EF493499 Heinicke et al., 2007

App. p. -12-

Pristimantis fenestratus 266046 MHNSM9298 n/a EF493703 n/a n/a Heinicke et al., 2007

Pristimantis lymani 267220 KU218019 n/a EF493392 n/a n/a Heinicke et al., 2007

Pristimantis skydmainos 266052 MHNSM10071 n/a EF493393 n/a n/a Heinicke et al., 2007

Pristimantis buckleyi 267210 KU217836 n/a EF493350 n/a n/a Heinicke et al., 2007

Pristimantis cryophilius 267214 KU217863 n/a EF493672 n/a n/a Heinicke et al., 2007

Pristimantis curtipes 267215 KU217871 n/a EF493513 EF493435 EF493497 Heinicke et al., 2007

Pristimantis gentryi 267230 KU218109 n/a EF493511 n/a n/a Heinicke et al., 2007

Pristimantis appendiculatus 267866 KU177637 n/a EF493524 n/a n/a Heinicke et al., 2007

Pristimantis devillei 267216 KU217991 n/a EF493688 n/a n/a Heinicke et al., 2007

Pristimantis quinquagesimus 267872 KU179374 n/a EF493690 n/a n/a Heinicke et al., 2007

Pristimantis truebae 267229 KU218013 n/a EF493512 n/a n/a Heinicke et al., 2007

Pristimantis vertebralis 267870 KU177972 n/a EF493689 n/a n/a Heinicke et al., 2007

Pristimantis ockendeni 267253 KU222023 n/a EF493519 EF493434 EF493496 267254 Heinicke et al., 2007

Pristimantis bromeliaceus 171051 KU291702 n/a EF493351 n/a n/a Heinicke et al., 2007

Pristimantis schultei 267199 KU212220 n/a EF493681 n/a n/a Heinicke et al., 2007

Pristimantis festae 267247 KU218234 n/a EF493515 n/a n/a Heinicke et al., 2007

Pristimantis leoni 267437 KU218227 n/a EF493684 EF493433 EF493495 Heinicke et al., 2007

Pristimantis ocreatus 267439 KU208508 n/a EF493682 n/a n/a Heinicke et al., 2007

Pristimantis pyrrhomerus 267441 KU218030 n/a EF493683 n/a n/a Heinicke et al., 2007

App. p. -13-

Pristimantis orcesi 267221 KU218021 n/a EF493679 n/a n/a Heinicke et al., 2007

Pristimantis thymelensis 267644 QCAZ16428 n/a EF493516 EF493442 EF493503 Heinicke et al., 2007

Pristimantis melanogaster 267438 MHNSM-WED56846 n/a EF493826 EF493664 n/a n/a Heinicke et al., 2007

Pristimantis orestes 267249 KU218257 n/a EF493388 n/a n/a Heinicke et al., 2007

Pristimantis simonbolivari 267248 KU218254 n/a EF493671 n/a n/a Heinicke et al., 2007

Pristimantis aniptopalmatus 171070 KU291627 n/a EF493390 n/a n/a Heinicke et al., 2007

Pristimantis peruvianus 266050 MHNSM9267 n/a EF493707 EF493436 EF493498 Heinicke et al., 2007

Pristimantis rhabdolaemus 267875 KU173492 n/a EF493706 n/a n/a Heinicke et al., 2007

Pristimantis sagittulus 171098 KU291635 n/a EF493705 EF493439 EF493501 Heinicke et al., 2007

Pristimantis stictogaster 171080 KU291659 n/a EF493704 EF493445 EF493506 Heinicke et al., 2007

Pristimantis toftae 267206 KU215493 n/a EF493353 n/a n/a Heinicke et al., 2007

Pristimantis colomai 267635 QCAZ17101 n/a EF493354 EF493440 EF493502 Heinicke et al., 2007

Pristimantis cremnobates 267878 KU177252 n/a EF493528 EF493424 EF493486 Heinicke et al., 2007

Pristimantis cruentus 267876 AMNH12444-448 n/a EF493697 n/a n/a Heinicke et al., 2007

Pristimantis latidiscus 267219 KU218016 n/a EF493698 n/a n/a Heinicke et al., 2007

Pristimantis ridens 267877 AMNH-A124551 n/a EF493355 n/a n/a Heinicke et al., 2007

Pristimantis achatinus 267208 KU217809 n/a EF493827 EF493660 n/a n/a Heinicke et al., 2007

Pristimantis actites 267209 KU217830 n/a EF493696 EF493432 EF493494 Heinicke et al., 2007

Pristimantis crenunguis 267879 KU177730 n/a EF493693 EF493666 n/a n/a Heinicke et al., 2007

App. p. -14-

Pristimantis labiosus 267640 QCAZ19771 n/a EF493694 n/a n/a Heinicke et al., 2007

Pristimantis lanthanites 267252 KU222001 n/a EF493695 n/a n/a Heinicke et al., 2007

Pristimantis w-nigrum n/a n/a n/a AY326004 n/a n/a Heinicke et al., 2007

Pristimantis duellmani 267444 KU217998 n/a n/a n/a EF493438 EF493500 Heinicke et al., 2007

Pristimantis duellmani n/a n/a n/a AY326003 n/a n/a Heinicke et al., 2007

Pristimantis surdus 267871 KU177847 n/a EF493687 n/a n/a Heinicke et al., 2007

Pristimantis acerus 267207 KU217786 n/a EF493678 n/a n/a Heinicke et al., 2007

Pristimantis cajamarcensis 267211 KU217845 n/a EF493823 EF493663 n/a n/a Heinicke et al., 2007

Pristimantis calcarulatus 267868 KU177658 n/a EF493523 n/a n/a Heinicke et al., 2007

Pristimantis celator 267874 KU177684 n/a EF493685 n/a n/a Heinicke et al., 2007

Pristimantis ceuthospilus 267198 KU212216 n/a EF493520 n/a n/a Heinicke et al., 2007

Pristimantis chloronotus n/a n/a n/a AY326007 n/a n/a Heinicke et al., 2007

Pristimantis croceoinguinis 267213 KU217862 n/a EF493669 EF493665 n/a n/a Heinicke et al., 2007

Pristimantis dissimulatus 267867 KU179090 n/a EF493522 n/a n/a Heinicke et al., 2007

Pristimantis euphronides 266624 BWMC6918 n/a EF493527 EF493427 EF493489 Heinicke et al., 2007

Pristimantis glandulosus 267217 KU218002 n/a EF493676 n/a n/a Heinicke et al., 2007

Pristimantis imitatrix 267205 KU215476 n/a EF493824 EF493667 n/a n/a Heinicke et al., 2007

Pristimantis inusitatus 267218 KU218015 n/a EF493677 n/a n/a Heinicke et al., 2007

Pristimantis lirellus 267200 KU212226 n/a EF493521 n/a n/a Heinicke et al., 2007

App. p. -15-

Pristimantis luteolateralis 267863 KU177807 n/a EF493517 n/a n/a Heinicke et al., 2007

Pristimantis nyctophylax 267869 KU177812 n/a EF493526 EF493425 EF493487 Heinicke et al., 2007

Pristimantis parvillus 267864 KU177821 n/a EF493351 n/a n/a Heinicke et al., 2007

Pristimantis petrobardus 267202 KU212293 n/a EF493825 EF493367 n/a n/a Heinicke et al., 2007

Pristimantis phoxocephalus 267222 KU218025 n/a EF493349 n/a n/a Heinicke et al., 2007

Pristimantis pycnodermis 267223 KU218028 n/a EF493680 n/a n/a Heinicke et al., 2007

Pristimantis rhodoplichus 267250 KU219788 n/a EF493674 n/a n/a Heinicke et al., 2007

Pristimantis riveti 267224 KU218035 n/a EF493348 n/a n/a Heinicke et al., 2007

Pristimantis rozei 102308 Novoucher n/a EF493691 EF493429 EF493491 Heinicke et al., 2007

Pristimantis shrevei 266036 Novoucher n/a EF493692 n/a n/a Heinicke et al., 2007

Pristimantis spinosus 267225 KU218052 n/a EF493673 n/a n/a Heinicke et al., 2007

Pristimantis subsigillatus 267246 KU218147 n/a EF493525 n/a n/a Heinicke et al., 2007

Pristimantis supernatis n/a n/a n/a AY326005 n/a n/a Heinicke et al., 2007

Pristimantis thymalopsoides 267873 KU177861 n/a EF493514 n/a n/a Heinicke et al., 2007

Pristimantis unistrigatus 267227 KU218057 n/a EF493387 EF493444 EF493505 Heinicke et al., 2007

Pristimantis urichi 101646 USNM336098 n/a EF493699 EF493426 EF493488 Heinicke et al., 2007

Pristimantis verecundus 267646 QCAZ12410 n/a EF493686 n/a n/a Heinicke et al., 2007

Pristimantis versicolor 267228 KU218096 n/a EF493389 EF493431 EF493493 Heinicke et al., 2007

Pristimantis walkeri 267231 KU218116 n/a EF493518 EF493428 EF493490 Heinicke et al., 2007

App. p. -16-

Pristimantis wiensi 267251 KU219796 n/a EF493377 EF493668 n/a n/a Heinicke et al., 2007

Pristimantis festae KU218234 n/a EF493515 n/a n/a Heinicke et al., 2007

Agalychnis callidryas n/a n/a n/a DQ283423 n/a DQ283018 Heinicke et al., 2007

Agalychnis callidryas n/a n/a n/a n/a n/a EF493362 n/a Heinicke et al., 2007

Craugastor daryi 267858 UTA57940 n/a EF493531 EF493452 EF493480 Heinicke et al., 2007

Craugastor longirostris 267853 KU177803 n/a EF493395 EF493454 EF493482 Heinicke et al., 2007

Litoria caerulea n/a n/a AY883980 AY843692 n/a AY844131 Heinicke et al., 2007

Litoria caerulea 267887 novoucher n/a n/a n/a EF493446 n/a Heinicke et al., 2007

Phrynopus auriculatus 171082 KU291634 n/a EF493708 n/a n/a Heinicke et al., 2007

Phrynopus bracki 171045 USNM286919 n/a EF493709 EF493421 EF493507 Heinicke et al., 2007

Rana catesbeiana n/a n/a n/a DQ283257 n/a DQ282959 Heinicke et al., 2007

Rana catesbeiana 266591 N0_voucher n/a n/a n/a EF493448 n/a Heinicke et al., 2007

Lynchius flavomaculatus 267966 KU218210 n/a EU186667 EU186745 EU186766 Hedges et al., 2008

Lynchius nebulanastes 268115 KU181408 n/a EU186704 n/a n/a Hedges et al., 2008

Oreobates cruralis 267962 KU215462 n/a EU186666 EU186743 EU186764 Hedges et al., 2008

Oreobates saxatilis 267960 KU212327 n/a EU186726 EU186708 EU186742 EU186763 Hedges et al., 2008

App. p. -17-

FIGURES

Figure 1. Major clades of Pristimantis frogs. MP of 80 individuals of frogs including eight out-group species. Bootstrap supports are presented. The groups are named according to Hedges et al., (2008).

Figure 2. A time tree of Pristimantis frogs. The tree topology is derived from a Bayesian analysis de 80 taxa. Support values are indicated at nodes (ML/Bayesian posterior probability). Calibration nodes are indicated by an asterisk. Branches with blue color show the Central American species.

Figure 3. Maximum likelihood phylogeny of 265 individuals of frogs is presented. The data set consists of 4279 base pairs of aligned DNA sequences, including mitochondrial DNA (12S rRNA, 16S rRNA, and COI) and nuclear DNA (Rag-1 and Tyr genes). Posterior probabilities are shown. First segment (top) of tree. (B) Second segment of tree. (C) Third segment (bottom) of tree.

Figure 4. Maximum likelihood phylogeny of 265 individuals of frogs is presented. The data set consists of 4279 base pairs of aligned DNA sequences, including mitochondrial DNA (12S rRNA, 16S rRNA, and COI) and nuclear DNA (Rag-1 and Tyr genes). Posterior probabilities are shown. The terminal taxa names are collapsed. First segment (top) of tree. (B) Second segment of tree. (C) Third segment (bottom) of tree.

E76_Clongirostris_AJC1336_AntMac E13_Ptaeniatus_CJD069_San 10 0 100 Ptaeniatus_AJ C1126_PaCo 100 Ptaeniatus_AJ C1961_PaPa 100 100 Ptaeniatus_AJ C1995_PaPa Ptaeniatus_CH6796_PaPa 100 Ptaeniatus_AJ C1835_PaDa Ptaeniatus_AJ C1839_PaDa Frater group 100 E38_Pzophus_NRPS0070_AntUrr E39_Pzophus_NRPS0071_AntUrr 100 E6_Plibrarius_QCAZ25852_Napo Pockendeni_voucher_KU222023 91 E62_Psp_NRPS0001b_AntAnor E61_Psp_NRPS0067_AntCal E73_Pzophus_NRPS0072_AntUrr 100 Ppirrensis_AJ C0594_PaDa 75 Ppirrensis_AJ C1863_PaDa 100 Pardalis group 75 P a l t ae _A J C0 3 9 8_CrAla Ppardalis_AJ C0188_PaChi Pwalkeri_voucher_K U2 1 81 16 100 E72_Ppai s a _NRPS0062_AntCal E60_Ppai s a _NRPS0060_AntCal Frater group Punistrigatus_voucher_K U21 80 5 7 E29_Psp2_AJ C1353_TolFal 100 E33_Ptaeniatus_AJ C1363_TolFal E71_Ptaeniatus _AJC1373_Tol Frater group E36_Pmiyatai_RC 6 1 1 _SanFlor E9_Pmarti ae_QCAZ18018_Napo Pmuseosus_AJC1210_PaPa Paltamazonicus_voucher_KU215460 Pversicolor_voucher_ K U2 1 809 6 100 100 Pmoro_AJC1753__PaPa Ridens group 100 Pmoro_AJC1860_PaDa Pnyctophylax_voucher_K U17 7 8 12 Pgaldi E8_Pquaqua ve rsu s _QCAZ25676_Pastaza 100 Pcurtipes _voucher_KU217871 100 Pduellmani P l e oni _voucher_KU218227 E15_Pviejas_EMM250_AntSanRaf 100 E20_Pviejas_EMM249_AntSanRaf 100 E17_Pviejas_EMM248_AntSanRaf Frater group 100 E25_Pviejas_SMG326_AntSanRaf 100 E28_Pviejas_AJC1352_TolFal 10 0 10 0 E30_Pviejas_AJC1355_TolFal Pcf_cruentus_AJC0217_PaChi Pcerasinus_AJC1142_PaPa Ridens group Pcruentus_AJC0524_CrLim Pcolomai_voucher_QCAZ17101 100 Pcaryophyllaceus_AJC1138_PaPa Unistrigatus Pcaryophyllaceus_CH6367_PaDaCa group Pcremnobates_voucher_KU177252 100 Priden s _A J C0 1 26_CrPunta 100 Pridens_ENS10722_HonOla 100 Ridens group 100 Pridens_AJC0211_PaKu Pridens_AJC0336_PaPa Pactites_voucher_KU217830 100 Pthymelensis_vouc h e r_QCAZ16428 100 E42_Psavagei_NRPS0083_Vi ll Conspicillatus 100 E43_Psavagei_NRPS0085_Vi ll group E52_Pnervicus_NRPS0048_CunChin 100 Peuphronides_vo u c h e r _BWMC6918 100 100 Pachatinus_AJC0573_PaDarCan Conspicillatus 100 Pcondor_voucher_KU217857 group 100 Pconspicillatus_voucher_QCAZ28448 100 Pbipunctatus_voucher_KU291638 Pgaigae_CH6471_PaBocas 100 Pperuvianus Peruvianus Psagittulus_voucher_K U29 16 3 5 group Pstictogaster_voucher_KU29165 Prozei Unistrigatus Purichi_voucher_USNM336098 group Lynchius_flavomaculatus 100 Oreobates_cruralis Oreobates_saxatilis Phryno pus_bracki_USNM286919 Outgroup 100 Litoria_caerulea Agalychnis_c all idryas C_daryi_voucher_UTA_A57940 C_longirostris_vo uc h e r _KU177803

1. 0

Figure1.

App. p. -19-

Agalychnis callidr 1 Litoria caerul Cdaryi_UTA_A57 1 Clongirostris KU177 1 E76_Clongirostris_AJC1336_An * Phryno pus bra cki USNM286919 0961 Lync hius flavomaculat us 0,99 Oreobates_cruralis 1 Oreobates saxatilis 0,687 Pactites voucher KU217830 Ec * Pcaryophyllaceus CH6367 CoCrPa 1 1 Pcaryophyllaceus AJC1138 CoCrPa Pcremnobat e s KU1 7 725 2 E c 1 0, 9 80 1 Pridens_ENS10722 Pridens AJC0126 1 1 Pridens AJC0211 1 Pridens AJC0336 0,865 Pcruentus_AJC0524_CrPa 0,999 Pcolomai_QCAZ17101_CoEc Pcerasinus AJC1142CoHnNiPa 0,984 1 Pcf cr u en t u s AJC 0 217 Cr Pa 1 Pmuseosus AJC1210 Pa 1 E30 Pviejas AJC1355 Co 1 100/1 E28 Pviejas AJC1352 Co E15 Pviejas EMM250 Co 100/1 1 E25 Pviejas SMG326Co 0,97 E20 Pviejas EMM249 Co 0,9 E 17_Pvie ja s_EMM248S_Co Prozei Ve 0,862 Pu r i chi _ USNM3 3 6 098 _T r iT o Pperuvianus BrCoE 1 Psagittulus_KU291635 0 , 349 2 1 Pstictoga ste rKU291659 Peuphronides_BWMC6918_Ant 0, 9 98 100/1 E52 Pnervicus NRPS0048 1 1 E42 Psavagei NRPS0083 98/0, E43 Psavagei NRPS0085 100/1 Pgaigae CH6471 CoC 100/1 Pbipunc ta tu s KU2 91 63 8 1 10 0 /1 Pachatinus AJC0573EcC Pcondor KU217857E 1 Pconspicillat us QCAZ2 8448 BrCo Pthymelensis_QCAZ16428_ 0,843 PleoniKU21 8227C 1 1 Pduellm ani Co Pcurtipes_KU217871_CoEc 0, 9 06 Pnyctophylax_KU177812_ 1 EcPgaldi EcPe 0,759 1 Pmoro AJC186 0 Co CrPa 1 Pmoro AJC1753 CoC Pversicolor KU218096E E8_Pquaquaversus_QCAZ25676_Co 1 Paltamazonicus_KU215460_BrCoEcPe 0 , 458 Pwalke r i_ KU2 18 1 1 6_Ec Ppardali sPa 100/1 1 1 1 Paltae_AJC0398_PaCr 100/1 Ppirrensis_AJC0594 Ppirrensis_AJC1863_Pa 1 1 E6 Pli brari us QCAZ25852 Pockendeni_KU222023_BrCo Punist ri ga t u s KU21805 7 C 1 E61_Psp_NRPS0067_Co 0,490 E 6 2 _Psp_ NR PS0 00 1 b_C o 97/0, 9 9 E38 Pzoph us NRPS0070 Co 1 0,995 E39 Pzophus NRPS0071 0,443 E73Co Pzophus NRPS0072 0,99 E60_Ppaisa_NRPS0060_Co 1E72_Ppaisa_NRPS0062_Co 0810 E9 Pmartiae QCAZ18018 BrCo 0,928 E29_Psp2_AJC1353_Co 1 E36_Pmiyatai_RC611_Co 1 E33_Ptaeniatus_AJC1363_ 1 1 E71_Ptaeniatus_AJC1373_ E13 Ptaeniatus CJD069 C 100/1 Ptaeniatus_AJC1835_CoPa 1 Ptaeniatus_AJC1839_CoPa 100/1 Ptaeniatus_AJC1126_CoPa L 1Ptaeniatus_AJC1961_CoPa 0,946 Ptaeniatus AJC1995 CoPa 0,998 Ptaeniatus_CH6796_CoPa

60, 50, 40, 30, 20, 10, 0,

Figure2. App. p. -20-

Outgroup

Pactites KU217830 1 1 Pwnigrum 0,8 Planthanites_KU222001 Plabi osus QCAZ19771 0,8 PcrenunguisKU177730 Pcremnobates_KU177252 1 E55 Perythropleura NRPS0055 VallCai Pcruentus AJC0581 PaDa

Pcruentus_AJC0524_CrLim 1 1 Pcruentus KRL0685 PaCo Pcruentus AJC0480 CrHer 0,5 0,9 0,6 0,6 Pcruentus_AJC0475_CrCar 0,7 Pcruentus_AMNH12444_448 1 Pcruentus AJC1133 PaPa 1 Pcruentus rojotomate CH6721 PaPa 0,8 Pcruentus_AJC1204_PaPa 1 E57 Perythropleura NRPS0057 VallCai 0,9 1 E22 Pcf Paisa EMM247 AntSanRaf 0,7 E80_Pcf_paisa_AJC1344_AntMac PcolomaiQCAZ17101 0,8 1 0,8 Platidiscus_KU218016 E67_PsPNRPS0013b_AntAmal 1 Pcerasinus_AJC1132_PaPa Pcerasinus AJC1142 PaPa 1 1 Pcerasinus_AJC0071_CrHer 1 Pcerasinus AJC0527 CrLim 0,8 1 Pcf cruentus AJC0234 PaChi

0,9 Pcf cruentus AJC0217 PaChi 1 E65_Pviejas_NRPS0010b_AntAm E66 Pviejas NRPS0011b AntAma l al 0,9 E25 Pviejas SMG326 AntSanRaf E20_Pviejas_EMM249_AntSanRaf 1 0,9 E17_Pviejas_EMM248_AntSanRaf 1 E28 Pviejas AJC1352 TolFal 1 0,9 E30_Pviejas_AJC1355_TolFal 0,9 1 E18 Pviejas EMM232 AntSanRaf E21_Pviejas_EMM233_AntSanRaf

E15_Pviejas_EMM250_AntSanRaf E74 Pcf taeniatus AJC1191 ChNu qu 1 1 Pcf taeniatus AJC1683 PaDa Pcaryophyllaceus AJC1138 PaPa 0,8 Pcaryophyllaceus AJC0187 PaCh 0,8 Pcaryophyllaceus MVZ203810 0,8 1 Pcaryophyllaceus AJC0486 CrSanJo Pcaryophyllaceus_CH6367_PaDaCa Pridens_AJC0216_PaPa 0,9 1 Pridens AMNH A124551 1 Pridens AJC0336 PaPa Pridens_AJC0211_PaKu Pridens Ens10647 HonOla 1 1Pr idens ENS10722 HonOla 1 Pridens_DL401_CrSanJ Pridens AJC0522 CrHer 1 Pridens AJC0356 CrLim Pridens_AJC0126_CrPunta

Figure3a. App. p. -21-

Prozei 1 0,7 Purichi USNM336098 Pdendrobatoides_ROM43318 Periphus QCAZ 32705 1 Pchloronotus 1 Psupernatis KU 202432 0,8 Pthymelensis_QCAZ16428 E3_Psuetus_MHUA0440_AntGua Pprolatus_KU177433 0,8 Pglandulosus_KU218002 1 Pinusitatus KU21 8015 Pacerus KU21 7786 0,8 Pcalcarulatus_KU177658 1 0,8 Pdissimulatus KU179090 1 Pappendi culatus KU177637 0,9 Ppycnodermis_KU218028 Porcesi_KU218021 Pmoro_AJC1753__PaPa 1 1 Pmoro_AJC1860_PaDa 0,9 Pzeuctotylus ROM43978 0,9 1 Pbromeli ace us KU291702 1 0,9 Pcf mendax MTD45080 Pschultei_KU212220 1 1 Pgaldi QCAZ32368 1 Pnyctophylax_KU177812 1 Psubsigillatus_KU218147 Pcrucifer_KU177733 Psimonsii_KU212350 Pcryophilius_KU217863 0,7 1 Pspinosus_KU218052 0,8 Pphoxocephalus_KU218025 1 Priveti_KU218035 0, 7 0,5 1 Pversicolor_KU218096 Prhodoplichus_KU219788 Ppetrobardus_KU212293 0, 7 0,9 Pmelanogaster_MHNSM_WED56846 0,9 E7_Pquaquaversus_QCAZ16150_Sucumbios 0,9 1 E8_Pquaquaversus_QCAZ25676_Pastaza Prhabdocnemus_KU291651 Pwiensi_KU219796 0,7 Psimonboli vari KU218254 1 Porestes KU218257 Pd i a dem at u s_ KU22 1 9 99 1 0,9 Psp snote AJC2005 PePa Pa l tam az oni cus KU215460 Pinguinalis_ROM40164 1 1 Pmarmoratus_ROM43913 1 1Psaltissimus_ROM43310 1 Pcruciocularis_KU291673 0,9 0,8 1 1 PPimitatrix_KU215476lire ll us KU212226 Pjester ROM43302 1 Ppulvinat us KU181015 E 4 _ Poc ke n den i_ QC AZ _ 25 7 66_ Na po 1 E10_Pockendeni_QCAZ25428_Orellana Pparvillus KU177 8 21 1 Pluteolateralis_KU177807 1 Pwalkeri_KU218116 Pchalceus_KU177638 0,9 Ppardali s CH6284 PaDa 111 Ppardali sKRL 0 69 0 Pa C o 1 Ppardalis_AJC1208_PaPa 1 Ppirrensis_AJC1863_PaDa 1 Ppirrensis_AJC0594_PaDa Paltae_AJC0398_CrAla 1 Ppardalis AJC0188 PaChi Pcajamarcensis_KU217845 1 Pceuthospilus KU212216 0, 9 Pardalonychus KU212301 1 Pminutulus KU291677 0,9 Pockendeni_KU222023 1 E6_Plibrarius_QCAZ25852_Napo E38_Pzophus_NRPS0070_AntUrr 0,9 1 E39_Pzophus_NRPS0071_AntUrr E41_Pzophus_NRPS0076_AntUrr 1 E73_Pzophus_NRPS0072_AntUrr 0,9 1 E40_Pzophus_NRPS0074_AntUrr 0,9 E60_Ppaisa_NRPS0060_AntCal 1 E72 Ppaisa NRPS0062 AntCal 0,6 Punistrigatus_KU218057 0,6 E34_Psp2_AJC1368_TolFal E62_Psp_NRPS0001b_AntAnor 0, 8 1 E63_Psp_NRPS0002b_AntAnor E64_Psp_NRPS0007b_AntAnor 0,9 1 1 E54_Psp1_NRPS0054_VallCai 0,9 E56_Psp1_NRPS0056_VallCai E61_Psp_NRPS0067_AntCal E37 Pmiyat ai RC612 SanFlor 1 E36_Pmiyatai_RC611_SanFlor 0,8 E11_Pmiyatai_RC610_SanDivi 1E12_Pmiyatai_RC613_SanFlor Ptaeniatus_CH4999_PaCo Ptaeniatus_AJC1994_PaPa Ptaeniatus_AJC1977_PaPa Ptaeniatus_AJC1993_PaPa 1 Ptaeniatus_AJC1782_PaPa 0,9 Ptaeniatus AJC1961 PaPa Ptaeniatus_AJC1995_PaPa 1 Ptaeniatus_CH6796_PaPa 0,8 0,9 1 Ptaeniatus_CH4945_PaCo Ptaeniatus_AJC1126_PaCo Ptaeniatus_CH5067_PaCo 1 Ptaeniatus_AJC1839_PaDa 1Ptaeniatus_CH5585_PaDa Ptaeniatus_AJC1835_PaDa 1 E47 Ptaeniatus NRPS0017CunYacopi E48_Ptaeniatus_NRPS0019_CunYacopi 1 1 E46_Ptaeniatus_NRPS0016_CunYacopi E49_Ptaeniatus_NRPS0022_CunYacopi 1 1 E71_Ptaeniatus_AJC1373_Tol 1E33_Ptaeniatus_AJC1363_TolFal 0,9 0,9 E31_Ptaeniatus_AJC1359_TolFal 0,7 E1_Ptaeniatus_MHUA0426_AntMac 0,9 E26_Ptaeniatus_NN_AntSanRaf 0,9 E69 Ptaeniatus NRPS0017b AntAmal E70_Ptaeniatus_NRPS0019b_AntAmal 1 1 E2_Ptaeniatus_MHUA0455_AntAmalf E14_Ptaeniatus_SMG325_AntSanRaf E35_Ptaeniatus_AJC1372_TolFal E16_Etaeniatus_CJD070_SanFlor 1 E23_Ptaeniatus_CJDO67_San E13_Ptaeniatus_CJD069_San 0,9 E19_Ptaeniatus_CJD068_San E24 Ptaeniatus CJD071 San E51PbogotensisNRPS0033CunChin E29_Psp2_AJC1353_TolFal 0,6 E58_Pptochus_nrps0058_VallCai 0,8 1 E9_Pmartiae_QCAZ18018_Napo 0,9 E5_Pmartiae_QCAZ17998_Napo E45_Pfrater_NRPS0090_Vill

Figure3b.

App. p. -22-

E59 Pbrevifrons NRPS0059 VallCa i Pquinquagesimus KU179374 0,8 Pduellmani KU217998 0,9 Pthymalopsoide s KU1 7 786 1

1 Pdevil lei KU217991 0,7

1 0,9 Pbuckl eyi KU217836

Pcurtipes_KU217871 1 Pgentryi KU218109 1 0,7 1 Ptruebae KU21 8 0 13

Psurdus_KU177847 1 Pcelator_KU177684 Pverecundus QCAZ12410

Ppyrrhomerus KU218030 1 0,8 0,9 Pocreatus_KU208508 1 Pleoni_KU218227 1 Pfestae_KU218234 Ptrepi d otus KU218234 Pterraeboliva r is Pfenestratus MHNSM9298 0,7 Pcondor KU217857 1 Pmalkini_QCAZ28296 1 0, 7 0,8 Pcitriogaster KU212278 Pconspi cillat us QC AZ 2 844 8 1 Plyma ni KU218019 1 Pachatinus_KU217809 1 1 1 Pachatinus_AJC0573_PaDarCan

Pskydma inos MHNSM10071 1 Pbipunctatus_KU291638 E68_Pgaigeae_NRPS0016b_AntAmal 1 1 Pgaigae_CH6471_PaBocas 1 Pgaigae_KRL8880_PaCo 0,6 E79_Pgaigeae_AJC1339_AntMac E44_Psavagei_NRPS0087_Vill 0,6 1 E42_Psavagei_NRPS0083_Vill 1 E43_Psavagei_NRPS0085_Vill E52 Pnervicus NRPS0048 CunChin

1 E53 Pelegans NRPS0052CunChin 0,9 1 E50 Paffinis NRPS0031 CunChin

Peuphro n ides BWMC6918 1 Pshrevei Pperuvian us MHNSM9 2 67 1 1 Pperuvianus_KST0278_PePa Pperuvianus AJC2025 PePa Psagittulus KU291635 1 0,9 1 Ppluvicanorus AMNH A165195 1 Prhabdolaemus_KU173492 1 1 Ptoftae_KU215493 Paniptopalmatus KU291627 Pstictogaster_KU291659 1 1 1 Palbertus_KU291675 Pc f _ r ha b dola em u s_ KU1 7 349 2 Pcaprifer KU177680 1 Psp AJC2066 PaAncon Psp AJC2067 PaAncon

Pp l at y da ctyl u s_ MB H5 7 4 6_B ol 1 Pcroceoingu i ni s_ KU2 17 8 62 0,8 Psp naranja KST0208 PePa 1 Pconspicillatus_KST0253_PePa 1 Pfenestratus_MBH5712_Bol 0,9 PcruentusAJC0460 CrAla

1 E32_Pgaigeae_AJC1360_TolFal Pcruentus_AJC1128_PaPa 0,7 1 Pmuseosus_AJC1210_PaPa Pmuseosus_AJC1143_PaPa

5. 0E - 4

Figure3c.

App. p. -23-

Outgr oup

P actites_K U217 830 1 1 Pwnigrum 0,8 P lan than ites_K U222 001 Plabiosus_QCA Z19 771 0,8 P cr enungu is_KU17 7730 P cr emnob ates_ KU17 7252 1

1 1 0,5 0,9 Pcruentus 0,6 0,6 0,7 1 1 0,8

1 P ery thro p leur a 0,9 1Ppaisa 0,7 Pcolomai_Q CAZ1710 1 0,8 1 0,8 P latid iscu s_KU 2180 16 E67_PsPNRPS001 3b_A n tAmal 1

1 Pcerasinu s 1 1 0,8 1 Pcf_ cruentus

0,9 1

0,9

1 0,9 1 P v iejas 0,9 0,9 1

Pcf_taen iatus 1 1

0,8 0,8 P caryo phy llaceu s 0,8 1

0,9 1 1

1 Pridens 1

1

Figure4a.

App. p. -24-

Pro zei 1 P u r ich i_US N M33 60 98 0,7 Pdendrob ato id es_ RO M4331 8 Periphus_QCAZ32705 1 Pchloronotus 1 P su p ernatis_ K U_ 20 24 32 0,8 Pthymelensis_QCAZ16428 E3_Psuetus_MHUA0440_AntGua Pprolatus_KU177433 0,8 Pglandulosus_KU218002 1 Pinusitatu s_ K U2 18 01 5 Paceru s_KU21 77 86

0,8 Pcalcarulatu s_ K U 17 76 58 1 0,8 Pdissimulatus_KU179090 1 P ap p endicu latu s_ KU 17 7637 0,9 Ppycnodermis_KU218028 Po rcesi_KU 21 80 21 1 1 Pmoro 0,9 Pzeu ctoylus_ROM43978 t 0,9 1 Pbromeliaceu s_ K U 29 17 02 1 0,9 Pcf_mend ax_ MTD 4 50 80 P sch u ltei_ K U 21 22 20 1 1 P g ald i_ QCA Z3 23 68 1 Pnyctophy lax _KU177812 1 P su b sigillatu s_ K U2 18 14 7 P cr u cif er_K U 17 77 33 P sim o n sii_ KU 21 23 50 P cr y op hiliu s_K U 21 78 63 0,7 1 P sp in o sus_K U2 18 05 2 0,8 P p ho xo cep h alu s_ KU 21 8025 1 P r iv eti_ KU 21 80 35 0,7 0,5 1 Prhodoplichus_ K U2 19 78 8 P p etr o bardu s_K U 21 22 93 0,7 0,9 P m elan og aster _ MH NS M_W ED5 68 46 0,9 E7_Pquaquaversus_QCAZ16150_Sucumbios 0,9 1 E8 Pquaquaversu s Q C AZ25676 Pastaza P r h abd ocnem u s_ K U2 91 651 0,7 Pwiensi_KU219796 Psimonbolivari KU21 8254 1 Porestes_KU218257 P d iad ematu s_ KU 22 19 99 1 Psp_snote_AJC2005_PePa 0,9 P altam azon icu s_ K U 21 54 60 Pinguinalis_ROM40164 1 1 1P m ar m or atu s_ RO M4 39 13 1 P saltissimu s_ RO M43310 1 Pcruciocularis_KU291673 P imitatrx i _ K U2 15 47 6 0,9 0,8 1 1 Plirellus_KU212226 Pjester_ROM43302 1 P p u lv inatu s_ KU 18 10 15 1 Po ck enden i P p ar v illus_K U 17 78 21 1 Pluteolateralis_KU177807 1 Pwalkeri_KU218116 Pchalceus_ K U1 77 63 8 0,9 111 Ppardalis 1 1 Ppirrensis 1 Paltae_AJC0398_CrAla 1 P p ar d alis_ A JC01 88 _P aCh i Pcajamarcensis_ K U 2 17 845 1 Pceuthospilus_KU212216 0,9 Pardalony chu s_ KU 21 23 01 1 P m in u tulu s_ K U2 91 67 7 0,9 1 P o ck enden i_K U 22 20 23 E6_Plibrarius_QCAZ25852 _N apo 0,9 1 P zo p hus 1 Pzo phus 0,9 1 0,9 1 Ppaisa 0,6 0,6 Punistrigatus_KU218057 E34_Psp2 _A JC1 36 8_ To lFal E62_Psp_ N RP S0 00 1b _A ntAn o r 0,8 1 E63_Psp_ N RP S0 00 2b _A ntAn o r 1 0,9 1 E54_PE64_Psp1_NRPS0054_V_ N RP S0 00 7b _A antllCAanori 0,9 E56_Psp1_NRPS0056_VallCai E61_Psp_ N RP S0 06 7_ An tCal 1 0,8 Pmiyatai 1

1 0,9

1 0,8 0,9 1

1 1 1 P taen iatus 1 1

1 1 1 0,9 0,9 0,7

0,9 0,9 1 1

1 0,9 E51Pbogo tensisNRPS003 3 Cu nChin E29 Psp2 AJC1353 TolFal 0,6 E58_Pptochus_nrps0058_V allCai 0,8 1 Pmartiae 0,9 E4 5 _P f rater _N RP S 00 90 _Vill

Figure4b.

App. p. -25-

E59_Pbrevif ro ns_ N RP S0 05 9_ V allCai Pquinquagesimus_KU179374 0,8 0,9 Pduellmani_KU217998 Pthymalopso id es _K U1 77 86 1

1 P d ev illei_ K U 2179 91 0,7

0,9 1 Pbuckleyi_ K U217 83 6 Pcu rtip es_ KU 2178 71 1 Pgen tryi_ K U2 1810 9

1 1 0,7 P tr u eb ae_ KU 2180 13 P su rd u s_ K U1 7784 7 Pcelato r_KU177684 1 P v er ecu nd u s_ QCA Z1 24 10

Ppyrrhomerus_KU218030 1 0,8 0,9 P o cr eatu s_ KU 2085 08 Pleo n i_KU218227 1 1 P f estae_ K U 21 8234 Ptr epidotus_KU218234 Pterraeb o liv aris Pfen estratu s_ MHNS M9 29 8 0,7 Pcondor_KU2178 57 1 Pmalkini_QCAZ28296 1 0,7 0,8 Pcitriogaster_KU212278 1 P co n sp icilla tu s_Q CA Z28 44 8 Plymani_ KU 21 8019 1 1 1 1 Pach atin u s

Pskydmainos_MH N S M10 07 1 1 P b ip un ctatu s_ KU2 91 63 8

1 1 Pgaig ae 1 0,6

Psav ag ei

0,6 1

1 E52_Pnervicu s_NRPS0048_Cun Chin

1 1 E53_Pelegan s_NRPS0052_Cun Chin 0,9 E50_Paffinis_N RPS0031_CunCh in

Peuphronides_BW MC6 91 8 1 Pshrevei

1 Pperuv ianus 1

P sag ittu lu s_ K U291 63 5 1 1 Ppluvicanorus_AMNH_A_165195 0,9 1 Prhabd olaemu s_K U1 73 49 2 1 1 Pto ftae_KU215493 Pan ip to palmatus_KU291627 1 Psticto gaster_KU291659 1 1 P alb er tu s_ KU 2916 75 Pcf_rhabdolaemus_K U1 73 49 2 P cap r if er _K U 1776 80 1 P sp _A JC2 06 6_ PaAn con P sp _A JC2 06 7_ PaAn con

Pplatydactylus_MBH5746_Bol 1 Pcro ceo inguinis_K U2 17 86 2 0,8 Psp_naranja_KST0208_PePa

1 Pconspicillatus_K S T02 53 _ P ePa 1 Pfen estratu s_MBH5712_Bol 0,9 Pcruentus_AJC0460_CrAla 1 E32_Pgaig eae_AJC1360_TolF al Pcruentus_AJC1128_PaPa 0,7 1 Pmuseosus_A JC1210_PaPa

5.0E-4

Figure4c.

App. p. -26-