The Pennsylvania State University the Graduate School the Huck Institutes for Life Sciences MODULATION of NUCLEAR FACTOR KAPPA B

The Pennsylvania State University

The Graduate School

The Huck Institutes for Life Sciences

MODULATION OF NUCLEAR FACTOR KAPPA B (NFκB) TRANSACTIVATION BY

TRANSFORMING GROWTH FACTOR β-1 (TGFβ-1) IN KERATINOCYTES:

IMPLICATIONS FOR RESPONSIVENESS TO ULTRAVIOLET RADIATION (UVB)

A Dissertation in

Integrative Biosciences

Kelly A. Hogan

Submitted in Partial Fulfillment

of the Requirements

for the Degree of

Doctor of Philosophy

December 2011

The dissertation of Kelly A. Hogan was reviewed and approved* by the following:

Adam B. Glick Associate Professor of Veterinary and Biomedical Sciences Dissertation Advisor Chair of Committee

John Vanden Heuvel Professor of Veterinary and Biomedical Sciences

Andrea Mastro Professor of Microbiology and Cell Biology

K. Sandeep Prabhu Associate Professor of Immunology and Molecular Toxicology

Avery August Distinguished Adjunct Professor of Immunology

Peter Hudson Willaman Professor of Biology Director, Huck Institutes of the Life Sciences

*Signatures are on file in the Graduate School

Abstract

Molecular crosstalk leading to the integration of signal transduction pathways—and the formation of a signaling network—is particularly important for maintaining cellular homeostasis. Stimuli received at the cell surface and transduced to the nucleus can expect to be modified by any number of inputs in a highly context-dependent and cell-specific manner. Nuclear factor kappa B (NFκB) and transforming growth factor β-1 (TGFβ-1) are not only critical factors mediating inflammation, but they also play a substantial role in cancer progression. Therefore, understanding the intersection of these factors may shed light on inflammatory diseases and progression of cancer in skin. However, little is known about how TGFβ-1 and NFκB interact in keratinocytes, which rely heavily on both factors to maintain homeostasis. These studies provide data in keratinocytes that suggest TGFβ-1 modulated NFκB-dependent expression of proinflammatory cytokines, namely TNFα. Although results in these studies fail to show TGFβ- 1-mediated activation of upstream molecules of the canonical NFκB pathway or translocation of NFκB, preliminary evidence reveals that TGFβ-1 activating kinase (TAK-1) may provide a molecular link between TGFβ-1 receptor activation and NFκB transactivation. In spite of the fact that upstream signaling events are only speculative and part of ongoing inquiry, results presented in this chapter support the hypothesis that TGFβ-1-mediated NFκB transactivation of gene expression is Smad3-dependent. Furthermore, TGFβ-1 potentiates NFκB binding to consensus DNA sites, which putatively involves both the p50 and p65 subunit. The biological relevance of TGFβ-1 and NFκB crosstalk leading to expression of proinflammatory cytokines is also explored. Preliminary evidence suggests that this pathway may have a role in TGFβ-1- mediated apoptosis, differentiation, and ras-mediated induction of NFκB-dependent genes in keratinocytes. These studies are the first to show an intersection between TGFβ-1 and NFκB pathways, which may represent a mechanism by which TGFβ-1 ‘tunes’ or modulates NFκB- dependent gene expression.

iii

cytokine TNFα between 2-6 h post treatment and required an intact TGFβ-1 signaling pathway. Furthermore, an acute decrement in Smad7 expression was observed initially, but restored to control levels by 6 h. Smad7 repression also appears to be partially Smad3 dependent. The results of these studies also demonstrated for the first time TGFβ-1-mediated NFκB binding of p50 and p65 subunits to DNA following UVB exposure. Although degradation of IκB or translocation of the p50 subunit was not observed, the data presented herein suggested a scenario whereby the NFκB-dependent proinflammatory cytokine was expressed in a p50- and Smad3- dependent manner. Taken together, it is likely that TGFβ-1 is among the pathways involving NFκB transactivation that modulate or tune response to UVB.

Table of Contents

List of Figures ix-xiii

List of Tables xiv

Abbreviations xv

Acknowledgements xvi-xviii

Chapter 1: Introduction 1-64

I TGFβ-1 Signaling 1-8

A. Bioactivation of Latent TGFβ-1 1-2 B. TGFβ-1 Receptors 2-4 C. Smads 4-7 1) Smads in Skin 7-8

II TGFβ-1 Biology in Skin 8-18

A. Structure and Function of Skin 8-11 1) TGFβ-1 in Growth Inhibition and Senescence 11-12 2) TGFβ-1 in Apoptosis 12 3) TGFβ-1 in Terminal Differentiation 12-13 B. Role of TGFβ-1 in Immune Modulation 13-14 C. Role of TGFβ-1and Smads in Carcinogenesis 14-15 1) TGFβ-1 and Ras in Cancer Progression 15-16 2) TGFβ-1 in Tumor Immunology and Inflammation 17-18

III NFκB Signaling in Skin 18-23

A. Canonical NFκB pathway 18-22 B. NFκB Transactivation 22-23

IV Role of NFκB in Skin Homeostasis 23-33

A. Role of NFκB in Growth Inhibition and Senescence 24-25 B. Role in Terminal Differentiation 25-26 C. Role of NFκB in Apoptosis 26-27 D. Role of NFκB in Immune Modulation 27-28 1) TNFα in skin 28-31 E. Role of NFκB in Carcinogenesis 31-33

V Ultraviolet Radiation (UVR) Responsiveness in Skin 33-39

A. Acute Responses to UVR in Skin 35-36 B. Chronic UVR Exposure and Skin Carcinogenesis 36-37 C. Role of NFκB in UVB Responsiveness 37-38 D. Role of TGFβ-1 in UVB Responsiveness 38-39

VII Crosstalk between TGFβ-1 and NFκB 39-40

VIII Hypothesis and Aims 40-41

IX Literature Cited 41-64

Chapter 2: TGFβ-1 Crosstalk: Intersections between NFκB or Ras and TGFβ-1 Signaling in Keratinocytes 65-145

I Abstract 65

II Introduction 65-66

III Materials and Methods 66-74

A. Materials 66-67 B. Animal studies 67 C. Isolation of keratinocytes 67-68 D. Cell culture 68 E. Cell viability assay 68 F. Caspase 3/7 assay 68-69 G. Preparation of whole cell lysates 69 H. Western analysis 69 I. Preparation of nuclear extract 69-70 J. Electrophoretic mobility shift assay 70-71 K. Supershift assay 71 L. RNA isolation 71 M. cDNA synthesis 71-72 N. qPCR 72 O. v-Ha-Ras transduction 72 P. Luciferase assay 72-73 Q. siRNA transfection 73 R. Adenoviral infection 73 S. Statistical analysis 73-74

IV Results 74-124

A. TGFβ-1 mediated TNFα expression is NFκB and Smad3 dependent 74-78 B. TGFβ-1 fails to activate upstream NFκB signaling factors, but regulates 78-83 NFκB binding to DNA and transactivation C. TGFβ-1-induced transactivation of NFκB requires Smad-3 and an intact 84-88 NFκB signaling pathway D. Exploration of mechanisms linking TGFβ-1 signaling to NFκB activation 88-100 E. Biological relevance of the TGFβ-1/NFκB intersection 100-116

V Discussion 116-124

A. A novel target of TGFβ-1-mediated NFκB-dependent gene expression 116-118 B. Failure of TGFβ-1 to activate upstream molecules in the canonical NFκB 118-119 signaling pathway C. Smad3 interaction with NFκB during NFκB transactivation 119-122 D. Biological relevance of TGFβ-1-mediated NFκB 122-124

VI Summary 125

VII Future Directions 125-132

A. Elucidation of NFκB/Smad3 interactions 125-127 B. Kinases as mediators of non-canonical NFκB signaling 127-132

VI Literature Cited 132-145

Chapter 3: Role for TGFβ-1 in NFκB-mediated Response to Ultraviolet Radiation (UVB) in Keratinocytes 146-185

I Abstract 148

II Introduction 148-150

III Materials and Methods 150-156

A. Materials 150 B. Animal studies 150 C. Isolation of keratinocytes and fibroblasts 150-151 D. Cell culture 151 E. In vitro UVB treatment 151-152 F. Preparation of whole cell lysates 152 G. Western analysis 152-153 H. Preparation of nuclear extract 153 I. Electrophoretic mobility shift assay 153-154 J. Supershift assay 154 K. Myeloperoxidase immunohistochemistry 154-155

vii

L. RNA isolation 155 M. cDNA synthesis 155 N. qPCR 155-156 O. Luciferase assay 156 P. Statistical analysis 156

IV Results 156-175

A. Ultraviolet radiation (UVB)-induced TNFα is Smad3- and NFκB- 156-164 dependent B. UVB activates the TGFβ-1 pathway, but not the canonical NFκB 164-168 pathway involving TAK-1 C. TGFβ-1 mediates UVB-induced NFκB binding to DNA 168-173

V Discussion 173-178

A. Regulation of UVB-induced proinflammatory cytokines by TGFβ-1 173-175 B. UVB-mediated activation of upstream effectors of the TGFβ-1 signaling 175-176 Pathway C. TGFβ-1-mediated NFκB transcriptional activation 176-178

VI Literature Cited 178-185

Chapter 4: Discussion 186-197

I Global Discussion and Implications 186-197

A. Crosstalk in inflammation: TGFβ-1 and NFκB 186-189 B. NFκB as an amplifier rather than inducer of the ultraviolet radiation (UVR) response in the epidermis 189-192 C. TNFα as an endogenous tumor promoter 192

II Literature Cited 192-197

viii

List of Figures

FIGURE 1-1 Structure of latent and bioactive TGFβ-1 1

FIGURE 1-2 Structure of TGFβ (TβRI and TβRII) receptor complex 4

FIGURE 1-3 Major structural domains of the Smads 5

FIGURE 1-4 Interactions between Smads and other cofactors or corepressors 6

FIGURE 1-5 Role of Smads in skin development and differentiation 7

FIGURE 1-6 Structure of skin 8

FIGURE 1-7 Mechanisms of apoptosis in the keratinocyte 10

FIGURE 1-8 Mechanisms of TGFβ-1 growth inhibition 11

FIGURE 1-9 Involvement of ras in cellular crosstalk 16

FIGURE 1-10 Structural domains of NFκB subunits 19

FIGURE 1-11 Possible dimers formed by NFκB subunits 19

FIGURE 1-12 Structure of IκK 20

FIGURE 1-13 Canonical versus non-canonical NFκB signaling pathways 21

FIGURE 1-14 Protein structure of IκB 22

FIGURE 1-15 Role of NFκB in differentiation 24

FIGURE 1-16 Paradoxical functions of TNFα in skin 29

FIGURE 1-17 Dose response curve for ultraviolet radiation (UVB) 33

FIGURE 1-18 Light spectrum featuring ultraviolet spectrum 34

FIGURE 1-19 Cell specific responses to UVB: keratinocytes versus HeLa cells, a common model used in UV research 35

FIGURE 1-20 Formation of cyclopyrimidine dimer (CPD) by UVB 36

FIGURE 2-1 TGFβ-1 mediates NFκB-dependent proinflammatory cytokine expression in mice with skin-targeted doxycycline-inducible TGFβ-1 over-expression (K5rTA/ tetOTGFβ-1) 71

FIGURE 2-2a TGFβ-1-induced TNFα expression is increased at 6 h and sustained by 24 h 72

FIGURE 2-2b TGFβ-1-induced TNFα expression is NFκB-dependent 72

FIGURE 2-3 TGFβ-1-induced TNFα expression is Smad3 dependent and sustained over 24 h 73

FIGURE 2-4 TNFα-induced NFκB transactivation is abrogated by inhibition of the endogenous TGFβ-1 signaling pathway 73

FIGURE2- 5a TGFβ-1 treatment does not result in IκB degradation 75

FIGURE2- 5b TGFβ-1 treatment results in an increase in activated IKKα 75

FIGURE 2-6 TGFβ-1 treatment of keratinocytes in normal serum does not result in translocation of p50 in cells cultured in 8% serum 76

FIGURE 2-7 TGFβ-1 treatment of serum starved keratinocytes did not result in translocation of p50 under serum starved conditions 76

FIGURE 2-8 NFκB binding to DNA is TGFβ-1-dependent 77

FIGURE 2-9 TGFβ-1-induced NFκB binding to DNA involves p50 and p65 subunits 78

FIGURE 2-10 TGFβ-1 mediates NFκB transactivation in a dose dependent manner 80

FIGURE 2-11 TGFβ-1 mediates NFκB transactivation in a time dependent manner 81

FIGURE 2-12 TGFβ-1-mediated NFκB transactivation exhibits Smad3 dosage dependence 81

FIGURE 2-13 TGFβ-1-mediated NFκB transactivation is abrogated by pharmacological inhibition with a type I TGFβ receptor antagonist 81

FIGURE 2-14 TGFβ-1-mediated NFκB transactivation is decreased by a small molecule inhibitor of Smad3 (SIS3) 82

FIGURE 2-15 Exogenous Smad3 increases TGFβ-1-mediated NFκB transactivation 82

FIGURE 2-16 TGFβ-1-mediated NFκB transactivation exhibits p50 dosage dependence 83

FIGURE 2-17 TGFβ-1-mediated NFκB transactivation is decreased by pharmacological inhibition of the NFκB pathway 85

FIGURE 2-18 Exogenous p50 increases TGFβ-1-mediated NFκB transactivation 85

FIGURE 2-19 Exogenous p65 increases TGFβ-1-mediated NFκB transactivation 86

FIGURE 2-20 TGFβ-1-mediated Smad transactivation exhibits p50 dosage dependence 86

FIGURE 2-21 TNFα expression is inhibited by IκB super repressor 87

FIGURE 2-22 TGFβ-1-mediated NFκB transactivation is inhibited genetically with an IκB super repressor 89

FIGURE 2-23 Protein kinase C are important signal transduction mediators during differentiation. PKC isoforms are localized in specific strata 89

FIGURE 2-24 Pharmacologic evidence implicates PKCs in TGFβ-mediated NFκB transactivation 91

FIGURE 25 PKCα siRNA knocksdown both constituitive and TGFβ-1-mediated PKCα expression 91

FIGURE 2-26 Genetic inhibition of PKCα fails to implicate a role for the kinase in TGFβ-1- mediated NFκB transactivation 91

FIGURE 2-27 TGFβ-1 does not change the pattern of PKCα substrates in keratinocytes that overexpress PKCα 92

FIGURE 2-28 TGFβ-1-dependent NFκB binding to DNA is not altered by over-expression of PKCα 92

FIGURE 2-29 TGFβ-1-mediated NFκB transactivation is not altered by PKCα over-expression 93

FIGURE 2-30 Pharmacologic implicates PKD (PKCμ) in TGFβ-mediated NFκB transactivation 95

FIGURE 2-31 Maximal phorbol ester (TPA) activated NFκB transactivation requires intact TGFβ-1 signaling 95

FIGURE 2-32 Inhibition of TGFβ-1 activating kinase-1 (TAK-1) results in a decrease in TGFβ- 1-mediated NFκB transactivation 97

FIGURE 2-33 Pharmacological inhibition of TAK-1 does not change IκB levels in the presence or absence of TGFβ-1 treatment 97

FIGURE 2-34 TGFβ-1 modulates apoptosis through NFκB 98

FIGURE 2-35 Differentiation state partially influences TGFβ-1-mediated NFκB transactivation 98

FIGURE 2-36 TGFβ-1serves a dual role in the regulation of ras-induced NFκB-dependent genes in triple transgenic mouse skin 100

FIGURE 2-37 TGFβ-1serves a dual role in the regulation of ras-induced NFκB-dependent genes in keratinocytes in vitro 101

FIGURE 2-38 Ras-induced TNFα expression is NFκB-dependent and can be modulated by TGFβ-1 102

FIGURE 2-39 NFκB subunit protein levels are not modulated by inducible ras over a range of doxycycline doses and times 104

FIGURE 2-40 NFκB subunit protein levels are not modulated by inducible ras over a range of doxycycline doses 106

FIGURE 2-41 NFκB subunit protein levels are neither modulated by v-ha-ras, TGFβ-1, or both 107

FIGURE 2-42 Intact TGFβ-1 signaling is required for TGFβ-1 and ras induced NFκB transactivation 108

FIGURE 2-43 Ras and TGFβ-1 induce Smad-transactivation and together, increase Smad- transactivation 110

FIGURE 2-44 Oncogenic ras-induced cell viability requires intact NFκB, but not TGFβ-1 110

FIGURE 2-45 Increased levels of p65 and p50 in Pam212 versus SP-1 cells is is not TGFβ-1 dependent 111

FIGURE 2-46 Increased levels of NFκB binding in Pam212 versus SP-1 cells is not TGFβ-1 dependent 113

FIGURE 2-47 NFκB transactivation over a range of TGFβ-1 doses is less robust in Pam 212 SCC cells versus SP-1 papilloma cells 113

FIGURE 2-48 Schematic of proposed mechanisms by which TGFβ-1 mediates NFκB in keratinocytes 117

FIGURE 3-1 UVB-induced TNFα expression in mice is Smad3 dependent 158

FIGURE 3- 2 UVB-induced TNFα expression is Smad3-dependent in mouse keratinocytes 158

FIGURE 3-3 UVB-induced TNFα expression is inhibited pharmacologically by a type I TGFβ-1 receptor antagonist 159

FIGURE 3-4 UVB-induced TNFα expression in mice is mediated by TGFβ-1 signaling 159

FIGURE 3-5 UVB-induced TNFα expression is dependent on TGFβ-1 signaling 160

xii

FIGURE 3-6 Mice wild type and knockout for TGFβ-1 demonstrate no evidence of neutrophil infiltration at 6 h post UVB 160

FIGURE 3-7 UVB-induced TNFα expression is NFκB-dependent 162

FIGURE 3-8 UVB represses Smad7 expression at 2 h, but restoration of Smad7 at 6 h is Smad3- dependent 162

FIGURE 3-9 UVB-induced Smad transactivation is elevated in the presence of exogenous TGFβ-1 163

FIGURE 3-10 UVB treatment resulted in activation of phospho-Smad2, Smad3, but not in IκB degradation 165

FIGURE 3-11 UVB treatment does not result in IκB degradation 167

FIGURE 3-12 UVB treatment of serum starved keratinocytes does not result in translocation of p50 169

FIGURE 3-13 UVB-induced NFκB binding to DNA is TGFβ-1-dependent 170

FIGURE 3-14 UVB-induced NFκB binding to DNA is Smad3 dependent and involves p50 and p65 subunits 171

FIGURE 3-15 UVB does not mediate NFκB or Smad transactivation in a luciferase assay 171

FIGURE 3-16 UVB fails to mediates NFκB transactivation in p53 deficient NHK4 cells 172

FIGURE 4-1 Intact NFκB signaling in keratinocytes is essential for maintaining skin immune homeostasis 188

FIGURE 4-2 Two pools of IκB are degradated at different rates, ensuring homeostasis in the face of diverse stimuli 190

xiii

List of Tables

TABLE 1-1 TGFβ family ligands activate specific TGFβ receptor subtypes and Smads 3

xiv

Abbreviations

AK Actinic keratosis ALK-5 Activin receptor-like kinase 5 ANOVA Analysis of variance Bis Bisindolylmaleimide CAPE Caffeic acid phenethyl ester CKI Cell cycle kinase inhibitor DAG Diacylglycerol DOX Doxycycline EMSA Electrophoretic mobility shift assay GAPDH Glyceraldehyde 3-phosphate dehydrogenase HaCaT Human keratinocyte cell line IκBSR Inhibitor of kappa B super repressor IκK Inhibitor of kappa B kinase IL Interleukin IκB Inhibitor of kappa B MAPK Mitogen activating protein kinase MIP Macrophage inhibitor protein MPO Myeloperoxidase NFκB Nuclear factor kappa B NHEK Normal human epidermal keratinocytes OX 5Z-7-Oxozeanenol PKA Protein kinase A PKC Protein kinase C PKD Protein kinase D RHD Rel homology domain ROS Reactive oxygen species SB SB-431542 SBE Smad binding element SCC Squamous cell carcinoma siRNA Small inhibitor of ribonucleic acid SMAD Homolog of SMA and mothers against decapentaplegic TAD Transactivation domain TAK-1 TGFβ-1 activating kinase TGFβ-1 Transforming growth factor beta-1 TNFα Tumor necrosis factor alpha TPA 12-O-tetradecanoylphorbol-13-acetate TβRI Type I TGFβ-1 receptor TβRII Type II TGFβ-1 receptor UVR Ultraviolet radiation UVA Ultraviolet electromagnetic radiation subtype A UVB Ultraviolet electromagnetic radiation subtype B UVC Ultraviolet electromagnetic radiation subtype C

Acknowledgements

Foremost, I wish to thank my advisor, the incredibly patient Dr. Adam Glick, for seeing me through a project with twists and turns neither of us anticipated. Much to his credit, Dr. Glick hung in there with me in spite of many fits and starts.

And there were many.

The most satisfying ones were self-imposed. There was the spring spent in Woods Hole and a stint in Milwaukee the summer before I defended; there were the conferences I couldn’t resist attending (including the thirty six hour round trip to the West coast in search of an elusive Fulbright); there were numerous grant and fellowship applications that became my advisor’s burden as well.

Admittedly, I was on a bit of a quest—a search for something meaningful: my purpose. Dr. Glick quietly accommodated what were big dreams in the making. A lesser advisor would have clipped this bird’s wings long ago.

I owe a debt of gratitude to my committee members. The committee evolved over the years, with each faculty member contributing in an important way to the final product. Their collective generosity will always serve as a reminder to me to be generous to my own students one day.

I am also indebted to my professors at Rutgers—the place where I cut my scientific teeth. A creative writing major fresh out of forestry school, I was utterly underprepared to enter a graduate program in “hard” science. At Rutgers I crossed over to another world, earning both a masters in toxicology and credit toward a Ph.D. There I received exceptional didactic training in toxicology and learned by example how to be a decent teacher. I grew leather thick skin at Rutgers, which proved just as useful at Penn State.

While at Penn State, I had incredible opportunities to do science and, more importantly, test my mettle as a scientist and learn—through a great deal of trial and error-- just how difficult research can be. Opportunities came mainly in the form of access—access to interesting animal models; an array of reagents I hadn’t previously utilized; and a larger community of cancer researchers thanks to Dr. Glick’s network of former colleagues from the National Cancer Institute. A few who standout include: members of Dr. Glick’s former lab who taught me specialized techniques and collaborated with me willingly; lab mates and fellow graduate students on the Penn State campus who improved upon existing protocols, shared opportunities for collaboration, and provided generous consult; and technical staff who pitched in willingly, often lightening the load and the mood in significant and welcome ways.

I feel special gratitude toward the staff members at the Huck Institute of the Life Sciences and the Center for Molecular Toxicology and Carcinogenesis at Penn State who, on a daily basis,

xvi

make earning a Ph.D. possible. It takes a village to raise a Ph.D. and the support staff I encountered here were truly partners in my education.

I was very fortunate at Penn State to have the opportunity to focus exclusively on my research. This privilege was made possible by generous funding from the National Cancer Institute, Huck Institute of the Life Sciences, Penn State Institutes of Energy and the Environment, the Department of Veterinary and Biomedical Sciences at Penn State, Sigma Xi, American Physiological Society, Burroughs Wellcome Fund, Sahakian Family Travel Fund, and Fred Gellert Family Foundation.

To my State College friends and neighbors who (sometimes quite literally) ran this marathon by my side: some saw me to the finish line; others were there in spirit; some headed for a different horizon, taking another path altogether. Each should know that no act of kindness or show of support was ever forgotten. Because of my friendships, State College (and the lab on campus) became my second home.

I was fortunate to have a family that significantly increased in number while I chipped away at my research. During my years at Rutgers and Penn State I gained three beautiful nieces. What I didn’t anticipate was how profoundly these little girls would inspire me along the way. On the difficult days I told myself: today, you’re doing this so that one day your nieces will see what’s possible for girls. I’m grateful for the family I have: for my sister, my brother-in-law, and their children, and for my parents. My family showed no tell-tale signs of graduate school fatigue. Their encouragement made all the difference.

This dissertation and the many years I spent in the lab are dedicated to the memory of my grandfather, Dr. Cornelius Hogan, a prison dentist at the former Trenton State Prison who maintained a private practice in Burlington, New Jersey. My grandfather’s journey was not unlike my own: his doctorate was earned through sheer persistence. He passed away nearly forty years ago, before we were ever really acquainted. My accomplishment now connects us in a special way. I believe he would have been proud of his very persistent granddaughter.

xvii

“Second Home” by Kelly Hogan

xviii

Chapter 1 Introduction

I TGFβ-1 Signaling

A. Bioactivation of Latent TGFβ-1

The transforming growth factor β (TGFβ) subfamily consists of extracellular multipotent growth factors with a wide range of tissue-specific effects. Best known for its role during development, TGFβ plays an equally important part in mature tissues by maintaining homeostasis. Homeostasis in the skin, in particular, is achieved by tight regulation of cell proliferation and death, adhesion, migration, differentiation, and matrix metabolism. Dysregulated of TGFβ signaling, therefore, has profound consequences to skin integrity, and may result in compromised barrier function or development of skin cancer.

TGFβ isoforms -1, -2, and -3 are highly homologous genes (Oft et al., 1996) secreted as a biologically inactive large latent complex (LLC) consisting of non-covalently bonded latency- associated protein (LAP) and a covalently bonded latent TGFβ binding protein (LTBP) (Figure 1) (Oklu and Hesketh, 2000).

FIGURE 1-1

Structure of latent and bioactive TGFβ-1(Oklu and Hesketh, 2000)

Removal of the LAP/LTBP complex by proteolysis is essential for bioactivation of TGFβ. One hypothesis is that the LLC acts as a cellular sensor, which in turn regulates the proteolytic release of TGFβ (Annes et al., 2003). Bioactivation of TGFβ involves a number of proteases including

MMP-2 and -9 as well as protease-inducing molecules such as thrombospondin, integrins, reactive oxygen species, or changes in tissue pH (Annes et al., 2003). Mutations in components of the LLC leads to complex connective tissue disorders such as Marfans syndrome (Oklu and Hesketh, 2000) and Camurati-Engelmann disease (Annes et al., 2003), whereas dysplastic tissues exibit reduced LTBP. This reduction of LTBP suggests that in addition to maintaining tissue homeostasis, LLC components are important during cancer progression as well. Examples of dysregulation of large latency complex molecules demonstrate how tightly regulated TGFβ must remain. Indeed, inappropriate bioactivation or latency can lead to disrupted tissue homeostasis and progression of skin specific disease.

The TGFβ isoforms include TGFβ-1, -2, and -3 and are differentially expressed in skin both temporally and spatially during embryogenesis (Pelton et al., 1991), tissue repair (Levine et al., 1993), and carcinogenesis (Gold et al., 1994;Gorsch et al., 1992). These differences are also species specific. In human keratinocytes, the TGFβ-1 isoform predominates in differentiated cells whereas TGFβ-2 and -3 are secreted primarily by proliferating keratinocytes (Cho et al., 2004). In mouse, however, growth and differentiation of basal keratinocytes are largely regulated by TGFβ-1 (Glick et al., 1990). Although these isoforms share 71-76% homology, they vary in their receptor recognition and binding affinity. TGFβ-1 and -3 have greater binding affinity for TGFβ type I and II receptors than TGFβ-2 (Cheifetz et al., 1990). These differences have consequences during the progression of cancer. Studies in three dimensional cultures of human skin suggest that TGFβ-2 is upregulated in malignant or invading keratinocytes and that TGFβ-3 is upregulated in the stroma surrounding tumors (Gold et al., 2000). In a two stage model of carcinogenesis in mouse, however, TGFβ-1 and 2 are present in normal skin and in papillomas at low risk for conversion. In high risk papillomas, however, expression of TGFβ-1 and -2 is lost and increased proliferation is observed (Glick et al., 1993a). In spite of species differences in TGFβ localization, both human and mouse models provide evidence that TGFβ-1 and -2 are implicated in tumorigenesis and that certain isoforms appear to have stage-specific roles during cancer progression.

B. TGFβ-1 Receptors

TGFβ receptors are dimers that interact upon ligand binding and form a distinct hetero- tetrameric receptor-ligand complex. The receptors can be broadly divided into two TGFβ receptor classes: Type I receptors and Type II receptors (Table 1) (Goumans and Mummery, 2000;de Caestecker, 2004;Massague, 2008;Massague et al., 2005).

TABLE 1-1

TGFβ family ligands activate specific TGFβ receptor subtypes and Smads (Goumans and Mummery, 2000)

Type I receptors include ALKs 1-7. TβRII is included among Type II receptors TGFβ subfamily encompass the activins, the nodals, and the bone morphogenic proteins (BMPs) as well as TGFβ- 1, -2, and 3. Whereas activins, nodals, and BMPs bind promiscuously to several type I and type 2 TGFβ-1 receptors, TGFβ-1, 2, and 3 bind very specifically to TβRI (also Alk5) and TβRII. Type I (TβRI) and II (TβRII) receptors differ in their affinities for TGFβ with TβRII having the greater affinity. Therefore, with the aid of betaglycan (TβRIII), an accessory receptor that presents TGFβ to TβRII, TGFβ binds to TBRII. Once TGFβ binds to TβRII, the TβRII:TGFβ complex then recruits TβRI (Alk5) (Laiho et al., 1991;Wrana et al., 1994). This assembly has been described metaphorically as ‘a very private embrace’—an analogy that highlights the extent to which TGFβ-1-3 signaling is not only a highly orchestrated, but a highly regulated event (Massague, 2008).

Once TGFβ binds to TβRII and recruits TβRI, the constitutively active TβRII phosphorylates TβR1 on multiple serine and threonine residues in a 30 amino acid protein domain upstream of the catalytic region on the receptor. This domain—known as the GS domain—is a juxtamembrane region rich in glycine and serine residues, which serves both as a structural inhibitor of the kinase domain and a docking site for the transcription factors Smad 2 and 3 (Wieser et al., 1995;ten Dijke P. and Hill, 2004). Phosphorylation of the GS box, however, alleviates this inhibition by: 1) releasing a bound repressor protein called FKBP12 (Huse et al., 1999); and 2) exposing an ATP binding site in the catalytic domain (Zhu and Sizeland, 1999).

What regulates receptor phosphorylation has not been elucidated. Clearly, however, phosphorylation of TβRI by TβRII is far from spurious. The presence of FKBP12 may prevent ligand independent phosphorylation in the event that receptors come within close juxtaposition (Figure 2) (Massague, 1998).

FIGURE 1-2

Structure of TGFβ (TβRI and TβRII) receptor complex (Massague, 1998)

The complexity of the TβRI and II receptor complex, which is unique among membrane bound receptors, may be a mechanism by which TGFβ 1-3 elicits biological effects over a narrow dose range (Groppe et al., 2008). This tightly regulated TGFβ-1 signaling at the level of the receptor may reflect a special adaptation during the natural history of these receptors, which is useful during repair or regulation of the inflammatory response. As organisms required a greater degree of tissue maintenance, TβRI and II may have evolved to regulate more specific functions (Massague, 2008).

C. Smads

The TGFβ family directly activates a family of transcription factors called SMADs. SMADs are unique among transcription factors because they are recruited to the receptor by the SMAD anchor for receptor activation (SARA) protein (Tsukazaki et al., 1998); activated at the cell membrane by TβRI, and immediately translocated to the nucleus . SMADs act in many capacities to regulate TGFβ-1 signaling. They are both transcriptional coactivators and receptor inhibitors and can be divided into three families: receptor-regulated SMADs (1,5,8,2,3); co- Smads (4); and inhibitory SMADs (6,7). Receptor-regulated SMADs (1,5,8,2,3) are phosphorylated by Type I TGFβ receptor subtypes. ALK 1, 2, 3, 6 phosphorylate SMAD 1,5,and 8 and ALK 4 and 5 phosphorylate SMAD 2 and 3 (Table 1) (Goumans and Mummery, 2000). SMADs are differentiated by their structure, which in turn dictates their specific role and function in the TGFβ signaling pathway (Massague, 1998). Structurally, SMADs can be characterized by two conserved domains, MH1 and MH2, which are linked by a linker region (Figure 3) (Massague et al., 2005).

FIGURE 1-3

Major structural domains of the Smads (Massague et al., 2005)

The presence of an MH2 domain in all SMADs permits interaction with the receptor. Once the MH2 domain is phosphorylated by the Type I receptor, the R-SMADs become transcriptionally active and capable of binding co-SMAD 4. The function of the MH1 domain—a β-hairpin--is to bind to DNA. As the MH1 domain of a receptor SMAD approaches a SMAD binding element (SBE) element, the β-hairpin inserts itself into the major groove of DNA and forms hydrogen bonds with three base pairs of the SBE (Shi et al., 1998). Inhibitory SMADs lack the MH-1 domain and therefore do not interact with DNA. Understanding the role of the MH-1 domain in DNA binding is essential to understanding SMAD transcriptional regulation. Prior to receptor activation, however, the MH1 domain of SMADs functions as an autoinhibitor of these transcription factors, thus preventing promiscuous activation of receptor SMADs.

Signaling mediated by TGFβ-1 through the ALK 5 receptor mainly activates SMADs 2 and 3. Although the mechanism for SMAD2 or SMAD3-dependent gene expression is unknown, structural differences in these transcription factors may provide insight into their distinct roles. What differentiates SMAD2 from 3 is the presence of an additional 30 amino acids in the MH1 domain of SMAD2, which prevents SMAD2 from binding directly to DNA (Dennler et al., 1999). However, because SMAD 3 and 4 contain DNA binding capabilities (Zawel et al., 1998), an association between SMAD2 and 4 or SMAD3 and 4 results in a transcriptionally active complexes. The question of stoichiometry among the various SMADs is one of much debate. X-ray crystal structure analysis suggests that receptor SMADs either form a heterodimer ( eg SMAD2-SMAD4) or a heterotrimer (eg SMAD2-SMAD2-SMAD4 or SMAD3- SMAD3-SMAD4) (Wu et al., 2001;Chacko et al., 2004). Studies of transcriptional regulation in vivo demonstrate that the formation of heterodimers or heterotrimers may be dependent on the particular target gene being expressed (Inman and Hill, 2002). To add to this complexity, transactivation domains (TADs) have been identified in both SMAD 3 and 4 suggesting that interactions with other transcription factors, in addition to the SMAD partners involved, is

critical to TGFβ-mediated gene expression (Massague and Wotton, 2000). Therefore, the interaction between the SMADs and other coactivators or corepressors is also likely to influence TGFβ-mediated gene expression (Figure 4) (Massague and Wotton, 2000;Derynck et al., 1998;Prokova et al., 2005;Imoto et al., 2005;Derynck and Zhang, 2003).

FIGURE 1-4

Interactions between Smads and other cofactors or corepressors (Massague and Wotton, 2000)

Although both SMAD2 and 3 are activated when TGFβ-1 binds to the TβRI, differences in SMAD-mediated gene expression have been observed. Microarray analysis of TGFβ-1- treated transformed human keratinocytes (HaCaT) reveals differences in gene expression patterns following inhibition of SMAD2 or SMAD3 or both SMAD 2 and 3 (Kretschmer et al., 2003). Interestingly, in separate studies using gene silencing by RNAi, SMAD3 is shown to have a greater capacity for growth inhibition than SMAD2. In fact, the ratio of SMAD2: SMAD3 may influence gene expression (Kim et al., 2005). To illustrate how structure of each transcription factor influences the specificity of each, a SMAD2-specific MH1 domain prevents protein-protein interactions with certain coactivators, thus further differentiating the function of SMAD2 from that of SMAD3 (Brown et al., 2007). An alternative explanation for differential DNA binding of these transcription factors is that SMAD 3 has greater specificity for GC-rich sequences in the SBE. Clearly, SMAD 2 and 3 do not merely compensate for one another, but rather each has distinct roles in TGFβ-mediated gene expression.

Germline deletions of individual SMADs reveal an obligatory role during development for SMAD2. The absence of SMAD2 is embryonic lethal suggesting a requirement for this transcription facor during development (Waldrip et al., 1998). Whereas knockout of SMAD2 produces a lethal phenotype, this is not the case for SMAD3 knockout mice (Zhu et al., 1998;Datto et al., 1999;Yang et al., 1999). SMAD3 knockouts are smaller, have mild forelimb malformations, and die earlier in life as a result of a compromised immune system. This finding provides some insight into the redundant nature of SMADs in TGFβ signaling. This redundancy

is also noted in skin where targeted knockout of SMADs has surprisingly few consequences. For example, keratinocyte-specific SMAD 2 or 3 knockout mice fail to demonstrate specific phenotypic changes in skin (Owens et al., 2008). For example, over-expression of SMAD2 delays hair growth, but does not appear to produce specific skin pathology. Over-expression of SMAD3 in fibroblast, on the other hand, accelerates wound healing (Sumiyoshi et al., 2004), suggesting a cell-specific role for SMADs. Curiously, whole mouse SMAD 3 knockout models show accelerated wound healing. This points to the possibility that SMAD3 expressed either in fibroblasts, immune cells, or keratinocytes, inhibits wound healing (Ashcroft et al., 1999).

1) Role of SMADS in Skin

Although receptor SMADs appear dispensable in skin development and differentiation, co-SMAD 4 and inhibitory SMAD7 seem to have a more significant role in this tissue (Figure 5) (Owens et al., 2008).

FIGURE 1-5

Role of Smads in skin development and differentiation (Owens et al., 2008)

These molecules are present in high abundance in hair follicles as well as the bulge region where stem cells reside. However, when SMAD 7 is inhibited, terminal differentiation is blocked and hyperproliferation of basal cells is observed (Owens et al., 2008). When SMAD 4 is inhibited in skin, the stoichiometry of SMAD2 and 3 shifts to compensate for the loss of SMAD4 and there is an eventual decline in skin homeostasis that is characterized by hair follicle collapse and tumor formation observed in these knockout mice (Qiao et al., 2006;Yang et al., 2005). Little is known about the role of SMADs 1, 5, and 8 in skin development and differentiation; however, staining

7 for these SMADs is prominent in the interfollicular epidermis and hair follicles suggesting a role for BMP signaling during these processes (Han et al., 2006).

II TGFβ-1 Biology in Skin

A. Structure and Function of Skin

The function of skin is largely dependent on its structural integrity. Skin is composed of multiple strata which are differentiated to varying degrees (Proksch et al., 2008). Considered the “business end” of the epidermis, the statum basale, or basal layer, is composed of proliferative cells adjacent to the basement membrane. Basal keratinocytes rely on growth factors and inhibitors as well as programmed cell death to maintain a 1-2 cell layer that differentiates into the stratum spinosum or suprabasal layer (Figure 6) (Proksch et al., 2008).

FIGURE 1-6

Structure of skin (Proksch et al, 2008)

Growth promoting factors act through their respective receptors to control the cell cycle in keratinocytes and include epidermal growth factor (EGF), fibroblast growth factor (FGF), hepatocytes growth factor (HGF), nerve growth factor (NGF), insulin-like growth factor (IGF),

granulocyte-macrophage colony stimulating factor (GM-CSF), and endothelin-1(ET-1) (Shirakata, 2010). Growth factors are responsible for promoting cell division through the regulation of cyclin-dependent kinases (cdks), which when activated bind to their respective cyclins. Cdk/cyclin complexes are composed of eithercyclin D bound to cdk4/6 or cyclin E or A bound to cdk 2. The role of these complexes is to phoshorylate retinoblastoma proteins including Rb, p107, and p130. In quiescent cells Rb, p107, and p130 are hypophosphorylated and repress E2F transcription factors. Phosphorylation of Rb family proteins by cdk/cyclin complexes results in release of E2F, a transcription factor necessary for G1 to S phase cycle cycle progression.

Cell cycle control of basal keratinocytes, on the other hand, is accomplished by growth inhibitors such as IFN-γ, NFκB, but most significantly by TGFβ-1. Prior to growth inhibition, however, the proliferative potential of basal keratinocytes is maintained by p63, a transcription factor that functions at the interface of proliferation of basal cells and stratification of skin (Lippens et al., 2005). Upon differentiation expression of p63 isoforms is altered. This combined with activation of growth inhibitor transcription factors such as NFκB sets the cell off onto a differentiation pathway.

Growth inhibition occurs when activated cdk/cyclin complexes are inhibited by cyclin dependent kinase inhibitors (CKIs), which prevent hyperphosphorylation of Rb proteins. There are several families of CKIs including the Cip/Kip family (p21, p27, and p57), which bind to cdk4-6/cyclin D and cdk2-cyclin E/A; and the INK4 family (p15, p16, p18, and p19), which bind exclusively to cdk4/6-cyclin D.

Pathological conditions that increase thickening of the basal cell layer provide models of dysfunctional growth regulation. Hyperplastic skin disorders such as psoriasis, lichen planus, mycosis fungoides, and chronic wounds, for example, involve abnormal response to growth factors or insensitivity to growth inhibitors. These hyperplastic keratinocytes exhibit aberrant differentiation programs, as evidenced by a change in keratin composition, increased migratory capability (Gniadecki, 1998), and production of interleukins such as the potent pleiotropic cytokine IL-1(Kupper, 1990;Uchi et al., 2000) and TNFα (Ansel et al., 1990). Keratinocyte- derived cytokines, in turn, recruit inflammatory cells to the skin. The trifecta of hyperproliferation that disrupts normal epidermal cell turnover, increased apoptosis that in turn potentiates proliferation, and chronic inflammation may predispose basal keratinocytes to a transformed phenotype.

Unlike growth arrest, which primes keratinocytes for differentiation and eventual formation of the protective cornified layer, apoptosis is a program of cell death that eliminates a potentially rogue cell through karyorhexis, shrinkage of plasma membranes, and eventual phagocytosis by neighboring keratinocytes or macrophages (Teraki and Shiohara, 1999). Although this process can guard against cell transformation, dysregulation of apoptosis can promote skin diseases such as psoriasis, tumors, and hair loss. Apoptosis occurs in a cell that

has been triggered to self destruct as a consequence of DNA damage that is beyond repair. This process utilizes ‘death receptors’ such as Fas or, under certain conditions, TNFαRI. However, apoptosis is not always ligand-dependent. Ultraviolet radiation, for example, induces apoptosis in skin by clustering death receptors and forming a death inducing signaling complex (DISC) (Lippens et al., 2005;Raj et al., 2006) (Figure 7).

FIGURE 1-7

Mechanisms of apoptosis in the keratinocyte (Raj et al., 2006)

Activation of either pathway leads to the release of mitochondrial proteins such as cytochrome c, which in turn initiates a caspase cascade that includes caspases 3, 7, 8, and 9 (Raj et al., 2006).

Whereas apoptosis suppresses rogue cells which have the potential to expand or negatively impact neighboring cells, terminal differentiatiation involves the transition of proliferating cells to keratin-rich ‘storage cells’ with low metabolic activity, but high barrier function against environmental influences (Lippens et al., 2005). In this way, differentiated cells become ‘functional corpses’ which differ from apoptotic cells in that they contribute to the structure and function of skin (Lippens et al., 2005) by manufacturing keratins, loricrin, flaggrin, involucrin, and SPRR-1. During the course of terminal differentiation, keratinocytes undergo desquamation, become increasingly cornified, reach the surface of skin, and eventually cease to function. At this point in their life cycle, desquamated keratinocytes are shed. Several factors that mediate the switch from proliferation to differentiation have been identified. They include calcium (Dlugosz and Yuspa, 1993;Dlugosz and Yuspa, 1994) , cell shape (Watt et al., 1988), interferonγ (Saunders et al., 1996), retinoic acid, phorbol esters (Toftgard et al., 1985), and integrins (Levy et al., 2000). The barrier quality of skin is a function of protein-protein and protein-lipid cross-links which is a result of terminal differentiation. Structural components

destined to become the cornified envelope include loricrin, involucrin, SPRR-1, filaggrin, and keratin intermediate filaments.

1) TGFβ-1 in Growth Inhibition and Senescence

TGFβ-1 acts in a cell-specific manner; the cytokine is growth promoting in dermal fibroblasts, but growth inhibitory in basal keratinocytes. In keratinocytes, TGFβ-1 often acts in an autocrine fashion to counter the effects of growth promoting factors such as EGF. In this example, EGF increases the expression of TGFβ-1, which in turn exerts control over the cell cycle (Yamasaki et al., 2003). With the exception of development and in some mature tissues, TGFβ-1 is generally considered growth inhibitory. TGFβ-mediated growth arrest occurs in epithelial, endothelial, fibroblast, neuronal, lymphoid, and hematopoietic cell types. Complete cytostasis, however, is observed in lung epithelial cells and in keratinocytes (Laiho et al., 1990;Massague, 2004). In epithelial cells, TGFβ-mediated growth inhibition occurs by several mechanisms involving the regulation of transcription or post-translational modification of cell cycle proteins. CKIs such as p21 and p15 are induced by TGFβ-1, whereas TGFβ-1 represses transcription of growth promoting Myc and Id1 and Id2 (Figure 8) (Massague, 2004;Li et al., 1995).

FIGURE 1-8

Mechanisms of TGFβ-1 growth inhibition (Massague, 2004)

Cumulatively, these genes are part of a TGFβ1-mediated repertoire of gene products charged with cell cycle regulation.

The distinction between growth inhibition and senescence lies in the functional outcome of each: growth inhibition prepares keratinocytes to enter a program of terminal differentiation; whereas senescence reflects an aging cell’s exit from the cell cycle (Gandarillas, 2000).

Keratinocytes transduced with v-Ha ras demonstrate a particularly interesting TGFβ-1-dependent senescence response that may have implications in cancer progression. Cells expressing oncogenic ras show an increase in TGFβ-1. The significance of this observation is unclear; however, these cells eventually undergo TGFβ-1-dependent growth inhibition and senescence (Tremain et al., 2000;Vijayachandra et al., 2003;Vijayachandra et al., 2009). This finding is significant given the observation that v-Ha ras transduced keratinocytes lacking an intact TGFβ-1 signaling pathway form tumors when grafted onto mouse skin (Vijayachandra et al., 2009;Tremain et al., 2000). Therefore, loss of TGFβ-1 and failure of cells to undergo senescence in the context of oncogenic ras may accelerate skin cancer progression.

2) TGFβ-1 in Apoptosis

Mechanistically, little is known about TGFβ-1-mediated apoptosis in epidermal cells. The role of TGFβ-1 in the programmed cell death of keratinocytes is best characterized in models of wound healing. During re-epithelialization of wounds, impaired TGFβ-1 signaling reduces apoptosis and increases the rate of wound healing thus suggesting a role for TGFβ-1 in execution of programmed cell death (Amendt et al., 2002;Ashcroft et al., 1999). In addition, mice with targeted over-expression of TGFβ-1 in skin showed increase apoptosis (Liu et al., 2001). However, most of what is known about TGFβ-1 signaling in apoptosis is focused on in the liver. There, activation of NFκB induces SMAD7, which inhibits TNFα-stimulated apoptosis (Lallemand et al., 2001). Alternatively TGFβ-1 stabilizes IκB in hepatocytes and potentiates apoptosis (Cavin et al., 2003). Clearly,the paucity of data in keratinocytes demonstrates that the role of TGFβ-1 in programmed cell death in keratinocytes requires elucidation. In addition to understanding its role in normal skin development, apoptosis may be an important feature of cancer progression. During two stage carcinogenesis, a greater number of apoptotic cells are observed in papillomas that progress to SCC (Stern et al., 1997); therefore, TGFβ-1-regulated apoptosis may be an important aspect of tumor progression. A likely intersection with respect to apoptosis may involve TGFβ-1 and TNFα, a critical signaling molecule in apoptosis for many cell types.

3) TGFβ-1 in Terminal Differentiation

In mouse keratinocytes, the role of TGFβ-1 in keratinocyte terminal differentiation is controversial. On the one hand, TGFβ-1 suppresses the differentiation program as demonstrated by decreased expression of differentiation markers such as transglutamase type 1 (Dahler et al., 2001) and keratin 1(McDonnell et al., 2001). However, TGFβ-1 activated transcription factors Smad3/4 act in concert with E2F to negatively regulate Myc. Inhibition of Myc, in turn, results in withdrawal from the cell cycle, presumably a first step toward differentiation (Chen et al., 2002). Whether TGFβ-1 directly mediates differentiation is unclear; however, SMADs appear to play an interesting role in differentiation as coactivators with IκKα, which during differentiation has been shown to act as a transcription factor (Descargues et al., 2008c). Together, SMAD2/3 and IκK indirectly repress Myc expression, which in turn causes cell cycle withdrawal. One

carveat, however, is that the absence of SMAD 3 has little effect on skin differentiation, suggesting a redundancy in pathways and factors involved in terminal differentiation. One additional candidate for IκK/Smad-mediated transcriptional regulation may be the Id proteins. When over-expressed in three dimensional skin culture, Ids block normal differentiation (Descargues et al., 2008a;Rotzer et al., 2006). Therefore, the repressive action of TGFβ-1 on Id proteins is likely critical to the differentiation program and the involvement of IκK as a transcriptional repressor is an interesting possibility.

Alteration of the differentiation program of keratinocytes may in fact represent an important step in cancer progression. In the presence of oncogenic ras, TGFβ-1 inhibits expression of transgulatminases (1 and 3) and constituents of the cornified envelop Small proline-rich proteins (1A and 2H) suggesting that inhibition of TGFβ-1 signaling during cancer progression could contribute to preneoplastic outgrowth (Markell et al., 2011). Furthermore, studies deomonstrating inhibition of TGFβ-1 in tumor promoter-treated mouse skin results in an increase in the epidermal growth factor Cripto-1. Cripto-1, in turn, blocks normal differentiation through a mechanism involving TGFβ-1 inhibition (Shukla et al., 2008). Indeed, the role of skin homeostasis cannot be underestimated during execution of the differentiation program in skin.

B. Role of TGFβ-1 in Immune Modulation

Keratinocyte-derived TGFβ-1 is implicated in the modulation of both immune cells and the inflammatory response in skin. During the acute inflammatory response, TGFβ-1 induces the differentiation of monocytes to antigen presenting dendritic cells (Randolph et al., 2002); TGFβ- 1 also attracts CD4+ and CD8+ T cells, neutrophils, monocytes and macrophages, and mast cells (Adams et al., 1991;Wahl et al., 1987;Fan et al., 1992). The importance of TGFβ-1 in chemotaxis is particularly cogent in wounded Smad3 knockout mice, which demonstrate an impaired inflammatory response (Ashcroft et al., 1999). In addition to a role in acute response to a stimulus, TGFβ-1 is also involved in the antigen-specific adaptive immune response involving antigen presentation to memory T cells by Langerhan cells, dendritic cells, or macrophages. In TGFβ-1 knockout mice, maturation and migration of Langerhan cells (Borkowski et al., 1996;Borkowski et al., 1997) and dendritic cells are impaired (Borkowski et al., 1996;Ju et al., 2007;Borkowski et al., 1997;Hemmi et al., 2001), suggesting a role for TGFβ- 1 in antigen presentation and ultimately T cell response.

In contrast to the TGFβ-1 knock-out model which lacks the ability to mount an immune response in skin, skin-targeted over-expression of latent or bioactive TGFβ-1 reveals a psoriatic phenotype characterized by a Th1-type cytokine profile resulting in a pro-inflammatory and hyperplastic response in skin (Li et al., 2004b;Li et al., 2005). That TGFβ-1 fails to resolve chronic inflammation in TGFβ-1 over-expression models may be due in part to the presence of TGFβ-1 producing CD4+CD25+ T cells that secrete IL-17 and recruit additional inflammatory cells to the skin (Veldhoen and Stockinger, 2006;Mangan et al., 2006). T cells with a Th17

phenotype do not express inhibitory Smad 7, suggesting that, in the context of TGFβ-1 over- expression, they may be resistant to the immunosuppressive effects of TGFβ-1 (Veldhoen and Stockinger, 2006). Furthermore, epidermal hyperplasia observed in this model is likely the result of mitogens secreted from fibroblasts and inflammatory cells, which in turn induce growth in keratinocytes (Li et al., 2004b). This paradoxical regulation of the immune response by TGFβ-1 is dependent on cell type, state of differentiation, and predominating cytokine profile (Sporn and Roberts, 1992;Wahl, 1994;Letterio and Roberts, 1998). Thus, in addition to controlling growth of keratinocytes, the presence of keratinocyte-derived TGFβ-1 is critical to establishing innate and acquired immunity in skin as well as initiating and resolving inflammation.

C. Role of TGFβ-1 and SMADS in Carcinogenesis

Squamous cell carcinoma (SCC), the most aggressive form of skin cancer arises from epidermal basal cells which have been exposed to chronic ultraviolet radiation and incurred DNA damage. Formation of actinic keratosis (AK) in skin is considered the precursor to SCC and is a key event in the natural history of SCC formation (Rossi et al., 2007). Histologically, AKs are in situ intraepithelial neoplasms which in some instances progress to a metastatic phenotype (Yantsos et al., 1999;Del Bino S. et al., 2004). Therefore, AK are markers of increased skin cancer risk. The skin has provided cancer biologists with an important canvas upon which to explore the multistage nature of cancer progression. Although the behavior of TGFβ-1 is often context-dependent, mouse models of SCC progression have also provided a great deal of insight into the role of TGFβ-1 during the progression of epithelial cancers.

In a mouse model of chemical carcinogenesis resulting in activation of oncogenic Ha-ras, loss of TGFβ-1 function resulted in higher risk of malignant conversion in a certain population of papillomas (Glick et al., 1993b). In this particular population, increased proliferation and mutations giving rise to chromosomal instability were observed. Conversely, papillomas at low risk for conversion expressed functional TGFβ-1 in basal keratinocytes. During skin cancer progression, TGFβ-1 also induces epithelial-mesenchymal transition, which results in a dedifferentiated phenotype of the epithelium (Cui et al., 1996). Induction of the TGFβ-1 transgenic mouse skin that is both initiated and promoted results in papillomas rapidly converting to metastatic carcinomas, in part by increased expression of matrix metalloproteinase (Weeks et al., 2001). When an alternate approach was taken and a dominant negative type II TGFβ-1 receptor was expressed in mouse skin lacking TGFβ-1 responsiveness, an increased number of carcinomas was observed along with more rapid tumor progression (Amendt et al., 2002). Furthermore, the growth inhibitory function of TGFβ-1 was lost in tumors in the skin-specific TGFβ-1 over-expression model. During chemically induced carcinogenesis, SMADs 1-5 are lost post-transcription and SMAD 7 is upregulated, thus implicated SMADs as well in TGFβ-1-mediated cancer progression (He et al., 2001).

Studies in mice lacking SMAD3 are contradictory. Whereas loss of SMAD3 is shown to accelerate malignant progression in adult mice by reducing the senescence response and

permiting cells to exit the cell cycle (Vijayachandra et al., 2003), other studies in SMAD3 null pups show resistance to chemical carcinogenesis (Li et al., 2004a). The later finding may be a consequence of the morphology of neonatal mouse skin, which, like human skin, has a thicker proliferative layer. Indeed, in studies comparing SMAD 2 and 3 heterozyotes with chemically induced tumors, SMAD3 heterozygotes exhibited greater resistance to neoplasms than SMAD2, which therefore appeared to serve a tumor suppressor function (Tannehill-Gregg et al., 2004). When TGFβ-1 exists at physiological concentrations, CDK phosphorylation of the SMADs (at CDK-specific phosphorylation sites on the protein) inhibits the transcription factor, allowing progression of the cell cycle. In the context of cancer, however, a high level of CDK occurs, persistent SMAD inactivation results, and cells become resistant to TGFβ-1 inhibition (Matsuura et al., 2004).

Taken together, studies performed in mouse models of carcinogenesis demonstrate a definitive role for TGFβ-1 that appears to be stage specific and context dependent. The switch from tumor suppressor to oncogene during tumor progression is a consequence of both resistance to TGFβ-1 and overproduction of the cytokine in the tumor environment (Glick, 2004). If inactivation of TGFβ-1 signaling occurs early in tumor development and resistance to TGFβ-1 occurs late in tumor progression, unregulated growth and metastasis can occur respectively.

1) TGFβ-1 and Ras in Cancer Progression

As some of the studies described herein show, the growth inhibitory action of TGFβ-1 is highly context-dependent. The presence of oncogenic ras—a hallmark of about 30% of cancers—is a factor that probably most influences the behavior of TGFβ-1 (Schubbert et al., 2007). The relationship between oncogenic ras and TGFβ-1 signaling, therefore, is viewed as an important intersection in cancer biology. Identified initially in 1979 by Robert Weinberg in NIH-3T3 cells, what would become known as a mutation of ras was then recognized as a series of Alu repeats responsible for transformation of cells (Shih et al., 1979). Four highly homologous isoforms of ras have been identified and include Hras, NRas, KRas4A, and Kras4B. Ras mutations occur by amino acid substitution at position glycine 12, glycine 13, and glutamate 61 (Schubbert et al., 2007). By 1982, mutations of ras were identified in human cancers (Malumbres and Barbacid, 2003). Later mechanistic studies revealed Ras proteins are GTPases requiring binding to GTP (Gibbs et al., 1984) with structural homology to G proteins (Hurley et al., 1984) and a propensity to be activated by mitogens (Mulcahy et al., 1985). The ability of ras to be activated by mitogens (Kato et al., 1992) is tied to its membrane association by farnesyl transferases (Prendergast et al., 1994) or geranylgeranyl transferases (Cox et al., 1992). The enzymes link ras protein to the cell membrane by a carbon fatty acid chain in a process called prenylation. Activation of ras involves several upstream signaling molecules that connect it with tyrosine kinase receptors such as the EGF receptor (Lowenstein et al., 1992). Downstream ras effectors are numerous and have a varied array of biological consequences including increased transcription, translation, cell-cycle progression, apoptosis, and cell survival (Figure 9) (Malumbres and Barbacid, 2003).

FIGURE 1-9

Involvement of ras in cellular crosstalk (Malumbres and Barbacid, 2003)

Furthermore, ras activation impinges on signaling pathways involving molecules ranging from MAPK to PI3K to PLC to PKC (Malumbres and Barbacid, 2003).

Of the most relevant ras-activated effectors influencing TGFβ-1 signaling are the mitogen activated protein kinases (MAPK), which include ERK, p38, and JNK (Javelaud and Mauviel, 2005). In various tissues, crosstalk between TGFβ-1 and MAPK is evident. In mammary epithelium, the interaction of Ha-ras and TGFβ-1 results in epithelia-mesenchymal transition and thus greater invasiveness (Oft et al., 1996;Janda et al., 2002). Curiously, there are at least four other sites in the SMAD activation domain which can be phosphorylated by kinases such as p38 MAPK (Kretzschmar et al., 1999), ERK (Hayashida et al., 2003), Rho-associated kinase , and cyclin-dependent kinase, thus TGFβ-1 os potentially connects to numerous pathways. SMAD3 plays a critical role in TGFβ-1 signaling in the context of ras activation to an array of other pathways. In keratinocytes, mutations of Ha ras are most frequent and result in an early increase of PKCα activity (Yuspa et al., 1994), hyperproliferation, growth arrest, and senescence (Tremain et al., 2000). Ras-induced senescence appears to require SMAD 3 (Vijayachandra et al., 2003;Bae et al., 2009). Furthermore, SMAD3 deficiency in v-ras-induced fibroblasts results in inhibition of farnesyl transferase, which is necessary for ras interaction at the cell membrane (Arany et al., 2007). In skin, progression of benign tumors to invasive carcinoma leading to epithelial-mesenchymal transition in vivo requires TGFβ-1 (Cui et al., 1996). Taken together, the studies described here establish a firm link between TGFβ-1 and ras, which appears to play a substantial role during cancer progression.

2) TGFβ-1 in Tumor Immunology and Inflammation

What is not understood entirely are the factors that converge in the tumor microenvironment during the course of cancer progression. Increasingly, immune cells are emerging as an important component of cancer progression. Indeed, unresolved chronic inflammation has tumor promoting effects (de Visser et al., 2006;Coussens and Werb, 2002). In conditions of chronic skin inflammation, such as in psoriasis, blockade of TGFβ-1 signaling results in unopposed inflammation. Although psoriasis does not lead to formation of SCC, this observation demonstrates a critical role for TGFβ-1 in the resolution of inflammation (Flisiak et al., 2002;Doi et al., 2003;Flisiak et al., 2003). In other instances of chronic inflammation such as ulcers, lupus erthematosus, lichen planus and epidermolysis bullosa, an increased risk of SCC has been documented (Kaplan, 1987;Mayron et al., 1988;Mallipeddi et al., 2004). Thus, the inflammatory microenvironment coupled with dysregulation of the TGFβ-1 pathway is fertile soil for the development and progression of SCCs (Glick et al., 2008).

The two stage mouse model of carcinogenesis provides one such context to explore the intersection of TGFβ-1 and inflammation in cancer progression. In this model, TPA-induced inflammation promotes the metastatic conversion of a portion of tumors through activation of protein kinase C and downstream transcription factors AP-1 and NFκB (Cataisson et al., 2003). AP-1 and NFκB, in turn, induce pro-inflammatory cytokines such as TNFα resulting in infiltration of inflammatory cells. Increasingly epithelial cells are implicated in the recruitment of inflammatory cells and the regulation of the inflammatory milleu (Pasparakis, 2009). This is observed in TGFβ-1 wild type versus heterozygous mice treated with the tumor promoter TPA. Compared to TGFβ-1 heterozygous mice, TGFβ-1 wild type mice treated with TPA demonstrate increased skin proliferation, papilloma formation, and infilitration of immune cells into tumors suggesting that TGFβ-1 signaling can be modified by a pro-inflammatory environment (Perez- Lorenzo et al., 2010).

Adaptive immune cells in skin may also contribute to inflammation observed in TGFβ-1 over-expression models. TGFβ-1 increases Th17 secreting CD4+ and gamma-delta + T cells which are observed in the pre-malignant tumor microenvironment (Mohammed et al., 2010). An increase in Th17 secreting cells results in an increase in proinflammatory cytokines such as TNFα, which sustains a proinflammatory environment. Curiously, Th17 cells lack Smad 7 and are therefore resistant to TGFβ-1 suppression (Veldhoen and Stockinger, 2006) This suggests that, in addition to regulating innate immune cells, TGFβ-1 also controls certain cells of the adaptive immune system, thus contributing to the complexity underlying SCC progression. In addition to influencing T cells in a pro-inflammatory environment, tumor-induced TGFβ-1 may alter naïve T cell phenotype such that they express FoxP3 and become T regulatory cells (Tregs). Tregs, in turn, suppress antigen presenting cells in the skin and thus inhibit the presentation of tumor antigens (Liu et al., 2007). NK cells have also been shown in skin to mediate tumor surveillance. Mice lacking NKG2D receptors, which stimulate innate immune responses, are more susceptible to chemically-induced tumors (Smyth et al., 2005) and TGFβ-1 downregulates

these receptors in some cancers (Castriconi et al., 2003). Whether or not TGFβ-1-altered immune surveillance is relevant during SCC progression is still being explored.

III NFκB Signaling

The regulation of homeostasis is critical to the ability of cells or tissues to respond appropriately to changes in their environment. Injurious environmental stimuli, in particular, require a response that is prompt but capable of being resolved just as quickly. The immune response is one such mechanism by which tissues can address an injury, a pathogen, or an exposure and then regain homeostasis. The discovery of nuclear factor κB as an important trigger in immune system activation was a breakthrough in many ways (Sen and Baltimore, 1986). This finding represents the identification of a rapid response transcription factor capable of activating both B and T cells. Identified recently in the horseshoe crab, this ancient protein appears to regulate the expression of immune-related genes in lower invertebrates as well (Wang et al., 2006), suggesting a fundamental role for NFκB not only in maintaining cellular and tissue homeostasis, but in an organism’s survival.

A. Canonical NFκB pathway

In mammals, the NFκB family of transcription factors consists of five members: RELA (p65), REL (c-REL), RELB, p50, and p52. Each subunit contains a Rel homology domain (RHD) which is responsible for: 1) dimerization of subunits to one another or to the inhibitory IκB; 2) targeting NFκB to the nucleus; and 3) binding of dimers to degenerate NFκB consensus site. The multiple functions of RHDs can be attributed to two immunoglobulin-like domains that simultaneously dimerize a partner protein and recognize the consensus DNA binding site. Dimerization of subunits is dictated by the presence or absence of a C-terminal transcription activator domain (TAD). Therefore, subunits lacking a TAD, such as p50 and p52, must rely on interaction with p65, cREL, or RELB to induce NFκB-dependent gene expression (Figure 10) (Vallabhapurapu and Karin, 2009).

FIGURE 1-10

Structural domains of NFκB subunits (Vallabhapurapu and Karin, 2009)

Interactions between NFκB subunits are dictated by small differences in dimer topology as well as residues that are exposed at the surface of dimers (Hoffmann et al., 2006). Of the 15 possible dimer combinations, 12 are capable of binding to DNA and regulating transcription (Figure 11) (Hoffmann et al., 2006).

FIGURE 1-11

Possible dimers formed by NFκB subunits (Hoffman et al., 2006)

Theoretically, all dimer combinations are possible, with the exception of RELB, which necessarily must form a heterodimer (Fusco et al., 2008). However, not all binding possibilities are equally probable. Binding affinities between subunits make some combinations more likely than others (Hoffmann et al., 2006). In general, RELB preferentially dimerizes with p50 or p52 and heterodimers typically form among p65, cREL, and p50 (Solan et al., 2002). Homodimers of p50 compete with heterodimers to achieve their repressive effects, but in fact have significantly lower affinity for κB binding sites than NFκB heterodimers (Phelps et al., 2000). It is therefore necessary for p50 homodimers to recruit corepressors such as histone deacetylases (HDACs) to assure stability of the homodimer.

The activation of NFκB subunits occurs by the canonical pathway as well as by various noncanonical pathways. The classical NFκ B pathway begins with activation of the TNFα receptor, a prototypic member of the trimeric cytokine family charged with responding to environmental stimuli such as injury, exposure to ultraviolet light, or pathogens. Activation of TNFα results in the recruitment of combinations of TRADDs, TRAFs, and RIP-1, which in turn phosphorylate inhibitor of κB kinase (IκK). IκK is composed of three subunits including catalytic subunits IκKα and IκKβ and a regulatory subunit IκKγ/NEMO (Figure 12) (Karin and Ben-Neriah, 2000a).

FIGURE 1-12

Structure of IκK (Karin and Ben-Neriah, 2000a)

IκK subunits are characterized in terms of their upstream activators. IκKβ is activated by TNα, IL-1, LPS, and dsRNA. IκKα, on the other hand, is activated by RANKL, BAFF, LTβR and results in activation of the noon-canonical NFκB-inducing kinase (NIK). Signaling through non- canonical NFκB pathways usually activate one or both subunits of IκK (Figure 13) (Sun, 2011).

FIGURE 1- 13

Canonical versus non- canonical NFκB signaling pathways (Sun, 2011)

Activation of IκKs occurs by phosphorylated in the activation loop at Ser 176 and 180 on IκKα and on IκKβ at Ser 177 (Mercurio et al., 1997). Once activated, IκK autophosphorylates its C- terminal region, which in turn decreases its activity (Figure 14) (Karin and Ben-Neriah, 2000b). Alternatively, phosphorylation of other residues of IκK such as Threonine 23 in IκKα represents activation by non-canonical mechanisms (Tai et al., 2009). The IκK complex consist of homo- or heterodimers of IκKα/β, which directly phosphorylate serine residues of IκB (Zandi et al., 1998).

The downstream target of IκK is the inhibitor of κB (IκB), which is phosphorylated on serine 32 and 36. The IκB family includes IκBα, IκBβ, IκBγ, IκBε, IκBζ, and BCL-3 as well as precursors to p50 (p105) and p52 (p100). Each exhibits a different time course of degradation In addition, IκBα and IκBβ contain COOH-terminal region PEST sequences, which contribute to their rapid degradation (Rechsteiner and Rogers, 1996). IκBα can shuttle between the cytoplasm and the nucleus because it contains both a nuclear localization sequence and a nuclear export signal. This allows IκB to regulate nuclear NFκB; however, the biological significance of IκB action in the nucleus is unclear (Ghosh and Karin, 2002).

Certain NFκB subunits, such as p50 and p52, do not contain RHDs. Rather, they are transcribed as the precursor proteins p105 and p100, which contain endoproteolytic cleavage site (Ghosh et al., 1990;Mercurio et al., 1993) and require additional ATP-dependent processing in the proteosome during activation (Fan and Maniatis, 1991). In contrast, the release of other subunit pairs requires IκK-mediated phosphorylation of IκB at serines 32 and 36. NFκB binding stabilizes IκB and thus the bound form of IκB is more susceptible to phosphorylation by IκK

(Mathes et al., 2008). Activation of IκB by IκK results in the targeting of these proteins for polyubiquitination at lysines 21 and 22 (Figure 14) (Yaron et al., 1998) by the Ubc5/E2RS enzyme pair (Palombella et al., 1994).

FIGURE 1-14

Protein structure of IκB (Yaron et al., 1998)

Once IκB is degradation by the 26S proteosome and NFκB nuclear localization sequence (NLS) are exposed, NFκB dimers can then translocate to the nucleus where they can in turn induce the expression of IκBα. IκB, therefore, is considered the master regulator of NFκB not only in the cytoplasm, but also in the nucleus. Nuclear IκBα, IκBζ, and BCL-3 bind to NFκB dimers and either repress or sustain transcription of NFκB-inducible genes and this depends on the expression levels and phosphorylation status of the IκBs (Bates and Miyamoto, 2004). With the exception of IκBβ, IκB family members contain an N-terminal nuclear export sequence (N-NES) (Huang et al., 2000) and therefore have a wider array of mechanisms by which they regulate NFκB.

B. NFκB Transactivation

What makes NFκB a remarkable transcription factor is the sheer number and diversity of genes it regulates. NFκB is a capable of responding quickly to a changing cellular environment (Hoffmann et al., 2006). Formation of subunit dimers is the basis of NFκB mediated gene expression. These dimers bind to 10 base pair consensus sites interspersed along promoter regions of a vast number of genes modulating a range of biological processes as diverse as inflammation, growth and growth inhibition, apoptosis, and cell survival. Dimer formation is the basis for this transcriptional specificity. Three mechanisms seem to govern dimer formation and selectivity of those dimers for certain promoters: 1) amino acid side chains at the dimer

interface; 2) amino acid sequences within the RHD, but outside the dimer interface; and 3) the affinity of IκB for dimer pairs (Hoffmann et al., 2006). This third mechanism suggests that IκB may have a stronger affinity for some dimer pairs or, alternatively, that the abundance of IκB may dictate the availability of particular dimer (Phelps et al., 2000).

Specificity of NFκB-dependent transcription depends on recognition of degenerate NFκB consensus sites on DNA. NFκB consensus sites, collectively known as κB sites, have the sequence 5’-GGGRN W YYCC-3”, where R is a purine base, N is any base, W is an adenine or thymine, and Y is a pyrimidine base (Sen and Baltimore, 1986;Chen and Ghosh, 1999). X-ray chrystalography reveals that dimers have preferences for different parts of the consensus site. For example, p50 or p52 subunits bind to the half-site 5’-GGGRN-3’ and RelA, c-REl, or RelB subunits bind to the 5’-YYCC-3’ half site. Heterodimers containing a REL-A, c-REL , RELB, p50, or p52 subunit are more likely to bind a 10 base pair site containing two five base pair half sites. Homodimers have different binding preferences: p50 or p52 homodimers bind an 11 base pair site composed of two five base pair half sites separated by an A-T base pair. RELA or c- REL homodimers bind a 9 base pair site containing two four base pair half sites (Chen and Ghosh, 1999). To summarize these protein-DNA interactions, dimers have preferences for half sites, but dimer pairs often permit higher affinity binding (Hoffmann et al., 2006). Although binding affinity is an important component of transcriptional specificity, it does not predict expression of a particular NFκB regulated gene because gene expression is contextual, often involving a constellation of coactivators that modulate the kinetics of NFκB binding to DNA (Nelson et al., 2002) as well as chromatin states that allow interaction between distal and proximal enhancers (Teferedegne et al., 2006). Indeed, as these scenarios illustrate, DNA binding is essential for NFκB-mediated transcription, but not sufficient.

IV Role of NFκB in Skin Homeostasis

NFκB is a well characterized transcription factor in lymphocytes and other non-epithelial cell types where it is critical for the survival of a cell exposured to environmental stimuli or pathogens. In most cell types, NFκB regulates expression of genes that activate the cellular stress response, increase cellular proliferation, and inhibit apoptosis (Verma et al., 1995;Baeuerle and Baltimore, 1996;Gerondakis et al., 1998). The role of NFκB in skin shares one similiarity with other cell types: NFκB protects keratinocytes from premature death by inducing the expresson of anti-apoptotic genes (Qin et al., 1999a;Seitz et al., 2000c;Fisher et al., 1996). Quite unlike most cell types, however, activation of NFκB in keratinocytes results in growth arrest which in turn primes basal cells to exit the cell cycle and embark on a differentiation program (Kaufman and Fuchs, 2000). Aside from its role in circumventing apoptosis and affecting growth arrest, NFκB also maintains immune homeostasis in epithelial tissues. Whereas activation of NFκB induces inflammation and tissue damage, inhibition of NFκB can also trigger inflammation and disease. These paradoxical responses can be observed in the epithelia of the intestine and in skin, both of which must sense and respond to microbes, mechanical and

23 chemical stressors, and in the case of skin, ultraviolet radiation (Wullaert et al., 2011). Although the role of immune cells in skin disease has been extensively studied, the contribution of keratinocytes to immune homeostasis is less well-elucidated. Increasingly, the role of keratinocytes has been expanded to regulating the skin-immune system interface.

A. Role of NFκB in Growth Inhibition and Senescence in Skin

Not unlike lymphoid tissues, epithelial tissues, whose primary function is to line and cover, must too respond to changing environmental stimuli and they do so by maintaining a balance between proliferating cells and terminally differentiated cells. The role of NFκB in epithelial tissues like the epidermis, therefore, is to mediate growth arrest in dividing basal keratinocytes so that these cells may begin an upward migration and differentiation (Figure 15) (Kaufman and Fuchs, 2000).

FIGURE 1-15

Role of NFκB in differentiation (Kaufman and Fuchs, 2000)

NFκB localization seems to be partially involved in the execution of the differentiation pathway; however, translocation of NFκB is not essential. In proliferating basal cells, NFκB is exlusively

24 cytoplasmic. As cells begin to differentiation, which is likely the result of p63 activation, a requirement for growth inhibition, NFκB translocates to the nucleus (Seitz et al., 1998c). During the early stages of differentiation, NFκB mediates the expression of antiapoptotic genes and therefore plays a role in cell survival as during differentiation. However, whereas p63 is essential for stratification and differentiation of the basal layer (Lippens et al., 2005), NFκB is not required during differentiation. Indeed the pharmacologic inhibitor pyrrolidine dithiocarbamate (PDTC) or the genetic blockade of IκB inhibited nuclear translocation of NFκB and increased DNA synthesis in basal cells (Seitz et al., 1998b). These studies seem to suggest that growth arrest is a function of activation of NFκB heterodimers rather than the transcriptionally repressive homodimers, but these functions in keratinocytes are likely redundant. The mechanism of NFκB-mediated growth inhibition in basal keratinocytes appears to involve the induction of the CKI p21. Although other CKIs (p27, p57, p15, p16, p18, and p19) remain unaffected by NFκB, over-expression of p65 and p50 subunits in p21 knockout mice show only partial reversal of the hyperplastic phenotype typical of p21 knockout mouse skin (Seitz et al., 2000a). This suggests that, in addition to p21, other factors may be required for complete growth inhibition by NFκB in the epidermis. Therefore, NFκB is not obligatory during differentiation and is, in fact, likely one of a number of redundant factors involved in differentiation.

In addition to growth inhibition, NFκB is implicated in senescence of keratinocytes. Senescence reflects a quiescent stage in the cell cycle in which keratinocytes are blocked from proliferating, resistant to apoptosis, and characterized by shortened telomeres, a marker of cellular aging (Gandarillas, 2000) or cumulative oxidative damage (Lundberg et al., 2000). Over-expression of the NFκB subunits RELA (p65) and p50 (Seitz et al., 2000a), and cREL (Bernard et al., 2004) induces senescence in normal human keratinocytes as demonstrated by the appearance of the SA-β-Gal senescence marker. Factors that allow cells to evade senescence and develop a transformed phenotype are considered oncogenic. In skin, the role of NFκB in senescence would suggest that this transcription factor is a tumor suppressor (Bernard et al., 2004;Gosselin and Abbadie, 2003).

B. Role of NFκB in Terminal Differentiation

In differentiated keratinocytes, NFκB is restricted to the nucleus (Seitz et al., 1998a). This suggests that NFκB or associated NFκB signaling molecules play at least a partial role in the differentiation program of keratinocytes (Dotto, 1999). Disruption of NFκB signaling in basal cells thwarts the differentiation program in keratinocytes and results in hyperplasia in models of NFκB inhibition and hypoplasia if NFκB is overexpressed (Seitz et al., 1998c). NFκB, therefore, is likely one of many redundant factors that signals growth arrest in basal cells prior to differentiation. An upstream NFκB signaling molecule, IκK, has emerged more recently as a major player in the differentiation of keratinocytes. Enhanced IκKα expression increases terminal differentiation in human keratinocytes through a mechanism involving e-cadherin, a

protein that forms the adherens junctions in epidermis and which is critical during differentiation (Moreno-Maldonado et al., 2008). Conversely, skin targeted IκKα knockout mice have a highly proliferative, undifferentiated epidermis lacking a granular layer or a statum corneum, the uppermost layers of differentiated cells in skin (Hu et al., 1999;Hu et al., 2001). The mechanism of IκK action during differentiation is quite unexpected, however. In addition to serving as a kinase, IκK has also been identified as a transcription factor which translocates to the nucleus independent of its kinase activity. Once in the nucleus, IκK functions as a cofactor in a SMAD4- independent SMAD2/3 signaling pathway that controls cell cycle withdrawal during keratinocyte terminal differentiation (Descargues et al., 2008b;Descargues et al., 2008a). Specfically, IκKα and Smad2/3 together induces Ma-1 and Ovol-1 activity, which in turn inhibit Myc. Inhibition of Myc results in exit from the cell cycle and a shift to the differentiation program. This pathway is redundant in that E2F and Smad2/3 inhibit Myc as well. Clearly, much like TGFβ-1, the central role of NFκB in terminal differentiation is growth arrest, a critical first step in the transition from proliferating cell to differentiating cell.

C. Role of NFκB in Apoptosis

Much debate has centered around whether senescence, differentiation, and apoptosis share common pathways. What each has in common is suppression of proliferation, a requirement that can be met by NFκB. Although the actions of NFκB are cell specific, the transcription factor in a vast majority of cell types, including keratinocytes, inhibits apoptosis and protects the cell from premature death. Under normal conditions, NFκB induces the expression of anti-apoptotic factors including TRAF1, TRAF2, c-IAP1, and c-IAP2 and this expression can be accentuated or inhibited by over-expresssing or inhibition of NFκB, respectively (Seitz et al., 2000c). In mice with skin targeted over-expression of an IκB super repressor, premature, spontaneous apoptosis is observed (Seitz et al., 2000c) suggesting that this role for NFκB in skin is consistent with its role in other tissues.

How NFκB regulates apoptosis in keratinocytes is largely context dependent. For example, in the presence of pro-inflammatory or tumorigenic stimuli, keratinocytes become resistant to apoptosis (Qin et al., 1999b). Conversely, inhibition of NFκB in cells treated with TPA and IFNγ results in a greater susceptibility to apoptosis (Qin et al., 2001). Not unexpectedly, psoriatic skin which has characteristically high levels of secreted TNFα, is also resistant to apoptosis (Bonifati and Ameglio, 1999). These apoptosis resistant models also exhibit hyperproliferation, reflecting an imbalance of apoptosis and proliferation in the context of stimuli that disrupt skin homeostasis. The pro-inflammatory cytokine TNFα, in particular, can be especially vexing to keratinocytes lacking intact NFκB signaling. Capable of both activating the death pathway and protecting the cell from apoptosis, TNFα signaling events must be carefully managed by the keratinocyte (Natoli et al., 1998). Mathematical models of IκK activity predict that the kinase responds to a wide range of TNFα doses, peaks in its response quickly, but also maintains a mechanism for rapid downregulation of the kinase (Cheong et al., 2006). This model suggests that IκK is a cellular sentry of sorts, charged with balancing survival signals with

death signals. When, IκB is blocked in mouse skin, premature and spontaneous cell death results and this is preceded by unopposed TNFα signaling (Seitz et al., 2000b;Van Antwerp et al., 1996). Therefore, the role of NFκB in skin, in addition to growth arrest is to protect the cell from premature death resulting from various stimuli. But in the absence of intact NFκB signaling, the cell death program is activated and disruption of homeostasis in skin ensues.

D. Role of NFκB in Immune Modulation of Skin

The role of NFκB in skin morphogenesis and in homeostasis has received considerable interest in the last decade. What has emerged more recently, however, is the dual function NFκB plays in the activation and the inhibition of inflammation that has been described as ‘the two faces’ of NFκB (Sur et al., 2008). Several mouse models depict a paradoxical link between activation of NFκB in skin and a severe immune response (Sur et al., 2008).

Mice lacking functional IκB fail to sequester NFκB subunits in the cytoplasm and develop severe multi-organ inflammation, immune infiltration, and hyperplasia in skin (Beg et al., 1995;Klement et al., 1996). In mouse skin where IκB has been knocked out in proliferating basal cells, inflammation and increased expression of TNFα is observed followed by progression to SCC (van Hogerlinden M. et al., 2004). Skin inflammation in these animals is resolved when they are crossed onto a Rag2 knockout background, suggesting that T or B lymphocytes are critical components of the inflammatory phenotype (Rebholz et al., 2007). Complete ablation of p65 in the skin targeted IκB knockout also reverses inflammation, although a targeted p65 knockout alone is insufficient to produce the inflammatory phenotype (Rebholz et al., 2007). This suggests that the NFκB subunits have some redundancy and, indeed, a RELA (p65)/c-REL double deficient epidermis is in fact inflamed (Rebholz et al., 2007). Conversely, in skin targeted IκB over-expressing mice, where NFκB subunits are restricted to the cytoplasm, the skin exhibits hyperplasia, and macrophages, a major source of TNFα, infiltrate into the skin (Ulvmar et al., 2009). Indeed, IκB over-expression results in an inflammatory phenotype. In mouse skin expressing a degradation-resistant IκB super repressor (IκBSR), where NFκB subunits are also restricted to the cytoplasm, inflammation also ensues and mice develop spontaneous SCCs (van Hogerlinden M. et al., 1999). Taken together, in vivo models of IκB disruption, resulting in either unfettered NFκB subunit translocation or perpetual sequestration of subunits in the cytoplasm, both cause an inflammatory phenotype leading to SCC.

Not unlike alteration of IκB function, disruption of IκK also contributes to an inflammatory phenotype. Although mice lacking the IκKα subunit die at birth as a consequence structurally incompetent skin, mice lacking other IκK subunits exhibit an inflammatory phenotype that suggests a role for NFκB that extends beyond growth inhibition. A deficiency in NEMO (IκKγ) is observed in the X-linked genetic disorder Incontinentia Pigmenti, which is characterized by hyperplasia, hyperpigmentation of skin, and inflammation. Targeted NEMO knockout mice bred onto a Rag-1 knockout background show no resolution of inflammation suggesting no involvement of lymphocytes in this phenotype (Nenci et al., 2006). Crossing

NEMO-deficient mice with TNFR1-deficient mice, however, prevents an inflammatory phenotype in younger mice suggesting a TNFR-1-dependent mechanism. Eventually, however, an inflammatory phenotype emerges as this model ages, which is likely the result of a TNFR-1- independent mechanism. Keratinocytes with a targeted ablation of TGFβ-1 inducing kinase-1 (TAK-1), which is critical in both NFκB and MAPK signaling through IκK, results in a NEMO- like phenotype whereby skin is hyperkeratotic, hyperproliferative, and has an increased incidence of apoptotic cells and intraepidermal granulocyte microabscesses (Omori et al., 2006;Sayama et al., 2006). This phenotype as well can be reversed by crossing skin specific TAK-1 knockout mice with TNFR-1 knockout mice.

In several respects skin targeted IκKβ ablation resembles the phenotype of skin targeted NEMO knockouts: both exhibit epidermal hyperplasia, thickening of the epidermis, and the presence of granulocyte abscesses (Pasparakis et al., 2006). In contrast to NEMO knockouts, IκKβ knockouts exhibit neither hyperpigmentation nor increased apoptosis suggesting specific roles for IκKs. One difference between these phenotypes may lie in the relative contribution of immune cells to the inflammation observed. Whereas lymphocytes are involved in the NEMO knockout phenotype, neither T cells nor neutrophils appear to mediate inflammation induced in the IκKβ knockout model (Pasparakis et al., 2006). However, pharmacological inhibition of macrophages, a significant source of TNFα in skin, reverses the inflammatory phenotype (Stratis et al., 2006). Furthermore, crossing a skin targeted IκKβ knockout mice with a skin targeted TNFα knockout also results in the resolution of inflammation (Pasparakis et al., 2002).

Mice with skin targeted over-expression of IκKβ show evidence of sustained NFκB activation and infiltration of macrophages and T cells in the dermis (Page et al., 2010). When IκKβ over-expressing skin was transplanted onto NOD/SCID mice, inflammation persisted suggesting that this phenotype is independent of adaptive immunity. Surprisingly, when the IκKβ subunit is ablated in keratinocytes, an inflammatory phenotype resembling psoriasis is observed. These lines of evidence suggest that, in addition to its role in promoting inflammation, the NFκB signaling pathway also suppresses a cell’s response to pro-inflammatory cytokines such as TNFα, therefore underscoring the importance of NFκB in maintaining homeostasis at the immune system-skin interface. The precise mechanisms of IKK/IKB/NFκB-mediated inflammation are elusive. The increased presence of apoptotic cells in both NEMO and TAK-1 knockout mouse skin suggests that excessive death of keratinocytes could trigger inflammation. Alternatively, given the post-natal nature of inflammation in these models, environmental factors may precipitate the immune response observed in these models (Wullaert et al., 2011).

1) TNFα in skin

TNFα was first identified as a macrophage-derived cytokine capable of inducing necrosis in tumors (Carswell et al., 1975). Based on its involvement in the production of many secondary cytokines and its direct effect on endothelial cell adhesion, which is critical for inflammatory cell migration into the dermis, TNFα is considered a primary cytokine in skin, along with IL-1α and

IL-1β (Kupper, 1990). Skin derived TNFα is secreted by infiltrating macrophages as well as by Langerhan cells and keratinocytes where it serves as a pro-inflammatory cytokine responsible for attracting neutrophils or lymphocytes to the skin (Groves et al., 1995). TNFα has two basic biological functions in skin that seem paradoxical (Figure 16).

FIGURE 1-16

Paradoxical functions of TNFα in skin (http://www.benbest.com/he alth/MacroNut.html)

The first and most important function is to regulate genes that protect the cell from cytoxicity. The second function is to activate the cell death program. Depending on the cellular context, cell survival seems to trump apoptosis (Natoli et al., 1998). How TNFα elicits its pleiotropic effects— from mediating proinflammatory cytokine expression, to activating or inhibiting apoptosis, to promoting survival-- is unclear. Studies of TRAF inhibition reveal that this protein is largely involved in TNFα-mediated cytoprotection as it induces pro-survival, anti-apoptotic genes such as cIAP1 and cIAP2 (Liu et al., 1996;Natoli et al., 1997). By having the ability to activate both NFκB and MAPK, TRAF is well-positioned to orchestrate TNFα-mediated cytoprotection. In the event that TRAF is not able to induce cytoprotective genes, FADD is recruited to the TNFαRI receptor. The activation of FADD shifts TNFα signaling toward cell death (Kischkel et al., 1995).

TNFα regulation occurs at the level of transcription as well as mRNA stabilization (Vlantis and Pasparakis, 2010). Once secreted, TNFα is integrated as a trimer into the membrane and released as a soluble form by the metalloprotease TNFα converting enzyme (TACE). Both membrane bound and soluble TNFα trimers bind to cognate receptors located on

the cell membrane. TNFα receptor fall into two categories: 1) TNF receptor type 1 (TNFαR1); and 2) TNF receptor type 2 (TNFαR2). Whereas TNFαR2 is exclusively found on immune cells, TNFαR1 is constituitively expressed in most other cell types where TNFα receptor activation results in the activation of NFκB, MAPK (JNK, p38, ERK), and in some cell types, apoptotic pathways (Natoli et al., 1998).

Upon TNFα binding, a trimerized TNFαR1 associates with TNFR1-associated death domain (TRADD) and then recruits a constellation of proteins that comprise one of two complexes. Complex I mediates TNFα-induced NFκB or MAPK activation and includes in addition to TRADD, RIP1 kinase, and the ubiquitin ligases TNF receptor-associated factors (TRAF2 and TRAF5) (Vlantis and Pasparakis, 2010). In keratinocytes, in addition to inducing IκB, which limits NFκB activation, TNFα induces cdk inhibitor p21 (Basile et al., 2003) as well as G0/G1 switch genes (GOG2), and G1/S block genes (BTG2, BTG3), and GADD45A (Banno et al., 2004) suggesting that part of the function of TNFα in keratinocytes is to maintain cells in the G1 phase. Curiously, TNFα also induces NFκB-mediated anti-apoptotic genes in keratinocytes including cFLIP, A20, cIAP, TRAF1, and Bcl-XL (Banno et al., 2005). Therefore, an expanded role for TNFα has emerged in skin. Beyond regulating the expression of NFκB- dependent proinflammatory cytokines, TNFα also appears to regulate NFκB-dependent genes that promote cell survival by activating NFκB, a growth inhibitor in keratinocytes necessary for the differentiation of keratinocytes and expression of anti-apoptotic factors. In addition to mediating survival and growth inhibition, TNFα also recruits proteins for complex II, which regulates apoptosis. Complex II is composed of TRADD, TRAF2, Fas associated death domain (FADD) and deubiquitinated RIP-1, which by virtue of its dequiqitination can interact with FADD. FADD, in turn, is critical to the activation of the cell death program because it binds caspases and induces cell death (Wajant et al., 2003). Although many reports claim that TNFα- induced apoptosis is not NFκB-dependent (Natoli et al., 1998;Ferran et al., 1998), the most compelling example of NFκB-dependence is observed in the embryonic lethal p65 (RELA) knockout mouse. The lethality of this mutation is a consequence of severe TNFα-induced apoptosis in the liver. This phenotype is reversed in p65/TNFα double knockouts (Doi et al., 1999), thus providing strong evidence for a role for NF kB in TNFα-induced apoptosis.

A consequence of abundant TNFα secretion can be observed in the skin of psoriasis-- the best known clinical manifestation of disrupted homeostasis in skin (Wullaert et al., 2011). Characterized by the presence of hyperproliferative keratinocytes and inflammation, psoriasis illustrates the damaging effects of unmitigated TNFα in skin. It is not clear if excess TNFα is a primary or secondary effect of perturbed skin homeostasis; however, as in vivo models of disrupted NFκB signaling illustrate, it is clear that TNFα must remain tightly regulated. Left unopposed, this potent cytokine contributes significantly to skin pathology. This is most notable in mice with skin-specific deletions in IκKβ, which result in severe TNFα-mediated inflammation (Pasparakis et al., 2002). Activation of NFκB in response to TNFα can result in

expression of cell survival factors, growth inhibition, or under dire circumstances apoptosis. However, intact NFκB signaling in the cell is critical to the function of TNFα in keratinocytes. As illustrated herein, loss of NFκB in keratinocytes has profound consequences to cellular homeostasis.

E. Role of NFκB in Squamous Cell Carcinoma

What ties NFκB to cancer progression is the well characterized role for NFκB in promoting and resolving inflammation. It was Virchow who first proposed a link between inflammation and cancer in the 19th century and since the discovery of NFκB, many have attempted to link inflammation to cancer progression (Balkwill and Mantovani, 2001). Until recently, oncogenic mutations in NFκB subunits were only described in lymphoid cancers. In these cancers, genetic alterations of NFκB subunits such as c-REL result in hyperproliferation of lymphoid cells (Karin et al., 2002). Lymphoid tumors exemplify the concept of ‘NFκB addiction’ or the presence of persistently active NFκB in cancer cells (Chaturvedi et al., 2011). Although a role for NFκB in chronic inflammation has yet to be elucidated in skin carcinogenesis, malignant epithelial cells co-cultured with macrophages demonstrate NFκB dependent invasiveness (Hagemann et al., 2005). As illustrated in lymphoid and epithelial cells, NFκB functions in a diverse, cell-specific manner during tumor progression. Given the pleiotrophic and cell-specific nature of NFκB, however, the link between inflammation, carcinogenesis, and NFκB dependence may not be straightforward in skin.

As evidenced by its function as an inhibitor of both growth and apoptosis, NFκB has an unique role during skin cancer progression. In mouse models of SCC, inhibition of NFκB activation, rather than its constitutive activation, promotes development of skin papillomas and carcinomas. For example, down-regulation of IκKα is observed in human SCC (Zhu et al., 2009) and ablation of IκKα in mouse models leads to SCC in ras-initiated tumors (Park et al., 2007). However, alterations of IκK in a progressed tumor can also alter the histological variant of the tumor from a typical SCC to the very aggressive, highly metastatic acantholyic SCC. Acantholyic SCCs express high levels of IκKα and e-cadherins, but lack keratins 1 and 10, which signifies greater malignant potential (Moreno-Maldonado et al., 2008). Mice over-expressing the super repressor form of IκB show greater numbers of basal layer apoptotic cells and spontaneous development of SCC (van Hogerlinden M. et al., 1999). In the absence of intact NFκB signaling, the keratinocyte not only loses the growth inhibitory function of NFκB, but also the anti-apoptotic function of NFκB. Furthermore, this suggests that an absence of NF kB signaling, rather than an abrogation of a particular subunit, results in tumorigenesis in skin. This may be a function of the redundant nature of some subunits. However, tumor progression is often associated with a shift in subunit composition. Increased p50 homodimer binding to DNA, along with increased expression of nuclear IκB and Bcl-3, is observed in the two stage carcinogenesis mouse model. The role of IκB and BCl-3

have been shown to repress or sustain transactivation of dimers (Bates and Miyamoto, 2004;Bours et al., 1993;Fujita et al., 1992). In other situations, phosphorylated Bcl-3 increases binding of p50 homodimers, which in turn are repressive (Caamano et al., 1996). Indeed, Bcl-3 has been identified as the target of CYLD, a gene encoding the dequbiquitinase that increases the nuclear accumulation of Bcl-3/homodimer complexes. CYLD, in turn, is shown to inhibit tumor cell proliferation by blocking Bcl-3-dependent NFκB signaling (Massoumi et al., 2006). Taken together, Bcl-3 is unique in its ability to modulate repressive NFκB homodimers and therefore is an important target in cancer progression.

Down-regulation of NFκB not only results in a shift from expression of antiapoptotic genes to proapoptotic gene expression or an increase in inflammation, but seems to act in concert with oncogenic Ras to potentiate a rapid progression to SCC in skin. Mutations in the Ha-ras oncogene are observed in more than 90% of mouse skin tumors induced by a two stage carcinogenesis protocol (Slaga et al., 1995). The characteristic ras-induced growth arrest observed as cells attempt to counteract unrestrained growth is overcome when NFκB is inhibited (Dajee et al., 2003). This results in cells re-entering the cell cycle and progressing rapidly to SCC. This mechanism is also involved in regulating the expression of genes required for metastases including integrain α6, integrin β4, and laminin 5, thus implicating a loss of NFκB in the spread of skin cancer (Dajee et al., 2003).

Unsurprisingly, TNFα, the canonical activator of NFκB and mediator of inflammation in skin following inhibition of NFκB, also has a role in cancer progression. Keratinocyte-derived TNFα acts as an endogenous tumor promoter in a mouse model of multistage carcinogenesis. Mice deficient in TNFαR1 or treated with a TNFα neutralizing antibody are resistant to TPA- induced tumor promotion (Arnott et al., 2004). Furthermore, the mechanism of TNFα signaling during tumor promotion is mediated at least in part through PKCα and AP-1. This finding is further expanded in studies involving a skin targeted IκB over-expressing mouse crossed with a TNFαR1 knockout mouse. Tumor progression in the context of disrupted NFκB signaling is reversed, therefore suggesting that TNFαR1-mediated signaling cooperates with loss of NFκB during cancer progression (Lind et al., 2004).

The role of NFκB in SCC progression is most apparent in the molecular profile of the spontaneously transformed cell line PAM 212 (Dong et al., 1999) transplanted in a syngeneic host to model metastasis (Dong et al., 2001) as well as PAM metastic reisolates LY-2 and LY-8 (Smith et al., 1998). The PAM 212 line is derived from spontaneously transformed neonatal BALB/c keratinocytes capable of forming SCCs in vivo (Yuspa et al., 1980;Smith et al., 1998) and LY-2 and LY-8 are cell lines from lymph nodes of BALB/c mice implanted with PAM 212. Compared to BALB/c cells, Pam212 cells showed greater expression of proinflammatory cytokines following TNFα treatment. When PAM metastic reisolates are treated with TNFα, they demonstrate greater expression of proinflammatory cytokines than PAM 212 cells.

Curiously, over-expression of IκB super repressor in these various models blocks expression of proinflammatory cytokines suggesting that, in transformed or metastatic keratinocytes, NFκB is activated (Dong et al., 1999). To further identify changes in gene expression between transformed and metastatic cell lines, differential dispay analysis reveals alterations in gene expression that extend well beyond pro-inflammatory cytokines. As the phenotype becomes more malignant, increases in NFκB –regulated genes that mediate growth, apoptosis, inflammation and angiogenesis are observed (Dong et al., 2001). Expression of an IκB super repressor blocked NFκB regulated genes associated with a malignant phenotype (Loercher et al., 2004). Whereas inhibition of NFκB seems to promote tumor progression, activated NFκB plays an important role during metastatic progression. Indeed, NFκB signaling during cancer progression is a “double edge sword”. This metaphor describes the behavior of TGFβ during cancer progression, which serves as both a tumor suppressor prior to transformation and an oncogene during metastasis (Akhurst and Derynck, 2001).

V Ultraviolet Radiation (UVR) Responsiveness in Skin

Among toxicants demonstrating a hormetic dose response curve, UVB at low doses is therapeutic and, in fact, required for the synthesis of vitamin D ((Lucas et al., 2008) (Figure 17).

FIGURE 1-17

Dose response curve for ultraviolet radiation (UVB) (Lucas et al., 2008)

Therefore, absence of UVB exposure results in vitamin deficiency. Increasing, vitamin D is emerging as a critical modulator of immune function and therefore may also be implicated in mechanisms of skin carcinogenesis (Hart et al., 2001). With greater exposure, however, UVB becomes a causative agent of skin carcinogenesis. Skin is a natural chromophore for ultraviolet radiation (UVR) above 280 nm and below 400 nm. This range of wavelengths constitutes the UVA band (320-400 nm) and the UVB band (280-320), which reach the dermis and epidermis, respectively (Figure 18).

FIGURE 1-18

Light spectrum featuring ultraviolet spectrum (http://www.homesolariu ms.com.au/UVPhotothera py.asp)

Solar radiation accounts for 90-99% of the UVR that reaches the earth’s surface. In spite of its designation as one of the most potent carcinogens, UVB constitutes only 1-10% of solar rays reaching the earth and is 1,000-10,000 times as carcinogenic as UVA (Cooper and Bowden, 2007). The exact chromophore or photoregulator responsible for initiating UVR responsiveness in the epidermis is unclear. Cis-urocanic acid, an imidazole-derivative formed from a naturally occurring trans-isomer in the epidermis, is one proposed chromophore (Norval and El-Ghorr, 2002). Absorption of UVR by cis-urocanic acid results in the formation of reactive oxygen species (ROS), which contribute to tumor promotion (Haralampus-Grynaviski et al., 2002). Nucleic acids represent another potential chromophore, but absorb UVB exclusively (Rosenstein and Mitchell, 1987). DNA as a photoreceptor is appealing given its propensity to form UV- induced photo-products and its requirement for DNA repair. NADPH oxidase (NOX), a heme- containing metabolic enzyme, may also serve as a chromophore given its propensity to produce reactive oxygen species in the presence of UVB (Bubici et al., 2006;Heck et al., 2004). Taken together, the trigger for cell signal transduction in response to ultraviolet light is still vague,

The two signaling pathways that are predominately activated in UVB-exposed keratinocytes include c-Jun N-terminal protein kinase (JNK), which activates the transcription factor AP-1, and NFκB (Cooper, 1996). Whereas other cell types respond to stressors such as UVA, heat shock, ionizing radiation, and oxidative stress utilize stress-induced pathways involving EKR-1 and -2 and p38, these particular pathways are not activated directly by UVB in keratinocytes (Adler et al., 1996). The mechanism by which JNK is activated occurs through the receptor tyrosine kinase epidermal growth factor receptor (EGR). UV induced EGR activation results in the expression of numerous pro-inflammatory cytokines and genes involved in angiogenesis, cell division, apoptosis, cell adhesion, and migration (Madson et al., 2006;Madson and Hansen, 2007), and thus it is a critical pathway in UVR-induced carcinogenesis (El-Abaseri and Hansen, 2007;Singh et al., 2009). Crosstalk has been reported to occur between AP-1 and NFκB at the level of transcription suggesting cooperativity of these transcription factors during UVR induced gene expression (Li et al., 2000).

Responsiveness to UVR is exquisitely cell-specific. Studies of UVB responsiveness in a vast number of cell types is likely not biologically relevant given the improbability of exposure of most cell types to solar radiation. The keratinocyte is one of few cell types chronically exposed to UVR (Adachi et al., 2003;Fisher et al., 1997).

FIGURE 1-19

Cell specific responses to UVB: keratinocytes versus HeLa cells, a common model used in UV research (Adachi et al., 2003)

Current literature is wrought with studies using cells from tissues that are sequestered from solar radiation and wave lengths of UVR that are not biologically relevant (Adachi et al., 2003). Figure 19 emphasizes the importance of differentiating cell-specific responses to UVR in the literature. Clearly, cell signaling in UV-exposed non-keratinocyte cell types is less specific, with UV activating a variety of downstream signaling targets. In keratinocytes, however, response to UV is limited to activation of JNK, p53, and NFκB, with the activation of NFκB occurring in conjunction with activation of other cytokine signaling pathways as described in Chapter 3. Therefore, studies performed in cells that are not normally exposed to solar radiation can be misleading.

A. Acute Responses to UVR in Skin

Acute responsiveness to UVB in normal skin results in what is termed a “sunburned” phenotype (Figure 16) (Matsumura and Ananthaswamy, 2004). The clinical course of a sunburn

35 includes: 1) erythema associated with increased blood flow that is likely triggered by DNA damage (Young, 2006); 2) inflammation; 3) thickening of the epidermis; 4) and apoptosis of “sunburned” cells which involves damage to DNA followed by p53 induction, membrane receptor clustering, formation of ROS, and cleavage of caspases (van Laethem A. et al., 2005;Baba et al., 1996;Claerhout et al., 2006). Accumulated damage after acute exposures leads to cumulative damage equivalent to that observed in chronically exposed skin, Ultimately, UVB exposure leads to skin carcinogenesis (Figure 17) (Matsumura and Ananthaswamy, 2004). Therefore, understanding signaling events following acute UVB exposures is essential to understanding UV-induced carcinogenesis.

B. Chronic UVR Exposure and Skin Carcinogenesis

The first associations between UVR exposure and skin cancer were occupational. Precursors of chronically sun-exposed skin were recognized on the skin of sailors by a late 19th century German physician who dubbed this lesion “sailor’s skin carcinoma”. By the early 20th century, similar observations were made in vineyard workers (de Gruijl, 1999). The first studies in animals to establish a definitive link between UVR and tumor development demonstrated that UVR-induced tumors on rat could be blocked by colored glass were dependent on dose and time of exposure; and were in some ways reminiscent of tumors produced by chemical carcinogenesis (de Gruijl, 1999). Indeed, the characterization of UVR as a whole carcinogen capable of initiating genotoxic damage and promoting cell proliferation qualifies it as a whole carcinogen (Urbach et al., 1982).

The advent of the hairless SKH mouse strain showed consistent, wave length dependent formation of actinic keratoses (AK) and SCC. In these mice, cyclopyrimidine dimer (CPD), a genotoxic marker of UVR-induced DNA damage, results from exposure to the UVB action spectrum (280-315) (Figure 20) (Ichihashi et al., 2003).

FIGURE 1-20

Formation of cyclopyrimidine dimer (CPD) by UVB (Ichihashi et al., 2003)

More recent evidence has emerged, however, that suggests that UVA targets the stem cell compartment within the epidermis and, therefore, also plays a part in skin carcinogenesis (Agar et al., 2004). UVR-induced formation of CPDs requires nucleotide excision repair (NER) or unscheduled DNA synthesis to fill in gaps resulting from excision of the CPD. Patients with the hereditary disorder Xeroderma Pigmentosum (XP) are particularly sensitive to sun exposure and have a high risk of all skin cancers, yet lack the ability to perform unscheduled DNA synthesis. This was a clue to the importance of NER in repairing UVR-induced CPDs. Curiously, NER is

least efficient at removing CPDs in human (Mellon et al., 1987) and non-existent in mouse, a species that relies upon transcription-coupled repair (TCR) instead of NER (Ruven et al., 1994). Therefore, mice are particularly susceptible models to UVR-induced genotoxic lesions.

A UVR-induced molecular signature, responsible for initiating tumor development, has been identified for different forms of skin cancer. The tumor suppressor genes p53, PTCH (patched tumor suppressor gene), and the oncogene ras are among the mutations that contribute to a progressed phenotype in UVR-exposed skin. These mutations are characterized by C to T transition and CC to TT tandem transitions located at sites of pyrimidine-pyrimidine sequences (Ichihashi et al., 2003). The CC to TT transition is a specific marker of UV exposure. Mutations of p53 are found in actinic keratosis and, therefore, are presumed to be an early genotoxic event (Nagano et al., 1993;Berg et al., 1996). Furthermore p53 mutations are found in more than 90% of SCCs suggesting that among the genes targeted by UVR, p53 mutations are particularly prominent and thus considered a biomarker of UVR-induced genotoxicity (Brash et al., 1991).

Following the intiation of DNA, which confers a growth advantage on cells, the tumor is promoted by an agent that expands its growth potential. In UVR-exposed skin, UV both initiates DNA and promotes cellular growth, thus designating it a whole carcinogen. A dose of UVB equivalent to a mild sunburn functions as a tumor promotion. After an initial period of growth arrest, UVB induces proliferation inhibited proliferation, which with subsequent UVB exposures progresses to hyperplasia (Olsen, 1988). Although these changes are reversible, chronic UVB exposure is cumulative and becomes tumor promoting. What causes UVB-induced hyperproliferation are alterations in the cell cycle that involve increased protein expression of G1 phase cyclins (D1 and E); increased expression of cyclin-dependent kinases (cdk-2, 4, 6); and sustained entry into S phase (Berton et al., 2001).

C. Role of NFκB in UVB Responsiveness

The role of NFκB in UVB responsiveness is complex and still speculative. The canonical NFκB-activating ligand is TNFα; however, the affects of UVB-induced TNFα are indirect (Bender et al., 1998). The vast majority of published studies involving UV-induced NFκB are performed in cells which are not natural targets of UVR. In fact, some of the most seminal work in cellular responsiveness to UVR has been performed on Hela cells or fibroblasts using the UVC wavelength (200-280 nm), an action spectrum that fails to reach the earth’s surface and has little biological relevance. However, in spite of the relevance of these models and action spectrum, studies of UVC in Hela cells and fibroblasts are potentially informative. In Hela cells, UVC response is shown to involve cytoplasmic membrane signaling, but not a nuclear signal suggesting that UVC responsiveness requires no genotoxicity (Devary et al., 1993). Furthermore, IκB is degraded by the ubiquitin/proteasome pathway following UVC exposure, but this is not dependent on phosphorylation of IκB serines 32 and 36 as observed in the canonical pathway (Li and Karin, 1998). Instead, studies in Hela cells suggest that UVC- induced activation of the NFκB is IκK-independent and that casein kinase II (CK2)

37 phosphorylates IκBα at a cluster of C-terminal sites leading to IκB degradation (Kato, Jr. et al., 2003) and translocation of the p65 heterodimer (Li and Karin, 1998).

Most studies elucidating the mechanisms of UVR-induced NFκB in the epidermis are performed in the human keratinocyte cell line HaCaT. Surprisingly, few studies utilize cells from mouse. How NFκB is activated by UVB is not entirely clear, but it may involve UVB- induced production of reactive oxygen species (ROS), which is mediated in HaCaT cells by NADPH oxidase (Beak et al., 2004;Adhami et al., 2003;Kitazawa et al., 2002). In HaCaT cells, NFκB activates IκK, which in turn targets IκB for degradation (Adhami et al., 2003;Kitazawa et al., 2002). Compared to TNFα-induced transactivation in reporter assays, modest UVB-induced NFκB transactivation is observed and this increase can be inhibited pharmacologically by the IκK inhibitor parthenolide (Tanaka et al., 2005). UVB induces several NFκB-mediated genes in HaCaT cells including bFGF, MMP-1, IL-1, and TNFα (Tanaka et al., 2005). Microarray analysis of human primary keratinocytes derived from foreskins, however, reveals a more expansive expression profile. In addition to UVR-specific cytokines and stress response genes, UVB induces genes involved in basal transcription, splicing, translation, and proteosome degradation and down regulates genes involved in metabolism, and adhesion (Sesto et al., 2002;Li et al., 2001). Indeed, HaCaT cells as an in vitro model of UVB responsiveness are not without drawbacks. Critical differences are observed in HaCaT cells compared to primary human keratinocytes. HaCaTs have high constitutively activated NFκB and higher than usual levels of DNA binding to NFκB than primary cells. Unlike HaCaT cells, IκB degradation in human primary keratinocytes occurs hours after UVB exposure suggesting that UVB-induced activation of NFκB is independent of IκB degradation in primary cells. Because of their apparent aberrant NFκB function, HaCaT cells are exquisitely apoptotic following UVB exposure (Lewis et al., 2006). Although biologically more relevant than UVC-irradiated Hela cells, the use of HaCaT cells to elucidate mechanisms of NFκB-dependent UVB responsiveness may not accurately reflect the mechanism in primary cells. Indeed, drawbacks described for HaCaT cells, coupled with a paucity of data in primary keratinocytes his argues for use of primary cells in mechanistic studies of UVB-mediated activation of NFκB.

D. Role of TGFβ-1 in UVB Responsiveness

TGFβ-1 is a prominent cytokine in skin, which regulates critical aspects of skin homeostasis. Yet its role in UVB responsiveness is relatively unexplored. What is known about the role of TGFβ-1 in UVB responsiveness has been elucidated in mink lung epithelial cells, human fibroblasts, human keratinocytes, and whole skin, but not in mouse. In sun-exposed human aging skin, decreased TGFβRII mRNA and phospho-SMAD2 is observed along with an increase in SMAD7 suggesting that cumulative sun exposure down regulates TGFβ signaling in skin (Han et al., 2005). Consistent with this observation, acute UVB exposure of mink lung epithelial cells blocks TGFβRII and induces SMAD7 (Quan et al., 2001). The downregulation of TGFβRII is also observed in UVB-treated human fibroblasts (Quan et al., 2004), clearly a contributing factor to photoaging. Furthermore, UVB reduces DNA binding of SMAD3/4 within

4 hours of UVB exposure of human skin (Quan et al., 2002b). Paradoxically, in spite of observations suggesting an impairment of TGFβ-1 signaling by UVB, TGFβ-1 and -3 are increased at the mRNA level in human keratinocytes (Lee et al., 1997;Quan et al., 2002b), although TGFβ-2 is decreased (Quan et al., 2002b). Furthermore, an ROS-mediated increase in bioactive TGFβ-1 is observed in these cells (Wang and Kochevar, 2005). UVB-induced expression of TGFβ-1 mediated genes is not reported in keratinocytes. In human dermis, however, an increase in connective tissue growth factor (CTGF) is observed following UVB exposure (Quan et al., 2002a). CTGF, which is induced by TGFβ mediates TGFβ-induced type I procollagen synthesis. This molecule not only plays a role in cellular differentiation, but stimulates cell proliferation, chemotaxis, and adhesion and is the only TGFβ-regulated gene that can be modulated by UVB. Clearly, the paucity of data regarding the role of TGFβ-1 in UVB responsiveness in keratinocytes reflects a gap in both skin biology and pathology.

VII Crosstalk: TGFβ-1 and NFκB signaling

Crosstalk between TGFβ-1 and NFκB signaling pathways has not yet been described in keratinocytes. However, an intersection between these pathways has been demonstrated in many cell types as well as in the context of cancer. In a highly cell-specific manner, TGFβ-1 both acts on NFκB and is influenced by NFκB. These interactions result in both positive and negative regulation of gene expression and other biologically relevant processes. The diversity of biological outcomes demonstrated by crosstalk between NFκB and TGFβ-1 reflects the complexity of TGFβ-1 signaling, which takes on many different roles depending upon cellular context. TGFβ-1 has been shown to activate NFκB: 1) in neurons and promote cell survival (Konig et al., 2005); 2) in lymphoma cells, resulting in upregulation of IL-2 (Han et al., 1998); 3) in HeLa cells where TGFβ-1 phosphorylates p65 by way of PKA (Ishinaga et al., 2007); 4) in airway smooth muscle cells where TGFβ-1 induces CCL11 through a binding site for NFκB (Matsukura et al., 2010); and 5) in hepatocytes where TGFβ-1 activation of NFκB results in the upregulation of TGFα and HB-EGF (Murillo et al., 2007). When the direction of regulation is reversed, NFκB induces TGFβ-1. Examples of this reversal in regulation are demonstrated in both human airway smooth muscle cells and hepatocytes (Lin et al., 2010). Fewer studies show NFκB mediated upregulation of TGFβ-1. Another intersection of the TGFβ-1 and NFκB pathways involves the repression of TGFβ-1 signaling by activated NFκB. This usually involves competition for coactivators such as p300/CBP (Mori et al., 2003;Prokova et al., 2002;Nagarajan et al., 2000). NFκB induced SMAD 7 has been demonstrated as another mechanism of NFκB- mediated suppression of TGFβ-1(Bitzer et al., 2000).

In a vast majority of instances, crosstalk between NFκB and TGFβ-1 occurs in either epithelial cells or in immune cells and results in the inhibition of NFκB by TGFβ-1 and growth suppression in salivary gland, gut epithelium, and the endothelium. In human salivary gland cells, downregulation of NFκB by TGFβ-1-induced IκB expression (Azuma et al., 1999); in intestinal epithelium, blockade of NFκB recruitment to the IL-6 promoter (Haller et al., 2003); TGFβ-1-mediated inhibition of proinflammatory cytokine expression in intestinal epithelial cells

(Ruiz et al., 2006); and in endothelial cells, competition for coactivators between SMAD 2 and NFκB lead to blockade of proinflammatory e-selectin expression (DiChiara et al., 2000). Induction of RelB activation and cytokine secretion by human papillomavirus-like particle is inhibited by TGFβ-1 in dendritic cells, but not in Langerhans cells (Yan et al., 2005). In B cells, NFκB is inhibited by TGFβ-1, leading to apoptosis in immature B cells during clonal deletion (Arsura et al., 1996). In T-cells, TGFβ-1 attentuates NFκB binding to the Foxp3 promoter, which induces Foxp3 (Jana et al., 2009). In macrophages, TGFβ-1 suppression of NFκB is shown to lead to inhibition of MMP-9. Taken together, TGFβ-1 crosstalk with NFκB is has been described in many cell types and seems to play a diverse role in regulating gene expression.

In cancer cell lines, TGFβ-1/NFκB crosstalk results in negative and positive regulation of gene expression and various endpoints relevant to cancer including increased cell motility and invasiveness in pancreatic cancer cells (Chow et al., 2010); activation of α5β3 integrins in human chondrosarcoma cells by way of TGFβ-1 mediated activation of AKT, which in turn activates IκK (Yeh et al., 2008); and cell motility and invasiness in pancreatic cancer cells (Chow et al., 2010). Several studies have focused on a role for TGFβ-1/NFκB crosstalk in breast cancer cells where TGFβ-1 treated decreased NFκB binding by stabilizing IκB (Sovak et al., 1999). Furthermore, osteoblast TGFβ-1 was found to activate NFκB through ERK and AKT and induce β1 and β3 integrins necessary for metastasis of breast cancer cells (Wei et al., 2008). In a head and neck SCC cell line, high constituitive levels of NFκB resulted in down regulation of TβRII (Cohen et al., 2009). Whereas mechanisms of TGFβ-1-induced NFκB usually involve R- SMADs, Co-SMAD4 has been implicated in TGFβ-1 activation of NFκB in colon cancer cells (Grau et al., 2006). Taken together, the mechanistic possibilities for modulation of NFκB by TGFβ-1 (and vice versa) are wide ranging and cell specific, particularly in the context of cancer progression, and cell specific. Understanding TGFβ-1-mediated NFκB crosstalk in primary keratinocytes will reveal additional levels of regulation during the process of inflammation, cancer progression, as well as during the maintanence of cellular homeostasis.

VIII Hypothesis and Aims

These studies will test the hypothesis that one mechanism through which TGFβ-1 mediates inflammation is through regulation of NFκB dependent cytokines. Furthermore, proposed studies will explore how TGFβ-1 mediates NFκB through activation of upstream effectors of the NFκB pathway or by modulating transcriptional machinery required to induce genes that are both NFκB- and SMAD-3-dependent. Finally, it is hypothesized that crosstalk between NFκB and TGFβ-1 will result in a biological relevant outcome. Specifically, it is hypothesized that the pathway will have a role in one of several processes critical to maintaining cellular homeostasis in skin. The goal of these studies will be to identify potential targets of TGFβ1/NFκB regulation.

The first aim of these studies will be to identify NFκB-dependent target genes that can be induced by activation of the TGFβ-1 signaling pathway in skin. The second aim of these studies

is to elucidate the signaling molecules activated in this pathway as well as possible protein- protein interactions that occur downstream at the level of transcription. The third aim is to explore the role of crosstalk between TGFβ-1 and NFκB in processes critical to maintaining cellular homeostasis in keratinocytes. The intersection between TGFβ-1 and NFκB will be explored in the context of: 1) apoptosis; 2) differentiation; 3) oncogenic ras; and 4) responsiveness to ultraviolet light.

Studies will be performed using a variety of mouse models of altered TGFβ-1 signaling as well as primary cells isolated from these models. In addition to genetic approaches, pharmacologic approaches will be used to inhibit both the TGFβ-1 and NFκB signaling pathways.

IX Literature Cited

Adachi M, Gazel A, Pintucci G, Shuck A, Shifteh S, Ginsburg D, Rao LS, Kaneko T, Freedberg IM, Tamaki K, Blumenberg M (2003) Specificity in stress response: epidermal keratinocytes exhibit specialized UV-responsive signal transduction pathways. DNA Cell Biol 22:665-677.

Adams DH, Hathaway M, Shaw J, Burnett D, Elias E, Strain AJ (1991) Transforming growth factor-beta induces human T lymphocyte migration in vitro. J Immunol 147:609-612.

Adhami VM, Afaq F, Ahmad N (2003) Suppression of ultraviolet B exposure-mediated activation of NF-kappaB in normal human keratinocytes by resveratrol. Neoplasia 5:74-82.

Adler V, Polotskaya A, Kim J, Dolan L, Davis R, Pincus M, Ronai Z (1996) Dose rate and mode of exposure are key factors in JNK activation by UV irradiation. Carcinogenesis 17:2073-2076.

Agar NS, Halliday GM, Barnetson RS, Ananthaswamy HN, Wheeler M, Jones AM (2004) The basal layer in human squamous tumors harbors more UVA than UVB fingerprint mutations: a role for UVA in human skin carcinogenesis. Proc Natl Acad Sci U S A 101:4954-4959.

Akhurst RJ, Derynck R (2001) TGF-beta signaling in cancer--a double-edged sword. Trends Cell Biol 11:S44-S51.

Amendt C, Mann A, Schirmacher P, Blessing M (2002) Resistance of keratinocytes to TGFbeta- mediated growth restriction and apoptosis induction accelerates re-epithelialization in skin wounds. J Cell Sci 115:2189-2198.

Annes JP, Munger JS, Rifkin DB (2003) Making sense of latent TGFbeta activation. J Cell Sci 116:217-224.

Ansel J, Perry P, Brown J, Damm D, Phan T, Hart C, Luger T, Hefeneider S (1990) Cytokine modulation of keratinocyte cytokines. J Invest Dermatol 94:101S-107S.

Arany PR, Flanders KC, DeGraff W, Cook J, Mitchell JB, Roberts AB (2007) Absence of Smad3 confers radioprotection through modulation of ERK-MAPK in primary dermal fibroblasts. J Dermatol Sci 48:35-42.

Arnott CH, Scott KA, Moore RJ, Robinson SC, Thompson RG, Balkwill FR (2004) Expression of both TNF-alpha receptor subtypes is essential for optimal skin tumour development. Oncogene 23:1902-1910.

Arsura M, Wu M, Sonenshein GE (1996) TGF beta 1 inhibits NF-kappa B/Rel activity inducing apoptosis of B cells: transcriptional activation of I kappa B alpha. Immunity 5:31-40.

Ashcroft GS, Yang X, Glick AB, Weinstein M, Letterio JL, Mizel DE, Anzano M, Greenwell- Wild T, Wahl SM, Deng C, Roberts AB (1999) Mice lacking Smad3 show accelerated wound healing and an impaired local inflammatory response. Nat Cell Biol 1:260-266.

Azuma M, Motegi K, Aota K, Yamashita T, Yoshida H, Sato M (1999) TGF-beta1 inhibits NF- kappaB activity through induction of IkappaB-alpha expression in human salivary gland cells: a possible mechanism of growth suppression by TGF-beta1. Exp Cell Res 250:213-222.

Baba T, Hanada K, Hashimoto I (1996) The study of ultraviolet B-induced apoptosis in cultured mouse keratinocytes and in mouse skin. J Dermatol Sci 12:18-23.

Bae DS, Blazanin N, Licata M, Lee J, Glick AB (2009) Tumor suppressor and oncogene actions of TGFbeta1 occur early in skin carcinogenesis and are mediated by Smad3. Mol Carcinog 48:441-453.

Baeuerle PA, Baltimore D (1996) NF-kappa B: ten years after. Cell 87:13-20.

Balkwill F, Mantovani A (2001) Inflammation and cancer: back to Virchow? Lancet 357:539- 545.

Banno T, Gazel A, Blumenberg M (2004) Effects of tumor necrosis factor-alpha (TNF alpha) in epidermal keratinocytes revealed using global transcriptional profiling. J Biol Chem 279:32633- 32642.

Banno T, Gazel A, Blumenberg M (2005) Pathway-specific profiling identifies the NF-kappa B- dependent tumor necrosis factor alpha-regulated genes in epidermal keratinocytes. J Biol Chem 280:18973-18980.

Basile JR, Eichten A, Zacny V, Munger K (2003) NF-kappaB-mediated induction of p21(Cip1/Waf1) by tumor necrosis factor alpha induces growth arrest and cytoprotection in normal human keratinocytes. Mol Cancer Res 1:262-270.

Bates PW, Miyamoto S (2004) Expanded nuclear roles for IkappaBs. Sci STKE 2004:e48.

Beak SM, Lee YS, Kim JA (2004) NADPH oxidase and cyclooxygenase mediate the ultraviolet B-induced generation of reactive oxygen species and activation of nuclear factor-kappaB in HaCaT human keratinocytes. Biochimie 86:425-429.

Beg AA, Sha WC, Bronson RT, Baltimore D (1995) Constitutive NF-kappa B activation, enhanced granulopoiesis, and neonatal lethality in I kappa B alpha-deficient mice. Genes Dev 9:2736-2746.

Bender K, Gottlicher M, Whiteside S, Rahmsdorf HJ, Herrlich P (1998) Sequential DNA damage-independent and -dependent activation of NF-kappaB by UV. EMBO J 17:5170-5181.

Berg RJ, van Kranen HJ, Rebel HG, de VA, van Vloten WA, Van Kreijl CF, van der Leun JC, de Gruijl FR (1996) Early p53 alterations in mouse skin carcinogenesis by UVB radiation: immunohistochemical detection of mutant p53 protein in clusters of preneoplastic epidermal cells. Proc Natl Acad Sci U S A 93:274-278.

Bernard D, Gosselin K, Monte D, Vercamer C, Bouali F, Pourtier A, Vandenbunder B, Abbadie C (2004) Involvement of Rel/nuclear factor-kappaB transcription factors in keratinocyte senescence. Cancer Res 64:472-481.

Berton TR, Pavone A, Fischer SM (2001) Ultraviolet-B irradiation alters the cell cycle machinery in murine epidermis in vivo. J Invest Dermatol 117:1171-1178.

Bitzer M, von GG, Liang D, Dominguez-Rosales A, Beg AA, Rojkind M, Bottinger EP (2000) A mechanism of suppression of TGF-beta/SMAD signaling by NF-kappa B/RelA. Genes Dev 14:187-197.

Bonifati C, Ameglio F (1999) Cytokines in psoriasis. Int J Dermatol 38:241-251.

Borkowski TA, Letterio JJ, Farr AG, Udey MC (1996) A role for endogenous transforming growth factor beta 1 in Langerhans cell biology: the skin of transforming growth factor beta 1 null mice is devoid of epidermal Langerhans cells. J Exp Med 184:2417-2422.

Borkowski TA, Letterio JJ, Mackall CL, Saitoh A, Wang XJ, Roop DR, Gress RE, Udey MC (1997) A role for TGFbeta1 in langerhans cell biology. Further characterization of the epidermal Langerhans cell defect in TGFbeta1 null mice. J Clin Invest 100:575-581.

Bours V, Franzoso G, Azarenko V, Park S, Kanno T, Brown K, Siebenlist U (1993) The oncoprotein Bcl-3 directly transactivates through kappa B motifs via association with DNA- binding p50B homodimers. Cell 72:729-739.

Brash DE, Rudolph JA, Simon JA, Lin A, McKenna GJ, Baden HP, Halperin AJ, Ponten J (1991) A role for sunlight in skin cancer: UV-induced p53 mutations in squamous cell carcinoma. Proc Natl Acad Sci U S A 88:10124-10128.

Brown KA, Pietenpol JA, Moses HL (2007) A tale of two proteins: differential roles and regulation of Smad2 and Smad3 in TGF-beta signaling. J Cell Biochem 101:9-33.

Bubici C, Papa S, Pham CG, Zazzeroni F, Franzoso G (2006) The NF-kappaB-mediated control of ROS and JNK signaling. Histol Histopathol 21:69-80.

Caamano JH, Perez P, Lira SA, Bravo R (1996) Constitutive expression of Bc1-3 in thymocytes increases the DNA binding of NF-kappaB1 (p50) homodimers in vivo. Mol Cell Biol 16:1342- 1348.

Carswell EA, Old LJ, Kassel RL, Green S, Fiore N, Williamson B (1975) An endotoxin-induced serum factor that causes necrosis of tumors. Proc Natl Acad Sci U S A 72:3666-3670.

Castriconi R, Cantoni C, Della CM, Vitale M, Marcenaro E, Conte R, Biassoni R, Bottino C, Moretta L, Moretta A (2003) Transforming growth factor beta 1 inhibits expression of NKp30 and NKG2D receptors: consequences for the NK-mediated killing of dendritic cells. Proc Natl Acad Sci U S A 100:4120-4125.

Cataisson C, Joseloff E, Murillas R, Wang A, Atwell C, Torgerson S, Gerdes M, Subleski J, Gao JL, Murphy PM, Wiltrout RH, Vinson C, Yuspa SH (2003) Activation of cutaneous protein kinase C alpha induces keratinocyte apoptosis and intraepidermal inflammation by independent signaling pathways. J Immunol 171:2703-2713.

Cavin LG, Romieu-Mourez R, Panta GR, Sun J, Factor VM, Thorgeirsson SS, Sonenshein GE, Arsura M (2003) Inhibition of CK2 activity by TGF-beta1 promotes IkappaB-alpha protein stabilization and apoptosis of immortalized hepatocytes. Hepatology 38:1540-1551.

Chacko BM, Qin BY, Tiwari A, Shi G, Lam S, Hayward LJ, de CM, Lin K (2004) Structural basis of heteromeric smad protein assembly in TGF-beta signaling. Mol Cell 15:813-823.

Chaturvedi MM, Sung B, Yadav VR, Kannappan R, Aggarwal BB (2011) NF-kappaB addiction and its role in cancer: 'one size does not fit all'. Oncogene 30:1615-1630.

Cheifetz S, Hernandez H, Laiho M, ten DP, Iwata KK, Massague J (1990) Distinct transforming growth factor-beta (TGF-beta) receptor subsets as determinants of cellular responsiveness to three TGF-beta isoforms. J Biol Chem 265:20533-20538.

Chen CR, Kang Y, Siegel PM, Massague J (2002) E2F4/5 and p107 as Smad cofactors linking the TGFbeta receptor to c-myc repression. Cell 110:19-32.

Chen FE, Ghosh G (1999) Regulation of DNA binding by Rel/NF-kappaB transcription factors: structural views. Oncogene 18:6845-6852.

Cheong R, Bergmann A, Werner SL, Regal J, Hoffmann A, Levchenko A (2006) Transient IkappaB kinase activity mediates temporal NF-kappaB dynamics in response to a wide range of tumor necrosis factor-alpha doses. J Biol Chem 281:2945-2950.

Cho HR, Hong SB, Kim YI, Lee JW, Kim NI (2004) Differential expression of TGF-beta isoforms during differentiation of HaCaT human keratinocyte cells: implication for the separate role in epidermal differentiation. J Korean Med Sci 19:853-858.

Chow JY, Ban M, Wu HL, Nguyen F, Huang M, Chung H, Dong H, Carethers JM (2010) TGF- beta downregulates PTEN via activation of NF-kappaB in pancreatic cancer cells. Am J Physiol Gastrointest Liver Physiol 298:G275-G282.

Claerhout S, Van LA, Agostinis P, Garmyn M (2006) Pathways involved in sunburn cell formation: deregulation in skin cancer. Photochem Photobiol Sci 5:199-207.

Cohen J, Chen Z, Lu SL, Yang XP, Arun P, Ehsanian R, Brown MS, Lu H, Yan B, Diallo O, Wang XJ, Van WC (2009) Attenuated transforming growth factor beta signaling promotes nuclear factor-kappaB activation in head and neck cancer. Cancer Res 69:3415-3424.

Cooper KD (1996) Cell-mediated immunosuppressive mechanisms induced by UV radiation. Photochem Photobiol 63:400-406.

Cooper SJ, Bowden GT (2007) Ultraviolet B regulation of transcription factor families: roles of nuclear factor-kappa B (NF-kappaB) and activator protein-1 (AP-1) in UVB-induced skin carcinogenesis. Curr Cancer Drug Targets 7:325-334.

Coussens LM, Werb Z (2002) Inflammation and cancer. Nature %19-26;420:860-867.

Cox AD, Hisaka MM, Buss JE, Der CJ (1992) Specific isoprenoid modification is required for function of normal, but not oncogenic, Ras protein. Mol Cell Biol 12:2606-2615.

Cui W, Fowlis DJ, Bryson S, Duffie E, Ireland H, Balmain A, Akhurst RJ (1996) TGFbeta1 inhibits the formation of benign skin tumors, but enhances progression to invasive spindle carcinomas in transgenic mice. Cell 86:531-542.

Dahler AL, Cavanagh LL, Saunders NA (2001) Suppression of keratinocyte growth and differentiation by transforming growth factor beta1 involves multiple signaling pathways. J Invest Dermatol 116:266-274.

Dajee M, Lazarov M, Zhang JY, Cai T, Green CL, Russell AJ, Marinkovich MP, Tao S, Lin Q, Kubo Y, Khavari PA (2003) NF-kappaB blockade and oncogenic Ras trigger invasive human epidermal neoplasia. Nature 421:639-643.

Datto MB, Frederick JP, Pan L, Borton AJ, Zhuang Y, Wang XF (1999) Targeted disruption of Smad3 reveals an essential role in transforming growth factor beta-mediated signal transduction. Mol Cell Biol 19:2495-2504.

de Caestecker MP (2004) The transforming growth factor-beta superfamily of receptors. Cytokine Growth Factor Rev 15:1-11.

de Gruijl FR (1999) Skin cancer and solar UV radiation. Eur J Cancer 35:2003-2009.

de Visser KE, Eichten A, Coussens LM (2006) Paradoxical roles of the immune system during cancer development. Nat Rev Cancer 6:24-37.

Del Bino S., Vioux C, Rossio-Pasquier P, Jomard A, Demarchez M, Asselineau D, Bernerd F (2004) Ultraviolet B induces hyperproliferation and modification of epidermal differentiation in normal human skin grafted on to nude mice. Br J Dermatol 150:658-667.

Dennler S, Huet S, Gauthier JM (1999) A short amino-acid sequence in MH1 domain is responsible for functional differences between Smad2 and Smad3. Oncogene 18:1643-1648.

Derynck R, Zhang Y, Feng XH (1998) Smads: transcriptional activators of TGF-beta responses. Cell 95:737-740.

Derynck R, Zhang YE (2003) Smad-dependent and Smad-independent pathways in TGF-beta family signalling. Nature 425:577-584.

Descargues P, Sil AK, Karin M (2008a) IKKalpha, a critical regulator of epidermal differentiation and a suppressor of skin cancer. EMBO J 27:2639-2647.

Descargues P, Sil AK, Sano Y, Korchynskyi O, Han G, Owens P, Wang XJ, Karin M (2008c) IKKalpha is a critical coregulator of a Smad4-independent TGFbeta-Smad2/3 signaling pathway that controls keratinocyte differentiation. Proc Natl Acad Sci U S A %19;105:2487-2492.

Descargues P, Sil AK, Sano Y, Korchynskyi O, Han G, Owens P, Wang XJ, Karin M (2008b) IKKalpha is a critical coregulator of a Smad4-independent TGFbeta-Smad2/3 signaling pathway that controls keratinocyte differentiation. Proc Natl Acad Sci U S A %19;105:2487-2492.

Devary Y, Rosette C, DiDonato JA, Karin M (1993) NF-kappa B activation by ultraviolet light not dependent on a nuclear signal. Science 261:1442-1445.

DiChiara MR, Kiely JM, Gimbrone MA, Jr., Lee ME, Perrella MA, Topper JN (2000) Inhibition of E-selectin gene expression by transforming growth factor beta in endothelial cells involves coactivator integration of Smad and nuclear factor kappaB-mediated signals. J Exp Med 192:695-704.

Dlugosz AA, Yuspa SH (1994) Protein kinase C regulates keratinocyte transglutaminase (TGK) gene expression in cultured primary mouse epidermal keratinocytes induced to terminally differentiate by calcium. J Invest Dermatol 102:409-414.

Dlugosz AA, Yuspa SH (1993) Coordinate changes in gene expression which mark the spinous to granular cell transition in epidermis are regulated by protein kinase C. J Cell Biol 120:217- 225.

Doi H, Shibata MA, Kiyokane K, Otsuki Y (2003) Downregulation of TGFbeta isoforms and their receptors contributes to keratinocyte hyperproliferation in psoriasis vulgaris. J Dermatol Sci 33:7-16.

Doi TS, Marino MW, Takahashi T, Yoshida T, Sakakura T, Old LJ, Obata Y (1999) Absence of tumor necrosis factor rescues RelA-deficient mice from embryonic lethality. Proc Natl Acad Sci U S A 96:2994-2999.

Dong G, Chen Z, Kato T, Van WC (1999) The host environment promotes the constitutive activation of nuclear factor-kappaB and proinflammatory cytokine expression during metastatic tumor progression of murine squamous cell carcinoma. Cancer Res 59:3495-3504.

Dong G, Loukinova E, Chen Z, Gangi L, Chanturita TI, Liu ET, Van WC (2001) Molecular profiling of transformed and metastatic murine squamous carcinoma cells by differential display

and cDNA microarray reveals altered expression of multiple genes related to growth, apoptosis, angiogenesis, and the NF-kappaB signal pathway. Cancer Res 61:4797-4808.

Dotto GP (1999) Signal transduction pathways controlling the switch between keratinocyte growth and differentiation. Crit Rev Oral Biol Med 10:442-457.

El-Abaseri TB, Hansen LA (2007) EGFR Activation and Ultraviolet Light-Induced Skin Carcinogenesis. J Biomed Biotechnol 2007:97939.

Fan CM, Maniatis T (1991) Generation of p50 subunit of NF-kappa B by processing of p105 through an ATP-dependent pathway. Nature 354:395-398.

Fan K, Ruan Q, Sensenbrenner L, Chen B (1992) Transforming growth factor-beta 1 bifunctionally regulates murine macrophage proliferation. Blood 79:1679-1685.

Ferran C, Stroka DM, Badrichani AZ, Cooper JT, Wrighton CJ, Soares M, Grey ST, Bach FH (1998) A20 inhibits NF-kappaB activation in endothelial cells without sensitizing to tumor necrosis factor-mediated apoptosis. Blood 91:2249-2258.

Fisher GJ, Datta SC, Talwar HS, Wang ZQ, Varani J, Kang S, Voorhees JJ (1996) Molecular basis of sun-induced premature skin ageing and retinoid antagonism. Nature 379:335-339.

Fisher GJ, Wang ZQ, Datta SC, Varani J, Kang S, Voorhees JJ (1997) Pathophysiology of premature skin aging induced by ultraviolet light. N Engl J Med 337:1419-1428.

Flisiak I, Chodynicka B, Porebski P, Flisiak R (2002) Association between psoriasis severity and transforming growth factor beta(1) and beta (2) in plasma and scales from psoriatic lesions. Cytokine 19:121-125.

Flisiak I, Porebski P, Flisiak R, Chodynicka B (2003) Plasma transforming growth factor beta1 as a biomarker of psoriasis activity and treatment efficacy. Biomarkers 8:437-443.

Fujita T, Nolan GP, Ghosh S, Baltimore D (1992) Independent modes of transcriptional activation by the p50 and p65 subunits of NF-kappa B. Genes Dev 6:775-787.

Fusco AJ, Savinova OV, Talwar R, Kearns JD, Hoffmann A, Ghosh G (2008) Stabilization of RelB requires multidomain interactions with p100/p52. J Biol Chem 283:12324-12332.

Gandarillas A (2000) Epidermal differentiation, apoptosis, and senescence: common pathways? Exp Gerontol 35:53-62.

Gerondakis S, Grumont R, Rourke I, Grossmann M (1998) The regulation and roles of Rel/NF- kappa B transcription factors during lymphocyte activation. Curr Opin Immunol 10:353-359.

Ghosh S, Gifford AM, Riviere LR, Tempst P, Nolan GP, Baltimore D (1990) Cloning of the p50 DNA binding subunit of NF-kappa B: homology to rel and dorsal. Cell 62:1019-1029.

Ghosh S, Karin M (2002) Missing pieces in the NF-kappaB puzzle. Cell 109 Suppl:S81-96.:S81- S96.

Gibbs JB, Sigal IS, Poe M, Scolnick EM (1984) Intrinsic GTPase activity distinguishes normal and oncogenic ras p21 molecules. Proc Natl Acad Sci U S A 81:5704-5708.

Glick AB (2004) TGFbeta1, back to the future: revisiting its role as a transforming growth factor. Cancer Biol Ther 3:276-283.

Glick AB, Danielpour D, Morgan D, Sporn MB, Yuspa SH (1990) Induction and autocrine receptor binding of transforming growth factor-beta 2 during terminal differentiation of primary mouse keratinocytes. Mol Endocrinol 4:46-52.

Glick AB, Kulkarni AB, Tennenbaum T, Hennings H, Flanders KC, O'Reilly M, Sporn MB, Karlsson S, Yuspa SH (1993b) Loss of expression of transforming growth factor beta in skin and skin tumors is associated with hyperproliferation and a high risk for malignant conversion. Proc Natl Acad Sci U S A 90:6076-6080.

Glick AB, Kulkarni AB, Tennenbaum T, Hennings H, Flanders KC, O'Reilly M, Sporn MB, Karlsson S, Yuspa SH (1993a) Loss of expression of transforming growth factor beta in skin and skin tumors is associated with hyperproliferation and a high risk for malignant conversion. Proc Natl Acad Sci U S A 90:6076-6080.

Glick AB, Perez-Lorenzo R, Mohammed J (2008) Context-dependent regulation of cutaneous immunological responses by TGFbeta1 and its role in skin carcinogenesis. Carcinogenesis 29:9- 14.

Gniadecki R (1998) Regulation of keratinocyte proliferation. Gen Pharmacol 30:619-622.

Gold LI, Jussila T, Fusenig NE, Stenback F (2000) TGF-beta isoforms are differentially expressed in increasing malignant grades of HaCaT keratinocytes, suggesting separate roles in skin carcinogenesis. J Pathol 190:579-588.

Gold LI, Saxena B, Mittal KR, Marmor M, Goswami S, Nactigal L, Korc M, Demopoulos RI (1994) Increased expression of transforming growth factor beta isoforms and basic fibroblast growth factor in complex hyperplasia and adenocarcinoma of the endometrium: evidence for paracrine and autocrine action. Cancer Res 54:2347-2358.

Gorsch SM, Memoli VA, Stukel TA, Gold LI, Arrick BA (1992) Immunohistochemical staining for transforming growth factor beta 1 associates with disease progression in human breast cancer. Cancer Res 52:6949-6952.

Gosselin K, Abbadie C (2003) Involvement of Rel/NF-kappa B transcription factors in senescence. Exp Gerontol 38:1271-1283.

Goumans MJ, Mummery C (2000) Functional analysis of the TGFbeta receptor/Smad pathway through gene ablation in mice. Int J Dev Biol 44:253-265.

Grau AM, Datta PK, Zi J, Halder SK, Beauchamp RD (2006) Role of Smad proteins in the regulation of NF-kappaB by TGF-beta in colon cancer cells. Cell Signal 18:1041-1050.

Groppe J, Hinck CS, Samavarchi-Tehrani P, Zubieta C, Schuermann JP, Taylor AB, Schwarz PM, Wrana JL, Hinck AP (2008) Cooperative assembly of TGF-beta superfamily signaling complexes is mediated by two disparate mechanisms and distinct modes of receptor binding. Mol Cell 29:157-168.

Groves RW, Allen MH, Ross EL, Barker JN, MacDonald DM (1995) Tumour necrosis factor alpha is pro-inflammatory in normal human skin and modulates cutaneous adhesion molecule expression. Br J Dermatol 132:345-352.

Hagemann T, Wilson J, Kulbe H, Li NF, Leinster DA, Charles K, Klemm F, Pukrop T, Binder C, Balkwill FR (2005) Macrophages induce invasiveness of epithelial cancer cells via NF-kappa B and JNK. J Immunol 175:1197-1205.

Haller D, Holt L, Kim SC, Schwabe RF, Sartor RB, Jobin C (2003) Transforming growth factor- beta 1 inhibits non-pathogenic Gram negative bacteria-induced NF-kappa B recruitment to the interleukin-6 gene promoter in intestinal epithelial cells through modulation of histone acetylation. J Biol Chem 278:23851-23860.

Han G, Li AG, Liang YY, Owens P, He W, Lu S, Yoshimatsu Y, Wang D, ten DP, Lin X, Wang XJ (2006) Smad7-induced beta-catenin degradation alters epidermal appendage development. Dev Cell 11:301-312.

Han KH, Choi HR, Won CH, Chung JH, Cho KH, Eun HC, Kim KH (2005) Alteration of the TGF-beta/SMAD pathway in intrinsically and UV-induced skin aging. Mech Ageing Dev 126:560-567.

Han SH, Yea SS, Jeon YJ, Yang KH, Kaminski NE (1998) Transforming growth factor-beta 1 (TGF-beta1) promotes IL-2 mRNA expression through the up-regulation of NF-kappaB, AP-1 and NF-AT in EL4 cells. J Pharmacol Exp Ther 287:1105-1112.

Haralampus-Grynaviski N, Ransom C, Ye T, Rozanowska M, Wrona M, Sarna T, Simon JD (2002) Photogeneration and quenching of reactive oxygen species by urocanic acid. J Am Chem Soc 124:3461-3468.

Hart PH, Grimbaldeston MA, Finlay-Jones JJ (2001) Sunlight, immunosuppression and skin cancer: role of histamine and mast cells. Clin Exp Pharmacol Physiol 28:1-8.

Hayashida T, Decaestecker M, Schnaper HW (2003) Cross-talk between ERK MAP kinase and Smad signaling pathways enhances TGF-beta-dependent responses in human mesangial cells. FASEB J 17:1576-1578.

He W, Cao T, Smith DA, Myers TE, Wang XJ (2001) Smads mediate signaling of the TGFbeta superfamily in normal keratinocytes but are lost during skin chemical carcinogenesis. Oncogene 20:471-483.

Heck DE, Gerecke DR, Vetrano AM, Laskin JD (2004) Solar ultraviolet radiation as a trigger of cell signal transduction. Toxicol Appl Pharmacol 195:288-297.

Hemmi H, Yoshino M, Yamazaki H, Naito M, Iyoda T, Omatsu Y, Shimoyama S, Letterio JJ, Nakabayashi T, Tagaya H, Yamane T, Ogawa M, Nishikawa S, Ryoke K, Inaba K, Hayashi S, Kunisada T (2001) Skin antigens in the steady state are trafficked to regional lymph nodes by transforming growth factor-beta1-dependent cells. Int Immunol 13:695-704.

Hoffmann A, Natoli G, Ghosh G (2006) Transcriptional regulation via the NF-kappaB signaling module. Oncogene 25:6706-6716.

Hu Y, Baud V, Delhase M, Zhang P, Deerinck T, Ellisman M, Johnson R, Karin M (1999) Abnormal morphogenesis but intact IKK activation in mice lacking the IKKalpha subunit of IkappaB kinase. Science 284:316-320.

Hu Y, Baud V, Oga T, Kim KI, Yoshida K, Karin M (2001) IKKalpha controls formation of the epidermis independently of NF-kappaB. Nature 410:710-714.

Huang TT, Kudo N, Yoshida M, Miyamoto S (2000) A nuclear export signal in the N-terminal regulatory domain of IkappaBalpha controls cytoplasmic localization of inactive NF- kappaB/IkappaBalpha complexes. Proc Natl Acad Sci U S A 97:1014-1019.

Hurley JB, Simon MI, Teplow DB, Robishaw JD, Gilman AG (1984) Homologies between signal transducing G proteins and ras gene products. Science 226:860-862.

Huse M, Chen YG, Massague J, Kuriyan J (1999) Crystal structure of the cytoplasmic domain of the type I TGF beta receptor in complex with FKBP12. Cell 96:425-436.

Ichihashi M, Ueda M, Budiyanto A, Bito T, Oka M, Fukunaga M, Tsuru K, Horikawa T (2003) UV-induced skin damage. Toxicology 189:21-39.

Imoto S, Sugiyama K, Sekine Y, Matsuda T (2005) Roles for lysine residues of the MH2 domain of Smad3 in transforming growth factor-beta signaling. FEBS Lett 579:2853-2862.

Inman GJ, Hill CS (2002) Stoichiometry of active smad-transcription factor complexes on DNA. J Biol Chem 277:51008-51016.

Ishinaga H, Jono H, Lim JH, Kweon SM, Xu H, Ha UH, Xu H, Koga T, Yan C, Feng XH, Chen LF, Li JD (2007) TGF-beta induces p65 acetylation to enhance bacteria-induced NF-kappaB activation. EMBO J 26:1150-1162.

Jana S, Jailwala P, Haribhai D, Waukau J, Glisic S, Grossman W, Mishra M, Wen R, Wang D, Williams CB, Ghosh S (2009) The role of NF-kappaB and Smad3 in TGF-beta-mediated Foxp3 expression. Eur J Immunol 39:2571-2583.

Janda E, Lehmann K, Killisch I, Jechlinger M, Herzig M, Downward J, Beug H, Grunert S (2002) Ras and TGF[beta] cooperatively regulate epithelial cell plasticity and metastasis: dissection of Ras signaling pathways. J Cell Biol 156:299-313.

Javelaud D, Mauviel A (2005) Crosstalk mechanisms between the mitogen-activated protein kinase pathways and Smad signaling downstream of TGF-beta: implications for carcinogenesis. Oncogene 24:5742-5750.

Ju XS, Ruau D, Jantti P, Sere K, Becker C, Wiercinska E, Bartz C, Erdmann B, Dooley S, Zenke M (2007) Transforming growth factor beta1 up-regulates interferon regulatory factor 8 during dendritic cell development. Eur J Immunol 37:1174-1183.

Kaplan RP (1987) Cancer complicating chronic ulcerative and scarifying mucocutaneous disorders. Adv Dermatol 2:19-46.

Karin M, Ben-Neriah Y (2000a) Phosphorylation meets ubiquitination: the control of NF- [kappa]B activity. Annu Rev Immunol 18:621-663.

Karin M, Ben-Neriah Y (2000b) Phosphorylation meets ubiquitination: the control of NF- [kappa]B activity. Annu Rev Immunol 18:621-63.:621-663.

Karin M, Cao Y, Greten FR, Li ZW (2002) NF-kappaB in cancer: from innocent bystander to major culprit. Nat Rev Cancer 2:301-310.

Kato K, Cox AD, Hisaka MM, Graham SM, Buss JE, Der CJ (1992) Isoprenoid addition to Ras protein is the critical modification for its membrane association and transforming activity. Proc Natl Acad Sci U S A 89:6403-6407.

Kato T, Jr., Delhase M, Hoffmann A, Karin M (2003) CK2 Is a C-Terminal IkappaB Kinase Responsible for NF-kappaB Activation during the UV Response. Mol Cell 12:829-839.

Kaufman CK, Fuchs E (2000) It's got you covered. NF-kappaB in the epidermis. J Cell Biol 149:999-1004.

Kim SG, Kim HA, Jong HS, Park JH, Kim NK, Hong SH, Kim TY, Bang YJ (2005) The endogenous ratio of Smad2 and Smad3 influences the cytostatic function of Smad3. Mol Biol Cell 16:4672-4683.

Kischkel FC, Hellbardt S, Behrmann I, Germer M, Pawlita M, Krammer PH, Peter ME (1995) Cytotoxicity-dependent APO-1 (Fas/CD95)-associated proteins form a death-inducing signaling complex (DISC) with the receptor. EMBO J 14:5579-5588.

Kitazawa M, Nakano T, Chuujou H, Shiojiri E, Iwasaki K, Sakamoto K (2002) Intracellular redox regulation by a cystine derivative suppresses UV-induced NF-kappa B activation. FEBS Lett 526:106-110.

Klement JF, Rice NR, Car BD, Abbondanzo SJ, Powers GD, Bhatt PH, Chen CH, Rosen CA, Stewart CL (1996) IkappaBalpha deficiency results in a sustained NF-kappaB response and severe widespread dermatitis in mice. Mol Cell Biol 16:2341-2349.

Konig HG, Kogel D, Rami A, Prehn JH (2005) TGF-{beta}1 activates two distinct type I receptors in neurons: implications for neuronal NF-{kappa}B signaling. J Cell Biol 168:1077- 1086.

Kretschmer A, Moepert K, Dames S, Sternberger M, Kaufmann J, Klippel A (2003) Differential regulation of TGF-beta signaling through Smad2, Smad3 and Smad4. Oncogene 22:6748-6763.

Kretzschmar M, Doody J, Timokhina I, Massague J (1999) A mechanism of repression of TGFbeta/ Smad signaling by oncogenic Ras. Genes Dev 13:804-816.

Kupper TS (1990) Immune and inflammatory processes in cutaneous tissues. Mechanisms and speculations. J Clin Invest 86:1783-1789.

Laiho M, DeCaprio JA, Ludlow JW, Livingston DM, Massague J (1990) Growth inhibition by TGF-beta linked to suppression of retinoblastoma protein phosphorylation. Cell 62:175-185.

Laiho M, Weis FM, Boyd FT, Ignotz RA, Massague J (1991) Responsiveness to transforming growth factor-beta (TGF-beta) restored by genetic complementation between cells defective in TGF-beta receptors I and II. J Biol Chem 266:9108-9112.

Lallemand F, Mazars A, Prunier C, Bertrand F, Kornprost M, Gallea S, Roman-Roman S, Cherqui G, Atfi A (2001) Smad7 inhibits the survival nuclear factor kappaB and potentiates apoptosis in epithelial cells. Oncogene 20:879-884.

Lee HS, Kooshesh F, Sauder DN, Kondo S (1997) Modulation of TGF-beta 1 production from human keratinocytes by UVB. Exp Dermatol 6:105-110.

Letterio JJ, Roberts AB (1998) Regulation of immune responses by TGF-beta. Annu Rev Immunol 16:137-61.:137-161.

Levine JH, Moses HL, Gold LI, Nanney LB (1993) Spatial and temporal patterns of immunoreactive transforming growth factor beta 1, beta 2, and beta 3 during excisional wound repair. Am J Pathol 143:368-380.

Levy L, Broad S, Diekmann D, Evans RD, Watt FM (2000) beta1 integrins regulate keratinocyte adhesion and differentiation by distinct mechanisms. Mol Biol Cell 11:453-466.

Lewis DA, Hengeltraub SF, Gao FC, Leivant MA, Spandau DF (2006) Aberrant NF-kappaB activity in HaCaT cells alters their response to UVB signaling. J Invest Dermatol 126:1885- 1892.

Li AG, Lu SL, Han G, Kulesz-Martin M, Wang XJ (2005) Current view of the role of transforming growth factor beta 1 in skin carcinogenesis. J Investig Dermatol Symp Proc 10:110- 117.

Li AG, Lu SL, Zhang MX, Deng C, Wang XJ (2004a) Smad3 knockout mice exhibit a resistance to skin chemical carcinogenesis. Cancer Res 64:7836-7845.

Li AG, Wang D, Feng XH, Wang XJ (2004b) Latent TGFbeta1 overexpression in keratinocytes results in a severe psoriasis-like skin disorder. EMBO J 23:1770-1781.

Li CY, Suardet L, Little JB (1995) Potential role of WAF1/Cip1/p21 as a mediator of TGF-beta cytoinhibitory effect. J Biol Chem 270:4971-4974.

Li D, Turi TG, Schuck A, Freedberg IM, Khitrov G, Blumenberg M (2001) Rays and arrays: the transcriptional program in the response of human epidermal keratinocytes to UVB illumination. FASEB J 15:2533-2535.

Li JJ, Cao Y, Young MR, Colburn NH (2000) Induced expression of dominant-negative c-jun downregulates NFkappaB and AP-1 target genes and suppresses tumor phenotype in human keratinocytes. Mol Carcinog 29:159-169.

Li N, Karin M (1998) Ionizing radiation and short wavelength UV activate NF-kappaB through two distinct mechanisms. Proc Natl Acad Sci U S A 95:13012-13017.

Lin W, Tsai WL, Shao RX, Wu G, Peng LF, Barlow LL, Chung WJ, Zhang L, Zhao H, Jang JY, Chung RT (2010) Hepatitis C virus regulates transforming growth factor beta1 production through the generation of reactive oxygen species in a nuclear factor kappaB-dependent manner. Gastroenterology 138:2509-18, 2518.

Lind MH, Rozell B, Wallin RP, van HM, Ljunggren HG, Toftgard R, Sur I (2004) Tumor necrosis factor receptor 1-mediated signaling is required for skin cancer development induced by NF-kappaB inhibition. Proc Natl Acad Sci U S A 101:4972-4977.

Lippens S, Denecker G, Ovaere P, Vandenabeele P, Declercq W (2005) Death penalty for keratinocytes: apoptosis versus cornification. Cell Death Differ 12 Suppl 2:1497-508.:1497- 1508.

Liu VC, Wong LY, Jang T, Shah AH, Park I, Yang X, Zhang Q, Lonning S, Teicher BA, Lee C (2007) Tumor evasion of the immune system by converting CD4+. J Immunol 178:2883-2892.

Liu X, Alexander V, Vijayachandra K, Bhogte E, Diamond I, Glick A (2001) Conditional epidermal expression of TGFbeta 1 blocks neonatal lethality but causes a reversible hyperplasia and alopecia. Proc Natl Acad Sci U S A 98:9139-9144.

Liu ZG, Hsu H, Goeddel DV, Karin M (1996) Dissection of TNF receptor 1 effector functions: JNK activation is not linked to apoptosis while NF-kappaB activation prevents cell death. Cell 87:565-576.

Loercher A, Lee TL, Ricker JL, Howard A, Geoghegen J, Chen Z, Sunwoo JB, Sitcheran R, Chuang EY, Mitchell JB, Baldwin AS, Jr., Van WC (2004) Nuclear factor-kappaB is an important modulator of the altered gene expression profile and malignant phenotype in squamous cell carcinoma. Cancer Res 64:6511-6523.

Lowenstein EJ, Daly RJ, Batzer AG, Li W, Margolis B, Lammers R, Ullrich A, Skolnik EY, Bar-Sagi D, Schlessinger J (1992) The SH2 and SH3 domain-containing protein GRB2 links receptor tyrosine kinases to ras signaling. Cell 70:431-442.

Lucas RM, McMichael AJ, Armstrong BK, Smith WT (2008) Estimating the global disease burden due to ultraviolet radiation exposure. Int J Epidemiol 37:654-667.

Lundberg AS, Hahn WC, Gupta P, Weinberg RA (2000) Genes involved in senescence and immortalization. Curr Opin Cell Biol 12:705-709.

Madson JG, Hansen LA (2007) Multiple mechanisms of Erbb2 action after ultraviolet irradiation of the skin. Mol Carcinog 46:624-628.

Madson JG, Lynch DT, Tinkum KL, Putta SK, Hansen LA (2006) Erbb2 regulates inflammation and proliferation in the skin after ultraviolet irradiation. Am J Pathol 169:1402-1414.

Mallipeddi R, Keane FM, McGrath JA, Mayou BJ, Eady RA (2004) Increased risk of squamous cell carcinoma in junctional epidermolysis bullosa. J Eur Acad Dermatol Venereol 18:521-526.

Malumbres M, Barbacid M (2003) RAS oncogenes: the first 30 years. Nat Rev Cancer 3:459- 465.

Mangan PR, Harrington LE, O'Quinn DB, Helms WS, Bullard DC, Elson CO, Hatton RD, Wahl SM, Schoeb TR, Weaver CT (2006) Transforming growth factor-beta induces development of the T(H)17 lineage. Nature 441:231-234.

Markell LM, Masiuk KE, Blazanin N, Glick AB (2011) Pharmacologic Inhibition of ALK5 Causes Selective Induction of Terminal Differentiation in Mouse Keratinocytes Expressing Oncogenic HRAS. Mol Cancer Res.

Massague J (1998) TGF-beta signal transduction. Annu Rev Biochem 67:753-91.:753-791.

Massague J (2004) G1 cell-cycle control and cancer. Nature 432:298-306.

Massague J (2008) A very private TGF-beta receptor embrace. Mol Cell 29:149-150.

Massague J, Seoane J, Wotton D (2005) Smad transcription factors. Genes Dev 19:2783-2810.

Massague J, Wotton D (2000) Transcriptional control by the TGF-beta/Smad signaling system. EMBO J 19:1745-1754.

Massoumi R, Chmielarska K, Hennecke K, Pfeifer A, Fassler R (2006) Cyld inhibits tumor cell proliferation by blocking Bcl-3-dependent NF-kappaB signaling. Cell %19;125:665-677.

Mathes E, O'Dea EL, Hoffmann A, Ghosh G (2008) NF-kappaB dictates the degradation pathway of IkappaBalpha. EMBO J 27:1357-1367.

Matsukura S, Odaka M, Kurokawa M, Kuga H, Homma T, Takeuchi H, Notomi K, Kokubu F, Kawaguchi M, Schleimer RP, Johnson MW, Adachi M (2010) Transforming growth factor-beta

stimulates the expression of eotaxin/CC chemokine ligand 11 and its promoter activity through binding site for nuclear factor-kappaB in airway smooth muscle cells. Clin Exp Allergy 40:763- 771.

Matsumura Y, Ananthaswamy HN (2004) Toxic effects of ultraviolet radiation on the skin. Toxicol Appl Pharmacol 195:298-308.

Matsuura I, Denissova NG, Wang G, He D, Long J, Liu F (2004) Cyclin-dependent kinases regulate the antiproliferative function of Smads. Nature 430:226-231.

Mayron R, Grimwood RE, Siegle RJ, Camisa C (1988) Verrucous carcinoma arising in ulcerative lichen planus of the soles. J Dermatol Surg Oncol 14:547-551.

McDonnell MA, Law BK, Serra R, Moses HL (2001) Antagonistic effects of TGFbeta1 and BMP-6 on skin keratinocyte differentiation. Exp Cell Res 263:265-273.

Mellon I, Spivak G, Hanawalt PC (1987) Selective removal of transcription-blocking DNA damage from the transcribed strand of the mammalian DHFR gene. Cell 51:241-249.

Mercurio F, DiDonato JA, Rosette C, Karin M (1993) p105 and p98 precursor proteins play an active role in NF-kappa B-mediated signal transduction. Genes Dev 7:705-718.

Mercurio F, Zhu H, Murray BW, Shevchenko A, Bennett BL, Li J, Young DB, Barbosa M, Mann M, Manning A, Rao A (1997) IKK-1 and IKK-2: cytokine-activated IkappaB kinases essential for NF-kappaB activation. Science 278:860-866.

Mohammed J, Ryscavage A, Perez-Lorenzo R, Gunderson AJ, Blazanin N, Glick AB (2010) TGFbeta1-induced inflammation in premalignant epidermal squamous lesions requires IL-17. J Invest Dermatol 130:2295-2303.

Moreno-Maldonado R, Ramirez A, Navarro M, Fernandez-Acenero MJ, Villanueva C, Page A, Jorcano JL, Bravo A, Llanos CM (2008) IKKalpha enhances human keratinocyte differentiation and determines the histological variant of epidermal squamous cell carcinomas. Cell Cycle 7:2021-2029.

Mori N, Morishita M, Tsukazaki T, Yamamoto N (2003) Repression of Smad-dependent transforming growth factor-beta signaling by Epstein-Barr virus latent membrane protein 1 through nuclear factor-kappaB. Int J Cancer 105:661-668.

Mulcahy LS, Smith MR, Stacey DW (1985) Requirement for ras proto-oncogene function during serum-stimulated growth of NIH 3T3 cells. Nature 313:241-243.

Murillo MM, Carmona-Cuenca I, Del CG, Ortiz C, Roncero C, Sanchez A, Fernandez M, Fabregat I (2007) Activation of NADPH oxidase by transforming growth factor-beta in hepatocytes mediates up-regulation of epidermal growth factor receptor ligands through a nuclear factor-kappaB-dependent mechanism. Biochem J 405:251-259.

Nagano T, Ueda M, Ichihashi M (1993) Expression of p53 protein is an early event in ultraviolet light-induced cutaneous squamous cell carcinogenesis. Arch Dermatol 129:1157-1161.

Nagarajan RP, Chen F, Li W, Vig E, Harrington MA, Nakshatri H, Chen Y (2000) Repression of transforming-growth-factor-beta-mediated transcription by nuclear factor kappaB. Biochem J 348 Pt 3:591-6.:591-596.

Natoli G, Costanzo A, Guido F, Moretti F, Levrero M (1998) Apoptotic, non-apoptotic, and anti- apoptotic pathways of tumor necrosis factor signalling. Biochem Pharmacol 56:915-920.

Natoli G, Costanzo A, Ianni A, Templeton DJ, Woodgett JR, Balsano C, Levrero M (1997) Activation of SAPK/JNK by TNF receptor 1 through a noncytotoxic TRAF2-dependent pathway. Science 275:200-203.

Nelson G, Paraoan L, Spiller DG, Wilde GJ, Browne MA, Djali PK, Unitt JF, Sullivan E, Floettmann E, White MR (2002) Multi-parameter analysis of the kinetics of NF-kappaB signalling and transcription in single living cells. J Cell Sci 115:1137-1148.

Nenci A, Huth M, Funteh A, Schmidt-Supprian M, Bloch W, Metzger D, Chambon P, Rajewsky K, Krieg T, Haase I, Pasparakis M (2006) Skin lesion development in a mouse model of incontinentia pigmenti is triggered by NEMO deficiency in epidermal keratinocytes and requires TNF signaling. Hum Mol Genet 15:531-542.

Norval M, El-Ghorr AA (2002) Studies to determine the immunomodulating effects of cis- urocanic acid. Methods 28:63-70.

Oft M, Peli J, Rudaz C, Schwarz H, Beug H, Reichmann E (1996) TGF-beta1 and Ha-Ras collaborate in modulating the phenotypic plasticity and invasiveness of epithelial tumor cells. Genes Dev 10:2462-2477.

Oklu R, Hesketh R (2000) The latent transforming growth factor beta binding protein (LTBP) family. Biochem J 352 Pt 3:601-10.:601-610.

Olsen WM (1988) Early cell kinetic effects of a single dose of monochromatic ultraviolet B irradiation on hairless mouse epidermis. J Invest Dermatol 91:585-589.

Omori E, Matsumoto K, Sanjo H, Sato S, Akira S, Smart RC, Ninomiya-Tsuji J (2006) TAK1 is a master regulator of epidermal homeostasis involving skin inflammation and apoptosis. J Biol Chem 281:19610-19617.

Owens P, Han G, Li AG, Wang XJ (2008) The role of Smads in skin development. J Invest Dermatol 128:783-790.

Page A, Navarro M, Garin M, Perez P, Casanova ML, Moreno R, Jorcano JL, Cascallana JL, Bravo A, Ramirez A (2010) IKKbeta leads to an inflammatory skin disease resembling interface dermatitis. J Invest Dermatol 130:1598-1610.

Palombella VJ, Rando OJ, Goldberg AL, Maniatis T (1994) The ubiquitin-proteasome pathway is required for processing the NF-kappa B1 precursor protein and the activation of NF-kappa B. Cell 78:773-785.

Park E, Zhu F, Liu B, Xia X, Shen J, Bustos T, Fischer SM, Hu Y (2007) Reduction in IkappaB kinase alpha expression promotes the development of skin papillomas and carcinomas. Cancer Res 67:9158-9168.

Pasparakis M (2009) Regulation of tissue homeostasis by NF-kappaB signalling: implications for inflammatory diseases. Nat Rev Immunol 9:778-788.

Pasparakis M, Courtois G, Hafner M, Schmidt-Supprian M, Nenci A, Toksoy A, Krampert M, Goebeler M, Gillitzer R, Israel A, Krieg T, Rajewsky K, Haase I (2002) TNF-mediated inflammatory skin disease in mice with epidermis-specific deletion of IKK2. Nature 417:861- 866.

Pasparakis M, Luedde T, Schmidt-Supprian M (2006) Dissection of the NF-kappaB signalling cascade in transgenic and knockout mice. Cell Death Differ 13:861-872.

Pelton RW, Saxena B, Jones M, Moses HL, Gold LI (1991) Immunohistochemical localization of TGF beta 1, TGF beta 2, and TGF beta 3 in the mouse embryo: expression patterns suggest multiple roles during embryonic development. J Cell Biol 115:1091-1105.

Perez-Lorenzo R, Markell LM, Hogan KA, Yuspa SH, Glick AB (2010) Transforming growth factor beta1 enhances tumor promotion in mouse skin carcinogenesis. Carcinogenesis 31:1116- 1123.

Phelps CB, Sengchanthalangsy LL, Huxford T, Ghosh G (2000) Mechanism of I kappa B alpha binding to NF-kappa B dimers. J Biol Chem 275:29840-29846.

Prendergast GC, Davide JP, deSolms SJ, Giuliani EA, Graham SL, Gibbs JB, Oliff A, Kohl NE (1994) Farnesyltransferase inhibition causes morphological reversion of ras-transformed cells by a complex mechanism that involves regulation of the actin cytoskeleton. Mol Cell Biol 14:4193- 4202.

Prokova V, Mavridou S, Papakosta P, Kardassis D (2005) Characterization of a novel transcriptionally active domain in the transforming growth factor beta-regulated Smad3 protein. Nucleic Acids Res 33:3708-3721.

Prokova V, Mosialos G, Kardassis D (2002) Inhibition of transforming growth factor beta signaling and Smad-dependent activation of transcription by the Latent Membrane Protein 1 of Epstein-Barr virus. J Biol Chem 277:9342-9350.

Proksch E, Brandner JM, Jensen JM (2008) The skin: an indispensable barrier. Exp Dermatol 17:1063-1072.

Qiao W, Li AG, Owens P, Xu X, Wang XJ, Deng CX (2006) Hair follicle defects and squamous cell carcinoma formation in Smad4 conditional knockout mouse skin. Oncogene 25:207-217.

Qin JZ, Bacon P, Chaturvedi V, Nickoloff BJ (2001) Role of NF-kappaB activity in apoptotic response of keratinocytes mediated by interferon-gamma, tumor necrosis factor-alpha, and tumor-necrosis-factor-related apoptosis-inducing ligand. J Invest Dermatol 117:898-907.

Qin JZ, Chaturvedi V, Denning MF, Choubey D, Diaz MO, Nickoloff BJ (1999b) Role of NF- kappaB in the apoptotic-resistant phenotype of keratinocytes. J Biol Chem 274:37957-37964.

Qin JZ, Chaturvedi V, Denning MF, Choubey D, Diaz MO, Nickoloff BJ (1999a) Role of NF- kappaB in the apoptotic-resistant phenotype of keratinocytes. J Biol Chem 274:37957-37964.

Quan T, He T, Kang S, Voorhees JJ, Fisher GJ (2002a) Connective tissue growth factor: expression in human skin in vivo and inhibition by ultraviolet irradiation. J Invest Dermatol 118:402-408.

Quan T, He T, Kang S, Voorhees JJ, Fisher GJ (2002b) Ultraviolet irradiation alters transforming growth factor beta/smad pathway in human skin in vivo. J Invest Dermatol 119:499-506.

Quan T, He T, Kang S, Voorhees JJ, Fisher GJ (2004) Solar ultraviolet irradiation reduces collagen in photoaged human skin by blocking transforming growth factor-beta type II receptor/Smad signaling. Am J Pathol 165:741-751.

Quan T, He T, Voorhees JJ, Fisher GJ (2001) Ultraviolet irradiation blocks cellular responses to transforming growth factor-beta by down-regulating its type-II receptor and inducing Smad7. J Biol Chem 276:26349-26356.

Raj D, Brash DE, Grossman D (2006) Keratinocyte apoptosis in epidermal development and disease. J Invest Dermatol 126:243-257.

Randolph GJ, Sanchez-Schmitz G, Liebman RM, Schakel K (2002) The CD16(+) (FcgammaRIII(+)) subset of human monocytes preferentially becomes migratory dendritic cells in a model tissue setting. J Exp Med 196:517-527.

Rebholz B, Haase I, Eckelt B, Paxian S, Flaig MJ, Ghoreschi K, Nedospasov SA, Mailhammer R, bey-Pascher S, Schultze JL, Weindl G, Forster I, Huss R, Stratis A, Ruzicka T, Rocken M, Pfeffer K, Schmid RM, Rupec RA (2007) Crosstalk between keratinocytes and adaptive immune cells in an IkappaBalpha protein-mediated inflammatory disease of the skin. Immunity 27:296- 307.

Rechsteiner M, Rogers SW (1996) PEST sequences and regulation by proteolysis. Trends Biochem Sci 21:267-271.

Rosenstein BS, Mitchell DL (1987) Action spectra for the induction of pyrimidine(6- 4)pyrimidone photoproducts and cyclobutane pyrimidine dimers in normal human skin fibroblasts. Photochem Photobiol 45:775-780.

Rossi R, Mori M, Lotti T (2007) Actinic keratosis. Int J Dermatol 46:895-904.

Rotzer D, Krampert M, Sulyok S, Braun S, Stark HJ, Boukamp P, Werner S (2006) Id proteins: novel targets of activin action, which regulate epidermal homeostasis. Oncogene 25:2070-2081.

Ruiz PA, Shkoda A, Kim SC, Sartor RB, Haller D (2006) IL-10 gene-deficient mice lack TGF- beta/Smad-mediated TLR2 degradation and fail to inhibit proinflammatory gene expression in intestinal epithelial cells under conditions of chronic inflammation. Ann N Y Acad Sci 1072:389-94.:389-394.

Ruven HJ, Seelen CM, Lohman PH, van KH, van Zeeland AA, Mullenders LH (1994) Strand- specific removal of cyclobutane pyrimidine dimers from the p53 gene in the epidermis of UVB- irradiated hairless mice. Oncogene 9:3427-3432.

Saunders N, Dahler A, Jones S, Smith R, Jetten A (1996) Interferon-gamma as a regulator of squamous differentiation. J Dermatol Sci 13:98-106.

Sayama K, Hanakawa Y, Nagai H, Shirakata Y, Dai X, Hirakawa S, Tokumaru S, Tohyama M, Yang L, Sato S, Shizuo A, Hashimoto K (2006) Transforming growth factor-beta-activated kinase 1 is essential for differentiation and the prevention of apoptosis in epidermis. J Biol Chem 281:22013-22020.

Schubbert S, Shannon K, Bollag G (2007) Hyperactive Ras in developmental disorders and cancer. Nat Rev Cancer 7:295-308.

Seitz CS, Deng H, Hinata K, Lin Q, Khavari PA (2000a) Nuclear factor kappaB subunits induce epithelial cell growth arrest. Cancer Res 60:4085-4092.

Seitz CS, Freiberg RA, Hinata K, Khavari PA (2000b) NF-kappaB determines localization and features of cell death in epidermis. J Clin Invest 105:253-260.

Seitz CS, Freiberg RA, Hinata K, Khavari PA (2000c) NF-kappaB determines localization and features of cell death in epidermis. J Clin Invest 105:253-260.

Seitz CS, Lin Q, Deng H, Khavari PA (1998c) Alterations in NF-kappaB function in transgenic epithelial tissue demonstrate a growth inhibitory role for NF-kappaB. Proc Natl Acad Sci U S A 95:2307-2312.

Seitz CS, Lin Q, Deng H, Khavari PA (1998b) Alterations in NF-kappaB function in transgenic epithelial tissue demonstrate a growth inhibitory role for NF-kappaB. Proc Natl Acad Sci U S A 95:2307-2312.

Seitz CS, Lin Q, Deng H, Khavari PA (1998a) Alterations in NF-kappaB function in transgenic epithelial tissue demonstrate a growth inhibitory role for NF-kappaB. Proc Natl Acad Sci U S A 95:2307-2312.

Sen R, Baltimore D (1986) Inducibility of kappa immunoglobulin enhancer-binding protein Nf- kappa B by a posttranslational mechanism. Cell 47:921-928.

Sesto A, Navarro M, Burslem F, Jorcano JL (2002) Analysis of the ultraviolet B response in primary human keratinocytes using oligonucleotide microarrays. Proc Natl Acad Sci U S A 99:2965-2970.

Shi Y, Wang YF, Jayaraman L, Yang H, Massague J, Pavletich NP (1998) Crystal structure of a Smad MH1 domain bound to DNA: insights on DNA binding in TGF-beta signaling. Cell 94:585-594.

Shih C, Shilo BZ, Goldfarb MP, Dannenberg A, Weinberg RA (1979) Passage of phenotypes of chemically transformed cells via transfection of DNA and chromatin. Proc Natl Acad Sci U S A 76:5714-5718.

Shirakata Y (2010) Regulation of epidermal keratinocytes by growth factors. J Dermatol Sci 59:73-80.

Shukla A, Ho Y, Liu X, Ryscavage A, Glick AB (2008) Cripto-1 alters keratinocyte differentiation via blockade of transforming growth factor-beta1 signaling: role in skin carcinogenesis. Mol Cancer Res 6:509-516.

Singh B, Schneider M, Knyazev P, Ullrich A (2009) UV-induced EGFR signal transactivation is dependent on proligand shedding by activated metalloproteases in skin cancer cell lines. Int J Cancer 124:531-539.

Slaga TJ, DiGiovanni J, Winberg LD, Budunova IV (1995) Skin carcinogenesis: characteristics, mechanisms, and prevention. Prog Clin Biol Res 391:1-20.

Smith CW, Chen Z, Dong G, Loukinova E, Pegram MY, Nicholas-Figueroa L, Van WC (1998) The host environment promotes the development of primary and metastatic squamous cell carcinomas that constitutively express proinflammatory cytokines IL-1alpha, IL-6, GM-CSF, and KC. Clin Exp Metastasis 16:655-664.

Smyth MJ, Swann J, Cretney E, Zerafa N, Yokoyama WM, Hayakawa Y (2005) NKG2D function protects the host from tumor initiation. J Exp Med 202:583-588.

Solan NJ, Miyoshi H, Carmona EM, Bren GD, Paya CV (2002) RelB cellular regulation and transcriptional activity are regulated by p100. J Biol Chem 277:1405-1418.

Sovak MA, Arsura M, Zanieski G, Kavanagh KT, Sonenshein GE (1999) The inhibitory effects of transforming growth factor beta1 on breast cancer cell proliferation are mediated through regulation of aberrant nuclear factor-kappaB/Rel expression. Cell Growth Differ 10:537-544.

Sporn MB, Roberts AB (1992) Autocrine secretion--10 years later. Ann Intern Med 117:408- 414.

Stern MC, Duran HA, McKenna EA, Conti CJ (1997) Increased apoptosis during papilloma development in mice susceptible to tumor progression. Mol Carcinog 20:137-142.

Stratis A, Pasparakis M, Rupec RA, Markur D, Hartmann K, Scharffetter-Kochanek K, Peters T, van RN, Krieg T, Haase I (2006) Pathogenic role for skin macrophages in a mouse model of keratinocyte-induced psoriasis-like skin inflammation. J Clin Invest 116:2094-2104.

Sumiyoshi K, Nakao A, Setoguchi Y, Okumura K, Ogawa H (2004) Exogenous Smad3 accelerates wound healing in a rabbit dermal ulcer model. J Invest Dermatol 123:229-236.

Sun SC (2011) Non-canonical NF-kappaB signaling pathway. Cell Res 21:71-85.

Sur I, Ulvmar M, Toftgard R (2008) The two-faced NF-kappaB in the skin. Int Rev Immunol 27:205-223.

Tai DJ, Su CC, Ma YL, Lee EH (2009) SGK1 phosphorylation of IkappaB Kinase alpha and p300 Up-regulates NF-kappaB activity and increases N-Methyl-D-aspartate receptor NR2A and NR2B expression. J Biol Chem 284:4073-4089.

Tanaka K, Hasegawa J, Asamitsu K, Okamoto T (2005) Prevention of the ultraviolet B-mediated skin photoaging by a nuclear factor kappaB inhibitor, parthenolide. J Pharmacol Exp Ther 315:624-630.

Tannehill-Gregg SH, Kusewitt DF, Rosol TJ, Weinstein M (2004) The roles of Smad2 and Smad3 in the development of chemically induced skin tumors in mice. Vet Pathol 41:278-282.

Teferedegne B, Green MR, Guo Z, Boss JM (2006) Mechanism of action of a distal NF-kappaB- dependent enhancer. Mol Cell Biol 26:5759-5770. ten Dijke P., Hill CS (2004) New insights into TGF-beta-Smad signalling. Trends Biochem Sci 29:265-273.

Teraki Y, Shiohara T (1999) Apoptosis and the skin. Eur J Dermatol 9:413-425.

Toftgard R, Yuspa SH, Roop DR (1985) Keratin gene expression in mouse skin tumors and in mouse skin treated with 12-O-tetradecanoylphorbol-13-acetate. Cancer Res 45:5845-5850.

Tremain R, Marko M, Kinnimulki V, Ueno H, Bottinger E, Glick A (2000) Defects in TGF-beta signaling overcome senescence of mouse keratinocytes expressing v-Ha-ras. Oncogene 19:1698- 1709.

Tsukazaki T, Chiang TA, Davison AF, Attisano L, Wrana JL (1998) SARA, a FYVE domain protein that recruits Smad2 to the TGFbeta receptor. Cell 95:779-791.

Uchi H, Terao H, Koga T, Furue M (2000) Cytokines and chemokines in the epidermis. J Dermatol Sci 24 Suppl 1:S29-S38.

Ulvmar MH, Sur I, Memet S, Toftgard R (2009) Timed NF-kappaB inhibition in skin reveals dual independent effects on development of HED/EDA and chronic inflammation. J Invest Dermatol 129:2584-2593.

Urbach F, Forbes PD, Davies RE (1982) Modification of photocarcinogenesis by chemical agents. J Natl Cancer Inst 69:229-235.

Vallabhapurapu S, Karin M (2009) Regulation and function of NF-kappaB transcription factors in the immune system. Annu Rev Immunol 27:693-733.

Van Antwerp DJ, Martin SJ, Kafri T, Green DR, Verma IM (1996) Suppression of TNF-alpha- induced apoptosis by NF-kappaB. Science 274:787-789. van Hogerlinden M., Rozell BL, hrlund-Richter L, Toftgard R (1999) Squamous cell carcinomas and increased apoptosis in skin with inhibited Rel/nuclear factor-kappaB signaling. Cancer Res 59:3299-3303. van Hogerlinden M., Rozell BL, Toftgard R, Sundberg JP (2004) Characterization of the progressive skin disease and inflammatory cell infiltrate in mice with inhibited NF-kappaB signaling. J Invest Dermatol 123:101-108. van Laethem A., Claerhout S, Garmyn M, Agostinis P (2005) The sunburn cell: regulation of death and survival of the keratinocyte. Int J Biochem Cell Biol 37:1547-1553.

Veldhoen M, Stockinger B (2006) TGFbeta1, a "Jack of all trades": the link with proinflammatory IL-17-producing T cells. Trends Immunol 27:358-361.

Verma IM, Stevenson JK, Schwarz EM, Van AD, Miyamoto S (1995) Rel/NF-kappa B/I kappa B family: intimate tales of association and dissociation. Genes Dev 9:2723-2735.

Vijayachandra K, Higgins W, Lee J, Glick A (2009) Induction of p16ink4a and p19ARF by TGFbeta1 contributes to growth arrest and senescence response in mouse keratinocytes. Mol Carcinog 48:181-186.

Vijayachandra K, Lee J, Glick AB (2003) Smad3 regulates senescence and malignant conversion in a mouse multistage skin carcinogenesis model. Cancer Res 63:3447-3452.

Vlantis K, Pasparakis M (2010) Role of TNF in pathologies induced by nuclear factor kappaB deficiency. Curr Dir Autoimmun 11:80-93.

Wahl SM (1994) Transforming growth factor beta: the good, the bad, and the ugly. J Exp Med 180:1587-1590.

Wahl SM, Hunt DA, Wakefield LM, Cartney-Francis N, Wahl LM, Roberts AB, Sporn MB (1987) Transforming growth factor type beta induces monocyte chemotaxis and growth factor production. Proc Natl Acad Sci U S A 84:5788-5792.

Wajant H, Pfizenmaier K, Scheurich P (2003) Tumor necrosis factor signaling. Cell Death Differ 10:45-65.

Waldrip WR, Bikoff EK, Hoodless PA, Wrana JL, Robertson EJ (1998) Smad2 signaling in extraembryonic tissues determines anterior-posterior polarity of the early mouse embryo. Cell 92:797-808.

Wang H, Kochevar IE (2005) Involvement of UVB-induced reactive oxygen species in TGF- beta biosynthesis and activation in keratinocytes. Free Radic Biol Med 38:890-897.

Wang XW, Tan NS, Ho B, Ding JL (2006) Evidence for the ancient origin of the NF- kappaB/IkappaB cascade: its archaic role in pathogen infection and immunity. Proc Natl Acad Sci U S A 103:4204-4209.

Watt FM, Jordan PW, O'Neill CH (1988) Cell shape controls terminal differentiation of human epidermal keratinocytes. Proc Natl Acad Sci U S A 85:5576-5580.

Weeks BH, He W, Olson KL, Wang XJ (2001) Inducible expression of transforming growth factor beta1 in papillomas causes rapid metastasis. Cancer Res 61:7435-7443.

Wei YY, Chen YJ, Hsiao YC, Huang YC, Lai TH, Tang CH (2008) Osteoblasts-derived TGF- beta1 enhance motility and integrin upregulation through Akt, ERK, and NF-kappaB-dependent pathway in human breast cancer cells. Mol Carcinog 47:526-537.

Wieser R, Wrana JL, Massague J (1995) GS domain mutations that constitutively activate T beta R-I, the downstream signaling component in the TGF-beta receptor complex. EMBO J 14:2199- 2208.

Wrana JL, Attisano L, Wieser R, Ventura F, Massague J (1994) Mechanism of activation of the TGF-beta receptor. Nature 370:341-347.

Wu JW, Fairman R, Penry J, Shi Y (2001) Formation of a stable heterodimer between Smad2 and Smad4. J Biol Chem 276:20688-20694.

Wullaert A, Bonnet MC, Pasparakis M (2011) NF-kappaB in the regulation of epithelial homeostasis and inflammation. Cell Res 21:146-158.

Yamasaki K, Toriu N, Hanakawa Y, Shirakata Y, Sayama K, Takayanagi A, Ohtsubo M, Gamou S, Shimizu N, Fujii M, Miyazono K, Hashimoto K (2003) Keratinocyte growth inhibition by high-dose epidermal growth factor is mediated by transforming growth factor beta autoinduction: a negative feedback mechanism for keratinocyte growth. J Invest Dermatol 120:1030-1037.

Yan M, Peng J, Jabbar IA, Liu X, Filgueira L, Frazer IH, Thomas R (2005) Activation of dendritic cells by human papillomavirus-like particles through TLR4 and NF-kappaB-mediated signalling, moderated by TGF-beta. Immunol Cell Biol 83:83-91.

Yang L, Mao C, Teng Y, Li W, Zhang J, Cheng X, Li X, Han X, Xia Z, Deng H, Yang X (2005) Targeted disruption of Smad4 in mouse epidermis results in failure of hair follicle cycling and formation of skin tumors. Cancer Res 65:8671-8678.

Yang X, Letterio JJ, Lechleider RJ, Chen L, Hayman R, Gu H, Roberts AB, Deng C (1999) Targeted disruption of SMAD3 results in impaired mucosal immunity and diminished T cell responsiveness to TGF-beta. EMBO J 18:1280-1291.

Yantsos VA, Conrad N, Zabawski E, Cockerell CJ (1999) Incipient intraepidermal cutaneous squamous cell carcinoma: a proposal for reclassifying and grading solar (actinic) keratoses. Semin Cutan Med Surg 18:3-14.

Yaron A, Hatzubai A, Davis M, Lavon I, Amit S, Manning AM, Andersen JS, Mann M, Mercurio F, Ben-Neriah Y (1998) Identification of the receptor component of the IkappaBalpha- ubiquitin ligase. Nature 396:590-594.

Yeh YY, Chiao CC, Kuo WY, Hsiao YC, Chen YJ, Wei YY, Lai TH, Fong YC, Tang CH (2008) TGF-beta1 increases motility and alphavbeta3 integrin up-regulation via PI3K, Akt and NF- kappaB-dependent pathway in human chondrosarcoma cells. Biochem Pharmacol 75:1292-1301.

Young AR (2006) Acute effects of UVR on human eyes and skin. Prog Biophys Mol Biol 92:80- 85.

Yuspa SH, Dlugosz AA, Cheng CK, Denning MF, Tennenbaum T, Glick AB, Weinberg WC (1994) Role of oncogenes and tumor suppressor genes in multistage carcinogenesis. J Invest Dermatol 103:90S-95S.

Yuspa SH, Hawley-Nelson P, Koehler B, Stanley JR (1980) A survey of transformation markers in differentiating epidermal cell lines in culture. Cancer Res 40:4694-4703.

Zandi E, Chen Y, Karin M (1998) Direct phosphorylation of IkappaB by IKKalpha and IKKbeta: discrimination between free and NF-kappaB-bound substrate. Science 281:1360-1363.

Zawel L, Dai JL, Buckhaults P, Zhou S, Kinzler KW, Vogelstein B, Kern SE (1998) Human Smad3 and Smad4 are sequence-specific transcription activators. Mol Cell 1:611-617.

Zhu F, Park E, Liu B, Xia X, Fischer SM, Hu Y (2009) Critical role of IkappaB kinase alpha in embryonic skin development and skin carcinogenesis. Histol Histopathol 24:265-271.

Zhu HJ, Sizeland AM (1999) A pivotal role for the transmembrane domain in transforming growth factor-beta receptor activation. J Biol Chem 274:11773-11781.

Zhu Y, Richardson JA, Parada LF, Graff JM (1998) Smad3 mutant mice develop metastatic colorectal cancer. Cell 94:703-714.

Chapter 2

Transforming Growth Factor β1 Modulates NFκB in Primary Mouse Keratinocytes

I Abstract

II Introduction

The integration of signal transduction pathways is critical to maintaining tissue and cellular homeostasis. Signals originating at the cell surface are modified by various inputs so that cells can respond in a highly cell-specific, context-dependent manner. This is an idea that holds true in the nucleus as well, where transcription factors and comodulators converge, assemble transcriptional machinery, and integrate multiple upstream signaling inputs. The integration of various inputs allows a cell to fine tune its response to stumuli from the extracellular environment.

Nuclear factor kappa B (NFκB) and transforming growth factor β-1 (TGFβ-1) are not only critical factors mediating inflammation, but they also play a substantial role in cancer progression. Little is known about how these factors interact in keratinocytes, which rely heavily on TGFβ-1 and NFκB to maintain homeostasis. In other cell types, previous studies have identified cross-regulation of the NFκB and TGFβ-1 pathways in a variety of contexts. In fact, several mechanisms of TGFβ-1 mediated NFκB activation have been identified. In some instances, TGFβ-1-mediated NFκB transactivation of gene expression requires cooperative binding of NFκB and Smad at distinct enhancer sites. Expression of type II collagen in fibroblasts is one such example of gene regulation that depends on TGFβ-1 modulation of NFκB (Kon et al., 1999). In human umbilical vein endothelial cells, NFκB-dependent e-selectin expression is contingent on the availability of p300/CBP coactivators. The presence of Smad2, these coactivators are no longer available to NFκB and e-selectin expression is suppressed (DiChiara et al., 2000). In human colonic epithelial cells, nontypeable Haemophilus influenza- induced mucin requires activation of the TGFβ-1 signaling pathway that converges in the nucleus with NFκB, which has been activated by both the canonical and a noncanonical pathway upstream (Jono et al., 2002). Although there exists some precedence in the literature for a positive interaction between TGFβ-1 and NFκB, in a vast majority of epithelial cells and other cell types TGFβ-1 negatively regulates NFκB.

In keratinocytes, the results of the present studies show that TGFβ-1 is required for NFκB-dependent expression of proinflammatory cytokines. These studies show examples of proinflammatory cytokines which are both Smad- and NFκB-dependent and suggest that an interaction occurs between NFκB and Smad3 during transcription. Preliminary studies revealed that TGFβ-1-modulation of NFκB may also play a role during differentiation, in apoptosis, and in the modulation of ras-induced gene expression.

III Materials and Methods

A. Materials

TGFβ-1 (R&D Systems, Minneapolis, MN) was used at a standard dose (1ng/mL of media) in keratinocytes as was TPA (200 nM) (Calbiochem, La Jolla, CA). Inhibitors of TGFβ- 1 signaling included SB-431542 (0.5 uM) (Sigma, St. Louis, MO) according to a published report in keratinocytes specifically (Mordasky et al., 2010;Inman et al., 2002). SIS3, a small inhibitor of Smad3, was used at a concentration of 3 uM (Sigma, St. Louis, MO) (Jinnin et al., 2006). For activation of the canonical NFκB pathway, TNFα (30 ng/mL) (PeproTech, Princeton, NJ) was used at what is considered a standard dose in keratinocytes. To inhibit the NFκB pathway, IκK inhibitor parthenolide (Biomol, Plymouth Meeting, PA) was used at a concentration of 20 nM (Hehner et al., 1998;Hehner et al., 1999), and p65 inhibitor Caffeic acid phenethyl ester (CAPE) (a gift from the Mastro Lab, Penn State University) was used at a concentration of 5 ug/mL (Natarajan et al., 1996). PKC activation inhibitors included bisindolylmaleimide (5uM) (Toullec et al., 1991), G0-6976 (5 uM) (Gschwendt et al., 1996) and

a PKD activation inhibitor CID-755673 (a gift from the Wang Lab at the University of Pittsburgh) (10 uM) (Sharlow et al., 2008). An inhibitor of TAK-1, 5Z-7-Oxozeanenol (EMD, Gibbstown, NJ) (3-300 uM) (Ninomiya-Tsuji et al., 2003) was utilized in keratinocytes to inhibit a kinase connecting the TGFβ-1 receptor and IκK. To activate doxcycline inducible genes in vivo, 1 mg/kg was fed in chow to transgenic mice. Alternatively, 1ug/mL media was added to tissue culture of primary keratinocytes isolated from transgenic mice according to standard protocol utilized in the laboratory.

B. Animal Studies

Skin-specific expression of bioactive TGFβ-1, HaRasV12G, or both transgenes was achieved using a doxycycline inducible transgene system in an FVB strain of mouse. In this model, binding of the tetracycline analog to the constituitively expressed tetracycline transactivator (rTA) activates the tetracycline operator (tetO) and induces the expression of the (porcine) TGFβ-1 or (human) HaRas transgene in the keratin 5 (K5) expressing basal layer of skin. For doxycycline inducible HaRas transgene overexpression, a keratin 5 (K5) rTA mouse line (Diamond et al., 2000) was crossed with a tetORasV12G line (Chin et al., 1999) to produce a double transgenic K5rTA x tetORas line. For doxycycline inducible TGFβ-1 transgene overexpression, the keratin 5 (K5) rTA line was crossed with a tetOTGFβ-1 line (Liu et al., 2001) to produce a double transgenic K5rTA x tetOTGFβ1 line. To produce mice overexpressing both HaRas and TGFβ-1, K5rTA x tetOTGFβ-1 heterozygotes were crossed with tetORas homozygotes. Alternatively, K5rTA x tetORas mice were crossed with tetOTGFβ1 homozygotes to produce triple transgenic mice expressing both transgenes. These crosses produced single, double, and triple transgenic mice on an FVB/n background. To induce transgenes, 6 week old mice were treated with 1g/kg doxycycline in chow for 2 d. Prior to sacrifice, mice were administered 1g/kg doxycycline in chow for 48 hours and shaved just prior to sacrifice. Use of animals was approved by the Institutional Animal Care and Use Committee (IACUC).

C. Isolation of keratinocytes

Isolation of primary keratinocytes from mouse pups was performed according to Dlugosz et al. (Dlugosz et al., 1995). Briefly, keratinocytes were isolated from 1-3 day old litters born to FVB/n, Smad3 wild type, heterozygous, and knockout mice (C57BL/J6) (Datto et al., 1999), TGFβ-1 wild type and heterozygous mice (Balb/c) (Kulkarni et al., 1993), and NFκB1/p50 wild type, heterozyogous, and knockout mice (FVB) (Sha et al., 1995). Knockout and heterozygous mice were identified by tail snips genotyping at time of sacrifice. Isolated skins were trypsinized in 0.25% trypsin without EDTA (Cellgro, Manassas, VA) overnight at 4˙C. Trypsinization of skin resulted in separation of epidermis from dermis. Once separated, the epidermis was then minced in S-MEM media (Invitrogen, Carlsbad, CA) containing 1.4mM calcium. Minced epidermis was strained through a 100 μm nylon cell strainer (BD Falcon, Bedford, MA).

Isolated cells were pelleted by centrifugation at 800 rpm and then reconstituted in 1mL S-MEM media per mouse skin and amended with calcium chloride to a final concentration of 0.2mM. Cells that were cryopreserved contained 10% DMSO and were placed at -80˙C before being submerged in liquid nitrogen.

D. Cell culture

Primary mouse keratinocytes were plated in S-MEM (Earle’s salts, L-glutamate, non- essential amino acids, sodium phosphate monobasic at 0.14 g/L, without calcium chloride) containing 8% chelexed bovine serum amended with a final calcium chloride concentration of 0.2 mM. Typically, cells were plated in terms of a “mouse equivalent” or the amount of basal cells contained within the skin of one pup. The amount of cells in one mouse equivalent depended on the age of the pup. Each dish or tray required a particular number of mouse equivalents. However, for isolation of nuclear extract, 5 million cells were plated per 100 mm tissue culture dish. Within 12 hours of initial plating, the medium was replaced with fresh medium containing a final concentration of 0.05mM calcium chloride (Hennings et al., 1980b;Hennings et al., 1980a). Subsequent changes of media occurred 48 hours later or according to the requirements of a specific experiment. Calcium concentration remained 0.05mM through the course of the experiment to prevent differentiation.

Mouse cell lines (SP-1, PAM 212, and SCC) were also grown in S-MEM containing 0.05mM calcium chloride. Mouse cell lines, in particular, reflect stages of tumor progression ranging from papilloma to transformed tumor. The SP-1 cell line was originally isolated from papillomas produced by initiation and promotion of SENCAR mouse skin, which is highly susceptible to tumor formation (Strickland et al., 1988). PAM 212 is a cell line originally derived from a population of spontaneously transformed keratinocytes, which were originally isolated from BALB/c mouse pups (Smith et al., 1998).

E. Cell Viability Assay

Cell viability was determined by the CellTiter 96 Non-Radioactive Cell Proliferation Assay (Promega, Madison, WI), which measured the viability of cells by their ability to metabolize tetrazolium salt to a formazan product. Assay dye (15 uL) was added to each well of a 96 well plate containing confluent cells. Three hours later, 100 uL Stop/Solubilization solution was added to each well to stop the reaction and solubilize the formazan product. Formation of the formazan product, indicating cell viability, was detected by absorbance at 570 nm using a plate reader.

F. Caspase 3/7 Activity

Apoptosis was measured indirectly by determination of caspase-3 and-7 activity using a proluminescent caspase-3/7 substrate using a Caspase-Glo 3/7 Assay (Promega, Madison, WI).

The product of the cleaved substrate was amino-luciferin, which was metabolized by luciferase to produce light. Caspase-Glo 3/7 Buffer and lyophilized Caspase-Glo 3/7 Substrate were equilibrated to room temperature, mixed, and stored no longer than 4 weeks at -20˙C. Confluent cells were grown in a 96 well plate, pre-treated with parthenolide (10 nM) for 1h and then treated with TGFβ-1 (1ng/mL) for 24 h.

G. Preparation of whole cell lysates

Whole cell lysate consisting of a crude prep or cytosolic and nuclear components was obtained using a RIPA buffer (1% Triton-X, 0.5% sodium deoxycholate, 0.1% SDS, 50 mM Tris HCl pH 7.4, 150 mM NaCl, 1 mM EDTA) with a protease and phosphatase inhibitor cocktail (10 mM NaF, 2 mM sodium orthovanadate , 1 mM phenylmethylsulfonyl fluoride (PMSF), 10 ug/mL leupeptin, 10 ug/mL aprotinin, 10 ug/mL trypsin inhibitor) containing inhibitors of tyrosine phosphatase, serine protease, calpain, and aspartyl protease. Cells were scraped, collected into centrifuge tubes, centrifuged at 13,000 x g for 15 min at 4˙C. Cleared lysates were transferred to a fresh centrifuge tube, aliquoted into smaller volumes, and stored at -80˙C to protect phophoproteins. Protein concentrations were determined by BCA protein assay.

H. Western analysis Protein samples were heated to 95 degrees C for 5 min and resolved on a 12.5% polyacrylamide gel (for 1 gel, 5 mL 30% bis-acrylamide, 3 mL 1.5 M Tris pH 8.8, 3.775 mL dH2O, 120 uL 10% SDS, 90 uL 10% APS, 6 uL TEMED) at 120 V for approximately 2 hours (Sivaprasad et al., 2004). Proteins were transferred to 0.2 μM nitrocellulose (BioRad, Hercules, CA) at 100V for 1 hour. Protein-containing membranes were blocked with 5% powder milk dissolved in wash buffer (10 mL 1 M Tris, 40 mL 5M NaCl, 4 mL Tween 20). Membranes were incubated with antibodies against: pSmad 2 (1:1000) (Cell Signaling, Danvers, MA); actin (1:10,000) (Millipore, Billerica, MA); total IκB C-21 (1:2000) (Santa Cruz, Santa Cruz, CA); p- IKKα (1:1000) (Santa Cruz, Santa Cruz, CA); pSmad3 (1:1000) (Epitomics, Burlingame, CA); α-tubulin (1:1000) (Invitrogen, Carlsbad, CA); p50 C-19 (1:500) (Santa Cruz, Santa Cruz, CA) ; p65 F-6 (Santa Cruz, Santa Cruz, CA); and Lamin A/C (1:1000) (Cell Signaling, Danvers, MA); acetyl p65 (Lys310) (Cell Signaling, Danvers, MA). Following overnight incubation with primary antibodies, membranes were incubated 1h at room temperature with an appropriate horseradish peroxidase-linked secondary antibody. Peroxidase activity was detected by enhanced chemiluminesence (Thermo Scientific, Rockford, IL) and autoradiography (American Digital Imaging, Boise, ID).

I. Preparation of nuclear extract

Confluent cells were washed twice with ice cold PBS and kept on ice in a tilted position. Buffer A (0.33M sucrose, 10mM Hepes pH 7.4, 1mM MgCl2, 0.1% Triton X-100) amended

with protease and phosphatase inhibitors described above was applied to each dish, which was kept on ice. Prior to applying Buffer A, plates were again aspirated. To a 100 mm plate of cells, 0.3 mL Buffer A was added. Plates remained on ice and were gently scraped. Lysates were collected in a microcentrifuge tube and kept on ice for 30 minutes to extract the cytosolic proteins from plasma membrane, DNA, and nucleoli. Lysates were centrifuged at top speed for 5 minutes at 4˙C. Supernatent representing the cytosolic fraction was collected and transferred to a chilled microcentrifuge tube and kept on ice. To remove any contaminating cytosolic fraction, the remaining pellet was washed twice with 1 mL Buffer A and centrifuged at 14,000 rpm for 5 min. Buffer A wash buffer was removed by aspiration and 0.15 mL Buffer B (0.45M NaCl, 10mM Hepes pH 7.4, 1mM MgCl2) containing protease inhibitors as previously described. The pellet containing Buffer B was gently resuspended by pipet and incubated on ice for 1 h. Every 10 min., tubes were flicked. Tubes were centrifuged at 14,000 rpm for 5 min at 4˙C, the nuclear extract removed and aliquoted to cold centrifuge tubes, which were stored at 80˙C. Protein was quantified as described above and extracts and lysates where assayed by western analysis for the presence and absence of the nucleus-specific lamin A/C and the cytoplasm-specific α-tubulin to determine the purity of the fractions.

J. Electrophoretic mobility shift assay

Electrophoretic mobility shift assays (EMSA) were performed according to modifications of a published protocol (Davis et al., 2001). De-salted oligos (~100 μM working stock) (Qiagen, Valencia, CA) were custom made. The sequences are: F-AGT TGA GGG GAC TTT CCC AGG C and R-GCC TGG GAA AGT CCC CTC AAC T. The probe annealing reaction included 1 uL of forward and reverse primers, 5 uL annealing buffer (200 mM Tris-HCl pH 7.5; 100 mM MgCl2; 250 mM NaCl) and 18 uL H2O. The reaction was heated for 2 min at 98˙C and cooled on the bench top. Probe labeling required combining 18 uL dH2O, 3 uL of annealed probe, 3 uL T4 polykinase (Promega, Madison, WI), and 3 uL kinase buffer (Promega, Madison, WI), and 3 uL 32P-ATP gamma (MP Biomedicals, Solon, OH). The probe labeling reaction was heated in a water bath at 37˙C for 1 h. Labeled probe was then column purified by first draining a Micro Bio-Spin chromatography column (Biorad, Hercules, CA) by gravity filtration. The column was then centrifuged at 1000 x g for 45 sec to remove remaining buffer. Radioactive probe was applied to the column and the column was centrifuged at 1000 x g for 4 min. Counts (cpm) and column efficiency were measure in a scintillation counter (Beckman, Brea, CA) to determine the dilution factor required to achieve 20,000 cpm/uL. Column efficiency was between 20-30%. For the EMSA reaction, 2 uL labeled probe, 5 uL polydIdC (Sigma, St. Louis, MO), 4 uL 5x binding buffer (20% glycerol, 5 mM MgCl2, 2.5 mM EDTA, 2.5 mM DTT, 250 mM NaCl, 50 mM Tris-HCl pH 7.5), and 9uL of sample (10 ug) were combined and incubated for 20 min. Reactions were performed with a mutant probe (sense: 5’-AGT TGA GGC GAC TTT CCC AGG C-3’; anti-sense: 5’-GCC TGG GAA AGT CGC CTC AAC T-3’) to show specificity of the signal (Shan et al., 2008). The signal produced from the EMSA reaction using the mutant

70 probe was slightly higher than the signal produced by the non-mutant probe. A control using 1 uL (100 pmol) of free probe resulted in the cold probe out competing hot probe and thus the signal. All reactions were incubated at room temperature for 20 min. Nucleic Acid Sample Buffer (5x) (Biorad, Hercules, CA) was added to each reaction (4uL). A centriguation was performed at 14,000 x g to pellet any precipitants in the reaction, which tended to become trapped in the wells. Reactions with sample buffer were loaded into a Criterion 5% TBE gel (Biorad, Hercules, CA). Gel electrophoresis was performed at 120V using 1x TBE buffer (5x buffer recipe: 108 g Tris base, 55 g boric acid, 40 mL 0.5M EDTA in 2L of dH2O) until the lower dye front was approximately 2/3 through the gel. The gel was adhered to a piece of Whatman and dried for about 2h in a gel dryer.

K. Supershift assay

Supershifts were performed by adding 1ug of antibody 30 min prior to the addition of the radiolabeled probe. Supershifts were performed with p50 NLS (Santa Cruz, Santa Cruz, CA), p65 F6 (Santa Cruz, Santa Cruz CA), and IgG as an isotype control.

L. RNA Isolation

To isolate RNA from cells, 1 mL Trizol (Invitrogen, Carlsbad, CA) was applied to cells growing on a 60 mm tissue culture dish and collected in a 2 mL chloroform resistant microcentrifuge tube. For tissue, 50-100 mg was homogenized in 1 mL Trizol using a tissue lyzer (Qiagen, Valenicia, CA) at the rate of 30 beats/sec x 4 minutes for a total of 8 minutes, while altering the orientation of the plate between runs. Supernatant was transferred to a fresh 2 mL centrifuge tube, and passed twice through a 26 gauge needle. Chloroform (0.2 mL/1 mL Trizol) was added to each sample, vigorously shaken for 15 sec and incubated at room temperature for 2-3 minutes. Samples were then centrifuged at 12,000 x g for 15 min. The top or aqueous phase was transferred to a fresh 2 mL centrifuge tube and 1 uL (5 ug/uL) RNAse-free glycogen (Invitrogen, Carlsbad, CA) was added as an RNA carrier. Isopropyl alcohol (0.5 mL/1mL Trizol) was added to each sample and incubated for 10 min. Samples were then centrifuged at 12,000 x g for 10 min. at 4˙C. Supernatent was aspirated and pellets were washed with 75% ethanol. Samples were then centrifuged at 7500 x g for 5 min. at 4˙C and supernatant aspirated. The remaining RNA pellet was dried for 10 min in a tube rack under a fume hood. The dried pellet was then dissolved in 50 uL DEPC by placing the tube on ice for 2 h. Resuspended RNA was incubated at 55˙C for 10 min. and stored at -80˙C.

M. cDNA synthesis

RNA was quantified on a Nanodrop (Thermo Scientific, Wilmington, DE) using the 260 nm wavelength to determine nucleic acid composition and the 280 nm wavelength to assess

protein contamination. A 260/280 ratio of 1.8 indicated purity of the RNA. RNA was diluted to 200 ng/uL. Each reverse transcription reaction contained the following volulme of reagents: 5 uL 5x reverse transcription buffer (Promega, Madison, WI), 0.5 uL 50x 100mM dNTP (Denville Scientific, Metuchen, NJ), 500 ng/mL random primer (Promega, Madison, WI), 0.31uL reverse transcriptase (Promega, Madison, NJ), 12.44 uL DEPC-dH2O. However, a mastermix was made based on the number of reactions such that 18.75 uL master mix was added to 6.25uL (200ng/uL) for a final RNA concentration of 1.25 ug/25uL. The reactions were then placed in a heat block (25˙C for 10 min, 42˙C for 2h, 85˙C for 5 min.) To control for amplification of contaiminating genomic DNA, one reaction lacked reverse transcriptase. cDNA resulting from reverse transcriptase reaction was stored at -20 ˙C.

N. qPCR

A master mix was made from 15 uL PerfeCTa SYBR Green SuperMix for iQ, 0.8 uL forward and reverse primers, and 3.4 uL dH2O (Quanta Biosciences, Gaithersburg, MD). Reactions consisted of master mix and 50 ng cDNA, which was amplified for 2 min. at 50˙C, 10 min at 95˙C, then 40 cycles of 95˙C for 15 sec., and 60˙C for 1 min. Melt curve analysis followed relative quantification of gene expression to assure specificity of amplification.

Primer 1 Sequence (5'-3') Primer 2 Sequence (5'-3') 18S TCAACTTTCGATGGTAGTCGCCGT TCCTTGGATGTGGTAGCCGTTTCT Mip-3a CGACTGTTGCCTCTCGTACA AGCCCTTTTCACCCAGTTCT IL-1b AAGGGCTGCTTCCAAACCTTTGAC ATACTGCCTGCCTGAAGCTCTTGT IL-6 AACCGCTATGAAGTTCCTCTCTGC TAAGCCTCCGACTTGTGAAGTGGT KC GCTGGGATTCACCTCAAGAA TCTCCGTTACTTGGGGACAC MIP-2 TTGCTCGGGCCTTAAAAGTA AGGGTCCACAGCTCATCATC S100A8 ATGCCGTCTGAACTGGAGAA TGGCTGTCTTTGTGAGATGC S100A9 TCATCGACACCTTCCATCAA TTACTTCCCACAGCCTTTGC TNFα GATTATGGCTCAGGGTCCAA GAGACAGAGGCAACCTGACC

O. v-Ha-Ras transduction

Three days post-plating, 0.5 mL v-RasHA retrovirus was applied to 60 mm tissue culture dishes at a 1:2 dilution using media with 0.05 mM calcium chloride. The v-RasHA retrovirus was generated from Ψ producer cells (Roop et al., 1986) and titred by NIH3T3 focus forming assay. Once applied, plates were rocked at 15 min. increments for 1h, after which time, 3.0 mL media was added to plates. The retrovirus remained on the plates for a total of 3 days and then the media was again changed. Experiments were performed approximately 1d after the media change.

P. Luciferase Assay

Luciferase reporter plasmids were constructed of either Smad or NFκB binding element sequences. Smad reporter plasmids contained one copy of the Smad 2 binding element and two copies of the Smad 4 binding element (Zawel et al., 1998). NFκB reporter plasmids contained two copies of the immunoglobulin kappa NFκB binding sequences (Saksela and Baltimore, 1993). Additional plasmids that were co-transfected included: pBabe puro FLAG-SMAD3 (made by Dr. Adam Glick), pCMV4-p50 (a gift from Dr. Min-Ying Zhang, Penn State University), pCMV4-p65 (a gift from Dr. Vanden Heuvel, Penn State University), and DN-TAK- 1(K63W) (a gift from Dr. Ninomiya-Tsuji, North Caroline State University). A renilla- luciferase control plasmid (pRL-CMV) was co-transfected in order measure transfection efficiency. Luciferase assays were performed in 24 well dishes of confluent cells. Each well received 100 uL serum free media and 50 uL of plasmid DNA combined with a lipid carrier. Each assembled reactions included 0.5 ug luciferase reporter plasmid, 0.1 ug pRL-CMV, 50 uL serum free media, and 2 uL Lipofectamine 2000 (Invitrogen, Carlsbad, CA). Once applied, plates were incubated at 37˙C for 4h. Tranfection media was removed and replaced by media containing 0.05 mM calcium chloride. Luciferase and renilla activity was measured by a Promega 20/20 luminometer (Promega, Madison, WI).

Q. siRNA transfection Conical tubes (15 mL) were labeled for master mix, and included one designated for control siRNA and one designated for PKCα siRNA. One mL media (for each 60 mm tissue culture plate) containing 0.2% serum was placed in each tube. To these tubes, a final concentration of 20 nM siRNA was added and briefly vortexed. Hyperfect (Qiagen, Valencia, Ca) (1uL/mL media) was added to tubes and incubated from 10 min at room temperature. Plates of cells to be transfected with siRNA master mix were washed with 0.2% serum media and aspirated. To each aspirated plate, 1 mL master mix was added and incubated for 1.5 h. Plates were shaken every 10-15 min. Finally, 3 mL low calcium media were added and plates were placed in the incubator for later treatment.

R. Adenoviral Infection

Cells plated in a p100 dish were grown to 80% confluency and infected by an IκB super repressor or an empty adenoviral vector, which were produced in QBI 293 cells at the Protein Expression and Production Laboratory at the NIH. The titer of the adenoviral IKB super repressor and the empty vector was 6.2 x 1011 ifu/mL and 2.5 x 1011 ifu/mL, respectively. A concentration of either virus was added to 1 mL of 4 ug/mL polybreen to achieve a multiplicity of infection (MOI) of 10.

S. Statistical Analysis

One way analysis of variance (ANOVA) with Tukey’s post test was used as a test of significance. P values of <0.05 were considered significant. Dixon’x Q-test was used for identification and rejection of signal outliers.

IV Results

A. TGFβ-1 mediated TNFα expression is NFκB and Smad3 dependent

Proinflammatory cytokine expression in skin of mice over-expressing a TGFβ-1 transgene in basal keratinocytes (K5/rTA x tetOTGFβ-1) was assayed by RT-qPCR. In this model, over-expression of TGFβ-1 significantly increased mRNA expression of IL-1b (Figure 1a), IL-6 (Figure 1b), KC (Figure 1c), S100A9 (Figure 1d), TNFα (Figure 1e), MIP3a (Figure 1f), S100A8 (Figure 1g), MIP2 (Figure 1h). Further studies focused, in particular, on TNFα because of its critical role in skin physiology and pathogenesis (Wullaert et al., 2011;Pasparakis et al., 2002). To examine the time course of TNFα expression, FVB/n primary mouse keratinocytes were treated with TGFβ-1 and harvested 6 and 24 h post treatment. TNFα mRNA expression increased at 6 h and was sustained at 24 h (Figure 2a). To date, TGFβ-1-induced TNFα has only been observed in peripheral blood monocytes (Chen et al., 2008), but has not been reported in keratinocytes. As expected, TGFβ-1-treated keratinocytes heterozygous for p50 showed a significant decrease in TGFβ-1-induced TNFα expression versus expression in wildtype cells (Figure 2b). Curiuosly, a constitutively high expression of TNFα was observed in p50 knockout keratinocytes indicating a possible role for p50 homodimers in repression of TNFα. However, TGFβ-1-treated p50 knockout keratinocytes resulted in no expression of TNFα over control, thus strongly suggesting that TGFβ-1-induction of TNFα is NFκB-dependent.

To test the hypothesis that TGFβ-1-induced TNFα expression is also Smad3-dependent, Smad3 wild type and knockout keratinocytes were treated with TGFβ-1 and harvested 6 and 24 h post treatment. In addition to NFκB, Smad3 is also required for TNFα expression in keratinocytes (Figure 3). Although a decrease in TNFα expression was observed in Smad3 knockout keratinocytes at 6 h, this decrement was only significant at 24 h post TGFβ-1 treatment. The kinetics of TGFβ-1-induced TNFα expression suggests that TGFβ-1 may not be directly activating TNFα, although induction was seen as early as 6 h, suggesting otherwise. To explore the converse effect of TGFβ-1 signaling on TNFα, FVB/n primary keratinocytes were inhibited by the type I TGFβ receptor inhibitor SB-431542. TNFα-induced NFκB transactivation occuring at 24 h in FVB/n primary keratinocytes was inhibited by the type I TGFβ receptor inhibitor SB-431542 (Figure 4). This observation indicated that in addition to exogenous TGFβ-1-induced TNFα, TNFα transactivation appears to be partially regulated by endogenous TGFβ-1 signaling

Taken together, these data show for the first time in keratinocytes that TGFβ-1 regulates the expression of TNFα and that this regulation requires both NFκB and Smad-3 transcription factors. Although the highest expression of TNFα occured 24 h post treatment, earlier

FIGURE 2-1

TGFβ-1 mediates NFκB- dependent proinflammatory cytokine expression in mice with skin-targeted doxycycline-inducible TGFβ-1 over-expression (K5rTA/ tetOTGFβ-1)

(A-H)

mRNA accumulation was measured by RT-qPCR and normalized to 18S in skin of null mice (n=2 mice) or mice treated for 48 h with doxycycline (n=7 mice) collected over a period of time as animals became available. Data are represented as fold increase over null control. NT denotes non-transgenic (null) mouse; K5-TGFβ-1 denotes transgenic TGFβ- 1over-expressing mouse. This figure represents a portion of Figure 37 including data from NT and K5-TGFβ-1. *p<0.05 vscontrol.

FIGURE 2-2a

TGFβ-1-induced TNFα expression is increased at 6 h and sustained by 24 h

mRNA accumulation was measured in FVB/n primary mouse keratinocytesby RT-qPCR and normalized to 18S (n=3 plates of cells). Data are represented as fold increase over control and represent one experiment, which was repeated 3 times.

FIGURE 2-2b

TGFβ-1-induced TNFα expression is NFκB-dependent

mRNA accumulation was measured in p50 wild type, heterozygous, and knockout primary mouse keratinocytesby RT-qPCR and normalized to 18S (n=2-3 wells of cells). Data are represented as fold increase over respective control and are representative of an experiment that has been repeated twice. *p<0.05 vs a or b.

FIGURE 2-3

TGFβ-1-induced TNFα expression is Smad3 dependent and sustained over 24 h

mRNA accumulation was measured in Smad3 wild type and knockout primary mouse keratinocytes(n=4 wells of cells) by RT-qPCR and normalized to 18S. Data are represented as fold increase over wild type control and reflect a representative experiment. Experiment was repeated 3 times. *p<0.05 vs a or b.

FIGURE 2-4

TNFα-induced NFκB transactivation is abrogated by inhibition of the endogenous TGFβ-1 signaling pathway

FVB/n primary mouse keratinocyteswere cotransfected with 2x NFκB lucifera se reporter plasmid. Cells were pretreated with the type I TGFβ receptor inhibitor SB- 431542 for 1 h and treated with TNFα for 24 h (n=3-7 wells of cells). Luciferase activity was detected on a plate reader luminometer. Data are represented as fold over control and reflect a representative experiment, which was repeated 3 times. *p<0.05 vs a or b.

expression was evident as well. This suggested that the kinetics of TGFβ-1-induced TNFα are not rapid and that recruitment of additional factors or pathways is likely required.

B. TGFβ-1 fails to activate upstream NFκB signaling factors, but regulates NFκB binding to DNA and transactivation

To determine upstream signaling events that mediate transactivation of NFκB, FVB/n keratinocytes were pretreated with the ALK inhibitor SB-431542 and harvested at time points post-TGFβ-1 treatment. Nuclear extracts and cytosolic lysates were isolated and assayed by western analysis to determine: 1) the distribution of p50 in both compartments; and 2) activation and degradation of the upstream effector IκB, a molecule that regulates NFκB subunit sequestration and translocation to the nucleus. Lamin A/C and α-tubulin western analysis showed specificity and purity of the cytosolic and nuclear fractions, respectively.

There was no change in cytosolic IκB levels following treatment of FVB/n primary mouse keratinocytes with TGFβ-1 (Figure 5a) suggesting that in the presence of activated TGFβ- 1 signaling, IκB remained stable and retained NFκB subunits in the cytoplasm. A mild increase in pIκK was observed preliminarily at 2 and 6 h post TGFβ-1, suggesting activation of IκB may occur at a time point greater than 6h post TGFβ-1 treatment (Figure 5b). Therefore, TGFβ-1 did not appear to appreciably modulate canonical NFκB signaling in the cytoplasm. In addition, activation of the TGFβ-1 signaling pathway did not result in nuclear translocation of p50 during a time course ranging from 15 min to 6 h (Figure 6). To rule out that lack of translocation is caused by the presence of serum, FVB/n keratinocytes were serum starved 6 h prior to inhibitor pre-treatment and then harvested 15 min, 1 h, and 6 h post TGFβ-1. No p50 translocation occurred following TGFβ-1 treatment under serum starved conditions (Figure 7). Furthermore, the type II TGFβ receptor inhibitor SB-431542 had no effect on cytoplasmic or nuclear p50 content. NFκB-dependent cytokine expression appears to require in tact TGFβ-1 signaling, although TGFβ-1 does not appear to activate the canonical NFκB signaling pathway or result in translocation of NFκB to the nucleus.

In spite of a lack of TGFβ-1-mediated p50 translocation, gel shift analysis (EMSA) showed that TGFβ-1 increased binding of NFκB to DNA following TGFβ-1 treatment (Figure 8). FVB/n primary keratinocytes were plated in media with serum or under serum starvation conditions 6 h prior to ALK-5 inhibitor treatment, as described previously. EMSA was performed on nuclear extracts from keratinocytes harvested at 1 h and 6 h post TGFβ-1. Binding between NFκB and consensus DNA was increased at 1and 6 h post-TGFβ-1 and was blocked at both time points by the ALK-5 inhibitor SB-431542. Supershifts performed with p50 and p65 antibodies added to the gel shift reaction revealed that NFκB binding included both p50 and p65 NFκB subunits (Figure 9).

To further explore the role of TGFβ-1-induced binding of NFκB subunits to DNA, luciferase reporter studies were undertaken to examine the role of TGFβ-1 in the regulation of

FIGURE 2-5a

TGFβ-1 treatment does not result in IκB degradation

(A)

Lysates were isolated from TGFβ-1-treated FVB/n primary mouse keratinocytesand used to perform western analysis to probe for total IκB protein (n=1 plate of cells). Cells were pretreatment with the type I TGFβ receptor inhibitor SB- 431542 for 1 h .Experiment was not repeated.

(B)

Densitometry was performed on a representative blot using Ima geJ software. Signal was normalized to a loading control. Histograms represent fold/respective control.

FIGURE 2-5b

TGFβ-1 treatment results in an increase in activated IKKα

(A)

Lysates were isolated from TGFβ-1- treated FVB/n primary mouse keratinocytes2 and 6 h post- treatment and probed for p-IKK protein (n=1 plate of cells) by western immunoblotting. Experiment was not repeated.

(B)

(Densitometry was performed on a representative blot using Ima geJ software. Signal was normalized to a loading control. Histograms represent fold/respective control.

FIGURE 2-6

TGFβ-1 treatment of keratinocytes in normal serum does not result in translocation of p50 in cells cultured in 8% serum

Nuclear extracts and cytosolic lysa tes were isolated from TGFβ-1-treated FVB/n primary mouse keratinocytesat time points between 30 min and 6 h. Cells were grown in the usual medium with 8% bovine serum. Western analyses of pSmad2 , p50, and la min A/C (n=1 plate of cells). Experiment was repeated 3 times.

FIGURE 2-7

TGFβ-1 treatment of serum starved keratinocytes did not result in translocation of p50 in serum starved cells

Nuclear extracts and cytosolic lysa tes were isolated from SB-431542 pretreated and TGFβ-1-treated FVB/n primary mouse keratinocytesat time points between 15 min and 6 h. SB refers to SB-431542, a type I TGFβ receptor antagonist. Cells were serum starved with 0.5% bovine serum for 5 hours prior to treatment. Western analyses of p50, and la min A/C, and tubulin (n=1 plate of cells). Experiment was repeated 3 times.

FIGURE 2-8

NFκB binding to DNA is TGFβ-1- dependent

(A)

(Nuclear extracts were isolated from SB-431542 pretreated and TGFβ-1-treated FVB/n primary mouse keratinocytesat time points between 1 h and 6 h. SB refers to SB-431542, a type I TGFβ receptor antagonist. Cells were grown in the usual medium with 8% bovine serum. Extracts were incubated with 32P ATP gamma la beled NFκB oligonucleotide probe in a gel shift assay (EMSA). Protein bound to probe was resolved on a TBE gel (n=1 plate of cells). Signal was detected by autoradiography. Experiment was repeated 2 times.

(B)

Densitometry was performed on a representative blot using Ima geJ software. Signal was normalized to a loading control. Histograms represent fold/respective control.

FIGURE 2-9

TGFβ-1-induced NFκB binding to DNA involves p50 and p65 subunits

(A)

Supershift analysis was performed by incubating gel shift (EMSA) reaction with p50 or p65 antibody for 30 min prior to addition of probe (n=1 plate of cells) An upward shift in the band indicates the presence of a particular subunit. Experiment was repeated 2 times.

(B)

Densitometry was performed on a representative blot using Ima geJ software. Histogram represents fold/respective control.

NFκB transactivation. To perform these studies, primary mouse keratinocytes were transfected and treated for 24 h with varying doses of TGFβ-1. An increase of luciferase activity was observed over doses ranging between 0.05-1.0 ng/mL TGFβ-1 (Figure 10). The most significant increase in activity occurred from 0.5-1.0 ng/mL; however, the dose most significantly different from control was 1.0 ng/mL. The dose of TGFβ-1 producing a signal most significantly different from control (1 ng/mL) was then administered to transfected cells during a time course spanning 6-24 h (Figure 11). At 12 and 24 h post-TGFβ-1, luciferase activity was significantly different than control (p<0.001). NFκB luciferase activity observed at 24 h was also significantly different from that observed at 12 h.

Taken together, these data reveal that TGFβ-1 mediated NFκB transactivation in a dose and time dependent manner. Furthermore, the time course of transactivation suggests that TGFβ-1 may not have a direct effect on mediating NFκB transactivation.

C. TGFβ-1-induced transactivation of NFκB requires Smad-3 and an intact NFκB signaling pathway

Studies were carried out to test the hypothesis that the novel role for TGFβ-1 as a mediator of NFκB transactivation involves the TGFβ-1-receptor regulated transcription factor Smad-3. Keratinocytes harveseted from mice lacking one or both alleles for Smad3 were transfected with an NFκB luciferase reporter, treated with TGFβ-1 (1ng/mL) for 24 h and assayed for luciferase activity. TGFβ-1-mediated NFκB transactivation was found to be Smad3 gene dosage dependent (Figure 12). TGFβ-1-treated Smad3 wild type keratinocytes demonstrated a significant increase in luciferase activity, which was significantly decreased in Smad3 knockout keratinocytes.

Pharmacologic inhibition of FVB/n keratinocytes with the type II TGFβ receptor inhibitor SB-431542 (Figure 13) or the small molecule inhibitor of Smad3 or SIS3 (Figure 14), followed by TGFβ-1 treatment of FVB/n keratinocytes, also revealed a significant decrease in NFκB transactivation. As anticipated, when FVB/n keratinocytes were cotransfected with a Smad-3 expression plasmid and an NFκB luciferase reporter and treated with TGFβ-1, increased NFκB luciferase activity was observed (Figure 15). Co-transfection of Smad2 or-4 did not result in enhanced NFκB transactivation in TGFβ-1-treated FVB/n keratinocytes (data not shown).

Further studies were carried out to: 1) confirm that TGFβ-1-mediated NFκB transactivation was NFκB-dependent; and 2) determine the relative contribution of the NFκB subunits p50 and p65 to NFκB transactivation. Using both genetic and pharmacologic approaches, NFκB transactivation was measured in: 1) keratinocytes from p50 wild type and knockout mice; or 2) FVB/n keratinocytes pretreated with pharmacologic and genetic inhibitors of the NFκB signaling pathway. Keratinocytes were treated for 24 h with TGFβ-1. In these studies, in the absence of p50, TGFβ-1-induced NFκB luciferase activity was significantly decreased in the absence of p50 (Figure 16).

FIGURE 2-10

TGFβ-1 mediates NFκB transactivationin a dose dependent manner

FVB/n primary mouse keratinocytes were cotransfected with 2x NFκB lucifera se reporter pla smid. Cells were treated with TGFβ-1 at doses between 0.05 – 1.0 ng/mLmedia for 24 h (n=6 wells of cells). Luciferase activity was detected on a plate reader luminometer. Experiment was repeated twice. *p<0.05 vs a or b.

FIGURE 2-11

TGFβ-1 mediates NFκB transactivation in a time dependent manner

FVB/n primary mouse keratinocyteswere cotransfected with 2x NFκB lucifera se reporter pla smid. Cells were trea ted with 1 ng TGFβ-1/ mLmedia for 24 h (n=6 wells of cells). Luciferase activity was detected on a plate reader luminometer. Experiment was repeated twice. p<0.05 vs a, b, or c.

FIGURE 2-12

TGFβ-1-mediated NFκB transactivation exhibits Smad3 dosage dependence

C57BL/J6 Smad3 wild type, heterozygous, and knockout primary mouse keratinocyteswere cotransfected with 2x NFκB lucifera se reporter pla smid. Cells were treated with 1 ng TGFβ-1/ mL media for 24 h (n=6 wells of cells). Luciferase activity was detected on a plate reader luminometer. Experiment was repeated 3 times. P<0.05 vs a or b.

FIGURE 2-13

TGFβ-1-mediated NFκB transactivation is abrogated by pharmacological inhibition with a type I TGFβ receptor antagonist

FVB/n primary mouse keratinocyteswere cotransfected with 2x NFκB lucifera se reporter plasmid. Cells were pretreated with 1 uM SB- 431542 for 1 h following treatment with 1 ng TGFβ-1/ mL media for 24 h (n=6 wells of cells). Luciferase activity was detected on a plate reader luminometer. Experiment was repeated 3 times. P<0.05 vs a or b.

FIGURE 2-14

TGFβ-1-mediated NFκB transactivation is decreased by a small molecule inhibitor of Smad3 (SIS3)

FVB/n primary mouse keratinocyteswere cotransfected with 2x NFκB lucifera se reporter plasmid. Cells were pretreated with 10 uM SIS3 for 1 h following treatment with 1 ng TGFβ-1/ mL media for 24 h (n=6 wells of cells). Luciferase activity was detected on a plate reader luminometer. Experiment was repeated twice.

FIGURE 2-15

Exogenous Smad3 increases TGFβ-1- mediated NFκB transactivation

FVB/n primary mouse keratinocyteswere cotransfected with a Smad3 and 2x NFκB lucifera se reporter. Cells were treated with TGFβ-1 (1 ng/mL media) for 24 h (n=3-4 wells of cells). Luciferase a ctivity wa s detected on a plate reader luminometer. Experiment was repeated twice.

FIGURE 2-16

TGFβ-1-mediated NFκB transactivationexhibits p50 dosage dependence

FVB/n p50 wildtype and knockout primary mouse keratinocyteswere cotransfected with a 2x NFκB lucifera se reporter plasmid. Cells were treated with TGFβ-1 (1 ng/mL media) for 24 h (n=6 wells of cells). Luciferase a ctivity wa s detected on a plate reader luminometer. Experiment was repeated 3 times.

Consistent with observations in a genetic model of p50 inhibition, a significant decrease in NFκB transactivation was also observed in TGFβ-1-treated cells which were pretreated with pharmacologic inhibitors of the NFκB pathway (Figure 17). These included the IκK inhibitor parthenolide, which is derived from Tanacetum parthenium, also known as fever few, and caffeic acid phenethyl ester (CAPE), an inhibitor of NFKB binding to DNA. Curiously, in both genetic and pharmcologic models of NFκB inhibition, TGFβ-1-induced NFκB transactivation was only reduced by ~50%. This suggests that TGFβ-1-mediated NFκB transactivation involves factors other than p50 or p65.

To better understand the relative contribution of NFκB heterodimers in TGFβ-1-induced transactivation, FVB/n keratinocytes were co-transfected with p50 or p65 expression plasmids and treated with TGFβ-1. These experiments revealed significantly enhanced luciferase activity in the presence of p50 (Figure 18), but less significant activity in the presence of cotransfected p65 (Figure 19). These studies demonstrated that the addition of either NFκB subunits or Smad3 enhances TGFβ-1-mediated NFκB transactivation, suggesting inter-dependence of these proteins during transactivation.

To determine whether a reciprocal relationship exists between p50 and the Smad binding element (SBE), keratinocytes from p50 wild type, heterozygous, and knockout FVB/n mice were transfected with an SBE luciferase reporter. Following TGFβ-1 treatment, a significant increase in SBE luciferase activity was observed in p50 wild type keratinocytes. However, a significant decrease in SBE luciferase activity was observed in p50 knockout keratinocytes compared to TGFβ-1-treated keratinocytes with p50 in tact (Figure 20). TGFβ-1-treated p50 knockout keratinocytes had ~50% less SBE luciferase activity compared to TGFβ-1-treated p50 wild type keratinocytes. These observations suggest that the role of p50 in SBE transactivation is partially involved in TGFβ-1 modulation of NFκB. In contrast, loss of NFκB transactivation in TGFβ-1- treated SMAD KO keratinocytes was ~70% of TGFβ-1-treated SMAD wild type keratinocytes (Figure 3), suggesting a greater role for Smad3 than NFκB in TGFβ-1-mediated NFκB transactivation.

Taken together, these results suggest that SMAD3 contributes to NFκB transactivation. This is demonstrated by reduced NFκB transactivation in TGFβ-1-treated keratinocytes with abrogated TGFβ-1 signaling.

D. Exploration of mechanisms linking TGFβ-1 signaling to NFκB activation

Studies exploring the upstream effectors involved in TGFβ-1-mediated NFκB transactivation focused on IκB, a critical molecule in the canonical NFκB signaling pathway, which sequesters NFκB subunits in the cytoplasm until it is activated and targeted for degradation. In the present study, FVB/n keratinocytes inhibited with IκB super repressor and treated with TGFβ-1 showed inhibited TNFα expression (Figure 21). These observations were confirmed in FVB/n keratinocytes cotransfected with an IKB super repressor and an NFκB

FIGURE 2-17

TGFβ-1-mediated NFκB transactivationis decreased by pharmacological inhibition of the NFκB pathway

FVB/n primary mouse keratinocytes were cotransfected 2x NFκB lucifera se reporter pla smid. Cells were pretreated with either an inhibitor of IκK activation (20 uM parthenolide) or p65 DNA binding (5 ug/mLcaffeic a cid phenethylester or CAPE) and treated with TGFβ-1 (1 ng/mL media) for 24 h (n=4 wells of cells). Luciferase a ctivity wa s detected on a plate reader luminometer. Experiment was repeated twice.

. FIGURE 2-18

Exogenous p50 increases TGFβ-1-mediated NFκB transactivation

FVB/n primary mouse keratinocytes were cotransfected with p50 and 2x NFκB luciferase reporter plasmid. Cells were treated with TGFβ-1 (1 ng/mL media) for 24 h (n=3-4 wells of cells). Luciferase activity was detected on a plate reader luminometer. Experiment was repeated twice.

FIGURE 2-19

Exogenous p65 increases TGFβ-1- mediated NFκB transactivation

FVB/n primary mouse keratinocyteswere cotransfected with p65 and 2x NFκB lucifera se reporter plasmid. Cells were treated with TGFβ-1 (1 ng/mL media) for 24 h (n=3-4 wells of cells). Luciferase activity was detected on a plate reader luminometer. Experiment was repeated twice.

FIGURE 2-20

TGFβ-1-mediated Smad transactivation exhibits p50 dosage dependence

FVB/n p50 wildtype and knockout primary mouse keratinocytes were cotransfected with a Smad-luciferase reporter containing a 1x Smad2 binding site and a 2x Smad 4 binding site. Lucifera se a ctivity. Cells were treated with TGFβ-1 (1 ng/mL media) for 24 h (n=6 wells of cells). Luciferase activity was detected on a plate reader luminometer. Experiment was repeated 3 times. p<0.05 vs a or b.

FIGURE 2-21

TNFα expression is inhibited by IκB super repressor

mRNA accumulation was measured in FVB/n primary mouse keratinocytesby RT- qPCR and normalized to 18S (n=4 wells of cells). Prior to treatment, these cells were infected with an adenoviral IκB super repressor (IKBSR), which prevented release and translocation of NFκB subunits. Data are represented as fold over control. Experiment was repeated 3 times. p<0.05 vs a or b.

luciferase reporter plasmid. A significant decrease in NFκB transactivation was observed as well when IκB was repressed (Figure 22).

In an attempt to reconcile conflicting data that suggested a role for TGFβ-1 both in TNFα expression and NFκB transactivation, non-canonical signaling pathways were explored. In particular, it was hypothesized that kinases directly modify transcription factors, coactivators, or corepressors in the nucleus and thus facilitate NFκB transactivation and expression of NFκB- dependent genes. Candidate kinases included protein kinase C (PKC), protein kinase D (PKD), or TGFβ-1 activating kinase-1 (TAK-1).

1) Protein kinase C (PKC) and protein kinase D (PKD) do not appear to modulate TGFβ-1-mediated transactivation

Protein kinase C is a family of phospholipid-dependent serine/threonin protein kinases, which are important signal transduction mediators during differentiation of keratinocytes (Gschwendt et al., 1996). Six of the nine genes for PKC have been identified in human keratinocytes, including PKCα, δ, ε, η, ζ, and μ (Denning, 2004). More recently, additional atypical PKCs λ, ι, and μ have been identified in keratinocytes. PKCα is considered the classical PKC because it is activated by second messengers calcium and DAG, whereas PKCδ, ε, and η are calcium-independent. PKCζ is activated by neither calcium nor DAG and is, therefore, considered an atypical PKC.

PKC isoforms serve an important role in skin differentiation and are localized in specific strata (Figure 23) (Denning, 2004) . For example, PKCε and ζ appears to drive proliferation in the basal layer (Tibudan et al., 2002;Denning, 2004); PKCα is mostly found in the spinous (suprabasal) layer and potentiates growth arrest (Deucher et al., 2002;Tibudan et al., 2002); PKCη is found exclusively in the granular (suprabasal) layer as well, and along with PKCδ, regulates the expression of differentiation markers involucrin and transglutaminase 1 (Kashiwagi et al., 2002). PKCδ, however, is not restricted to a particular layer, but has been identified in greatest abundance in the basal layer, where the isoform mediates apoptosis (Denning et al., 2002). PKCλ and ι are found at intercellular junctions of keratinocytes and are implicated in the barrier function of skin (Helfrich et al., 2007;Cohen et al., 2006). PKCμ is the human homologue of mouse PKD, a proproliferative enzyme occurring in the basal layer (Ristich et al., 2006a).

Evidence in other cell types suggests that TGFβ-1 treatment causes diacylglyercol (DAG) formation (Ignotz and Honeyman, 2000), which in turn serves as a substrate for PKC, an activator of NFκB (Catley et al., 2004;Holden et al., 2008). To test the hypothesis that TGFβ-1 mediates NFκB transactivation through PKC in keratinocytes, FVB/n primary mouse keratinocytes were pretreated for 24 h bisindolylmaleimide (Bis), an inhibitor of PKC-ζ or Go- 6976, a pan inhibitor of PKC-α,-β,-γ,-μ/PKD and then treated for 24 h with TGFβ-1. TGFβ-1- mediated NFκB transactivation was significantly increased versus control, but significantly

FIGURE 2-22

TGFβ-1-mediated NFκB transactivationis inhibited genetically with an IκB super repressor

FVB/n primary mouse keratinocyteswere cotransfected with a 2x NFκB lucifera se pla smid. Cells were treated with TGFβ-1 (1 ng/mL media) for 24 h (n=6 wells of cells). Luciferase a ctivity wa s detected on a plate reader luminometer. Experiment was repeated 3 times. *p<0.05 vs a or b.

FIGURE 2-23

Protein kinase C are important signal transduction mediators during differentiation. PKC isoforms are localized in specific strata (Denning, 2004).

inhibited by Bis or GO-6976 (Figure 24). This finding suggested a potential role for PKCα, μ, and ζ in keratinocytes. Although the pan PKC inhibitor also blocked PKCβ and γ, little is known about the existence or role of these isoforms in keratinocytes.

To confirm pharmacologic inhibition, PKC was inhibited genetically with small interfering RNA (siRNA). Inhibition with PKCα siRNA was confirmed by western immunoblotting with anti-PKCα and was shown to inhibit both constituitively expressed PKCα and mildly blocked TGFβ-1-induced PKCα (Figure 25). Once inhibition by PKCα siRNA was verified, keratinocytes were cotransfected with PKCα siRNA and an NFκB luciferase reporter plasmid and cells were treated with TGFβ-1. In two separate experiments using two different lots of PKCα siRNA, luciferase activity was measured at 24 and 48 h post TGFβ-1 (Figure 26). No significant difference in TGFβ-1-mediated NFκB luciferase activity was observed using either lot of siRNA. Contrary to pharmacologic evidence, this genetic approach suggested that TGFβ-1 does not appear to modulate NFκB transactivation through PKCα.

To explore the possibility that TGFβ-1 increases the activation of PKCα , keratinocytes were isolated from skin-specific PKCα over-expressing mouse pups and cultured. PKCα over- expressing mice demonstrated increased cytokine levels and inflammation, suggesting that the PKCα pathway is important in the immune response in skin (Cataisson et al., 2003). Furthermore, this inflammatory response requires NFκB (Cataisson et al., 2005). PKCα over- expressing primary keratinocytes contained large pools of PKCα restricuted to basal cells. Upon treatment of these cells, it was believed that activation of PKCα would be accentuated in this model. PKCα over-expressing keratinocytes were treated with TGFβ-1 for 5 min, 45 min, and 2 h prior to harvest. Western immunoblotting for pSMAD2 and PKCα substrate proteins for phosphorylation (greater and less than 50 kD) was performed on lysates isolated from TGFβ-1- treated keratinocytes (Figure 27a). PCKα substrates were more intense or sustained in PKCα over-expressing keratinocytes, but this expression did not appear to TGFβ-1 mediated. Furthermore, pSMAD-2 activation, which peaked at 45 min, did not appear to influence activation of the PKCα pool (Figure 27b).

Based on the previous observation that TGFβ-1 signaling mediates NFκB binding to consensus site DNA, a gel shift assay was performed on nuclear extracts isolated from TGFβ-1- treated FVB/n and PKCα over-expressing keratinocytes 6 h post treatment These results demonstrate that, although TGFβ-1 increases NFκB binding to consensus DNA, this increase was not PKCα-dependent (Figure 28). To test the hypothesis that an increased pool of PKCα would enhance TGFβ-1-mediated NFκB transactivation, FVB/n and PKCα over-expressing mouse keratinocytes were transfected with an NFκB luciferase plasmid, treated with TGFβ-1, and harvested 12 and 24 h post treatment. Consistent with a lack of increased NFκB binding to DNA, these data revealed no difference in TGFβ-1-mediated NFκB transactivation in wild type versus PKCα over-expressing primary keratinocytes (Figure 29).

FIGURE 2-24

Pharmacologic evidence implicates PKCs in TGFβ- mediated NFκB transactivation

FVB/n primary mouse keratinocyteswere transfected with a 2x NFκB lucifera se plasmid. Cells were pretreated with 5 uM bisindolylma leimide, an inhibitor of PKC-ζ or 5 uM Go- 6976, a pan inhibitor of PKC-α, -β, -γ, -μ/PKD for 1 h and then treated with TGFβ-1 (1 ng/mL media) for 24 h (n=4 wells of cells). Luciferase activity was detected on a plate reader luminometer. Experiment was repeated twice. *p<0.05 vs a, b, or c.

FIGURE 25

PKCα siRNA knocksdown both constituitive and TGFβ-1- mediated PKCα expression

Lysates were isolated from FVB/n primary mouse keratinocytes transfected with 20 nM PKCα and scramble siRNA and treated for 24 h with TGFβ-1 (1ng/mL media). Lysates were probe for PKCα protein by western analysis (n=1 plate of cells). Experiment was not repeated.

FIGURE 2-26

Genetic inhibition of PKCα fails to implicate a role for the kinase in TGFβ-1-mediated NFκB transactivation

FVB/n primary mouse keratinocytes were cotransfected with a 2x NFκB lucifera se pla smid. Cells were transfected with 20 nM PKCα siRNA and then treated with TGFβ-1 (1 ng/mL media) for 24 h (n=8 wells of cells). Luciferase a ctivity wa s detected on a plate reader luminometer. Experiment was repeated twice. *p<0.05 vs a, b, or c.

FIGURE 2-27a

TGFβ-1 does not change the pattern of PKCα substrates in keratinocytes that overexpress PKCα

Lysates were isolated from wildtype and PKCα overexpressing FVB/n primary mouse treated for 5 min to 2 h with TGFβ-1 (1ng/mL media). Lysates were probed by western analysis for changes in protein substrates of PKCα (n=1 plate of cells). Experiment was not repeated .

FIGURE 2-27b

pSmad2 activation is not altered in the presence of PKCα over- expression

Lysates were probed by western analysis for pSmad2 to assure activation of TGFβ- 1 pathway (n=1 plate of cells). No differences in pSmad activation were observed between genotypes. Experiment was not repeated.

FIGURE 2-28

TGFβ-1-dependent NFκB binding to DNA is not altered by overexpressionof PKCα

Nuclear extracts were isolated f ro m TGFβ-1-treated wildtype and PKCα overexpressing FVB/n primary mouse keratinocytesat 6 h. Cells were grown in the usual medium with 8% bovine serum. Extracts were incubated with 32P ATP gamma labeled NFκB oligonucleotide probe in a gel shift assay (EMSA). Protein bound to probe was resolved on a TBE gel (n=1 pla te of cells). Signa l wa s detected by autoradiography. Experiment was not repeated.

FIGURE 2-29

TGFβ-1-mediated NFκB transactivation is not altered by PKCα overexpression

Wildtype and PKCα overexpressing FVB/n primary mouse keratinocyteswere transfected with a 2x NFκB lucifera se plasmid. Cells were pretreated with type I TGFβ receptor inhibitor SB-431542 for 1h and then treated with TGFβ-1 (1 ng/mL media) for 24 h (n=4 wells of cells). Luciferase activity was detected on a plate reader luminometer. Experiment was not repeated. *p<0.05 vs a, b, c, or d.

Protein kinase D (PKD) is activated by PKCε or η, diacylglycerol (DAG), TPA (Zugaza et al., 1996), or TNFα and, in turn, mediates activation of NFκB associated with oxidative stress. Whether TGFβ-1 activates PKD, however, is not known. To test the hypothesis that TGFβ-1 mediates NFκB transactivation through PKD, a pharmacologic approach was taken using the PKD-specfic inhibitor CID-755673 in FVB/n primary keratinocytes. Inhibition of TGFβ-1- mediated NFκB transactivation with CID-755675 was dose dependent (Figure 30); however, these doses may have been too high to reflect inhibition of PKD (PKD 1, 2, 3 have IC50s of 0.182, 0.280, 0.227 uM, respectively). The doses that were used in this experiment reflect ones that would inhibit PKC (>10 uM), CAK (15.3 uM), PLK1 (20.3 uM), Ca2+/calmodulin- dependent kinase II (CamKIIα) (40.5 uM), and AKT (>50 uM) (Sharlow et al., 2008), but were on the higher end of the range that would specifically inhibit PKD. A decrease of TGFβ-1- mediated NFκB was observed in keratinocytes treated with 10 uM CID, a dose sufficient to inhibit other PKC isoforms. This decrease, however, was not quite significant. A dose sufficient to inhibit CamKIIα (50 uM) and AKT (75 uM) significantly decreased TGFβ-1-mediated NFκB transactivation. Inhibition of PKD by one of two siRNA sequences resulted in no decrease, but in fact, an increase in NFκB transactivation at a standard concentration (data not shown).

In spite of initial pharmacologic data suggesting inhibition of TGFβ-1-mediated NFκB by PKCs as well as a role for intact endogenous TGFβ-1 signaling in TPA-induced NFκB transactivation, genetic studies provided little evidence to suggest involvement of PKCα. Genetic knockdown of PKCζ, δ, and μ, which are expressed in basal keratinocytes, are necessary to rule out involvement of these proteins in TGFβ-1/NFκB crosstalk. Taken together, pharmacologic data suggest that neither PKD nor PKCα is likely involved in TGFβ-1-mediated NFκB transactivation. However, based on observations generated from higher doses of inhibitors, possible factors linking TGFβ-1 signaling to NFκB transactivation include CamKIIα and AKT.

Curiously, when the DAG mimetic and PKC activator TPA (5 ug) was administered to TGFβ-1 wild type, heterozygous, and knockout keratinocytes with varying expression of endogenous TGFβ-1, a different result emerged. A decrement of NFκB luciferase activity was observed in a dose dependent manner (Figure 31). Although not significantly different from treated wild type keratinocytes, this gene dosage-dependent decrease suggested that an intact TGFβ-1 signaling pathway plays a role in PKC-mediated NFκB transactivation.

2) TGFβ-1 activating kinase-1 (TAK-1)

TGFβ-1 activating kinase (TAK-1) is believed to facilitate an interaction between the TGFβ-1 receptor and IκK and, therefore, is a logical link between these pathways. To test the hypothesis that TAK-1 modulates TGFβ-1-mediated NFκB transactivation, a dominant negative TAK-1 (DN-TAK-1) plasmid was cotransfected into FVB/n primary keratinocytes (Kajino et al., 2007), which were treated with TGFβ- and assayed for luciferase activity. The DN-TAK-1 plasmid reliably decreased TGFβ-1-mediated NFκB transactivation when between 0.1-0.5 ng (<

FIGURE 2-30

Pharmacologic evidence implicates PKD (PKCμ) in TGFβ-mediated NFκB transactivation

FVB/n primary mouse keratinocytes were transfected with a 2x NFκB luciferase plasmid. Cells were pretreated with 10-75 uM CID-755673, an inhibitor of PKC-μ/PKD for 1 h and then treated with TGFβ-1 (1 ng/mL media) for 24 h (n=4 wells of cells). Luciferase activity was detected on a plate reader luminometer. Experiment was not repeated. *p<0.05 vs a or b. At 10 uM, CID inhibits PKC and PKD. At 50 uM, CID inhibits AKT, PKC, and CamKIIa.

FIGURE 2-31

Maximal phorbol ester (TPA) activated NFκB transactivation requires intact TGFβ-1 signaling

FVB/n primary mouse keratinocyteswere transfected with a 2x NFκB lucifera se pla smid. Cells were trea ted with TPA (5 ug), PKC activator, for 12 or 24 h (n=4 wells of cells). Luciferase a ctivity wa s detected on a plate reader luminometer. Experiment was not repeated. *p<0.05 vs a, b,or c.

1.0 ng) DNA was transfected (Figure 32). When more than 1.0 ng DN-TAK-1 was transfected, NFκB-driven luciferase activity was often greater than TGFβ-1-treated keratinocytes lacking DN-TAK-1.

To further test the involvement of TAK-1 in TGFβ-1-mediated NFκB transactivation, FVB/n primary keratinocytes were pretreated with TAK-1 inhibitor (5Z)-7-oxozeaenol, followed by TGFβ-1 or UVB treatment in order to activate TAK-1. Western immunoblotting of IκB, a downstream target of TAK-1 activation revealed no degradation of the protein 5, 10, or 30 min post treatment, which suggested that TAK-1was not, in fact, activated by TGFβ-1 (Figure 33). TAK-1 inhibition at three concentrations showed no differences in the IκB versus TGFβ-1- treatment alone. TAK-1 inhibition studies were not performed in an NFκB transactivation assay.

Taken together, these results suggested that TAK-1 may be involved in TGFβ-1-mediated NFκB transactivation; however, pharmacologic inhibition of TAK-1 failed to demonstrate changes in TGFβ-1-mediated upstream signaling.

E. Biological relevance of the TGFβ-1/NFκB intersection

To understand the biological relevance of TGFβ-1-mediated NFκB transactivation and TNFα expression observed in keratinocytes several biological endpoints were explored to determine possible roles of this novel intersection in apoptosis, differentiation, and tumor progression.

1) Inhibition of NFκB signaling pathway decreased TGFβ-1-mediated apoptosis

To test the hypothesis that TGFβ-1 mediated apoptsosis in an NFκB-dependent fashion, , FVB/n primary keratinocytes were pretreated with IκK inhibitor parthenolide for 1h and then treated with TGFβ-1 for 24 h. Caspase 3/7 activity, a marker of apoptosis occurring by the extrinsic pathway, was significantly increased by TGFβ-1, but significantly inhibited by parthenolide (Figure 34). This suggested a role for TGFβ-1 modulation of NFκB in the regulation of apoptosis.

2) TGFβ-1-mediated NFκB transactivation is decreased with increased calcium concentrations

To explore the hypothesis that TGFβ-1-mediated NFκB transactivation may be relevant to terminal differentiation of keratinocytes, FVB/n primary keratinocytes were grown in varying amounts of calcium (0.05-1.5 mM) and transfected with NFκB luciferase plasmids. A significant increase in NFκB transactivation was observed between 0.05 and 0.12 mM calcium chloride, but not at higher concentrations (Figure 35). A decrease in TGFβ-1-mediated NFκB transactivation occurred at 0.20 mM calcium chloride and above. At 1.2 mM calcium chloride, terminal differentiation is induced (Dlugosz et al., 1995). At concentrations between 0.05 – 0.1. mM,

100

FIGURE 2-32

Inhibition of TGFβ-1 activating kinase-1 (TAK-1) results in a decrease in TGFβ-1-mediated NFκB transactivation

FVB/n primary mouse keratinocytes were transfected with dominant negative TAK-1 plasmid and a 2x NFκB lucifera se pla smid. Luciferase a ctivity. Cells were treated with TGFβ-1 (1 ng/mL media) for 24 h (n=4-6 wells of cells). Luciferase a ctivity wa s detected on a plate reader luminometer. Experiment was repeated 3 times. *p<0.05 vs a or b.

A. FIGURE 2-33

Pharmacological inhibition of TAK-1 does not change IκB levels in the presence or absence of TGFβ-1 treatment

(A) Lysates were isolated f ro m TGFβ-1 treated FVB/n primary mouse keratinocytesand used to B. perform western analysis to probe for total IκB protein (n=3 pla tes of cells). Cells were pretreated with 3, 30, or 300 uM TAK-1 inhibitor (5Z)-7-oxozeanenol treated with TGFβ-1 (1 ng/mL media) for 1 h. Experiment was not repeated.

(B) Densitometry was performed using Ima geJ software. Signal was normalized to a loading control. Histograms represent fold/respective control.

101

FiIGURE 2-34

TGFβ-1 modulates apoptosis through NFκB

Caspase 3/7 activity was determined using a commerical kit in FVB/n primary mouse keratinocytes that were pretreated with the IκK inhibitor parthenolide (20 uM) and then treated with TGFβ-1 (1 ng/mL media) for 24 h (n=3 wells of cells). Luciferase activity was detected on a plate reader luminometer. Experiment was not repeated. *p<0.05 vs a or b.

FIGURE 2-35

Differentiation state partially influences TGFβ-1-mediated NFκB transactivation

FVB/n primary mouse keratinocytes were plated as usual. On day 2 post plating, varying concentrations of calcium containing media were added to cells to recapitulate states of differentiation (for each treatment group, n=4 wells of cells). On the day of transfection, a 2x NFκB lucifera se pla smid wa s a dded to cells. Cells were treated with TGFβ-1 (1 ng/mL media ) for 24 h. Luciferase a ctivity wa s detected on a plate reader luminometer. Experiment was not repeated. *p<0.05 vsa, b, c, d, e, or f.

102

keratinocytes in culture rapidly proliferate and do not yet stratify. These results, therefore, suggest that concentration of calcium chloride may partially influence TGFβ-1-mediated NFκB transactivation and that the intersection of TGFβ-1 and NFκB may be relevant to terminal differentiation of keratinocytes. Specifically, NFκB appears to transactivate during cellular proliferation. At this stage, NFκB may be preparing the keratinocyte for growth inhibition as well as protecting the cell from apoptosis by inducing anti-apoptotic genes once it undergoes differentiation.

3) TGFβ-1-mediated NFκB transactivation modulated ras-induced gene expression

Mutations resulting in unmitigated ras expression contribute to a transformed phenotype (Malumbres and Barbacid, 2003). This is best characterized by unregulated growth and gene expression, which in turn confer a selective growth advantage on cells and the formation of tumors. To understand the role of the novel intersection between TGFβ-1 and NFκB on the function of oncogenic ras over-expression, studies were performed using in vivo and in vitro models of ras over-expression. Mice with skin-specific over-expression of double transgenic TGFβ-1 or ras or triple transgenic TGFβ-1 and ras were treated with doxycycline to induce expression of either or both transgenes. Expression of NFκB-mediated inflammatory cytokines including MIP-3a, IL-6, MIP-2, TNFα, S100A9, S100A8, KC, and IL-1b were measured in RNA isolated from whole skin of mice administered doxycycline. Patterns of proinflammatory gene expression revealed two trends: 1) a gene was expressed in the context of ras or TGFβ-1 transgene induction, but inhibited in the presence of both ras and TGFβ-1 (MIP-3a, MIP-2, S100A9, S100A8, KC, IL-1b) (Figure 36 a-f); or 2) TGFβ-1 or ras induced a gene, but the simultaneous induction of both TGFβ-1 and ras has an additive effect on gene expression (IL-6, TNFα) (Figure 36 a-f). Expression of proinflammatory cytokines was higher in skin expressing the ras transgene. The one exception was expression of TNFα, which was higher in skin expressing the TGFβ-1 transgene (Figure 36 g-h). These studies suggest that TGFβ-1 serves a dual role in the regulation of ras-induced NFκB-dependent genes. In some contexts, TGFβ-1 appears to inhibit NFκB-regulated genes when ras is over-expressed. In other contexts, ras enhances TGFβ-1-induced NFκB-dependent genes.

To confirm that ras and TGFβ-1-induction of NFκB-dependent genes was specific to keratinocytes, FVB/n primary keratinocytes were either: 1) transduced with ras; 2) treated with TGFβ-1 treated; 3) both ras-transduced and TGFβ-1-treated. Keratinocytes were harvested at two time points to assess the temporal pattern of gene expression. Patterns of gene expression in vitro were similar to those observed in vivo for a subset of genes examined (TNFα, S100A8, S100A9, MIP-2, IL-6, and MIP-3a). TGFβ-1 appeared to inhibit ras-induced NFκB-dependent expression of S100A8 and S100A9 (Figure 37 b-c). Conversely, TGFβ-1 appeared to potentiate ras-induced NFκB-dependent TNFα mRNA expression (Figure 37a). Expression of TNFα was higher in TGFβ-1-treated keratinocytes than in ras-transduced keratinocytes at 6 h, but rather than inhibition, showed an additive increase in ras-transduced keratinocytes treated with TGFβ-

103

FIGURE 2-36

TGFβ-1serves a dual role in the regulation of ras-induced NFκB- dependent genes in triple transgenic mouse skin

Mice with skin targeted over-expression of ras (K5rTA/tetOHaRas) (n=7 mice), TGFβ-1 (K5rTA/tetOTGFβ-1) (n=7 mice), and ras and TGFβ-1 (K5rTA/tetOHaRas/tetOTGFβ-1) (denoted TT) (n=6 mice), and non- transgenic (NT) (n=2 mice) were administered doxycycline (1mg/kg) for 48h. mRNA accumulation was measured in skin samples by RT-qPCR and normalized to 18S. Data are represented as fold over control. *p<0.05 vs a or b.

(A) MIP-3a

(B) MIP2

(E) IL-6

(F) TNFα

(G) S100A9

(H) S100A8

(I) KC

(J) IL-1b

104

105

FIGURE 2-37

TGFβ-1serves a dual role in the regulation of ras-induced NFκB- dependent genes in keratinocytes in vitro

FVB/n primary mouse keratinocyteswere transduced with Ha -ras or treated with TGFβ-1(1 ng/mLmedia) or both. Ras tranduced samples and respective control were isolated 9 d post plating. TGFβ-1 and respective control were isolated 4 d post plating. mRNA accumulation was measured by RT-qPCR and normalized to 18S (n=3 plates of cells). Data are represented as fold over 4d control. Experiment was not repeated. *p<0.05 vs a or b.

(A) TNFα

(B) S100A9

106

1. To test whether or not activation of a ras-induced TGFβ-1 modulated gene, such as TNFα, is in fact, NFκB dependent, TNFα expression was measured in FVB/n keratinocytes that were both transduced with ras and infected with an IκB super repressor (Figure 38). Although the low sample size for each treatment goup (n=2) prevented statistical analysis, this study demonstrates that ras-induced TNFα expression is NFκB dependent. Furthermore, these data show that TGFβ- 1-mediated ras induction of TNFα is also partially dependent on NFκB. In vitro studies in keratinocytes, therefore, demonstrate that TGFβ-1 alters the expression of NFκB-dependent gene expression in the context of ras activation.

To test the hypothesis that ras increases the amount of NFκB in keratinocytes, western immunoblotting of p50 and p60 NFκB subunits was performed in keratinocytes containing a doxycycline inducible K5rTA x tetOras transgene or transduced ras. Keratinocytes isolated from K5rTA x tetOras mice were treated with doses of doxycycline ranging from 1-100 ng for 2, 4, or 6 days and harvested. Western immunoblotting revealed no dose- or time-dependent change in the NFκB subunit p50 in keratinocytes expressing ras versus single transgenic cells (Figure 39). However, a small ras-dependent increase in p65 was observed in these cells, suggesting that ras may mediate p65, but not p50 protein levels. In doxycycline-inducible cells driven by a K14 promoter, which like K5 is predominantly expressed in basal keratinocytes, no change in p50 was observed across doses ranging from 1-1000 ng doxycycline (Figure 40). Keratinocytes transduced with ras or treated with TGFβ or ras tranduced and TGFβ-1 treated also revealed no changes in NFκB protein. In addition, inhibition of ALK-5 in TGFβ-1-treated or ras transduced keratinocytes or TGFβ-1 treated and ras transduced keratinocytes resulted in no alteration to the amount of NFκB subunits (Figure 41). These results suggested that neither TGFβ-1, its pharmacologic inhibition, nor transduction with ras had an effect on the expression of NFκB protein. Thus the effects of TGFβ-1 on ras induced NFκB-dependent gene expression appeared not to be mediated at the level of protein expression.

To test the hypothesis that TGFβ-1 modulates ras during NFκB transactivation, NFκB luciferase activity was measured in FVB/n keratinocytes that were either treated with TGFβ-1, transduced with ras, or both treated and transduced. To determine the role of the TGFβ-1 signaling pathway in ras mediated transactivation, keratinocytes were also pretreated with an ALK-5 inhibitor. A significant increase in luciferase activity was observed in TGFβ-1 or ras transduced keratinocytes (Figure 42). This increase was inhibited by SB-431542 in both TGFβ-1 treated or ras transduced keratinocytes. Curiously, in keratinocytes that were both ras transduced and TGFβ-1-treated, NFκB luciferase activity was additive, therefore demonstrating that ras and TGFβ-1 act in concert to significantly potentiate NFκB transactivation. The synergism between ras and TGFβ-1 resulting in induction or repression of genes may be a function of subunit composition bound to DNA. Distribution of subunits is probably gene-specfic. Supershift analysis of NFκB subunit binding to consensus site DNA in keratinocytes that were both ras transduced and TGFβ-1-treated was inconclusive as a consequence of high signal in the control (data not shown). However, transduced ras in this experiment result in DNA binding to a

107

FIGURE 2-38

Ras-induced TNFα expression is NFκB-dependent and can be modulated by TGFβ-1

FVB/n primary mouse keratinocytes were either transduced with v-Ha Ras (d 4), infected with an adenoviral IκB super repressor (d 6), treated with TGFβ-1(1 ng/mLmedia) (d8), or a combination thereof. mRNA accumulation was measured by RT- qPCR and normalized to 18S (n=2-3 pla tes of cells; low sa mple size did not allow ANOVA). Data are represented as fold over adenoviral βga l control. Experiment was not repeated.

108

FIGURE 2-39

NFκB subunit protein levels are not modulated by inducible ras over a range of doxycycline doses and times

(A)

Doxycycline inducible K5rTa/tetORas primary keratinocytes (n=1 plate of cells) were administered doses of doxycycline ranging from 0.025 – 1 ug at 2, 4, or 6 d post ras transduction. A dose dependent increase in ras protein and a mild increase in p65 protein was observed in a western analysis. Experiment was not repeated.

(B-D)

Densitometry was performed using ImageJ software. Signal was normalized to a loading control. Histograms represent fold/respective control.

109

FIGURE 2-40

NFκB subunit protein levels are not modulated by inducible ras over a range of doxycycline doses

(A)

Doxycycline inducible K14rTA/tetORas primary keratinocyteswere administered doses of doxycycline ranging from 0.025 – 1 ug at 2 d post ras induction. Although ras protein was observed in a western analysis, no increase in p50 protein was observed (n=3 plates of cells). Experiment was not repeated.

(B-D)

Densitometry was performed using Ima geJ software. Signal was normalized to a loading control. Histograms represent fold/respective control.

110

FIGURE 2-41

NFκB subunit protein levels are neither modulated by v-ha-ras, TGFβ-1, or both

FVB/n mouse primary keratinocytes were transduced with v-ha-ras for 4 or 9 d, and treated with the Type I TGFβ receptor inhibitor SB- 431542 (also denoted SB). Cells not transduced were pretreated with SB- 431542 and treated with TGFβ-1 for 24 h. Western analysis revealed no changes in p50 protein (n=1 pla te of cells). Experiment was not repeated.

(B-D)

Densitometry was performed using Ima geJ software. Signa l wa s normalized to a loading control. Histograms represent fold/respective control.

111

FIGURE 2-42

Intact TGFβ-1 signaling is required for TGFβ-1 and ras induced NFκB transactivation

FVB/n primary mouse keratinocyteswere transfected with a 2x NFκB lucifera se pla smid. Cells were trea ted with SB- 431542 for 24 h (n=6 wells of cells). Luciferase activity was detected on a plate reader luminometer. Experiment was repeated 3 times. *p<0.05 vs a, b, c, or d.

112

consensus oligonucleotide and this signal shifted with the addition of p50 and p65. That these signals were not greater than the control, makes interpretation of these results difficult.

Taken together, these results indicate that while ras did not appear to influence the amount of NFκB subunit proteins, activated ras din appear to interact with TGFβ-1 signaling during the regulation of NFκB-dependent genes. Whereas TGFβ-1 bolsters ras-induced NFκB- dependent genes in vivo, it inhibits other proinflammatory genes. To test the hypothesis that differential expression of NFκB-dependent proinflammatory genes is related to the predominance of Smad binding element (SBE) consensus sites in the promoter region, FVB/n primary keratinocytes were transfected with a SBE-luciferase plasmid to test the levels of SBE transactivation in keratinocytes: 1) treated with TGFβ-1; 2) transduced with ras; or 3) both TGFβ-1 treated and ras transduced. SBE-luciferase activity was significantly increased in the presence of ras or TGFβ-1 (Figure 43). Keratinocytes that were both treated with TGFβ-1 and ras transduced showed a significant increase in SBE luciferase activity compared to other treatment groups, suggesting that the presence of SBEs in the promoter may also influence the outcome of gene expression in the presence of activated ras and TGFβ-1 signaling.

To determine a role for NFκB in ras/TGFβ-1 crosstalk observed in gene expression studies, an assay of cell viability was performed, which measured the number of metabolically active cells in culture following a specific treatment. Four main observations were observed: 1) TGFβ-1-treated keratinocytes (1 ng/mL) were less viable than control cells; 2) the IκKα inhibitor parthenolide significantly inhibited cell viability in ras-tranduced cells; 3) keratinocytes that were ras-transduced and TGFβ-1 treated showed significantly more cell viability than cells treated with TGFβ-1 alone (0.125 ng/mL), but parthenolide treatment of these cells significantly lowered viability; and 4) ras-transduced keratinocytes that were treated with both TGFβ-1 (1 ng/mL) and parthenolide were significantly less viable than cells that were not pretreated with the IκKα inhibitor (Figure 44). This data suggested that an intact NFκB pathway was necessary for ras-induced cellular proliferation, but did not play any role in keratinocytes treated with TGFβ-1 alone. What these studies did not show, however, is modulation of ras by TGFβ-1, which was demonstrated during ras-induced expression of proinflammatory cytokines. These data indicated that the the effect of TGFβ-1 observed during ras-induced gene expression had no bearing on cell viability which seemed to be largely ras- and NFκB-dependent.

To further explore a possible role for NFκB in crosstalk between the TGFβ-1 signaling pathway and activation of ras, expression of NFκB subunits, NFκB binding to DNA, and NFκB transactivation were determined in the SP-1 papilloma-derived cell line and the SCC cell line PAM 212. Both SP-1 and PAM 212 cell lines express oncogenic ras, and therefore, provide an in vitro model of cancer progression (Harper et al., 1987). The amount of NFκB p50 and p65 subunits in nuclear extracts isolated from TGFβ-1-treated SP-1 and PAM 212 cells was measured by western analysis. In spite of no observed increase in NFκB protein in ras transduced or –inducible keratinocytes, increased expression of both NFκB p50 and p65 was observed in PAM 212 cells versus SP-1 (Figure 45). This increase, however, did not appear to

113

FIGURE 2-43

Ras and TGFβ-1 induce Smad-transactivation and together, increase Smad- transactivation

FVB/n primary mouse keratinocyteswere transduced with v-Ha-Ras and transfected with a lucifera se reporter plasmid containing a 1x Smad2 binding site and a 2x Smad 4 binding (n=6 wells of cells). Luciferase a ctivity wa s detected on a plate reader luminometer. Experiment was not repeated. *p<0.05 vs a or b.

FIGURE 2-44

Oncogenic ras-induced cell viability requires intact NFκB, but not TGFβ-1

Ba lb/c mouse primary keratinocyteswere transduced with v-ha-ras, pretreated with IκKinhibitor parthenolide (20 uM), and treated with TGFβ-1 (1 ng/mL media ) (n=3 wells of cells). Cell via bility wa s determined by an assay that determines metabolic activity. Absorbance at 570 nm was detected on a plate reader. Experiment was not repeated. *p<0.05 vs a, b, c, or d.

114

FIGURE 2-45

Increased levels of p65 and p50 in Pam212 versus SP-1 cells is is not TGFβ-1 dependent

( A)

Lysates were isolated from SP-1 and Pam212 cell lines treated with TGFβ-1 (1 ng/mLmedia) were probed for p50 and p65 by western analysis (n=1 plate of cells). Experiment was not repeated.

(B)

Densitometry was performed using Ima geJ software. Signal was normalized to a loading control. Histograms represent fold/respective control.

115

be TGFβ-1-dependent, suggesting that NFκB was more abundant in the cell line representing the more progressed phenotype. This result was mirrored in a gel shift assay of NFκB binding to DNA, where greater binding occurred in PAM 212 cells (Figure 46). In both cell lines, NFκB binding to DNA was TGFβ-1-independent. These results suggested that TGFβ-1 had little role in modulating NFκB protein expression or DNA binding in either papilloma or SCC cell lines. However, NFκB luciferase activity in SP-1 versus PAM 212 cells revealed differences in the fold increase of NFκB transactivation in SP-1 and PAM 212 cells following doses of TGFβ-1 ranging from 50-1000 pg/mL. TGFβ-1-treated SP-1 cells demonstrated a twofold increase in NFκB transactivation compared to that in PAM 212 cells (Figures 47 a and b). This result is inconsistent with the observation of higher p65 expression and NFκB binding in the more progressed PAM 212 cell line. These data represent preliminary results from a single experiment.

V Discussion

Crosstalk among signaling pathways within a cell serves several important functions: 1) integrate and economize the relay of information from the cellular membrane to the nucleus; and 2) create an array of molecular intersections that allow for tuning of signaling pathways. The main consequence to the cell is more nuanced, tightly controlled gene expression as well as greater responsiveness to environmental stimuli. Data presented herein demonstrate for the first time one such intersection in keratinocytes which involves TGFβ-1 mediated transactivation of NFκB.

A. TNFα: a novel target of TGFβ-1-mediated NFκB-dependent gene expression

That TGFβ-1 induces the expression of TNFα in keratinocytes and whole skin is a novel finding with implications for maintaining skin homeostasis. Expression of TNFα can be attenuated by inhibition of both NFκB or TGFβ-1 signaling pathways. There is very little precedent for studying the role of TGFβ-1 in the regulation of TNFα. In keratinocytes, this finding is potentially important for understanding the role of TNFα in skin homeostasis as well as in inflammation (Groves et al., 1995), apoptosis (Wajant et al., 2003), cytoprotection (Natoli et al., 1997;Liu et al., 1996;Basile et al., 2003), and differentiation (Wu et al., 2011). Although TNFα is a critical signaling molecule in keratinocytes, chronic expression is associated with inflammatory skin disease. Intact NFκB signaling plays an important role in mangaging the cytotoxic potential of TNFα (Pasparakis et al., 2002). Therefore, lateral pathways that mediate NFκB signaling, such as the TGFβ-1 signaling pathway, may play a role in maintaining this balance.

Crosstalk between TNFα and TGFβ-1 has been considered previously in fibroblasts, which largely drive extracellular matrix metabolism in skin. Studies in fibroblasts deomonstrate a relationship between TGFβ-1 and TNFα, which tends to be antagonist. For example, TGFβ-1 induction of COL1A2 promoter activity in fibroblasts has been shown to be antagonized by

116

FIGURE 2-46

Increased levels of NFκB binding in Pam212 versus SP-1 cells is not TGFβ-1 dependent

Nuclear extracts were isolated f ro m TGFβ-1-treated SP-1 and Pam212 cells at 15 min, 1 h, and 6 h post-treatment. Cells were grown in the usual medium with 8% bovine serum. Extracts were incubated with 32P ATP gamma labeled NFκB oligonucleotide probe in a gel shift assay (EMSA). Protein bound to probe was resolved on a TBE gel (n=1 plate of cells). Signal was detected by autoradiography. Experiment was not repeated.

FIGURE 2-47

NFκB transactivation over a range of TGFβ-1 doses is less robust in Pam 212 SCC cells versus SP-1 papilloma cells

SP-1 and Pam212 cells were transfected with a 2x NFκB lucifera se plasmid and lucifera se a ctivity. Transfectionsoccurred on different days because of differences in growth rate of the cell lines. Cells were treated with TGFβ-1 (50-1000 pg) or TNFα as a positive control for 24 h (n=4 wells of cells). Luciferase activity was detected on a plate reader luminometer. Experiment was repeated 3 times.

117

TNFα. By shifting transcription factor composition from AP-1 to c-jun and inhibiting SMAD, TNFα inhibits COL1A2 (Chung et al., 1996). TGFβ-1 also appears to regulate repression of collagenase through junB, a repressor of AP-1 in fibroblasts (Mauviel et al., 1993). Finally, TNFα in fibroblasts has been shown to antagonize TGFβ-1-induced expression of type I collagen by inducing junB, which in turn interferes with binding of SMAD3 to DNA (Solis-Herruzo et al., 1988;Mauviel et al., 1994;Verrecchia et al., 2002).

In contrast to fibroblasts, in some cellular contexts, such as in adipocytes (Samad et al., 1999), bronchiolar-alveolar epithelium (Warshamana et al., 2001), proximal tubular cells (Phillips et al., 1996), and endothelial cells (Phan et al., 1992), TNFα has been shown to induce TGFβ-1 expression, which in these contexts, counteracts TNFα. Recent findings in vivo demonstrate a positive correlation between TNFα expression and TGFβ-1 mRNA in blood leukocytes (Helmig et al., 2011). Taken together, TGFβ-1 and TNFα crosstalk appears to be both context dependent and cell specific.

In keratinocytes, the implications of TGFβ-1-induced TNFα expression are unclear, particularly given the time course of expression. That TNFα expression occurs at 6 h, but is highest at 24 h post treatment suggests that expression is indirect or secondary to activation of the TGFβ-1 signaling pathway. Furthermore, this time course suggests that the expression of other proteins may be required to induce TNFα. Regardless of whether TGFβ-1 induced TNFα expression is direct or indirect, TGFβ-1-induced TNFα in keratinocytes may have implications for both cellular homeostasis and tissue pathology. Under normal circumstances, TGFβ-1- induced TNFα may be a mechanism by which cellular levels of TNFα are maintained or primed. Under pathological conditions, such as in the context of high extracelluar levels of TGFβ-1, increased TNFα expression could either counter the effects of TGFβ-1 by activating cell survival pathways or trigger programmed cell death under particularly dire circumstances. What is not yet understood is the physiological or pathological implications of TGFβ-1 mediated TNFα expression.

Future studies should assess whether there is a corresponding increase in TNFα protein localized in the cell membrane awaiting in soluble form. Additional studies should be performed to determine whether protein synthesis is required for the TGFβ-1-induced TNFα expression. For these studies TNFα expression should be measured in TGFβ-1 keratinocytes pre-treated with cycloheximide or another appropriate protein synthesis inhibitor. If TGFβ-1 fails to induce TNFα after cycloheximide treatment, this would suggest a requirement for de novo protein synthesis prior to TGFβ-1-inducing TNFα expression.

B. Failure of TGFβ-1 to activate upstream molecules in the canonical NFκB signaling pathway

118

Consistent with the finding that TGFβ-1-induced TNFα expression in keratinocytes in vivo and in vitro, the results of the present studies demonstrated peak NFκB transactivation 24 h post TGFβ-1-treatment. This result has been shown as well in mink lung epithelial cells, which were treated with TGFβ-1 for 16 h prior to the measurement of luciferase activity (Lopez-Rovira et al., 2000). However, TGFβ-1 signaling did not induce IκB degradation and showed no evidence of translocation from the cytoplasm to the nucleus. This was also observed in mink lung epithelial cells where the degradation of IκBα, β, or ε did not occur following TGFβ-1 treatment similar to the dose administered to keratinocytes (Lopez-Rovira et al., 2000). However, keratinocytes infected with an adenoviral super repressor of IκB showed both decreased TNFα expression and NFκB transactivation, suggesting that NFκB is activated from a pool of NFκB sequestered in the cytoplasm. On the other hand, if NFκB is released from cytoplasmic stores by canonical factors such as activation of IκB, the time course of activation may occur at more acute time points. In the present studies, no activation or degradation of IκB was observed at 15 min, 1 h, or 6 h. Therefore, future studies should explore earlier time points.

While IκB is activated in the canonical signaling pathway of NFκ, IκK is activated in both canonical and noncanical pathways. Part of the focus in the present studies was to elucidate a potential role for TGFβ-1 signaling pathway in activation of NFκB through the canonical pathway. Preliminary data in the present studies suggested a possible role for TAK-1 in TGFβ-1- mediated activation of NFκB through a non-canonical mechanism. If this finding can be confirmed, it will provide an important mechanism for some of the observations observed herein. How TGFβ-1 signaling intersects with pathways (or perhaps single molecules) that regulate NFκB in a non-canonical fashion has been virtually unexplored. An array of receptors elicit noncanonical NFκB signaling including LTβR, BAFFR, CD40, RANK, Fn14, TNFR2, CD30, CD27, and TLR4. Most signal through NFκB-inducing kinase (NIK), which phosphorylates IκKα homodimers independent of NEMO (Figure 48) (Sun, 2011). The result is proteosome processing of p100 to p52. Future studies should examine the role of TGFβ-1 pathway in this non-canonical pathway through NFκB-inducing kinase (NIK)

Indeed, non-canonical NFκB pathways can enhance canonical NFκB signaling. One example is phorbol ester treatment, which alone is a poor activator of NFκB; but when administered with TNFα, phorbol ester increases NFκB transcriptional (Catley et al., 2004). The mechanism of enhancement of the canonical NFκB pathway by a non-canonical pathway requires that each pathway occurs in parallel, activating separate upstream factors, but converging at the level of transcription. In the case of TPA enhanced TNFα activation of NFκB, TNFα activates NFκB, while phorbol ester phosphorylates p65, which in turn recruits p300/CBP to the promoter. Together these pathways , acting in parallel and then converging in the nucleus, result in greater transcriptional competency.

C. SMAD3 interaction with NFκB during NFκB transactivation

119

In the absence of upstream signaling, as hypothesized above, the events culminating in TGFβ-1 inducing TNFα appeared to coalesce in the nucleus. In the present studies, the TGFβ-1 signaling pathway appears by an indirect mechanism to mediate DNA binding to NFκB. This is observed by a dose and time dependent increase in NFκB transactivation. This finding is consistent with TGFβ-1-mediated NFκB transactivation reported in a mink lung epithelial cell line (Lopez-Rovira et al., 2000). In keratinocytes, TGFβ-1 did not result in nuclear translocation of p50 in the presence of serum or under serum starved conditions. Nuclear translocation of NFκB was also not observed by Lopez-Rovira in mink lung epithelial cells (Lopez-Rovira et al., 2000), suggests that TGFβ-1 is modulating resident nuclear NFκB rather than molecules of the canonical NFκB pathway upstream of the nucleus (Figure 48).

In present studies with keratinocytes, addition of SMAD-3 or NFκB subunits potentiated NFκB transactivation, thus supporting the hypothesis that TGFβ-1 modulates NFκB in the nucleus by providing the signal necessary for recruitment of SMAD-3. Indeed, studies in mink lung epithelial cells showed that TGFβ-1 receptor activation increased SMAD-3 binding to p52 (Lopez-Rovira et al., 2000). Although the effect of TGFβ-1 on subunits other than p50 and p65 has not been previously described, future studies should focus on p52 and RelB heterdimers, which have been shown to regulate genes induced by p50/p65 in a redundant fashion (Saccani et al., 2003). Intriguingly, p52/RelB is activated through a non-canonical pathway which processes p100, resulting in p52 activation. (Senftleben et al., 2001;Xiao et al., 2001;Sun, 2011) (Muller and Siebenlist, 2003;Schmitz et al., 2004). This slower, sustained pathway typically involving a kinase known as NFκB-inducing kinase (NIK) leads to the formation of p52/RelB heterdimers, which are translocated to the nucleus (Muller and Siebenlist, 2003;Coope et al., 2002;Dejardin et al., 2002;Gingery et al., 2008;Sun, 2011) In the present studies, neither a role for NIK, nor involvement of p52/RelB in TGFβ-1-mediated NFκB transactivation was explored. Previous published studies demonstrated a lack of p52 in keratinocytes (Takao et al., 2003). However, other evidence suggests that p52 is, in fact, present in keratinocytes (Hinata et al., 2003). Future research should pursue the hypothesis that TGFβ-1 activates p52/RelB through NIK and mediates TGFβ-1-induced TNFα expression.

Although the present studies provide no definitive evidence for interaction between SMAD3 and NFκB, some evidence presented herein suggested that SMAD3 and NFκB were comodulators during transcription, and perhaps bind at their respective binding sites. Whereas 70% of TGFβ-1 mediated NFκB transactivation was lost in keratinocytes containing no p50, 50% of TGFβ-1-mediated SMAD transactivation was lost in these cells. Therefore, both SMAD3 and NFκB appear to be nearly equally influential in TGFβ-1 mediated NFκB and SMAD transactivation. These findings suggested that both SMAD and NFκB binding elements were present in the the promoter regions of NFκB-dependent proinflamatory genes and necessary for their induction by TGFβ-1. Indeed, examination of the promoter region of TNFα may reveal numerous SMAD and NFκB binding sites. Future studies should test SMAD and NFκB

120

FIGURE 2-48

Schematic of proposed mechanisms by which TGFβ-1 mediates NFκB in keratinocytes (designed by K. Hogan)

121

transactivation using deletion constructs of a physiological promoter such as TNFα to determine the relative contribution of SMAD and NFκB binding sites.

D. Biological relevance of TGFβ-1-mediated NFκB

1) Differentiation and Apoptosis

Preliminary studies focused on two important aspects of skin homeostasis, which are potentially regulated by NFκB and TGFβ-1: apoptosis and differentiation. In the present studies in keratinocytes, TGFβ-1 significantly activated caspase 3/7 activity. When cells were pretreated by an inhibitor of IκKα, caspase 3/7 activity was significantly decreased, suggesting an NFκB-mediated component of TGFβ-1-induced apoptosis. This preliminary result, which suggested involvement of NFκB in TGFβ-1-mediated caspase 3/7 activity has not been described previously in keratinocytes. Future experiments should: 1) confirm these findings by using other methods for inhibiting NFκB and detecting apoptosis; and 2) explore a time course for caspase 3/7 activity as well as a dose-dependence for NFκB inhibition.

Apoptosis and differentiation are distinct processes with shared features. However, the one feature both apoptosis and differentiation have in common is activation of caspases required for loss of the nucleus in both apoptosis and in differentiated cells (Weil et al., 1999;Wu et al., 2011). Apoptosis and differentiation have been shown to be induced by tumor necrosis factor- related apoptosis-inducing ligand (TRAIL), which binds to numerous death receptors.and may directly mediate apoptosis (Hacker and Karin, 2002). Curiously, in addition to TRAIL, p52/p100 binds to the death receptor and both induce markers of differentiation through caspase 3 (Wu et al., 2011). Cleavage of caspase 3 is not only required for TRAIL-induced apoptosis, but also for apoptosis mediated through the extrinsic pathway. Furthermore, a role for TGFβ-1 in TRAIL-induced apoptosis may occur through TAK-1, a TGFβ-1 and TNFα mediated kinase that activates NFκB (Lluis et al., 2010;Herrero-Martin et al., 2009;Choo et al., 2006). The role of TAK-1 in apoptosis offers an additional avenue of exploration.

Although a role for TGFβ-1-mediated caspase-3 was not explored in the context of differentiation, the present studies performed in keratinocytes demonstrated a calcium dependence, which was not significantly different across a range of calcium concentrations. However, at calcium concentrations greater than 0.20 mM, TGFβ-1-mediated NFκB transactivation was substantially reduced. Execution of the differentiation program in a proliferating basal keratinocytes resulted in localization of NFκB to the nucleus and induction of differentiation markers. NFκB, therefore, is typically found within the nuclei of differentiated cells (Dotto, 1999). As cells progress along a path of differentiation, the morphology of the nucleus becomes condensed and the organelle no longer functions in the same capacity as it did in the proliferating cell. Therefore, decreased NFκB transactivation in kertinocytes cultured in high calcium concentrations in these studies is expected. Curiously, caspase 3 is a substrate for the PKCδ isoform, which, as shown in the present studies, may be an intermediary in TGFβ-1-

122

mediated NFκB signaling (Okuyama et al., 2004). The decrement of NFκB activation in differentiating cells in the present studies is expected, although in preneoplastic cell lines derived from hamster embryos, elevated calcium has been showen to activate NFκB and cause cells to become resistant to apoptosis. Indeed, this is an intriguing mechanism for activating terminal differentiation instead of programmed cell death (Petranka et al., 2001).

This set of studies—focusing on both apoptosis and differentiation as a biological relevant endpoint of TGFβ-1 and NFκB crosstalk—is important for understanding the mechanism by which keratinocytes shifts away from a differentiation program toward a path of programmed cell death. The distinctions between apoptosis and differentiation are especially important for understanding cancer progression. Apoptosis of keratinocytes can result in a tumorigenic environment in skin and drive clonal expansion of transformed cells (Raj et al., 2006). Future studies should clarify the role of TGFβ-1 mediated regulation of NFκB in apoptosis using alternative measures of apoptosis in in vitro or in vivo models of SMAD3 or NFκB inhibition.

2) Crosstalk with an oncogene: effect of TGFβ-1 mediated NFκB transactivation in the context of ras expression

In the present studies, expression of ras-induced NFκB-dependent proinflammatory cytokines MIP-3a, MIP-2, S100A9, S100A8, KC, IL-1b was blocked by inhibition of the TGFβ- 1 pathway. This result suggested a potentially protective mechanism by which TGFβ-1 modulates ras-induced expression of NFκB-dependent genes. However, increased expression of IL-6 and TNFα resulted from the pharmacologic inhibition of TGFβ-1, suggesting that TGFβ-1 differentiall regulates ras-induced pro-inflammatory genes. In FVB/n keratinocytes transduced with ras, transfected with an NFκB luciferase reporter, and treated with an inhibitor of TGFβ-1, NFκB transactivation was consistently reduced when TGFβ-1 signaling was abrogated. This result was intriguing because it showed that intact TGFβ-1 signaling was necessary for ras- transduced transactivation. This indicates a role for intact TGFβ-1 signaling in ras-induced gene expression.

Although upstream effectors of NFκB, translocation, or post-translational modification of NFκB were not measured in ras over-expresssing kertinocytes in the present studies, data herein show that activation of ras did not result in an increase in NFκB protein. Although published studies indicate that ras-induced NFκB does not involve activation of IκK, future studies should elucidate upstream NFκB signaling factors to determine whether or not NFκB translocation occurs in the presence of TGFβ-1 and ras.

Although ras did not appear to increase the amount of NFκB protein, the present studies showed that ras-induced NFκB transactivation was significantly increased and that this increase was inhibited by a pharmacologic inhibitor of TGFβ-1. Furthermore, NFκB transactivation was additive in ras over-expressing cells treated with TGFβ-1. These results suggested that intact

123

endogenous TGFβ-1 signaling was important for maintaining ras-induced NFκB transactivation and that TGFβ-1 may play a role in determining the composition of NFκB subunits. One hypothesis is that TGFβ-1 modifies regulation of ras-induced proinflammatory cytokines by shifting NFκB subunit composition. Future studies should identify NFκB subunit composition at the promoters of ras-induced proinflamatory cytokines using a gel shift and super shift assay.

How has crosstalk between TGFβ1 and NFκB influence been previously explored? In a keratinocyte cell line derived from initiated primary keratinocyte, containing mutant ras, TGFβ-1 mediated expression of NFκB-dependent urokinase-type plasminogen activator (uPA) and matrix metalloproteinase-9 (MMP-9) (Tobar et al., 2010). The mechanism of NFκB activation in this context involved TGFβ-1- receptor activation of ras-related C3 boulinum-1 (Rac-1), a G-protein with GTPase activity known to regulate the cell cycle, cell adhesion, epithelial differentiation, and stem cells (Didsbury et al., 1989). Rac-1, in turn, activates NADPH oxidase-2 (NOX-2), which produces reactive oxygen species responsible for activation of NFκB (Gloire et al., 2007), which was required for gene expression (Hordijk, 2006). Thus it is reasonable to consider the impact of TGFβ-1 in ras-induced expression of NFκB-dependent genes.

To further test the hypothesis that TGFβ-1 modifed ras-induced NFκB transactivation, studies were performed in in vitro models where ras is activated including in an papilloma (SP-1) and SCC (PAM 212) cell line. Little is known about how NFκB behaves in SCC (Loukinova et al., 2001). The most recent published study showed that downregulation of NFκB allows transformed cells to overcome ras-induced growth arrest, suggesting that NFκB and ras both contribute to malignant progression (Dajee et al., 2003). The present studies sought to explore the question of TGFβ-1-mediated NFκB transactivation in the context of transformed cell lines expressing ras. Increased subunit binding and nuclear protein were observed in both the SP-1 and PAM 212 SCC cell lines, but this increase was not TGFβ-1-dependent. Although DNA binding of NFκB was higher in PAM 212 cells, the magnitude of NFκB transactivation was higher in SP-1 cells treated with a range of TGFβ-1 doses. In PAM 212 cells, TGFβ-1-mediated NFκB transactivation was less robust. Published studies show TGFβ-1 suppression of NFκB transactivation in PAM 212 cells using a much higher dose of TGFβ-1 (10 ng/mL) (Loukinova et al., 2001). In the present studies, the suppression of TGFβ-1 mediated NFκB transactvation in PAM212 cells, compared to the papilloma cell line may be indicative of changes that occur to NFκB signaling in more progressed phenotypes. If TGFβ-1 modulates NFκB in the context of ras, alterations of TGFβ-1 signaling, coupled with activation of NFκB signaling, would potentially change the course of ras signaling as well. Few studies have pursued an interaction between ras, NFκB, and TGFβ-1/SMAD—three factors critical to both inflammation and cancer. Future studies should address these inconsistencies by assessing several endpoints focusing mainly on how TGFβ-1modulates transcriptional regulation in these cell lines, including measures of: 1) differences in NFκB-dependent proinflamatory cytokine expression; 2) composition of NFκB subunits binding to DNA in SP-1 cells versus PAM 212 cells; and 3) NFκB transactivation assay using deletion constructs from a physiological promoter.

124

VI Summary

Whether TGFβ-1 directly mediates NFκB is not clear. Data in the present studies suggest that the novel intersection between TGFβ-1 and NFκB may play a role in apoptosis, differentiation, or the ras-induced gene expression. One hypothesis is that intact TGFβ-1 signaling has the potential to modulate or tune expression of NFκB-dependent genes. In published studies, TGFβ-1suppressed IL-1α mediates gene expression, which is NFκB- dependent. This example of TGFβ-1 ‘tuning’ may play a part in the regulation of proinflamatory cytokines, which left unregulated, may damage tissues. The role of TGFβ-1 as a tuner or integrator of signaling pathways is not a new idea. TGFβ-1 opposes many growth factors including signals from receptor tyrosine kinases like EGF (Takehara et al., 1987;Kretzschmar et al., 1997;de Caestecker et al., 1998). However, the molecular mechanism and biological relevance of TGFβ-1 ‘tuning’ of transcriptional regulation has been virtually unexplored. Among the most likely biologically relevant targets of TGFβ-1 tuning is the modulation of inflammation, which is often initiated by NFκB-dependent cytokine expression and resolved by TGFβ-1. Future studies should explore the role of TGFβ-1 in the regulation of ras-induced proinflammatory cytokines in vivo. By crossing the p50 knockout mouse with the skin targeted inducible ras and TGFβ-1 mouse, the hypothesis that TGFβ-1 tunes NFκB-dependent proinflammatory cytokine expression in the presence of ras can be further explored.

VII Future Directions

A. Elucidation of NFκB/Smad3 interactions

Although in the present studies TGFβ-1 failed to activate upstream effectors of the canonical NFκB pathway, preliminary evidence suggests that crosstalk may also be occurring at the level of the nucleus. There are several possible scenarios that can be explored in future studies: 1) Smad3 serves as a coactivator of NFκB; or 2) Smad3 and NFκB bind to DNA at two distinct sites with or without physical interaction. The first scenario implicating Smad3 as a coactivator of transcription is a well-established role for the protein. Smads have been identified as coactivators of the vitamin D receptor (Yanagisawa et al., 1999), forkhead activin signal transducer-1 (FAST-1) (Zhou et al., 1998) and FAST-2 (Labbe et al., 1998), and homeodomain transcription factor Hoxc-8 (Shi et al., 1999). The present studies demonstrated increased NFκB binding with the addition of Smad3, suggesting an interaction between Smad3 and NFκB at a DNA binding site containing an NFκB responsive element. Future work should confirm this assertion by establishing an interaction between Smad3 and NFκB in vitro and then testing whether this interaction is sustained during binding to presence of a physiological promoter. First, pulldown assays with Western analyses should be carried out to establish the possibility of protein-protein interaction between subunits of NFκB and Smad3. To further demonstrate this interaction, a mammalian two-hybrid system would establish transactivation resulting from protein interaction. This assay should consist of a GAL-4 DNA binding domain fused to a protein coding sequence for Smad3 (or p65/p50), a vector containing the VP-16 activation

125

domain and protein coding sequence for p50/p65 (or Smad3), and a third vector containing multiple GAL-4 binding sites driving a luciferase reporter.

Although proteins can be shown to interact in vitro, this may not necessarily occur in the context of DNA binding. For example, regulation of JunB requires NFκB and Smad 3 to interact prior to and during DNA binding (Lopez-Rovira et al., 2000). Studies in fibroblasts have revealed an interaction between AP-1 and SMAD in vitro that was not sustained once the complex during DNA binding (Verrecchia et al., 2001). Instead, NFκB and AP-1 were found to bind to separate cognate cis-elements. Likewise, Smad and NFκB enhancer sites occurring in the type II collagen promoter were shown to be cooperative, but distinct (Kon et al., 1999). Therefore, future studies should test the hypothesis that a protein-protein interaction occurring between Smad3 and NFκB is sustained upon DNA binding. One approach is to perform a gel shift assay in which oligonucleotide probes containing promoter sequences for TNFα are incubated with an in vitro synthesized tagged NFκB in the presence and absence of an in vitro synthesized tagged Smad3. Supershift analysis should be performed to identify the composition of proteins bound to promoter oligo probes.

For a more complete snapshot of transcriptional regulation involving NFκB and Smad3 interaction, a chromatin immunoprecipitation (CHiP) assay can be performed. This method was considered in the present studies using Smad wildtype versus knockout keratinocytes as a model system to address the issue of Smad dependence in transcriptional regulation of NFκB. However, the low ratio of wild type: knockout mice (1:10) as a result of fetal reabsorption or small body size at birth, precluded use of model. Other forms of genetic inhibition of Smad3 were considered to lack the efficiency required for a sufficient knockdown of Smad3. A more complex approach could be pursued which involves elucidation of transcriptional events occurring on the proximal and distal regulatory regions. Studies using the chromosome conformation capture assay to elucidate NFκB-induced MCP-1 have shown that NFκB binds distal NFκB sites and recruits CBP/p300. CBP/p300 acetylates histones and recruits Sp-1, which in turn forms and stabilizes an interaction with elements on the proximal promoter (Teferedegne et al., 2006).

Direct interactions between SMAD3 and NFκB may not be as likely given a lack of a transactivation domain in p50 (Fujita et al., 1992). To address an interaction between Smad3 and NFκB involving a coactivator such as CBP/p300, future studies should explore HAT recruitment by SMAD as well as the requirement of NFκB phosphorylation for CBP/p300 binding. Recruitment of HATs such as p300 through the SMAD linker region known as the Smad activation domain (SAD) (Wang et al., 2005) serve multiple purposes: 1) HATs act as a bridge between SMAD3 and p50; 2) HATs are involved in histone modification through acetylation. Phosphorylation of NFκB, however, is required prior to binding with HATs (Zhong et al., 1998;Zhong et al., 1997). In the present studies, a hypothesis was explored that posited a role for TGFβ-1 in NFκB nuclear phosphorylation status, which is often required for interaction between transcription factors. Secondly, post-translational modification is also a mechanism by

126

which resident nuclear NFκB could be activated without involving the canonical NFκB signaling pathway.

Post translational modifications of NFκB subunits, specifically phosphorylation, have been identified at several residues in the protein and have been associated with numerous kinases. These necessary changes to NFκB occur both in the cytoplasm (Li et al., 1994b;Li et al., 1994a), but could theoretically occur on resident nuclear p50 molecules through PKA/ARAP-mediated phosphorylation. Residues critical to stability and DNA binding of p50 include Ser65, Ser337, and Ser342 in the Rel homology domain of p50 is critical to protein stability and DNA binding (Hou et al., 2003;Li et al., 1994b). Several kinases are responsible for phosphorylation of critical serine residues p65 including: MSK-1 (Vermeulen et al., 2003), PKA (Zhong et al., 1997) at Ser276, which recruits CBP/p300; Casein kinase II (CKII) at Ser529 (Wang et al., 2000); IκKβ at Ser536 (Sakurai et al., 1999b); and PKCζ at Ser311, which recruits CBP and RNA polymerase II (Anrather et al., 1999). Attempts to assay nuclear extracts from keratinocytes treated with TGFβ-1 and/or inhibitors of TGFβ-1 signaling, did not detect phosphorylated p50 (data not shown), which may have been a result of technical factors requiring immunoprecipitation of phospho-p50. In addition, extracts were incubated with alkaline phosphatase in another attempt to detect the presence of phospho-p50, but these studies were inconclusive. The role of phosphorylation in achieving transcriptional competency of NFκB cannot be over-emphasized. Future studies, therefore, should explore a role of TGFβ-1 in the phosphorylation status of nuclear NFκB should be pursued.

B. Kinases as mediators of non-canonical NFκB signaling

1) TGFβ- activating kinase I (TAK-1) Although present studies in keratinocytes showed that direct activation of NFκB did not occur through canonical NFκB signaling proteins, studies reported in the literature suggest that activation of IκK/IκB occurs through transforming growth factor β kinase-1 (TAK-1). TAK-1 is activated through toll like receptors, cytokine receptors (TNFα, IL-1), but also by TGFβ-1 through the TGFβ-1 receptor. In cells treated with TGFβ-1, the TGFβ-1 receptor associates with TRAF6 (Sorrentino et al., 2008), a ubiquitin ligase charged with activating NFκB through IκK/IκB (Zhang et al., 2005;Sun et al., 2004). The biological relevance of this pathway in keratinocytes has not yet been elucidated, nor have downstream target genes been identified. However, in keratinocyte-specific TAK-1-deficient mice TAK-1 is necessary for normal differentiation and prevention of TRAIL-induced apoptosis (Sayama et al., 2006;Choo et al., 2006). Furthermore, epidermal-specific deletions of TAK-1 result in severe inflammation, which is resolved when knockout mice are crossed with TNFαR1-deficient mice, suggesting a critical role for TNFα in TAK-1 signaling (Omori et al., 2006). Similar studies have not yet been performed in skin-targeted TGFβ-1 knockout models.

In the present studies, the role of TAK-1 as an intermediary signaling protein between TGFβ-1 receptor and NFκB was explored in keratinocytes using an assay of TGFβ-1-induced

127

NFκB transactivation. Inhibition of NFκB-luciferase activity by cotransfected dominant negative TAK-1 suggested TAK-1 involvement in this novel pathway. This was in agreement with published studies showing that TAK-1 deletion leads to impairment of TGFβ-1-mediated NFκB activation (Shim et al., 2005). Other studies suggest that both the activation of TAK-1 and TAK-1-mediated activation of IκK is dependent on the presence of various TAK-1 binding proteins (TABs) (Sakurai et al., 2000;Prickett et al., 2008;Brown et al., 2005;Neil and Schiemann, 2008;Singhirunnusorn et al., 2005) In the present studies, there was no increase in TGFβ-1-mediated NFκB transactivation in the presence of excess TAK-1 (data not shown). Future studies should explore the role of TABs in TGFβ-1-mediated TAK-1 activation.

In spite of preliminary observations that suggest involvement of TAK-1 in TGFβ-1- mediated NFκB transactivation, western analysis of total IκB following administration of TAK-1 inhibitors and activators failed to demonstrate IκB degradation over time. These findings suggested that TAK-1 does not signal through the canonical NFκB signaling pathway. Direct measurement of phophorylated TAK-1 proved to be technically difficult with the current commercially available phospho-specific antibody. In published studies, activated TAK-1 was measured indirectly by in vitro immunocomplex kinase assay that involves the immunoprecipitation of TAK-1 from TGFβ-1-treated lysates incubated with radiolabeled ATP and ectopically expressed IκK substrate (Sakurai et al., 1999a;Sakurai et al., 1999b). To measure kinase activity of TAK-1, immunoprecipitated TAK-1 from TGFβ-1-treated cells is incubated with an ectopically expressed MKK-6 substrate and radiolabeled ATP (Ninomiya-Tsuji et al., 2003). Both are detected by autoradiography. Future studies using an in vitro kinase assay should be performed to confirm the preliminary observation that, in fact, TAK-1 does not activate cytoplasmic targets in the canonical NFκB pathway.

Although the role of TAK-1 in TGFβ-1-mediated NFκB transactivation is inconclusive, the role of kinases, in general, is one of potentially great importance in the regulation of nuclear proteins. Indeed, TAK-1 has been shown to target the Smad co-repressor and oncoprotein SnoN for degradation in a TGFβ-1-dependent manner (Kajino et al., 2007). Interaction between SnoN and Smad heterodimers in the nucleus results in displacement of the p300 coactivator and recruitment of co-repressor N-CoR (He et al., 2003). What has not yet been elucidated is whether or not TGFβ-1-activated TAK-1 directly mediates NFκB transcription by phosphorylation of nuclear proteins through A-kinase anchoring proteins (ARAPs) or by some other mechanism. TAK-1, therefore, may play an intriguing role during TGFβ-1 signaling as a potential phosphorylator of nuclear proteins involved in NFκB transactivation.

2) Protein Kinase C (PKC)

In addition to TAK-1, other upstream signaling molecules were explored in these studies as potential candidates for either activating NFκB through IκK/IκB or by modifying resident nuclear NFκB. Protein kinases are well established phosphorylators of nuclear proteins like NFκB. The kinases explored in these studies included protein kinase C (PKC) and protein kinase

128

D (PKD), which it was hypothesized in the present studies, either activate NFκB through IκK/IκB or by post-translational modification of nuclear NFκB. Although pharmacologic inhibition of TGFβ-treated keratinocytes in the present studies suggested a role for PKC-ζ, α, β, γ, and μ/PKD in TGFβ-1-induced NFκB transactivation, subsequent biochemical and genetic studies did not support this initial observation. However, PKC isoforms are not uniformly distributed in the skin strata. PKC-ζ, ε, -δ, and μ/PKD are found in basal keratinocytes (Denning, 2004;Cohen et al., 2006) and, therefore, may have greater relevance in inhibition studies performed in basal keratinocye culture reported herein.

a) PKCα

These studies attempted to elucidate a role for PKCα in TGFβ-1-induced NFκB transactivation. Although PKCα is not predominant in basal cells, it plays a critical part in the expression of markers of differentiation including loricin, flilaggrin, SPR-1, and transglutaminase 1. PKCα is also involved in the activation of AP-1, which is an important transcription factor in differentiation (Rutberg et al., 1996) as well as in neoplastic, ras transduced keratinocytes where AP-1 mediates ras-induced gene expression through PKCα (Rutberg et al., 2000). Furthermore, promotion of skin overexpressing PKCα led to intraepidermal and dermal inflammation (Wang and Smart, 1999) and apoptosis (Cataisson et al., 2003). That PKCα is an inflammatory mediator suggests as well a role for the kinase in the TGFβ-1 and/or NFκB signaling pathways. Indeed, PKCα activates NFκB in keratinocytes (Bergmann et al., 1998;Cataisson et al., 2005), murine melanoma cells (La Porta and Comolli, 1998) and in a tumor cell line (Holden et al., 2008). PKC is also shown to be activated by TGFβ-1 (Halstead et al., 1995) and through DAG in a lung carcinoma cell line (Ignotz and Honeyman, 2000). Conversely, Smad3 phosphorylation by PKC led to abrogation of TGFβ-1 responsive genes (Yakymovych et al., 2001). As these examples of intersections between PKC and TGFβ-1 or NFκB demonstrate, it is also reasonable to consider a role for PKCα in TGFβ- 1/NFκB crosstalk.

Although data presented herein demonstrated no role for PKCα in TGFβ-1-mediated NFκB transactivation, the present data showed that endogenous TGFβ-1 signaling was involved in TPA-induced NFκB transactivation, which is mediated by PKC. A similar role for endogenous TGFβ-1 signaling was shown in TPA treated keratinocytes transfected with an AP- 1-driven luciferase reporter (Perez-Lorenzo et al., 2010). Endogenous TGFβ-1 signaling appears to mediate NFκB transactivation in these two contexts, suggesting some involvement of endogenous TGFβ-1, in modulating or tuning NFκB transactivation. How this theoretical pathway might integrate PKC is unclear.

Several PKC isoforms should be explored further as intermediaries of TGFβ-1/NFκB crosstalk. Although the pan-PKC inhibitor Go-6976 used in the studies presented herein blocked PKC-δ and PKC-μ/PKD, it did not target PKC-ε; therefore, no conclusions could be drawn about this isoform in keratinocytes. Evidence in the literature suggests that PKC-ε, should be furthered

129

explored as a kinase involved in TGFβ-1-mediated NFκB transactivation. For example, skin targeted over-expression of PKCε in the basal layer has been shown to produce hyperplasia (Reddig et al., 2000a). When these mice were treated with the PKC activator TPA, hyperplasia was sustained, suggesting a role for PKCε in keratinocyte proliferation. Furthermore, tumor initiation of mice with skin-specific over-expression of PKCε resulted in formation of malignant tumors even in the absence of tumor promotion, underscoring the relevance of this isoform in carcinogenesis (Reddig et al., 2000b;Reddig et al., 1999). Although there is no current literature documenting an interaction between PKCε and TGFβ-1 or NFκB, the potential role for these factors in cancer progression argues for further exploration of their intersection.

b) PKCζ

Atypical PKCs such as PKCζ and λ have been shown to activate NFκB and regulate NFκB dependent gene expression (Lallena et al., 1999). In mouse embryonic fibroblasts, PKCζ is shown to directly activate p65 without involvement of IκK, suggesting a non-canonical role for PKCζ (Leitges et al., 2001). Direct activation of p65 by phosphorylation is similar to reports suggesting a non-canonical role for GSK-3β (Hoeflich et al., 2000), T2K (Bonnard et al., 2000), and NIK (Yin et al., 2001). Furthermore, PKCζ has been shown to be stimulated by TGFβ-1 (Xia et al., 2008). Therefore, PKCζ might reasonable serve as an intermediary between TGFβ-1 and NFκB. The present studies showed pharmacologic inhibition of PKCζ with bisindolylmaleimide, which was not followed up using a genetic approach. Although few studies have addressed the role of PKCζ in keratinocytes, some evidence exists for a role for this atypical PKC in cell signaling involving the EGFR receptor in keratinocytes and SCC of the head and neck (Cohen et al., 2006). Future studies should therefore further explore the a role for PKCζ in TGFβ-1-mediated NFκB transactivation.

c) PKCδ

Crosstalk between TGFβ-1 and PKD-δ, in particular, has been shown in several contexts to influence the outcome of TGFβ-1 signaling and therefore requires consideration in future studies. For example, in vascular smooth muscle, TGFβ-1 activation of PKC-δ has been shown to maintain Smad-3 at levels required for Smad-dependent transactivation of fibronectin (FN) (Ryer et al., 2006). Furthermore, blockade of PKC-δ in mesangial cells, abrogated Smad-3- dependent and independent activity at the promoter of collagen I (Runyan et al., 2003). In dermal fibroblasts, activation of PKC-δ by TGFβ-1 results in phosphorylation of the transcriptional repressor Fli1, the recruitment of p300/CREB-binding protein-associated factor, and the dissociation of the co-repressor from the promoter region of collagen (COL1A2) (Asano and Trojanowska, 2009). In each of these examples, TGFβ-1 activation of PKC-δ had direct consequences on transactivation with little or no upstream signaling required to modulate gene expression. As a kinase capable of directly phosphorylating transcription factors or coactivators, PKC-δ activation by TGFβ-1 is a possible mechanism for TGFβ-1-mediated NFκB transactivation. To inhibit PKC-δ pharmacologically, rottlerin has long been considered a

130

selective antagonist with in IC50 between 3-6 uM. In these studies, rottlerin (mallotoxin) inhibited TGFβ-1 NFκB transactivation (data not shown). However, rottlerin has been reconsidered as a selective inhibitor of PKC-δ (Soltoff, 2007). As an inhibitor, rottlerin has been plagued by off-target effects (Davies et al., 2000). According to the manufacturer of rottlerin, early studies reflecting specificity of rottlerin has been attributed to an impurity identified in these early lots (http://www.lclabs.com/PRODFILE/P-R/R-9630.php4). Future studies should employ genetic inhibitors of PKC-δ to elucidate its role, if any, in TGFβ-1-induced NFκB.

3) Protein kinase D (PKD)

Perhaps one of the most influential among the PKCs in skin is PKCμ, also known in mouse as protein kinase D (PKD). PKD differs fundamentally from other PKCs in that it responds to mitogens and induces proliferation (Zugaza et al., 1997). Its prominent localization in the basal layer appropriately positions PKD to be pro-proliferative, but down-regulated during differentiation. Evidence for this is seen in an increase in the proliferative marker keratin 5 and the differentiation marker involucrin (Dodd M.E. et al., 2005). Dysregulation of PKD, on the other hand, likely contributes to hyperproliferative disorders in skin and thus is considered a potential therapeutic target for several skin diseases (Ristich et al., 2006b). Curiously, overexpression of PKD results in decreased response to TNFα-induced apoptosis and increased expression of NFκB-dependent genes, which was unaccompanied by increased NFκB binding to DNA (Johannes et al., 1998). Lint et al. suggests that PKD might, therefore, regulate NFκB directly, bypassing IκK/IκB, and targeting instead NFκB transcriptional machinery, by phosphorylating NFκB (Lint et al., 2002). Indeed, like other isoforms, PKD has been found to activate NFκB (Johannes et al., 1998) and export HDAC5 to the nucleus (Vega et al., 2004). This evidence was the basis for exploring PKD as a mediator of TGFβ-1-induced NFκB. In the present studies, the range of doses used to inhibit PKD with CID-755673 was, in retrospect, likely too high and may have produced off target effects. The decrement of NFκB driven luciferase activity observed was likely a consequence of inhibition of CamKIIα (Ishiguro et al., 2006) or AKT (Julien et al., 2007), both of which activate NFκB. Future studies should explore lower concentrations of inhibitor as well as the use of a genetic inhibitior of PKD in an NFκB reporter luciferase assay or expression of NFκB-dependent genes as readouts of NFκB actviation.

4) Protein Kinase A (PKA)

Among the kinases that were not pursued as mediators of NFκB activation by TGFβ-1, but should by considered in future studies is cyclic AMP-dependent protein kinase (PKA) which phosphorylates the p65 subunit of NFκB. This not only enhances DNA binding of p65, but readies the transcription factor for interaction with coactivators such as CBP/p300 (Zhong et al., 1998;Zhong et al., 2002). CBP/p300 coactivators contain histone acetyltransferase (HAT) domains that that permit the acetylation of p65 at Lys 218, 221, and 310 (Schmitz et al., 2004). Acetylation of p65 in the nucleus prevents its inhibition and transport out of the nucleus by

131

nuclear IκBα (Chen et al., 2001). In the present studies, western analysis was performed to measure acetylated p65 from nuclear extracts, which was not detectable even when high protein concentrations were used (data not shown). Acetylated p65 is found to be quite low in cells, suggesting that only a small portion of p65 is actually acetylated (Chen et al., 2001). Curiously, because p50 homodimers lack transactivation domains, they do not directly recruit HATs such as CBP/p300 and therefore rely on interactions with other coactivators such as BCL-3, which in turn recruit HATs (Dechend et al., 1999). The structural features of p65, namely a recognition site (RRXS) for the kinase upstream of the nuclear localization site within the rel homology domain, make it possible for the kinase to regulate p65 independent of IκK (Neumann et al., 1995;Mosialos and Gilmore, 1993). Similarly, examples of kinase remodeling have been documented for casein kinase II (CKII) (Wang et al., 2000) and PI3K-activated AKT (Delhase et al., 2000) whose roles as well have been extended to remodeling of coactivators and histones.

Careful consideration of signaling molecules in non-canonical pathways may lead to a more complete understanding of the novel pathway connecting TGFβ-1 to NFκB. The canonical NFκB pathway is activated in a rapid and transient fashion. On the other hand, the slow, persistent activation of non-canonical NFκB pathways requires protein synthesis and is reminiscent of the time course observed during TGFβ-1-mediated NFκB transactivation. Noncanonical NFκB pathways also play specific roles in the cell (Sun, 2011) and thus may be suitable candidates for modulating or tuning major lateral pathways. Future studies should explore the role of TGFβ-1-activated kinases leading to noncanonical activation of NFκB including isoforms of PKC, PKD, TAK-1, PKA, and NIK. Equally as important is the protein- protein interaction between SMAD3 and NFκB in the nucleus and the role this interaction plays in the regulation of TNFα expression. Finally, the biologic consequences of the novel intersection of TGFβ-1 and NFκB in keratinocytes may have implications for differentiation, apoptosis, and cancer progression and deserves further attention.

VII Literature Cited

Anrather J, Csizmadia V, Soares MP, Winkler H (1999) Regulation of NF-kappaB RelA phosphorylation and transcriptional activity by p21(ras) and protein kinase Czeta in primary endothelial cells. J Biol Chem 274:13594-13603.

Asano Y, Trojanowska M (2009) Phosphorylation of Fli1 at threonine 312 by protein kinase C delta promotes its interaction with p300/CREB-binding protein-associated factor and subsequent acetylation in response to transforming growth factor beta. Mol Cell Biol 29:1882-1894.

Bergmann M, Hart L, Lindsay M, Barnes PJ, Newton R (1998) IkappaBalpha degradation and nuclear factor-kappaB DNA binding are insufficient for interleukin-1beta and tumor necrosis

132

factor-alpha-induced kappaB-dependent transcription. Requirement for an additional activation pathway. J Biol Chem %20;273:6607-6610.

Bonnard M, Mirtsos C, Suzuki S, Graham K, Huang J, Ng M, Itie A, Wakeham A, Shahinian A, Henzel WJ, Elia AJ, Shillinglaw W, Mak TW, Cao Z, Yeh WC (2000) Deficiency of T2K leads to apoptotic liver degeneration and impaired NF-kappaB-dependent gene transcription. EMBO J 19:4976-4985.

Brown K, Vial SC, Dedi N, Long JM, Dunster NJ, Cheetham GM (2005) Structural basis for the interaction of TAK1 kinase with its activating protein TAB1. J Mol Biol 354:1013-1020.

Cataisson C, Pearson AJ, Torgerson S, Nedospasov SA, Yuspa SH (2005) Protein kinase C alpha-mediated chemotaxis of neutrophils requires NF-kappa B activity but is independent of TNF alpha signaling in mouse skin in vivo. J Immunol 174:1686-1692.

Catley MC, Cambridge LM, Nasuhara Y, Ito K, Chivers JE, Beaton A, Holden NS, Bergmann MW, Barnes PJ, Newton R (2004) Inhibitors of protein kinase C (PKC) prevent activated transcription: role of events downstream of NF-kappaB DNA binding. J Biol Chem 279:18457- 18466.

Chen LF, Fischle W, Verdin E, Greene WC (2001) Duration of nuclear NF-kappaB action regulated by reversible acetylation. Science 293:1653-1657.

Chen Y, Kam CS, Liu FQ, Liu Y, Lui VC, Lamb JR, Tam PK (2008) LPS-induced up-regulation of TGF-beta receptor 1 is associated with TNF-alpha expression in human monocyte-derived macrophages. J Leukoc Biol 83:1165-1173.

Chin L, Tam A, Pomerantz J, Wong M, Holash J, Bardeesy N, Shen Q, O'Hagan R, Pantginis J, Zhou H, Horner JW, Cordon-Cardo C, Yancopoulos GD, DePinho RA (1999) Essential role for oncogenic Ras in tumour maintenance. Nature 400:468-472.

Choo MK, Kawasaki N, Singhirunnusorn P, Koizumi K, Sato S, Akira S, Saiki I, Sakurai H (2006) Blockade of transforming growth factor-beta-activated kinase 1 activity enhances TRAIL-induced apoptosis through activation of a caspase cascade. Mol Cancer Ther 5:2970- 2976.

Chung KY, Agarwal A, Uitto J, Mauviel A (1996) An AP-1 binding sequence is essential for regulation of the human alpha2(I) collagen (COL1A2) promoter activity by transforming growth factor-beta. J Biol Chem 271:3272-3278.

Cohen EE, Lingen MW, Zhu B, Zhu H, Straza MW, Pierce C, Martin LE, Rosner MR (2006) Protein kinase C zeta mediates epidermal growth factor-induced growth of head and neck tumor cells by regulating mitogen-activated protein kinase. Cancer Res 66:6296-6303.

133

Coope HJ, Atkinson PG, Huhse B, Belich M, Janzen J, Holman MJ, Klaus GG, Johnston LH, Ley SC (2002) CD40 regulates the processing of NF-kappaB2 p100 to p52. EMBO J 21:5375- 5385.

Davies SP, Reddy H, Caivano M, Cohen P (2000) Specificity and mechanism of action of some commonly used protein kinase inhibitors. Biochem J 351:95-105.

Davis JN, Kucuk O, Djuric Z, Sarkar FH (2001) Soy isoflavone supplementation in healthy men prevents NF-kappa B activation by TNF-alpha in blood lymphocytes. Free Radic Biol Med 30:1293-1302. de Caestecker MP, Parks WT, Frank CJ, Castagnino P, Bottaro DP, Roberts AB, Lechleider RJ (1998) Smad2 transduces common signals from receptor serine-threonine and tyrosine kinases. Genes Dev 12:1587-1592.

Dechend R, Hirano F, Lehmann K, Heissmeyer V, Ansieau S, Wulczyn FG, Scheidereit C, Leutz A (1999) The Bcl-3 oncoprotein acts as a bridging factor between NF-kappaB/Rel and nuclear co-regulators. Oncogene 18:3316-3323.

Dejardin E, Droin NM, Delhase M, Haas E, Cao Y, Makris C, Li ZW, Karin M, Ware CF, Green DR (2002) The lymphotoxin-beta receptor induces different patterns of gene expression via two NF-kappaB pathways. Immunity 17:525-535.

Delhase M, Li N, Karin M (2000) Kinase regulation in inflammatory response. Nature 406:367- 368.

Denning MF (2004) Epidermal keratinocytes: regulation of multiple cell phenotypes by multiple protein kinase C isoforms. Int J Biochem Cell Biol 36:1141-1146.

Denning MF, Wang Y, Tibudan S, Alkan S, Nickoloff BJ, Qin JZ (2002) Caspase activation and disruption of mitochondrial membrane potential during UV radiation-induced apoptosis of human keratinocytes requires activation of protein kinase C. Cell Death Differ 9:40-52.

Deucher A, Efimova T, Eckert RL (2002) Calcium-dependent involucrin expression is inversely regulated by protein kinase C (PKC)alpha and PKCdelta. J Biol Chem 277:17032-17040.

Diamond I, Owolabi T, Marco M, Lam C, Glick A (2000) Conditional gene expression in the epidermis of transgenic mice using the tetracycline-regulated transactivators tTA and rTA linked to the keratin 5 promoter. J Invest Dermatol 115:788-794.

134

Didsbury J, Weber RF, Bokoch GM, Evans T, Snyderman R (1989) rac, a novel ras-related family of proteins that are botulinum toxin substrates. J Biol Chem 264:16378-16382.

Dlugosz AA, Glick AB, Tennenbaum T, Weinberg WC, Yuspa SH (1995) Isolation and utilization of epidermal keratinocytes for oncogene research. Methods Enzymol 254:3-20.:3-20.

Dodd M.E., Ristich VL, Ray S, Lober RM, Bollag WB (2005) Regulation of protein kinase D during differentiation and proliferation of primary mouse keratinocytes. J Invest Dermatol 125:294-306.

Dotto GP (1999) Signal transduction pathways controlling the switch between keratinocyte growth and differentiation. Crit Rev Oral Biol Med 10:442-457.

Fujita T, Nolan GP, Ghosh S, Baltimore D (1992) Independent modes of transcriptional activation by the p50 and p65 subunits of NF-kappa B. Genes Dev 6:775-787.

Gingery A, Bradley EW, Pederson L, Ruan M, Horwood NJ, Oursler MJ (2008) TGF-beta coordinately activates TAK1/MEK/AKT/NFkB and SMAD pathways to promote osteoclast survival. Exp Cell Res 314:2725-2738.

Gloire G, Horion J, El MN, Bex F, Chariot A, Dejardin E, Piette J (2007) Promoter-dependent effect of IKKalpha on NF-kappaB/p65 DNA binding. J Biol Chem %20;282:21308-21318.

Gschwendt M, Dieterich S, Rennecke J, Kittstein W, Mueller HJ, Johannes FJ (1996) Inhibition of protein kinase C mu by various inhibitors. Differentiation from protein kinase c isoenzymes. FEBS Lett 392:77-80.

Hacker H, Karin M (2002) Is NF-kappaB2/p100 a direct activator of programmed cell death? Cancer Cell 2:431-433.

Halstead J, Kemp K, Ignotz RA (1995) Evidence for involvement of phosphatidylcholine- phospholipase C and protein kinase C in transforming growth factor-beta signaling. J Biol Chem 270:13600-13603.

Harper JR, Reynolds SH, Greenhalgh DA, Strickland JE, Lacal JC, Yuspa SH (1987) Analysis of the rasH oncogene and its p21 product in chemically induced skin tumors and tumor-derived cell lines. Carcinogenesis 8:1821-1825.

135

He J, Tegen SB, Krawitz AR, Martin GS, Luo K (2003) The transforming activity of Ski and SnoN is dependent on their ability to repress the activity of Smad proteins. J Biol Chem 278:30540-30547.

Hehner SP, Heinrich M, Bork PM, Vogt M, Ratter F, Lehmann V, Schulze-Osthoff K, Droge W, Schmitz ML (1998) Sesquiterpene lactones specifically inhibit activation of NF-kappa B by preventing the degradation of I kappa B-alpha and I kappa B-beta. J Biol Chem 273:1288-1297.

Hehner SP, Hofmann TG, Droge W, Schmitz ML (1999) The antiinflammatory sesquiterpene lactone parthenolide inhibits NF-kappa B by targeting the I kappa B kinase complex. J Immunol 163:5617-5623.

Helfrich I, Schmitz A, Zigrino P, Michels C, Haase I, le BA, Leitges M, Niessen CM (2007) Role of aPKC isoforms and their binding partners Par3 and Par6 in epidermal barrier formation. J Invest Dermatol 127:782-791.

Helmig S, Stephan P, Dohrel J, Schneider J (2011) TNF-alpha mRNA expression correlates with TGF-beta mRNA expression in vivo. Inflammation 34:255-259.

Hennings H, Holbrook K, Steinert P, Yuspa S (1980a) Growth and differentiation of mouse epidermal cells in culture: effects of extracellular calcium. Curr Probl Dermatol 10:3-25.

Hennings H, Michael D, Cheng C, Steinert P, Holbrook K, Yuspa SH (1980b) Calcium regulation of growth and differentiation of mouse epidermal cells in culture. Cell 19:245-254.

Herrero-Martin G, Hoyer-Hansen M, Garcia-Garcia C, Fumarola C, Farkas T, Lopez-Rivas A, Jaattela M (2009) TAK1 activates AMPK-dependent cytoprotective autophagy in TRAIL-treated epithelial cells. EMBO J 28:677-685.

Hinata K, Gervin AM, Jennifer ZY, Khavari PA (2003) Divergent gene regulation and growth effects by NF-kappa B in epithelial and mesenchymal cells of human skin. Oncogene 22:1955- 1964.

Hoeflich KP, Luo J, Rubie EA, Tsao MS, Jin O, Woodgett JR (2000) Requirement for glycogen synthase kinase-3beta in cell survival and NF-kappaB activation. Nature 406:86-90.

Holden NS, Squires PE, Kaur M, Bland R, Jones CE, Newton R (2008) Phorbol ester-stimulated NF-kappaB-dependent transcription: roles for isoforms of novel protein kinase C. Cell Signal 20:1338-1348.

Hordijk PL (2006) Regulation of NADPH oxidases: the role of Rac proteins. Circ Res 98:453- 462.

Hou S, Guan H, Ricciardi RP (2003) Phosphorylation of serine 337 of NF-kappaB p50 is critical for DNA binding. J Biol Chem 278:45994-45998.

Ignotz RA, Honeyman T (2000) TGF-beta signaling in A549 lung carcinoma cells: lipid second messengers. J Cell Biochem 78:588-594.

136

Inman GJ, Nicolas FJ, Callahan JF, Harling JD, Gaster LM, Reith AD, Laping NJ, Hill CS (2002) SB-431542 is a potent and specific inhibitor of transforming growth factor-beta superfamily type I activin receptor-like kinase (ALK) receptors ALK4, ALK5, and ALK7. Mol Pharmacol 62:65-74.

Ishiguro K, Green T, Rapley J, Wachtel H, Giallourakis C, Landry A, Cao Z, Lu N, Takafumi A, Goto H, Daly MJ, Xavier RJ (2006) Ca2+/calmodulin-dependent protein kinase II is a modulator of CARMA1-mediated NF-kappaB activation. Mol Cell Biol 26:5497-5508.

Jinnin M, Ihn H, Tamaki K (2006) Characterization of SIS3, a novel specific inhibitor of Smad3, and its effect on transforming growth factor-beta1-induced extracellular matrix expression. Mol Pharmacol 69:597-607.

Johannes FJ, Horn J, Link G, Haas E, Siemienski K, Wajant H, Pfizenmaier K (1998) Protein kinase Cmu downregulation of tumor-necrosis-factor-induced apoptosis correlates with enhanced expression of nuclear-factor-kappaB-dependent protective genes. Eur J Biochem 257:47-54.

Jono H, Shuto T, Xu H, Kai H, Lim DJ, Gum JR, Jr., Kim YS, Yamaoka S, Feng XH, Li JD (2002) Transforming growth factor-beta -Smad signaling pathway cooperates with NF-kappa B to mediate nontypeable Haemophilus influenzae-induced MUC2 mucin transcription. J Biol Chem 277:45547-45557.

Julien S, Puig I, Caretti E, Bonaventure J, Nelles L, van RF, Dargemont C, de Herreros AG, Bellacosa A, Larue L (2007) Activation of NF-kappaB by Akt upregulates Snail expression and induces epithelium mesenchyme transition. Oncogene 26:7445-7456.

Kajino T, Omori E, Ishii S, Matsumoto K, Ninomiya-Tsuji J (2007) TAK1 MAPK kinase kinase mediates transforming growth factor-beta signaling by targeting SnoN oncoprotein for degradation. J Biol Chem 282:9475-9481.

Kashiwagi M, Ohba M, Chida K, Kuroki T (2002) Protein kinase C eta (PKC eta): its involvement in keratinocyte differentiation. J Biochem 132:853-857.

Kon A, Vindevoghel L, Kouba DJ, Fujimura Y, Uitto J, Mauviel A (1999) Cooperation between SMAD and NF-kappaB in growth factor regulated type VII collagen gene expression. Oncogene 18:1837-1844.

Kretzschmar M, Doody J, Massague J (1997) Opposing BMP and EGF signalling pathways converge on the TGF-beta family mediator Smad1. Nature 389:618-622.

Kulkarni AB, Huh CG, Becker D, Geiser A, Lyght M, Flanders KC, Roberts AB, Sporn MB, Ward JM, Karlsson S (1993) Transforming growth factor beta 1 null mutation in mice causes excessive inflammatory response and early death. Proc Natl Acad Sci U S A 90:770-774.

La Porta CA, Comolli R (1998) PKC-dependent modulation of IkB alpha-NFkB pathway in low metastatic B16F1 murine melanoma cells and in highly metastatic BL6 cells. Anticancer Res 18:2591-2597.

137

Labbe E, Silvestri C, Hoodless PA, Wrana JL, Attisano L (1998) Smad2 and Smad3 positively and negatively regulate TGF beta-dependent transcription through the forkhead DNA-binding protein FAST2. Mol Cell 2:109-120.

Lallena MJ, az-Meco MT, Bren G, Paya CV, Moscat J (1999) Activation of IkappaB kinase beta by protein kinase C isoforms. Mol Cell Biol 19:2180-2188.

Leitges M, Sanz L, Martin P, Duran A, Braun U, Garcia JF, Camacho F, az-Meco MT, Rennert PD, Moscat J (2001) Targeted disruption of the zetaPKC gene results in the impairment of the NF-kappaB pathway. Mol Cell 8:771-780.

Li CC, Dai RM, Chen E, Longo DL (1994a) Phosphorylation of NF-KB1-p50 is involved in NF- kappa B activation and stable DNA binding. J Biol Chem 269:30089-30092.

Li CC, Korner M, Ferris DK, Chen E, Dai RM, Longo DL (1994b) NF-kappa B/Rel family members are physically associated phosphoproteins. Biochem J 303:499-506.

Lint JV, Rykx A, Vantus T, Vandenheede JR (2002) Getting to know protein kinase D. Int J Biochem Cell Biol 34:577-581.

Liu ZG, Hsu H, Goeddel DV, Karin M (1996) Dissection of TNF receptor 1 effector functions: JNK activation is not linked to apoptosis while NF-kappaB activation prevents cell death. Cell 87:565-576.

Lluis JM, Nachbur U, Cook WD, Gentle IE, Moujalled D, Moulin M, Wong WW, Khan N, Chau D, Callus BA, Vince JE, Silke J, Vaux DL (2010) TAK1 is required for survival of mouse fibroblasts treated with TRAIL, and does so by NF-kappaB dependent induction of cFLIPL. PLoS One 5:e8620.

Lopez-Rovira T, Chalaux E, Rosa JL, Bartrons R, Ventura F (2000) Interaction and functional cooperation of NF-kappa B with Smads. Transcriptional regulation of the junB promoter. J Biol Chem 275:28937-28946.

Loukinova E, Chen Z, Van WC, Dong G (2001) Expression of proangiogenic chemokine Gro 1 in low and high metastatic variants of Pam murine squamous cell carcinoma is differentially regulated by IL-1alpha, EGF and TGF-beta1 through NF-kappaB dependent and independent mechanisms. Int J Cancer 94:637-644.

Malumbres M, Barbacid M (2003) RAS oncogenes: the first 30 years. Nat Rev Cancer 3:459- 465.

Mauviel A, Lapiere JC, Halcin C, Evans CH, Uitto J (1994) Differential cytokine regulation of type I and type VII collagen gene expression in cultured human dermal fibroblasts. J Biol Chem 269:25-28.

138

Mauviel A, Qiu CY, Dong W, Evans CH, Uitto J (1993) Transcriptional interactions of transforming growth-factor-beta with pro-inflammatory cytokines. Curr Biol 3:822-831.

Mordasky ML, Perez-Lorenzo R, Masiuk KE, Kennett MJ, Glick AB (2010) Use of a TGFbeta type I receptor inhibitor in mouse skin carcinogenesis reveals a dual role for TGFbeta signaling in tumor promotion and progression. Carcinogenesis 31:2127-2135.

Mosialos G, Gilmore TD (1993) v-Rel and c-Rel are differentially affected by mutations at a consensus protein kinase recognition sequence. Oncogene 8:721-730.

Muller JR, Siebenlist U (2003) Lymphotoxin beta receptor induces sequential activation of distinct NF-kappa B factors via separate signaling pathways. J Biol Chem 278:12006-12012.

Natarajan K, Singh S, Burke TR, Jr., Grunberger D, Aggarwal BB (1996) Caffeic acid phenethyl ester is a potent and specific inhibitor of activation of nuclear transcription factor NF-kappa B. Proc Natl Acad Sci U S A %20;93:9090-9095.

Natoli G, Costanzo A, Ianni A, Templeton DJ, Woodgett JR, Balsano C, Levrero M (1997) Activation of SAPK/JNK by TNF receptor 1 through a noncytotoxic TRAF2-dependent pathway. Science 275:200-203.

Neil JR, Schiemann WP (2008) Altered TAB1:I kappaB kinase interaction promotes transforming growth factor beta-mediated nuclear factor-kappaB activation during breast cancer progression. Cancer Res 68:1462-1470.

Neumann M, Grieshammer T, Chuvpilo S, Kneitz B, Lohoff M, Schimpl A, Franza BR, Jr., Serfling E (1995) RelA/p65 is a molecular target for the immunosuppressive action of protein kinase A. EMBO J 14:1991-2004.

Ninomiya-Tsuji J, Kajino T, Ono K, Ohtomo T, Matsumoto M, Shiina M, Mihara M, Tsuchiya M, Matsumoto K (2003) A resorcylic acid lactone, 5Z-7-oxozeaenol, prevents inflammation by inhibiting the catalytic activity of TAK1 MAPK kinase kinase. J Biol Chem 278:18485-18490.

Okuyama R, Nguyen BC, Talora C, Ogawa E, Tommasi d, V, Lioumi M, Chiorino G, Tagami H, Woo M, Dotto GP (2004) High commitment of embryonic keratinocytes to terminal differentiation through a Notch1-caspase 3 regulatory mechanism. Dev Cell 6:551-562.

139

Perez-Lorenzo R, Markell LM, Hogan KA, Yuspa SH, Glick AB (2010) Transforming growth factor beta1 enhances tumor promotion in mouse skin carcinogenesis. Carcinogenesis 31:1116- 1123.

Petranka J, Wright G, Forbes RA, Murphy E (2001) Elevated calcium in preneoplastic cells activates NF-kappa B and confers resistance to apoptosis. J Biol Chem 276:37102-37108.

Phan SH, Gharaee-Kermani M, McGarry B, Kunkel SL, Wolber FW (1992) Regulation of rat pulmonary artery endothelial cell transforming growth factor-beta production by IL-1 beta and tumor necrosis factor-alpha. J Immunol 149:103-106.

Phillips AO, Topley N, Steadman R, Morrisey K, Williams JD (1996) Induction of TGF-beta 1 synthesis in D-glucose primed human proximal tubular cells by IL-1 beta and TNF alpha. Kidney Int 50:1546-1554.

Prickett TD, Ninomiya-Tsuji J, Broglie P, Muratore-Schroeder TL, Shabanowitz J, Hunt DF, Brautigan DL (2008) TAB4 stimulates TAK1-TAB1 phosphorylation and binds polyubiquitin to direct signaling to NF-kappaB. J Biol Chem 283:19245-19254.

Raj D, Brash DE, Grossman D (2006) Keratinocyte apoptosis in epidermal development and disease. J Invest Dermatol 126:243-257.

Reddig PJ, Dreckschmidt NE, Ahrens H, Simsiman R, Tseng CP, Zou J, Oberley TD, Verma AK (1999) Transgenic mice overexpressing protein kinase Cdelta in the epidermis are resistant to skin tumor promotion by 12-O-tetradecanoylphorbol-13-acetate. Cancer Res 59:5710-5718.

Reddig PJ, Dreckschmidt NE, Zou J, Bourguignon SE, Oberley TD, Verma AK (2000b) Transgenic mice overexpressing protein kinase C epsilon in their epidermis exhibit reduced papilloma burden but enhanced carcinoma formation after tumor promotion. Cancer Res 60:595- 602.

Reddig PJ, Dreckschmidt NE, Zou J, Bourguignon SE, Oberley TD, Verma AK (2000a) Transgenic mice overexpressing protein kinase C epsilon in their epidermis exhibit reduced papilloma burden but enhanced carcinoma formation after tumor promotion. Cancer Res 60:595- 602.

Ristich VL, Bowman PH, Dodd ME, Bollag WB (2006a) Protein kinase D distribution in normal human epidermis, basal cell carcinoma and psoriasis. Br J Dermatol 154:586-593.

Ristich VL, Bowman PH, Dodd ME, Bollag WB (2006b) Protein kinase D distribution in normal human epidermis, basal cell carcinoma and psoriasis. Br J Dermatol 154:586-593.

Roop DR, Lowy DR, Tambourin PE, Strickland J, Harper JR, Balaschak M, Spangler EF, Yuspa SH (1986) An activated Harvey ras oncogene produces benign tumours on mouse epidermal tissue. Nature 323:822-824.

140

Runyan CE, Schnaper HW, Poncelet AC (2003) Smad3 and PKCdelta mediate TGF-beta1- induced collagen I expression in human mesangial cells. Am J Physiol Renal Physiol 285:F413- F422.

Rutberg SE, Adams TL, Glick A, Bonovich MT, Vinson C, Yuspa SH (2000) Activator protein 1 transcription factors are fundamental to v-rasHa-induced changes in gene expression in neoplastic keratinocytes. Cancer Res 60:6332-6338.

Rutberg SE, Saez E, Glick A, Dlugosz AA, Spiegelman BM, Yuspa SH (1996) Differentiation of mouse keratinocytes is accompanied by PKC-dependent changes in AP-1 proteins. Oncogene 13:167-176.

Ryer EJ, Hom RP, Sakakibara K, Nakayama KI, Nakayama K, Faries PL, Liu B, Kent KC (2006) PKCdelta is necessary for Smad3 expression and transforming growth factor beta- induced fibronectin synthesis in vascular smooth muscle cells. Arterioscler Thromb Vasc Biol 26:780-786.

Saccani S, Pantano S, Natoli G (2003) Modulation of NF-kappaB activity by exchange of dimers. Mol Cell 11:1563-1574.

Saksela K, Baltimore D (1993) Negative regulation of immunoglobulin kappa light-chain gene transcription by a short sequence homologous to the murine B1 repetitive element. Mol Cell Biol 13:3698-3705.

Sakurai H, Chiba H, Miyoshi H, Sugita T, Toriumi W (1999a) IkappaB kinases phosphorylate NF-kappaB p65 subunit on serine 536 in the transactivation domain. J Biol Chem 274:30353- 30356.

Sakurai H, Miyoshi H, Mizukami J, Sugita T (2000) Phosphorylation-dependent activation of TAK1 mitogen-activated protein kinase kinase kinase by TAB1. FEBS Lett 474:141-145.

Sakurai H, Miyoshi H, Toriumi W, Sugita T (1999b) Functional interactions of transforming growth factor beta-activated kinase 1 with IkappaB kinases to stimulate NF-kappaB activation. J Biol Chem 274:10641-10648.

Samad F, Uysal KT, Wiesbrock SM, Pandey M, Hotamisligil GS, Loskutoff DJ (1999) Tumor necrosis factor alpha is a key component in the obesity-linked elevation of plasminogen activator inhibitor 1. Proc Natl Acad Sci U S A 96:6902-6907.

Schmitz ML, Mattioli I, Buss H, Kracht M (2004) NF-kappaB: a multifaceted transcription factor regulated at several levels. Chembiochem 5:1348-1358.

141

Senftleben U, Cao Y, Xiao G, Greten FR, Krahn G, Bonizzi G, Chen Y, Hu Y, Fong A, Sun SC, Karin M (2001) Activation by IKKalpha of a second, evolutionary conserved, NF-kappa B signaling pathway. Science 293:1495-1499.

Sha WC, Liou HC, Tuomanen EI, Baltimore D (1995) Targeted disruption of the p50 subunit of NF-kappa B leads to multifocal defects in immune responses. Cell 80:321-330.

Shan W, Nicol CJ, Ito S, Bility MT, Kennett MJ, Ward JM, Gonzalez FJ, Peters JM (2008) Peroxisome proliferator-activated receptor-beta/delta protects against chemically induced liver toxicity in mice. Hepatology 47:225-235.

Sharlow ER, Giridhar KV, LaValle CR, Chen J, Leimgruber S, Barrett R, Bravo-Altamirano K, Wipf P, Lazo JS, Wang QJ (2008) Potent and selective disruption of protein kinase D functionality by a benzoxoloazepinolone. J Biol Chem 283:33516-33526.

Shi X, Yang X, Chen D, Chang Z, Cao X (1999) Smad1 interacts with homeobox DNA-binding proteins in bone morphogenetic protein signaling. J Biol Chem 274:13711-13717.

Shim JH, Xiao C, Paschal AE, Bailey ST, Rao P, Hayden MS, Lee KY, Bussey C, Steckel M, Tanaka N, Yamada G, Akira S, Matsumoto K, Ghosh S (2005) TAK1, but not TAB1 or TAB2, plays an essential role in multiple signaling pathways in vivo. Genes Dev 19:2668-2681.

Singhirunnusorn P, Suzuki S, Kawasaki N, Saiki I, Sakurai H (2005) Critical roles of threonine 187 phosphorylation in cellular stress-induced rapid and transient activation of transforming growth factor-beta-activated kinase 1 (TAK1) in a signaling complex containing TAK1-binding protein TAB1 and TAB2. J Biol Chem 280:7359-7368.

Sivaprasad U, Fleming J, Verma PS, Hogan KA, Desury G, Cohick WS (2004) Stimulation of insulin-like growth factor (IGF) binding protein-3 synthesis by IGF-I and transforming growth factor-alpha is mediated by both phosphatidylinositol-3 kinase and mitogen-activated protein kinase pathways in mammary epithelial cells. Endocrinology 145:4213-4221.

Solis-Herruzo JA, Brenner DA, Chojkier M (1988) Tumor necrosis factor alpha inhibits collagen gene transcription and collagen synthesis in cultured human fibroblasts. J Biol Chem 263:5841- 5845.

Soltoff SP (2007) Rottlerin: an inappropriate and ineffective inhibitor of PKCdelta. Trends Pharmacol Sci 28:453-458.

Sorrentino A, Thakur N, Grimsby S, Marcusson A, von B, V, Schuster N, Zhang S, Heldin CH, Landstrom M (2008) The type I TGF-beta receptor engages TRAF6 to activate TAK1 in a receptor kinase-independent manner. Nat Cell Biol 10:1199-1207.

142

Strickland JE, Greenhalgh DA, Koceva-Chyla A, Hennings H, Restrepo C, Balaschak M, Yuspa SH (1988) Development of murine epidermal cell lines which contain an activated rasHa oncogene and form papillomas in skin grafts on athymic nude mouse hosts. Cancer Res 48:165- 169.

Sun L, Deng L, Ea CK, Xia ZP, Chen ZJ (2004) The TRAF6 ubiquitin ligase and TAK1 kinase mediate IKK activation by BCL10 and MALT1 in T lymphocytes. Mol Cell 14:289-301.

Sun SC (2011) Non-canonical NF-kappaB signaling pathway. Cell Res 21:71-85.

Takao J, Yudate T, Das A, Shikano S, Bonkobara M, Ariizumi K, Cruz PD (2003) Expression of NF-kappaB in epidermis and the relationship between NF-kappaB activation and inhibition of keratinocyte growth. Br J Dermatol 148:680-688.

Takehara K, LeRoy EC, Grotendorst GR (1987) TGF-beta inhibition of endothelial cell proliferation: alteration of EGF binding and EGF-induced growth-regulatory (competence) gene expression. Cell 49:415-422.

Teferedegne B, Green MR, Guo Z, Boss JM (2006) Mechanism of action of a distal NF-kappaB- dependent enhancer. Mol Cell Biol 26:5759-5770.

Tibudan SS, Wang Y, Denning MF (2002) Activation of protein kinase C triggers irreversible cell cycle withdrawal in human keratinocytes. J Invest Dermatol 119:1282-1289.

Tobar N, Villar V, Santibanez JF (2010) ROS-NFkappaB mediates TGF-beta1-induced expression of urokinase-type plasminogen activator, matrix metalloproteinase-9 and cell invasion. Mol Cell Biochem 340:195-202.

Toullec D, Pianetti P, Coste H, Bellevergue P, Grand-Perret T, Ajakane M, Baudet V, Boissin P, Boursier E, Loriolle F, . (1991) The bisindolylmaleimide GF 109203X is a potent and selective inhibitor of protein kinase C. J Biol Chem 266:15771-15781.

Vega RB, Harrison BC, Meadows E, Roberts CR, Papst PJ, Olson EN, McKinsey TA (2004) Protein kinases C and D mediate agonist-dependent cardiac hypertrophy through nuclear export of histone deacetylase 5. Mol Cell Biol 24:8374-8385.

Vermeulen L, De WG, Van DP, Vanden BW, Haegeman G (2003) Transcriptional activation of the NF-kappaB p65 subunit by mitogen- and stress-activated protein kinase-1 (MSK1). EMBO J 22:1313-1324.

Verrecchia F, Vindevoghel L, Lechleider RJ, Uitto J, Roberts AB, Mauviel A (2001) Smad3/AP- 1 interactions control transcriptional responses to TGF-beta in a promoter-specific manner. Oncogene 20:3332-3340.

Verrecchia F, Wagner EF, Mauviel A (2002) Distinct involvement of the Jun-N-terminal kinase and NF-kappaB pathways in the repression of the human COL1A2 gene by TNF-alpha. EMBO Rep 3:1069-1074.

143

Wajant H, Pfizenmaier K, Scheurich P (2003) Tumor necrosis factor signaling. Cell Death Differ 10:45-65.

Wang D, Westerheide SD, Hanson JL, Baldwin AS, Jr. (2000) Tumor necrosis factor alpha- induced phosphorylation of RelA/p65 on Ser529 is controlled by casein kinase II. J Biol Chem 275:32592-32597.

Wang G, Long J, Matsuura I, He D, Liu F (2005) The Smad3 linker region contains a transcriptional activation domain. Biochem J 386:29-34.

Wang HQ, Smart RC (1999) Overexpression of protein kinase C-alpha in the epidermis of transgenic mice results in striking alterations in phorbol ester-induced inflammation and COX-2, MIP-2 and TNF-alpha expression but not tumor promotion. J Cell Sci 112 ( Pt 20):3497-3506.

Warshamana GS, Corti M, Brody AR (2001) TNF-alpha, PDGF, and TGF-beta(1) expression by primary mouse bronchiolar-alveolar epithelial and mesenchymal cells: tnf-alpha induces TGF- beta(1). Exp Mol Pathol 71:13-33.

Weil M, Raff MC, Braga VM (1999) Caspase activation in the terminal differentiation of human epidermal keratinocytes. Curr Biol 9:361-364.

Wu NL, Lee TA, Tsai TL, Lin WW (2011) TRAIL-induced keratinocyte differentiation requires caspase activation and p63 expression. J Invest Dermatol 131:874-883.

Wullaert A, Bonnet MC, Pasparakis M (2011) NF-kappaB in the regulation of epithelial homeostasis and inflammation. Cell Res 21:146-158.

Xia L, Wang H, Munk S, Kwan J, Goldberg HJ, Fantus IG, Whiteside CI (2008) High glucose activates PKC-zeta and NADPH oxidase through autocrine TGF-beta1 signaling in mesangial cells. Am J Physiol Renal Physiol 295:F1705-F1714.

Xiao G, Harhaj EW, Sun SC (2001) NF-kappaB-inducing kinase regulates the processing of NF- kappaB2 p100. Mol Cell 7:401-409.

Yakymovych I, ten DP, Heldin CH, Souchelnytskyi S (2001) Regulation of Smad signaling by protein kinase C. FASEB J 15:553-555.

Yanagisawa J, Yanagi Y, Masuhiro Y, Suzawa M, Watanabe M, Kashiwagi K, Toriyabe T, Kawabata M, Miyazono K, Kato S (1999) Convergence of transforming growth factor-beta and vitamin D signaling pathways on SMAD transcriptional coactivators. Science 283:1317-1321.

Yin L, Wu L, Wesche H, Arthur CD, White JM, Goeddel DV, Schreiber RD (2001) Defective lymphotoxin-beta receptor-induced NF-kappaB transcriptional activity in NIK-deficient mice. Science 291:2162-2165.

Zawel L, Dai JL, Buckhaults P, Zhou S, Kinzler KW, Vogelstein B, Kern SE (1998) Human Smad3 and Smad4 are sequence-specific transcription activators. Mol Cell 1:611-617.

144

Zhang P, Chan J, Dragoi AM, Gong X, Ivanov S, Li ZW, Chuang TH, Tuthill C, Wan Y, Karin M, Chu WM (2005) Activation of IKK by thymosin alpha1 requires the TRAF6 signalling pathway. EMBO Rep 6:531-537.

Zhong H, May MJ, Jimi E, Ghosh S (2002) The phosphorylation status of nuclear NF-kappa B determines its association with CBP/p300 or HDAC-1. Mol Cell 9:625-636.

Zhong H, SuYang H, Erdjument-Bromage H, Tempst P, Ghosh S (1997) The transcriptional activity of NF-kappaB is regulated by the IkappaB-associated PKAc subunit through a cyclic AMP-independent mechanism. Cell 89:413-424.

Zhong H, Voll RE, Ghosh S (1998) Phosphorylation of NF-kappa B p65 by PKA stimulates transcriptional activity by promoting a novel bivalent interaction with the coactivator CBP/p300. Mol Cell 1:661-671.

Zhou S, Zawel L, Lengauer C, Kinzler KW, Vogelstein B (1998) Characterization of human FAST-1, a TGF beta and activin signal transducer. Mol Cell 2:121-127.

Zugaza JL, Sinnett-Smith J, Van LJ, Rozengurt E (1996) Protein kinase D (PKD) activation in intact cells through a protein kinase C-dependent signal transduction pathway. EMBO J 15:6220- 6230.

Zugaza JL, Waldron RT, Sinnett-Smith J, Rozengurt E (1997) Bombesin, vasopressin, endothelin, bradykinin, and platelet-derived growth factor rapidly activate protein kinase D through a protein kinase C-dependent signal transduction pathway. J Biol Chem 272:23952- 23960.

145

Chapter 3

Role of Transforming Growth Factor β1 (TGFβ-1) in Ultraviolet Radiation (UVB) Responsiveness

I Abstract

The biological relevance of TGFβ-1-mediated TNFα was then explored in the context of ultraviolet radiation responsiveness, which elicits an inflammatory response involving the proinflammatory cytokine TNFα. Ultraviolet radiation, particularly the UVB wavelengths ranging from 280-320 nm, is a whole carcinogen capable of initiating and promoting squamous cell carcinoma (SCC), among other types of skin cancer, in both humans and laboratory rodents after repeated UVB exposure over time. Responsiveness to UVB, specifically, has not been particularly well-characterized in keratinocytes. Presently, the literature reflects more rigorous characterization of the UVC wavelengths in cell types that are typically not sun-exposed. Furthermore, published studies using the mouse as a model to inquire into TGFβ-1-mediated UVB responsiveness are non-existent. The present studies, performed in mouse and in primary keratinocytes isolated from mouse, demonstrate the intersection of TGFβ-1 and NFκB in the context of UVB responsiveness. Specifically, the hypothesis to be tested predicts that response to UVB will be partially dependent on TGFβ-1 signaling. UVB treated mice and keratinocytes in culture demonstrated Smad3- and NFκB-dependent expression of the proinflammatory cytokine TNFα between 2-6 h post treatment and required an intact TGFβ-1 signaling pathway. Furthermore, an acute decrement in Smad7 expression was observed initially, but restored to control levels by 6 h. Smad7 repression also appears to be partially Smad3 dependent. The results of these studies also demonstrated for the first time TGFβ-1-mediated NFκB binding of p50 and p65 subunits to DNA following UVB exposure. Although degradation of IκB or translocation of the p50 subunit was not observed, the data presented herein suggested a scenario whereby the NFκB-dependent proinflammatory cytokine was expressed in a p50- and Smad3- dependent manner. Taken together, it is likely that TGFβ-1 is among the pathways involving NFκB transactivation that modulate or tune response to UVB.

II Introduction

TGFβ-1 and ultraviolet radiation have in common several features: both can cause growth inhibition and acute inflammation. However, the kinetics of growth inhibition differ between TGFβ-1 and UVB. Whereas growth inhibitory effects of UVB occur 3 h after an erythemal dose (Petrocelli et al., 1996), TGFβ-1-induced G1 growth arrest occurs 1-2 d post TGFβ-1 (van et al., 1994;Glick et al., 1994) in human keratinocytes in culture. During the process of inflammation, however, TGFβ-1 and UVB play a dual role: both are proinflammatory during early stages of inflammation and become immune suppressive late in the inflammatory

146

process. In spite of their common actions in skin, very little is known, however, about the role of TGFβ-1 in UVB responsiveness.

Published studies have not elucidated a role for TGFβ-1 in UVB responsiveness in the mouse. Instead, this question has been explored in whole human skin as well as primary human keratinocytes isolated from foreskin. In UVB irradiated human skin, an increase in TGFβ-1 and - 3 was observed along with a decrement in TGFβ-2. Although no change in type I TGFβ receptors occurred, type II TGFβ receptors were decreased in the basal and suprabasal layers. Although no change was observed in Smads2, 3, or 4, Smad7 was increased. Finally, Smad3/4 binding was decreased (Quan et al., 2002b). This UVB-induced downregulation of TGFβ-1 reported by Quan et al was shown in another study demonstrating UVB-induced repression of the TGFβ-1-mediated gene connective tissue growth factor (CTGF) (Quan et al., 2002a). A similar result was shown in aging skin that had been chronically exposed to UVR. These studies as well demonstrated increased Smad7 and downregulation of type 2 TGFβ receptor (Han et al., 2005). Studies involving administration of narrow-band UVB to human skin afflicted with atopic dermatitis (AD)—an inflammatory disease—result in increased levels of Smad3 was observed, which is correlated with improvement of the disease. This is in contrast to decreased levels observed in non-UV irradiated AD skin (Gambichler et al., 2006). In spite of observations in whole skin showing UVB-induced downregulation of the TGFβ-1 pathway, UVB-treated primary human keratinocytes appear to increase de novo TGFβ-1 mRNA accumulation (Lee et al., 1997) as well as bioavailable TGFβ-1 (Wang and Kochevar, 2005). One mechanism for UVB-mediated increase in bioactive TGFβ-1 was UVB mediated, ligand independent activation of the EGF receptor, which in turn increased NADPH oxidase activity through rac. The production of reactive oxygen species stimulated MMP-2 and -9, which cleaved latent TGFβ-1 to the bioactive form (Wang and Kochevar, 2005). Taken together, published studies reveal a keratinocyte-specific response to UVB through the TGFβ-1 signaling pathway, which seems to indicate, on the one hand, downregulation of the TGFβ-1 pathway, but on the other hand, increased expression and bioavailability of TGFβ-1. However, a paucity of data exists for the role of TGFβ-1 in UVB responsiveness in terms of alterations in singaling and gene expression.

Results of studies outlined in Chapter 2 strongly suggest an intersection between TGFβ-1 and NFκB, namely that TGFβ-1 modulates the expression of NFκB-dependent proinflammatory cytokines and that the mechanism involves Smad3 coactivation. Expression of NFκB-dependent proinflammatory cytokines, particularly TNFα, in response to UVB is well-documented (Hawk et al., 1988;Cooper et al., 1993;Strickland et al., 1997a;Komatsu et al., 2006). Both UVB and UVC have been shown to activate NFκB in several cell types, but the biological relevance of studies in cells that are not natural targets of solar radiation is questionable (as reviewed in Chapter 1). In keratinocytes, basal cells are a natural chromophore for UVB (Rosenstein and Mitchell, 1987) and the site of TGFβ-1 biosynthesis in mouse epidermis (Glick et al., 1990).

147

Therefore, comparisons of UVB responsiveness in cell types other than keratinocytes, which may preferentially express another isoform of TGFβ-1, may be confounding.

It is clear from published literature that keratinocytes have adapted a specialized and stringent response of keratinocytes to UVB, which is not evident in cell types that are not normally exposed to UVB (Adachi et al., 2003). However, findings in studies involving keratinocytes are incomplete and inconsistent, suggesting that, despite its significance in skin carcinogenesis, UVB responsiveness is still a nacent field of research. Studies focusing on the role of NFκB in response to UVB can be characterized in two ways: 1) primary cells in culture differ in their UVB responsiveness from immortalized keratinocyte cell lines; and 2) rodent models differ in their UVB responsiveness from human models, highlighting the species specificity of UVB-induced NFκB activation. The most common in vitro model of keratinocytes is derived from normal human foreskin (NHEK). Likewise, the most common immortalized keratinocyte cell line is called HaCat (Boukamp et al., 1988;Lehman et al., 1993). Rarely are mouse primary keratinocytes employed as in vitro models in studies of UVB responsiveness. This paucity of in vitro data in the mouse model may be a consequence of fundamental differences between mouse and human keratinocytes that undermine attempts to compare or translate results from one species to another. For example, proliferating cultured human keratinocytes are more susceptible to UVB-induced apoptosis than mouse keratinocytes. This may be a consequence of lower p53 levels in the mouse (Chaturvedi et al., 2004). Furthermore, cultured mouse keratinocytes in media containing calcium express greater levels of the differentiation marker keratin 1 than human keratinocytes cultured under the same conditions (Chaturvedi et al., 2004). Clearly, extrapolation between human and mouse models is unreliable.

The uncertainty surrounding the role of NFκB in UVB responsiveness persists in part because of the many models employed by in vitro studies in the literature. This is most striking when primary keratinocytes from humans and mice are compared to cell lines derived from humans or mice. UVB research focuses considerably on four in vitro human or mouse models. Of particular relevance to the present studies are published studies of UVB-induced NFκB activation, which remains highly controversial and not completely understood. What studies in these models reveal are nuances in signaling that are highly species, model, and context dependent. These factors need to be carefully considered in future study designs.

NHEK

In NHEKs, UVB-induced NFκB activation is delayed compared to TNFα-induced activation, requiring first the activation of the p38 MAPK stress pathway (Lewis and Spandau, 2007) through the IGF-1 receptor, which shifts NFκB subunit composition toward heterodimer formation and results in expression of anti-apoptotic genes (Lewis and Spandau, 2008). In UVB- treated NHEKs, the IκKβ subunit does not appear to be activated (Adachi et al., 2003). Instead, UVB activates IκKα (Afaq et al., 2003), resulting in slow and persistent NFκB activation, often observed during activation of non-canonical NFκB pathways (Sun, 2011). Likewise, with some

148

exceptions (Afaq et al., 2003;Afaq et al., 2005), IκB is not typically activated or degraded by the activation of Ser 32 and 36 following UVB exposure in NHEKs (Lewis et al., 2006;Lewis and Spandau, 2007;Adachi et al., 2003). Instead, IκB degradation in NHEKs appears to occur through a specialized pathway that targets the amino acids in the PEST domain of IκB (Ito et al., 1995). Translocation of NFκB occurs in NHEK, but is delayed compared to TNFα-induced activation of NFκB (Lewis and Spandau, 2007). Phosphorylation of subunits in NHEK has been reported both to occur (Afaq et al., 2005), but does not appear obligatory based on other studies in human primary keratinocytes (Lewis and Spandau, 2007).

HaCaT

In HaCaT cells, very different mechanisms of NFκB activation emerged and this is likely an artifact of aberrant NFκB activity in this cell line. HaCat cells exhibit very high constituitive NFκB activation in untreated cells and a corresponding high degree of IκB degradation (Boukamp et al., 1988). This may be a consequence of high levels of activated AKT, which is known to activate NFκB (Madrid et al., 2000;Kuhn et al., 1999). Furthermore, HaCaT cells lack p53, which may explain in part the constituitively high NFκB activation, and are highly sensitive to apoptosis (Lehman et al., 1993). What the HaCaT model has provided, however, is insight into a role for UVB-induced reactive oxygen species, which are produced by NADPH oxidase and activate NFκB (Beak et al., 2004). In spite of their use in studies elucidating a role for NFκB in UVB responsiveness, HaCaT cells may not be the most appropriate model for this purpose.

Primary murine keratinocytes

In contrast, few studies of the role of NFκB in UVB responsiveness have been undertaken in primary murine keratinocytes. This may be a consequence of the ready availability of NHEK and HaCaT cells. One study focusing on the role of Erbb2 in UVB- induced NFκB-dependent gene expression utilizes the genetically outbred CD-1 primary mouse keratinocytes (Madson et al., 2006;El-Abaseri and Hansen, 2007;Madson and Hansen, 2007). To date, no other studies of NFκB in UVB responsiveness have been identified using primary mouse keratinocytes in culture.

Mouse keratinocyte cell lines

Immortalized mouse keratinocyte cell lines have provided interesting, but potentially confounding data as a consequence of transformed phenotypes that characterize these cell lines. Studies in murine cell lines have demonstrated DNA damage-induced activation of NFκB, a consequence of increased TNFα expression observed in the aftermath of a genotoxic lesion (Schwarz and Schwarz, 2009;O'Connor et al., 1996). Furthermore, in immortalized mouse keratinocytes, an interesting mechanism has emerged for UVB-induced NFκB through TNF receptor type I (TNFRI). In a ligand-independent fashion, TNFR1 trimerize and associate with TRAF2 to activate NFκB (Tobin et al., 1998). Whether mechanisms identified in keratinocyte cell lines will be recapitulated in primary cells remains to be seen.

149

Taken together, a review of studies utilizing mouse and in human in vitro models focusing specifically on mechanisms of UVB-mediated NFκB activation reveals variations from model to model that may confound experimental findings and interpretation of published data.

In the present studies, performed in mouse and in primary keratinocytes isolated from mouse, this work explored the intersection of TGFβ-1 and NFκB in the context of UVB responsiveness. Specifically, it is hypothesized that UVB responsiveness will be partially dependent on TGFβ-1 signaling. These studies show TGFβ-1-mediated expression of a UVB- induced proinflammatory cytokine through a Smad3 dependent mechanism that begins with upstream activation of cytosolic Smad 3 and requires TGFβ-1-mediated NFκB binding to DNA.

III Materials and Methods

A. Materials

B. Animal studies

Forty eight hours prior to exposure, mice were shaved. For irradiation, mice were placed in a UVB chamber which accommodated gang cages and a hanging housing specific for a bank of T8 and T12 rapid start fluorescent lamps (American Ultraviolet Light Company, Lebanon IN). Lamps emitted a wavelength of energy within the UVB spectrum (315-280 nm). To filter extraneous UVC wavelengths, the long wave passing filter Kodacel was secured to the housing so that it covered the bulbs. Using the equation described below, irradiance was measured using a UVX-31 radiometer with a sensor (UVP, Upland, CA). Mice lacking one or both alleles for Smad3 (C57BL/J6) (Datto et al., 1999) or TGFβ-1 (Balb/c) (Kulkarni et al., 1993) were exposed for to 540 mJ/cm2 of UVB radiation and sacrificed 6, 24, or 48 hours post exposure according to Metz et al. (Metz et al., 2006). To prevent human exposure to UVB radiation, the chamber was covered while the experiment was in progress. Use of animals was approved by the Institutional Animal Care and Use Committee (IACUC).

Isolation of keratinocytes and fibroblasts

Isolation of primary keratinocytes was performed according to Dlugosz et al. (Dlugosz et al., 1995). Briefly, keratinocytes were isolated from 1-3 day old mouse pups born to FVB/n, Smad3 wild type, heterozygous, and knockout mice (C57BL/J6) (Datto et al., 1999), TGFβ-1 wild type and heterozygous mice (Balb/c) (Kulkarni et al., 1993), NFκB1/p50 wild type,

150

heterozyogous, and knockout mice (FVB) (Sha et al., 1995), and keratinocytes isolated from transgenic mice expressing a firefly luciferase gene driven by a Smad binding element (SBE) (Satterwhite et al., 2007). Genotypes were identified from tail snips. Skins were isolated from mouse pups and varied in size based on the age of the pups. To separate the dermis from the epidermis, skins were floated in 0.25% trypsin without EDTA (Cellgro, Manassas, VA) overnight at 4 degrees C. The epidermis was then separated from the dermis and minced in S- MEM media (Invitrogen, Carlsbad, CA) containing 1.4 mM calcium. Minced epidermis was strained through a 100 μm nylon cell strainer (BD Falcon, Bedford, MA). Isolated cells were pelleted by centrifugation and then reconstituted in 1mL S-MEM medium per mouse skin and amended with calcium chloride to a final concentration of 0.2mM. Cells that were cryopreserved contained 10% DMSO and were placed at -80˙C before being submerged in liquid nitrogen.

Isolation of primary fibroblasts from the dermal portion of pup skin occurred after trypsinization according to laboratory protocol. Collagenase (0.35 g) was placed in DMEM, mixed, and centrifuged for 5-10 minutes at 2000 rpm. Collagenase was than filtered sequentially through a 0.45 μm and 0.22 μm filter. Dermis collected from primary keratinocyte isolation was placed in 10 mL of collagenase and minced with sterile scissors. DNAase (20,000 unit/mL) was added to dermis, which was then incubated for 10 min at room temperature. The volume was then brought up to 25 mL with DMEM containing 1.5 mM calcium chloride and the mixture was filtered through sterile gauze. The collected portion was pelleted at 1000 rpm for 5 min and the resulting pellet resuspended with 50 mL DMEM and 10% serum. The resuspended pellet was centrifuged again for 5 min and the supernatant saved. This step was repeated. The last centrifugation occurred at 1000 rpm and the resulting pellet was reconstituted based on mouse equivalents isolated.

C. Cell culture

NHK4 cells or primary mouse keratinocytes were plated in S-MEM (Earle’s salts, L- glutamate, non-essential amino acids, sodium phosphate monobasic at 0.14 g/L, without calcium chloride) containing 8% chelexed bovine serum amended with a final calcium chloride concentration of 0.2 mM. Typically, cells were plated in terms of a “mouse equivalent” or the amount of basal cells contained within one skin, which varied depending upon the day post birth. Each dish or tray required a particular number of mouse equivalents. However, for isolation of nuclear extract, 5 million cells were plated per 100 mm tissue culture dish. Within 12 hours of initial plating, the medium was replaced with fresh medium containing a final concentration of 0.05mM calcium chloride (Hennings et al., 1980b;Hennings et al., 1980a). Subsequent changes of media occurred 48 hours later or according to the requirements of a specific experiment. Calcium concentration remained 0.05mM through the course of the experiment to prevent differentiation.

D. In vitro UVB treatment

151

Plated cells were washed three times with PBS at room temperature and then UV irradiated in PBS to avoid the generation of reactive photoproducts from media components. Plates were then placed into a CL-1000 Ultraviolet Crosslinker (UVP, Upland, CA) with five F8T5 8 watt UVB lamps (UVP, Upland, CA) emitting a wavelength in the UVB range at 302 nm. The UVB crosslinker delivers constant power (mW/cm2 ); therefore, desired energy (mJ/cm2) was entered into the instrument and the time (sec) of exposure determined by the following equation: Power (mW/cm2) X Time (sec) = Energy (mJ/cm2), where Power = 0.1mJ/cm2 and Energy = 250-1000 mJ/cm2. Exposure to UVB, therefore, was equivalent to 25-100 mJ/cm2. Non-treated UVB controls were bathed in PBS for the duration of the experiment. Media collected prior to UVB exposure was returned to each respective plate.

E. Preparation of whole cell lysates

Whole cell lysate consisting of a crude prep or cytosolic and nuclear components was obtained using a RIPA buffer (1% Triton-X, 0.5% sodium deoxycholate, 0.1% SDS, 50 mM Tris HCl pH 7.4, 150 mM NaCl, 1 mM EDTA) with a protease and phosphatase inhibitor cocktail (10 mM NaF, 2 mM sodium orthovanadate , 1 mM phenylmethylsulfonyl fluoride (PMSF), 10 ug/mL leupeptin, 10 ug/mL aprotinin, 10 ug/mL trypsin inhibitor) containing inhibitors of tyrosine phosphatase, serine protease, calpain, and aspartyl protease. Cells were scraped, collected into centrifuge tubes, centrifuged at 13,000 x g for 15 min at 4˙C. Lysates were transferred to a fresh centrifuge tube, aliquoted into smaller volumes, and stored at -80˙C to protect phophoproteins. Protein concentrations were determined by BCA protein assay.

F. Western analysis

Protein samples were heated to 95 degrees C for 5 min and resolved on a 12.5% polyacrylamide gel (for 1 gel, 5 mL 30% bis-acrylamide, 3 mL 1.5 M Tris pH 8.8, 3.775 mL dH2O, 120 uL 10% SDS, 90 uL 10% APS, 6 uL TEMED) at 120 V for approximately 2 hours (Sivaprasad et al., 2004). Proteins were transferred to 0.2 μM nitrocellulose (BioRad, Hercules, CA) at 100V for 1 hour. Protein-containing membranes were blocked with 5% powder milk dissolved in wash buffer (10 mL 1 M Tris, 40 mL 5M NaCl, 4 mL Tween 20). Membranes were incubated with antibodies against: pSmad 2 (1:1000) (Cell Signaling, Danvers, MA); actin (1:10,000) (Millipore, Billerica, MA); total IκB C-21 (1:2000) (Santa Cruz, Santa Cruz, CA); pSmad3 (1:1000) (Epitomics, Burlingame, CA); α-tubulin (1:1000) (Invitrogen, Carlsbad, CA); p50 C-19 (1:500) (Santa Cruz, Santa Cruz, CA) ; and Lamin A/C (1:1000) (Cell Signaling, Danvers, MA). Following overnight incubation with primary antibodies, membranes were incubated 1h at room temperature with an appropriate horseradish peroxidase-linked secondary

152 antibody. Peroxidase activity was detected by enhanced chemiluminesence (Thermo Scientific, Rockford, IL) and autoradiography (American Digital Imaging, Boise, ID).

G. Preparation of nuclear extract

Confluent cells were washed twice with ice cold PBS and kept on ice. Buffer A (0.33M sucrose, 10mM Hepes pH 7.4, 1mM MgCl2, 0.1% Triton X-100) amended with protease and phosphatase inhibitors described above was applied to each dish, which was kept on ice. Prior to applying Buffer A, plates were again aspirated. To a 100 mm plate of cells, 0.3 mL Buffer A was added. Plates remained on ice and were gently scraped. Lysates were collected in a microcentrifuge tube and kept on ice for 30 minutes to extract the cytosolic proteins from plasma membrane, DNA, and nucleoli. Lysates were centrifuged 14,000 x g for 5 minutes at 4˙C. Supernatent representing the cytosolic fraction was collected and transferred to a chilled microcentrifuge tube and kept on ice. To remove any contaminating cytosolic fraction, the remaining pellet was washed twice with 1 mL Buffer A and spun at top speed for 5 min. Buffer A wash buffer was removed by aspiration and 0.15 mL Buffer B (0.45M NaCl, 10mM Hepes pH 7.4, 1mM MgCl2) containing protease inhibitors as previously described. The pellet containing Buffer B was gently resuspended by pipet and incubated on ice for 1 h. Every 10 min., tubes were flicked. Tubes were centrifuged at top speed for 5 min at 4˙C, the nuclear extract removed and aliquoted to cold centrifuge tubes, which were stored at 80˙C. Protein was quantified as described above and extracts and lysates where assayed by western analysis for the presence and absence of the nucleus-specific lamin A/C and the cytoplasm-specific α-tubulin to determine the purity of the fractions.

H. Electrophoretic mobility shift assay

153

dilution factor required to achieve 20,000 cpm/uL. Column efficiency was between 20-30%. For the EMSA reaction, 2 uL labeled probe, 5 uL polydIdC (Sigma, St. Louis, MO), 4 uL 5x binding buffer (20% glycerol, 5 mM MgCl2, 2.5 mM EDTA, 2.5 mM DTT, 250 mM NaCl, 50 mM Tris-HCl pH 7.5), and 9uL of sample (10 ug) were combined and incubated for 20 min. Reactions were performed with a mutant probe (sense: 5’-AGT TGA GGC GAC TTT CCC AGG C-3’; anti-sense: 5’-GCC TGG GAA AGT CGC CTC AAC T-3’) to show specificity of the signal (Shan et al., 2008). The signal produced from the EMSA reaction using the mutant probe was slightly higher than the signal produced by the non-mutant probe. A control using 1 uL (100 pmol) of free probe resulted in the cold probe out competing hot probe and thus the signal. All reactions were incubated at room temperature for 20 min. Nucleic Acid Sample Buffer (5x) (Biorad, Hercules, CA) was added to each reaction (4uL). Centrifugation at 14,000 x g was performed to pellet any precipitants in the reaction, which tended to become trapped in the wells. Reactions with sample buffer were loaded into a Criterion 5% TBE gel (Biorad, Hercules, CA). Gel electrophoresis was performed at 120V using 1x TBE buffer (5x buffer recipe: 108 g Tris base, 55 g boric acid, 40 mL 0.5M EDTA in 2L of dH2O) until the lower dye front was approximately 2/3 through the gel. The gel was adhered to a piece of Whatman and dried for about 2h in a gel dryer.

I. Supershift assay

Supershifts were performed by adding 1ug of antibody 30 min prior to the addition of the radiolabeled probe. Supershifts were performed with p50 NLS (Santa Cruz, Santa Cruz, CA), p65 (F6) (Santa Cruz, Santa Cruz CA), and IgG as an isotype control.

J. Myeloperoxidase Immunohistochemistry

Slides containing 5μm sections of ethanol fixed, paraffin embedded skin samples were deparaffinized with Histochoice (3 x 5 min), hydrated with ETOH (95%, 90%, and 70%), and washed with PBS (3 x 5 min). The tissue sections were incubated with 5% normal goat serum for 30 min at RT and washed in PBS (3 x 5 min). Slides were incubated with a primary antibody for myeloperoxidase (1:500) (Vector Labs, Burlinggame, CA) in 5% BSA in PBS for 30 min at room temperature and then washed in PBS (3 x 5 min). Slides were then incubated with a biotin conjugated goat anti-rabbit IgG secondary antibody (1:2000) (Vector Labs, Burlinggame, CA) in PBS for 30 min at room temperature. A vectastain ABC (Elite) kit provided hydrogen peroxidase conjugated strepavidin enhancement of signal by binding to the biotinylated secondary antibody. Slides were incubated with this reagent for 30 min at room temperature and washed in PBS (3 x 5 min). A DAB substrate containing a buffer, hydrogen peroxide as a substrate, and a chromogen was applied to slides for 5 min at room temperature. Slides were then washed in distilled water (3 x 5 min). Counter staining was performed with Mayer’s hematoxylin for 25 sec and slides were rinsed with tap water for 5 min. Slides were then

154

dehydrated through ETOH (70%, 90%, 95%) and cleared in Histochoice prior to mounting. Myeloperoxidase positive cells were counted in 5 fields under light microscopy and averaged.

K. RNA Isolation

To isolate RNA from cells, 1 mL Trizol (Invitrogen, Carlsbad, CA) was applied to cells growing on a 60 mm tissue culture dish and collected in a 2 mL chloroform resistant microcentrifuge tube. For tissue, 50-100 mg was homogenized in 1 mL Trizol using a tissue lyzer (Qiagen, Valenicia, CA) at the rate of 30 beats/sec x 4 minutes for a total of 8 minutes, while altering the orientation of the plate between runs. Supernatant was transferred to a fresh 2 mL centrifuge tube, and passed twice through a 26 gauge needle. Chloroform (0.2 mL/1 mL Trizol) was added to each sample, vigorously shaken for 15 sec and incubated at room temperature for 2-3 minutes. Samples were then centrifuged at 12,000 x g for 15 min. The top or aqueous phase was transferred to a fresh 2 mL centrifuge tube and 1 uL (5 ug/uL) RNAse-free glycogen (Invitrogen, Carlsbad, CA) was added as an RNA carrier. Isopropyl alcohol (0.5 mL/1mL Trizol was added to each sample and incubated for 10 min. Samples were then centrifuged at 12,000 x g for 10 min. at 4˙C. Supernatent was aspirated and pellets were washed with 75% ethanol. Samples were then centrifuged at 7500 x g for 5 min. at 4˙C and supernatant aspirated. The remaining RNA pellet was dried for 10 min in a tube rack in a fume hood and dissolved in 50 uL DEPC. Resuspended RNA was incubated at 55˙C for 10 min. and stored at - 80˙C.

L. cDNA synthesis

RNA was quantified on a Nanodrop (Thermo Scientific, Wilmington, DE) using the 260 nm wavelength to determine nucleic acid composition and the 280 nm wavelength to assess protein contamination. A 260/280 ratio of 1.8 indicated purity of the RNA. RNA was diluted to 200 ng/uL. Each reverse transcription reaction contained the following volulme of reagents: 5 uL 5x reverse transcription buffer (Promega, Madison, WI), 0.5 uL 50x 100mM dNTP (Denville Scientific, Metuchen, NJ), 500 ng/mL random primer (Promega, Madison, WI), 0.31uL reverse transcriptase (Promega, Madison, NJ), 12.44 uL DEPC-dH2O. However, a mastermix was made based on the number of reactions such that 18.75 uL master mix was added to 6.25uL (200ng/uL) for a final RNA concentration of 1.25 ug/25uL. The reactions were then placed in a heat block (25 degree C for 10 min, 42 degree C for 2h, 85 degree C for 5 min.) To control for amplification of contaiminating genomic DNA, one reaction lacked reverse transcriptase. cDNA resulting from reverse transcriptase reaction was stored at -20 degree C.

M. qPCR

155

A master mix was made from 15 uL PerfeCTa SYBR Green SuperMix for iQ, 0.8 uL forward and reverse primers, and 3.4 uL dH2O (Quanta Biosciences, Gaithersburg, MD). Reactions consisted of master mix and 50 ng cDNA, which was amplified for 2 min. at 50˙C, 10 min at 95 degree C, then 40 cycles of 95 degree C for 15 sec., and 60 degree C for 1 min. Melt curve analysis followed relative quantification of gene expression to assure specificity of amplification.

Primer 1 Sequence (5'-3') Primer 2 Sequence (5'-3') 18S TCAACTTTCGATGGTAGTCGCCGT TCCTTGGATGTGGTAGCCGTTTCT Smad7 TCTCAGGCATTCCTCGGAAGTCA AAGGTACAGCATCTGGACAGCCT GAPDH TCTTTTGCGTCGCCAGCCGAG GGTGACCAGGCGCCCAATACG IL-6 AACCGCTATGAAGTTCCTCTCTGC TAAGCCTCCGACTTGTGAAGTGGT TNFα GATTATGGCTCAGGGTCCAA GAGACAGAGGCAACCTGACC

N. Luciferase Assay

Luciferase reporter plasmids were constructed of either Smad or NFκB binding element sequences. Smad reporter plasmids contained one copy of the Smad2 binding element and two copies of the Smad 4 binding element (Zawel et al., 1998). NFκB reporter plasmids contained two copies of the immunoglobulin kappa NFκB binding sequences (Saksela and Baltimore, 1993). A renilla-luciferase control plasmid (pRL-CMV) was co-transfected in order measure transfection efficiency. Luciferase assays were performed in 24 well dishes of confluent cells. Each well received 100 uL serum free media and 50 uL of plasmid DNA combined with a lipid carrier. Each assembled reactions included 0.5 ug luciferase reporter plasmid, 0.1 ug pRL-CMV, 50 uL serum free media, and 2 uL Lipofectamine 2000 (Invitrogen, Carlsbad, CA). Once applied, plates were incubated at 37˙C for 4h. Tranfection media was removed and replaced by media containing 0.05 mM calcium chloride. Luciferase and renilla activity was measured by a Promega 20/20 luminometer (Promega, Madison, WI).

O. Statistical Analyses

IV Results

A. Ultraviolet radiation (UVB)-induced TNFα is Smad3- and NFκB-dependent

Using various models of TGFβ-1 signaling pathway ablation, TNFα expression was measured at a dose of 25 mJ/cm2 (Lewis and Spandau, 2007;Afaq et al., 2003) in vitro and 540 mJ/cm2 in vivo (Metz et al., 2006). This dosing protocol was chosen based on short term published studies in this strain. The infrequency with which Smad3 knockout mice are born alive prevented extensive dose response studies in this model. Smad3-dependent UVB-induced

156

TNFα expression was demonstrated both in vivo and in vitro using genetic (Figures 1 and 2) and pharmacologic (Figure 3) models of Smad3 ablation. This result is consistent with UVB induced TNFα expression reported in the literature, which typically occurs 4-6 h post UVB (Skov et al., 1998;Strickland et al., 1997b;Skov et al., 1998;Barr et al., 1999;Brink et al., 2000;Clingen et al., 2001;Scordi and Vincek, 2000).

To confirm that keratinocytes were the source of TNFα in skin, TNFα mRNA accumulation was measured in vitro using UVB-treated Smad3 wild type and knockout keratinocytes as well as UVB-treated FVB/n keratinocytes pretreated with the type II TGFβ-1 receptor inhibitor SB-43152 (1 uM). In culture, wild type primary keratinocytes showed a significant increase of TNFα expression at 2 h, which peaked at 6 h (Figure 2). This increase was significantly abrogated in Smad3 knockout keratinocytes, thus confirming findings observed in vivo in keratinocytes. Consistent with the genetic model, pharmacological inhibition of TGFβ-1 signaling in FVB/n keratinocytes was also significantly inhibited (Figure 3). In FVB/n keratinocytes, a shift in the kinetics of TNFα expression was apparent: TNFα expression peaked in Smad3 wildtype keratinocytes treated with the same dose at 6 h, whereas peak expression in FVB/n keratinocytes occurred at an earlier timepoint. These temporal difference are likely attributed to strain differences between the C57BL/J6 Smad3 wild type mice and FVB/n albino mice (Sharma et al., 2011;Hill et al., 1997;Enk et al., 2006;Chaturvedi et al., 2004).

The dependence of UVB induction of TNFα on endogenous TGFβ-1 was also confirmed in a Balb/c TGFβ-1 heterozygous mouse (Kulkarni et al., 1993). TGFβ-1 heterozygous mice were utilized instead of knockout mice due to the post-natal lethality observed in the knockout. In this model, UVB-induced TNFα expression was also observed at 6 h post treatment (Figure 4). In UVB-treated TGFβ-1 heterozygous mice, TNFα expression was reduced compared to UVB-treated wild type mice. TNFα expression measured in TGFβ-1 wild type and heterozygous keratinocytes in vitro was significantly decreased (Figure 5). To confirm that Smad3-dependent upregulation of other cytokines occurs, IL-6, also expressed post-UVB (Takashima and Bergstresser, 1996;Scordi and Vincek, 2000), was measured in keratinocytes. Indeed, IL-6 was increased at 6 h post UVB, although not significantly. Furthermore, IL-6 expression was decreased in UVB-treated Smad3 knockout keratinocytes, suggesting that in addition to TNFα, IL-6 expression is Smad3-dependent (data not shown.)

To examine the biological relevance of Smad-dependent TNFα expression, a preliminary study was performed to determine the extent of neutrophil recruitment into the dermis following a dose of 540 mJ/cm2. The present studies measured myeloperoxidase activity in UVB-treated TGFβ-1 wild type versus heterozygous mice. Preliminary evidence collected 6 h post UVB indicated that, at least at this early time point, MPO staining does not differ between between genotypes (Figure 6).

Whether and how NFκB mediates response to UVB in keratinocytes remains controversial and not fully elucidated. To confirm that NFκB is indeed involved in UVB

157

FIGURE 3-1

UVB-induced TNFα expression in mice is Smad3 dependent

mRNA accumulation was measured by RT- qPCR and normalized to 18S in skin of mice treated for 6 h with 540 mJ/cm2 UVB. Data are represented as fold increase over control. (Non-UVB treated Smad -/- mice are to be analyzed.)

FIGURE 3- 2

UVB-induced TNFα expression is Smad3- dependent in mouse keratinocytes

mRNA accumulation was measured in Smad3 wild type and knockout primary mouse keratinocytesby RT-qPCR and normalized to 18S (n=3 plates of cells). Data are represented as fold increase over wild type control. The figure is representative of an experiment repeated three times. *p<0.05 vsa and b.

158

FIGURE 3-3

UVB-induced TNFα expression is inhibited pharmacologically by a type I TGFβ-1 receptor antagonist

FVB/n mouse primary keratinocyteswere pretreated with SB-43152 (1 uM), UVB treated (25 mJ/cm2), and harvested 2 h post-UVB. mRNA accumulation was measured by RT-qPCR and normalized to 18S (n=3 plates of cells). Data are represented as fold increase over wild type control. The figure is representative of an experiment repeated three times. *p<0.05 vsa and b.

FIGURE 3-4

UVB-induced TNFα expression in mice is mediated by TGFβ-1 signaling

mRNA accumulation was measured by RT-qPCR and normalized to 18S in whole skin of mice treated for 6 h with 540 mJ/cm2 UVB. Data are represented as fold increase over wild type control. *p<0.05 vs a.

159

FIGURE 3-5

UVB-induced TNFα expression is dependent on TGFβ-1 signaling

TGFβ-1 wild type and heterozygous primary mouse keratinocytes were treated with 25 mJ/cm2 UVB and harvest 2 and 6 h post treatment. mRNA accumulation was measured by RT- qPCR and normalized to 18S (n=3 plates of cells). Data are represented as fold increase over wild type control. The figure is representative of an experiment repeated three times. *p<0.05 vs a and b.

FIGURE 3-6

Mice wild type and knockout for TGFβ-1 demonstrate no evidence of neutrophil infiltration at 6 h post UVB

Myeloperoxidase positive cells were counted in 5 fields on histological slides from skins of treated mice (n=3-4).

160

mediated TNFα expression in these students, UVB-induced expression of TNFα was measured in primary keratinocytes lacking the NFκB subunit p50 using a dose of 25 mJ/cm2. In these studies, TNFα expression was increased at 6 h in p50 wild type keratinocytes (Figure 7), but decreased below control in p50 heterozygous mice. Therefore, UVB did not induce TNFα in keratinocytes lacking p50. Curiously, there was a constituitively high level of TNFα expression in non-treated p50 knockout keratinocytes, suggesting a role for p50 in repression of basal TNFα expression.

To further explore the status of inhibitory Smad7 in the present studies, expression levels were measured at 25 mJ/cm2 in Smad wildtype and knockout keratinocytes with the expectation that, in light of a role for Smad3 in UVB-induced TNFα expression, Smad7 would be downregulated. Indeed, a significant down regulation of Smad7 was observed in primary keratinocytes at 2 h post UVB-treatment (Figure 8). Within 6 h post UVB-treatment in wild type keratinocytes, however, Smad7 levels were higher than control levels. Rapid recovery of Smad7 beyond levels observed in control keratinocytes were higher, but not significantly different from control. Smad7 expression at 6 h post UVB was in fact significantly higher than Smad7 levels in UVB-treated Smad3 knockout mice, suggesting that Smad3 was also involved in mediating expression of Smad7.

The observation that UVB appeared, at least initially, to suppress expression of Smad7, coupled with the apparent Smad3 and NFκB dependence of UVB-induced TNFα expression prompted further inquiry into the nature of UVB-mediated TGFβ-1 signaling. To better understand the effect of TGFβ-1 in Smad transactivation in response to UVB, studies were performed in whole skin and keratinocytes isolated from transgenic mice expressing a firefly luciferase gene driven by 12 Smad binding elements (SBE) (Satterwhite et al., 2007). In transgenic keratinocytes containing an SBE-luciferase reporter, UVB failed to induce the Smad luciferase reporter at 25 mJ/cm2 (Figures 9a-b) or 50 mJ/cm2 in either keratinocytes or fibroblasts. Upon addition of exogenous TGFβ-1 1 h prior to UVB-treatment in this experiment, a synergistic increase in Smad transactivation was observed in both cell types (Figure 9a-b). Furthermore, pretreatment with the NFκB inhibitor parthenolide reversed this synergism and returned SBE luciferase activity to levels equivalent to TGFβ-1 treatment alone. As anticipated, parthenolide does not appear to inhibit TGFβ-1-induced Smad luciferase activity.

In whole skin (540 mJ/cm2) (Figure 9c) and ears (540 mJ/cm2 or 1000 mJ/cm2) (Figure 9d-e) from transgenic mice containing an SBE-luciferase reporter, the SBE reporter was activated 48 h post UVB treatment. Earlier time points were not investigated. However, in hairless SKH-1 mice (data not shown), a strain differing from SBE-luciferase mice (FVB), activation of phospho-Smad2 occurs as soon as 2 h post UVB exposure and as late as 48h post exposure. Activation of Smads was not measured by western analysis in mouse models utilized in these studies. These studies in transgenic mice containing an SBE reporter gene fail to validate findings in vitro, which show Smad transactivation only in UVB exposed keratinocytes that have been pretreated with TGFβ-1 (Figure 9a).

161

FIGURE 3-7

UVB-induced TNFα expression is NFκB-dependent

mRNA accumulation was measured in p50 wild type and knockout primary mouse keratinocytesby RT-qPCR and normalized to 18S (n=3 plates of cells). Data are represented as fold increase over respective control to account for constituitively high TNFα expression in control samples. The figure is representative of an experiment repeated three times. *p<0.05 vs a.

FIGURE 3-8

UVB represses Smad7 expression at 2 h, but restoration of Smad7 at 6 h is Smad3- dependent

mRNA accumulation was measured in Smad3 wild type and knockout primary mouse keratinocytesby RT-qPCR and normalized to 18S (n=3 plates of cells). Data are represented as fold increase over wild type control. The experiment was not repeated. *p<0.05 vs a,b,c and d.

162

Figure 9a

UVB-induced Smad transactivationis elevated in fibroblasts and keratinocytes in the presence of exogenous TGFβ-1

(A-B)

Transgenic mouse keratinocytesexpressing SBE-lucifera se were pre- or post-treated with TGFβ-1 (1 ng/mLmedia) for 1h and/or pretreated with IκK inhibitor Parthenolide for 1h, and UVB irradiated and harvested 24 h post treatment (n=6 wells of cells). Luciferase a ctivity in each figure was detected on a plate reader luminometer. The figure is representative of an experiment repeated three times. *p<0.05 vs a and b.

Figure 9b

UVB-induced Smad transactivationis observed in vivo in both ears and skin of SBE-luciferase expressing mice

(C-D)

Ears from SBE-lucifera se expressing transgenic mice were UVB treated.

(E)

Skin from SBE-lucifera se expressing transgenic mice were UVB treated. *p<0.05 vsa.

163

Taken together, these results in UVB treated mouse skin and keratinocytes in culture suggested Smad3- and NFκB-dependent expression of the proinflammatory cytokine TNFα between 2-6 h post treatment and was dependent upon strain. Furthermore, UVB-induced TNFα expression appeared to require an intact TGFβ-1 signaling pathway. However, at 6 h MPO staining was not present. An acute decrement in Smad7 expression was observed initially, but returned to control levels by 6 h and appears to be partially Smad3 dependent. Finally, when cells were pretreated with TGFβ-1 and then UVB treated, a synergistic increase in Smad luciferase activity was observed.

B. UVB activates the TGFβ-1 pathway, but not the canonical NFκB pathway involving TAK-1

To assay activation of the TGFβ-1 signaing pathway by UVB, cellular extracts were immunoblotted for levels of phopho-Smad2 and Smad3 30 min, 1 h, 2 h, and 6 h post UVB treatment using a dose of 25, 50, or 75 mJ/cm2. At 75 mJ/cm2, Smad2 and 3 was activated above control. Therefore, all upstream signaling studies were performed at this dose. Phosphorylation of the canonical TGFβ-1 transcription factors Smad2 and Smad3 peaked at 30 min and began to decrease at 6 h (Figure 10). Furthermore, pretreatment with the type II TGFβ- 1 receptor inhibitor led to inhibition of Smad2 and 3 activation, suggesting that UVB activates the canonical TGFβ-1 pathway. However, when phospho-Smad proteins were normalized to its respective total Smad protein, this activation was no longer apparent. However, these data reveal that in UVB-treated keratinocytes pretreated with SB-431542, a decrease in pSmad2 or 3 was observed. This result suggested that, although Smad activation above control may not be required, endogenous levels of activated Smads are required for UVB responsiveness. Therefore, these data suggest that an intact TGFβ-1 signaling pathway is a necessary component of UVB responsiveness. Furthermore, these findings support previous data demonstrating Smad3-dependent TNFα expression.

In addition to activation of the canonical pathway of TGFβ-1 in the present studies the role of of the canonical NFκB signal in UVB responsiveness was explored by testing the hypothesis that NFκB activation parallels activation of Smads. In fact, following exposure of FVB/n primary keratinocytes to UVB over an identical time course (30 min – 6 h), IκB was not degraded. This observation suggested that: 1) UVB did not activate NFκB between 30 min and 6 h post-treatement; 2) UVB alternatively activated NFκB within 30 min of treatment or after 6 h; or 3) UVB activates NFκB through a non-canonical pathway and was therefore not detected by measuring IκB. To test the latter two possibilities, FVB/n primary keratinocytes were exposed to UVB at 75mJ/cm2 for 5 min, 10 min, and 30 min and exhibited no degradation of IκB levels (Figure 10). To explore the hypothesis that UVB activates NFκB through a noncanonical pathway, keratinocytes at each time point (5, 10, and 30 min) were pretreated with the TAK-1 inhibitor 5Z-7-Oxozeaenol followed by UVB treatment (75 mJ/cm2) showed no change in IκB (Figure 11). This finding suggests preliminarily that at very acute time points, the

164

FIGURE 3-10

UVB treatment resulted in activation of phospho-Smad2, Smad3, but not in IκB degradation

(A)

Lysates were isolated from UVB treated FVB/n primary mouse keratinocytesand used to perform western analysis to probe for total IκB, pSmad2, and pSmad3 and total Smad2 and 3 protein (n=1 plate of cells/treatment group). Cells were pretreatment with the type I TGFβ receptor inhibitor SB-431542 for 1 h. The figure is representative of an experiment repeated three times.

(B)

Densitometry was performed using Ima geJ software. Signal was normalized to a loading control. Histograms represent fold/respective control.

165

166

FIGURE 3-11

UVB treatment does not result in IκB degradation

(A)

Lysates were isolated from UVB- treated FVB/n primary mouse keratinocytesand used to perform western analysis to probe for total IκB and tubulin protein 5, 10, and 30 min post treatment (n=1 plate of cells/treatment group). A range of doses of TAK-1 inhibitor 5Z-7- Oxozeanenol were administered 1 h prior to UVB treatment without effect. Experiment was not repeated.

(B)

Densitometry was performed using Ima geJ software. Signal was normalized to a loading control. Histograms represent fold/respective control.

167

non-canonical NFκB pathway involving TAK-1-induced degradation of IκB does not appear to mediate UVB responsiveness in keratinocytes.

Taken together, the present studies are the first to demonstrate UVB-induced activation of the upstream canonical TGFβ-1 pathway. Phosphorylation of both Smad2 and Smad3 occurred at acute time points and diminished at 6h post UVB. The present studies showed no evidence of UVB-mediated activation of the canonical NFκB pathway through IκB at acute or long term time points. Indirect measures of TAK-1, a signaling molecule in the non-canonical NFκB pathway, revealed no role for this kinase at least at acute time points.

C. TGFβ-1 mediates UVB-induced NFκB binding to DNA

Consistent with the finding that UVB did not activate the canonical NFκB signaling pathway or a noncanonical pathway through TAK-1, no UVB-induced translocation of NFκB p50 was observed in these studies between 30 min and 6 h following treatment at 75 mJ/cm2 (Figure 12). However, an increase in NFκB binding to DNA at this dose was observed at 30 min and persisted at 1 h in UVB-treated FVB/n primary keratinocytes. These studies were performed at 25, 50, and 75 mJ/cm2, a dose consistent with that used in signaling studies. Furthermore, pretreatment of UVB-treated keratinocytes with a type II TGFβ-1 receptor inhibitor resulted in mild inhibition of DNA binding (Figure 13). Curiously, constitutive binding in control keratinocytes was also inhibited by the ALK-5 inhibitor, suggesting that endogenous TGFβ-1 signaling also mediates basal NFκB binding to DNA. When primary keratinocytes isolated from Smad3 wild type and knockout mice were treated with UVB, a mild increase in NFκB binding was observed in wild type keratinocytes, which was slightly decreased in UVB-treated knockout keratinocytes. Supershift analysis for both p50 and p65 subunits show involvement of the heterodimers in UVB-induced Smad3-mediated NFκB binding to DNA. A decrease in subunits is observed in UVB treated Smad3 knockout keratinocytes compared to UVB-treated wildtype cells (Figure 14). Binding studies with supershift were performed using 25 mJ/cm2 and should be repeated at 75 mJ/cm2 to remain consistent with binding data.

When NFκB and SBE transactivation was measured at 25 and 50 mJ/cm2, no appreciable increase was observed in NFκB- or SBE-driven luciferase activity (Figure 15 a-b). Although this result is consistent with previous studies of Smad transactivation described herein, a lack of NFκB transactivation was unexpected. In previously published studies of UVB-induced NFκB transactivation, these assays have often been performed in cell lines rather than primary cells using a chloramphenicol acetyltransferase reporter rather than a luciferase reporter (Adachi et al., 2003). One report in particular suggested that UVB activation of p53 results in competition with NFκB for a pool of p300/CBP coactivators (Campbell et al., 2001). To rule out p53 interference with NFκB transactivation, an NFκB transactivation study was carried out in NHK4 cells which lack p53. NFκB transactivation was observed at neither 25 nor 50 mJ/cm2 in this in vitro model (Figure 16), suggesting that p53 may not inhibit NFκB transactivation in UVB treated cells. NFκB transactivation assays reported in the literature were performed in ras containing 308

168

FIGURE 3-12

UVB treatment of serum starved keratinocytes does not result in translocation of p50

Nuclear extracts and cytosolic lysa tes were isolated from SB- 431542 pretreated and UVB- treated FVB/n primary mouse keratinocytesat time points between 15 min and 6 h. SB refers to SB-431542, a type I TGFβ receptor antagonist. Cells were serum starved with 0.5% bovine serum for 5 hours prior to treatment. Western analyses of p50, and la min A/C, and tubulin (n=1 plate of cells/treatment group). The figure is representative of an experiment repeated three times.

169

FIGURE 3-13

UVB-induced NFκB binding to DNA is TGFβ-1-dependent

(A)

Nuclear extracts were isolated from SB-431542 pretreated and TGFβ-1- treated FVB/n primary mouse keratinocytesat time points between 10 min and 1 h. SB refers to SB-431542, a type I TGFβ receptor antagonist. Cells were grown in 0.5% bovine serum. Extracts were incubated with 32P ATP gamma labeled NFκB oligonucleotide probe in a gel shift assay (EMSA) (n=1 plate of cells/treatment group). Protein bound to probe was resolved on a TBE gel. Signal was detected by autoradiography. The figure is representative of an experiment repeated three times.

(B)

Densitometry was performed using Ima geJ software. Signal was normalized to a loading control. Histograms represent fold/respective control.

170

FIGURE 3-14

UVB-induced NFκB binding to DNA is Smad3 dependent and involves p50 and p65 subunits

Smad3 wildtype and knockout keratinocyteswere treated with 25 mJ/cm2 UVB and gel shift assay performed. Supershift a na lysis was performed by incubating gel shift (EMSA) reaction with p50 or p65 antibody for 30 min prior to addition of probe (n=1 plate of cells/treatment group). An upward shift in the band indicates the presence of a particular subunit. Experiment was not repeated.

FIGURE 3-15

UVB does not mediate NFκB or Smad transactivationin a luciferase assay

FVB/n primary mouse keratinocytes were cotransfected with 2x NFκB lucifera se reporter pla smid. Cells were treated with UVB and harvested at 24 h (n=4 wells of cells). Luciferase a ctivity wa s detected on a plate reader luminometer. The figure is representative of an experiment repeated three times.

171

FIGURE 3-16

UVB fails to mediates NFκB transactivationin p53 deficient NHK4 cells

NHK4 cells were cotransfected with 2x NFκB lucifera se reporter plasmid. Cells were treated with 1 ng TGFβ-1/ mLmedia for 24 h (n=6 wells of cells). Luciferase a ctivity wa s detected on a plate reader luminometer. This experiment was not repeated.

172 keratinocytes, a transformed cell line with oncogenic ras activity that likely contributed to the NFκB transactivation observed in these published studies (Cooper et al., 2005a).

Taken together, these studies show for the first time that TGFβ-1 mediates NFκB binding to DNA following UVB exposure. Although this does not appear to involve the canonical NFκB pathway including degradation of IκB or translocation of the p50 subunit, the data presented herein describe a scenario whereby the NFκB-dependent proinflammatory cytokine is expressed in a p50 and Smad3 dependent manner. Furthermore, NFκB binding data suggests that endogenous or basal level TGFβ-1 signaling may mediate high constitutive NFκB binding in keratinoctyes.

V Discussion

A. Regulation of UVB-induced proinflammatory cytokines by TGFβ-1

1) TNFα expression

Results of studies presented in Chapter 2 indicated a role for TGFβ-1 in the induction of TNFα, which has also been well-documented in skin exposed to UVB. Whether TGFβ-1 mediates TNFα following UVB exposure has not been previously explored in skin. Therefore, the primary aim of measuring TGFβ-1-mediated expression of TNFα—considering a ‘keystone cytokine’ or first responder in injured skin (Yarosh et al., 2000)-- was to determine a role for TGFβ-1 in the expression of the NFκB-dependent gene in the context of UVB exposure (Yarosh et al., 2000). TNFα is significant during UVB responsiveness because not only is it involved in the expression of other cytokines, but it acts as a chemokine to recruit neutrophils into the dermis (Komatsu et al., 2006;Hawk et al., 1988;Cooper et al., 1993;Strickland et al., 1997b). Neutrophils, in turn, secrete reactive oxygen species (ROS) generated by NADPH oxidase and MPO as well as proteases that increase extracellular matrix metabolism (Komatsu et al., 2006;Rijken and Bruijnzeel, 2009). Excess production of free radicals and matrix metalloproteinase secretion from neutrophils contributes to the process of photoaging in the dermis, which is characterized by collagen breakdown (Rijken et al., 2006).

The epidermis is particularly sensitive to UVB-induced reactive oxygen species, which compromise lipid membranes, deplete cellular antioxidant and antioxidant enzymes, and activate NFκB, all of which contribute to the expression of proinflammatory cytokines (Rijken et al., 2006). In this environment, proinflammatory cytokines do not act independently of one another, but can synergize in the context of stimuli such as UVB and enhance gene expression (Bashir et al., 2009). That TGFβ-1 induces TNFα expression has interesting and important implications for cellular level decision making in keratinocytes. Increased TNFα can result in one of two highly context-driven outcomes (Szoltysek et al., 2008). One the one hand, activation of NFκB through TRAF2/RIP complex leads to expression of antiapoptotic genes and enhances cell survival. Alternatively, interaction with caspases via TRADD/FADD adaptor proteins leads to the activation of programmed cell death . Therefore, the significance of TNFα expression in

173

keratinocytes cannot be understated in terms of its ability to drive a cell’s decision to live or die. That UVB-induced TNFα expression is shown in these studies to be mediated by TGFβ-1 is a novel finding that has not previously been demonstrated.

2) Neutrophil recruitment

Although the TGFβ-1 signaling pathways could not be tied to the major biological consequence of TNFα expression—recruitment of neutrophils—it is possible that later time points might reveal neutrophil infiltration. Published studies in mouse suggest that recruitment of neutrophils into skin following UVB exposure may be delayed 24-48 h post UVB exposure (Komatsu et al., 2006). This may be, in part, a function of UVB-induced TNFα mRNA stabilization that persists 48 h post transcription (Leverkus et al., 1998). Therefore, future studies involving detection of myeloperoxidase, a marker of neutrophils, should include time points later than 6 h and utilize both UV-treated TGFβ-1 heterozygous and Smad3 knockout models to better understand the biological relevance of TGFβ-1 mediated TNFα expression post- UVB.

3) Smad7 down-regulation and recovery

In addition to identifying TNFα as a UVB target gene mediated by TGFβ-1, Smad7 expression in the present studies demonstrated an initial significant decrease at 2 h post UVB, followed by restoration to control levels by 6 h. The kinetics of Smad7 expression at 6 h are similar to that observed in UVB-treated human epidermis (Quan et al., 2002b), but contrary to studies in mink lung epithelial cells (Quan et al., 2001) and human skin (Han et al., 2005), which demonstrated upregulation of Smad7. In the present studies, derepression of Smad7 appeared to be, in part, mediated by Smad3 because Smad7 was significantly lower at 6 h in UVB-treated Smad knockout keratinocytes versus expression at 6 h in UVB-treated Smad3 wild type keratinocytes. Pharmacologic inhibition of Smad7 expression failed to show this phenomenon (data not shown). Although Smad7 derepression at 6 h post UVB may reflect Smad3- dependence, it is not known whether or not NFκB mediates Smad7 in response to UVB. In fibroblasts, TNFα has been demonstrated to induce Smad7 expression (Bitzer et al., 2000). In colon cancer cells, Smad7 has been shown to directly inhibit IκBα (Grau et al., 2006). Therefore, reports of crosstalk between NFκB and Smad7 in previous studies suggest that a mechanism is possible whereby TGFβ-1-induced TNFα expression permits restoration of Smad7 at the 6 h time point. Restoration of Smad7 levels, in turn, may facilitate downregulation of TGFβ-1 and, hence, NFκB transactivation. Future studies should measure Smad7 expression in UVB-treated p50 wild type versus knockout keratinocytes to explore a possible role for NFκB, as well, in Smad7 expression to test this hypothesis.

4) NFκB in UVB responsiveness

Although UVB is a well-established inducer of TNFα expression (Piguet et al., 1991;Buscher et al., 1988) NFκB sites in the promoter of TNFα, which are activated by LPS, are

174 dispensible during UVB activation of NFκB (Bazzoni et al., 1994). This suggests an alternative mechanism of UVB-induced NFκB activation that diverges from canonical NFκB signaling. Although this mechanism is not entirely clear, studies have demonstrated that UVB-induced TNFα requires: 1) post-transcriptional modifications (Bazzoni et al., 1994;Leverkus et al., 1998); 2) DNA damage; 3) interaction with other transcription factors; 4) generation of reactive oxygen species; 4) kinase phosphorylation; and 5) ligand independent receptor activation (Abeyama et al., 2000;Bashir et al., 2009;Szoltysek et al., 2008;Kibitel et al., 1998;Yarosh et al., 2000;Corsini et al., 1995). To confirm involvement of p50 in UVB-induced TNFα expression in the present studies, TNFα expression was assayed in p50 knockout keratinocytes. UVB-induced TNFα expression was, in fact, ablated in p50 knockout keratinocytes, thus confirming that NFκB is in fact required for UVB induced TNFα. Curiously, expression was constitutively high in the untreated p50 knockout samples. This indicates that p50 homodimers may have a role in repression of TNFα expression and that in the absence of p50, other combinations of dimers may up-regulate basal levels of TNFα expression in p50. (Bours et al., 1993;Caamano et al., 1996). Thus, the regulation of TNFα in response to UVB exposure is complex and fodder for future investigation.

B. UVB-mediated activation of upstream effectors of the TGFβ-1 signaling pathway

Few studies have explored the role of TGFβ-1 in UVB responsiveness. In fact, much of the work published has been carried out in fibroblasts or cell types that are not normally exposed to solar radiation. In studies of keratinocytes at doses equivalent to those administered in studies described herein, TGFβ-1 mRNA has been detected 4-8 h post-UVB and TNFα protein by 24 h post (Lee et al., 1997). Furthermore, UVB-induced reaction oxygen species have been shown to increase both the latent and bioactive form of TGFβ-1 within 2 h of UVB treatment (Wang and Kochevar, 2005). This is interesting with respect to data in the present studies showing increased Smad transactivation in UVB-treated keratinocytes pre-treated with bioactive TGFβ-1. This suggests a role for bioactive TGFβ-1, produced from latent TGFβ-1 by reactive oxygen species after UVB treatment as demonstrated by Wang or perhaps by infiltrating inflammatory cells. Future studies should explore a synergism between UVB and TGFβ-1 in NFκB transactivation and whether or not UVB-induced bioactivation of TGFβ-1 is a mechanism of TGFβ-1 involvement in UVB responsiveness in skin. Furthermore, a role for inflammatory cells that also secrete TGFβ-1, such as CD4+CD25+ T cells (Veldhoen and Stockinger, 2006;Mangan et al., 2006), should be explored as a contributor of the Smad transactivation observed in mouse skin.

Studies to date have not identified the upstream signaling components of the TGFβ-1 pathway that are involved in UVB responsiveness. UVB-induced degradation was not observed along two different time courses in the present studies. This is consistent with reports in the literature which show neither activation or degradation of IκB (Lewis and Spandau, 2007), nor

175

translocation of NFκB subunits. At higher doses reported in the literature (100 mJ/cm2), however, degradation of IκB was shown 3 h post UVB in the newborn mouse (Perez et al., 2000). This suggests the possibility that the NFκB pathway may be activated at higher doses of UVB. However, in cells from mouse treated with a dose less administered in the present studies, IκB phosphorylation and degradation is shown at earlier time points (15 min) (Afaq et al., 2003;Afaq et al., 2005). Furthermore, in primary cells exposed to 40 mJ/cm2 UVB, IκB showed a decrease in IκB over time (Lewis et al., 2006). In spite of some evidence that UVB does, in fact, degrade IκB, inhibition of NFκB prior to UVB exposure in normal human keratinocytes resulted in inhibition of TNFα expression (Abeyama et al., 2000). As these published studies emphasize, reports in the literature are inconsistent and difficult to reconcile with findings in the present studies. This may be partially attributed to species or strain differences. Whereas UVB- induced TNFα expression is increased in C57BL/6J and Balb/c mice, this is not the case for SKH1 mice, which demonstrated no UVB-induced increase in TNFα (Sharma et al., 2011).

Differences between mouse and human keratinocytes in culture may be a confounding factor in any attempt to elucidate how UVB activates NFκB. For example, p53 levels are lower in mouse than in humans; thus mouse skin is less susceptible to apoptosis and this is more likely to be reflected in signaling (Chaturvedi et al., 2004). Variations in experimental conditions may partially explain a lack of continuity in published data. Culture conditions, too, may influence activation of NFκB signaling proteins, particularly in keratinocytes, which are sensitive to cell density, calcium concentration, and serum levels (Dlugosz et al., 1995;Hennings et al., 1980b;Hennings et al., 1980a;Yuspa et al., 1980). Alternatively, it may be that UVB activation of NFκB is an IκB-independent phenomenon, differing from other activators of NFκB such as TNFα or LPS.

Alternative mechanisms of NFκB activation have been reported, which may provide a way to circumvent activation of canonical NFκB signaling molecules in keratinocytes, and thus explains observations in the present studies. For example, UVB-induced post-translational modification of NFκB has been reported in newborn mice exposed to UVB (Perez et al., 2000). Although these same studies reported IκB degradation, no NFκB translocation was observed. Instead, hyper-phosphorylated p50 was detected in the nucleus by indirect immunofluorescence and in alkaline phosphatase treated skin samples from newborn mice treated with UVB. The time course of phosphorylation was similar to the time course examined in the present studies. Furthermore, incubation of nuclear extracts from UVB-treated mouse skin with palindromic NFκB oligonucleotide probe and antibodies against p50 and p65 revealed that phosphorylated p50 formed both homodimers and heterodimers with p65 (Perez et al., 2000). Future studies should explore alternative mechanisms of UVB-induced NFκB activation including post- translational modifications that increase binding affinities of NFκB subunits (Hou et al., 2003;Li et al., 1994).

C. TGFβ-1-mediated NFκB transcriptional activation

176

These are the first studies to identify a role for Smad3 in the transcriptional regulation of the NFκB-dependent proinflammatory cytokine TNFα following UVB exposure. In the present studies, Smad3 appears to play a central role in the expression of TNFα, particularly at the level of transcription. In spite of failure to observe UVB-mediated upstream signaling events indicative of NFκB activation as well as evidence of translocation of the NFκB p50 subunit, TGFβ-1-dependent binding of NFκB on DNA was demonstrated using both pharmacologic and genetic approaches. The kinetics of UVB-induced NFκB binding reported in the literature were consistent with results described for the present studies (Lewis and Spandau, 2007;Afaq et al., 2003;Cooper et al., 2005b;Afaq et al., 2003;Lewis et al., 2006;Campbell et al., 2001).

That the canonical NFκB pathway did not appear to be involved in UVB-mediated TNFα expression is not totally unexpected. The role of NFκB in keratinocytes is highly specialized and the origin of the signal that triggers NFκB following UVB exposure has not yet been identified (Legrand-Poels et al., 1998). In normal proliferating cells, NFκB serves a growth inhibitory function and is one of many factors that sets a cell onto a path of differentiation. During early differentiation in suprabasal keratinocytes, the role of NFκB shifts toward production of anti- apoptotic factors (Lippens et al., 2005). Conversely, infection, inflammation, or cellular stress alters the function of NFκB. In these contexts—such as exposure to UVB—the focus of NFκB shifts toward production of cytokines and resistance to cellular stress that may activate programmed cell death (Lewis and Spandau, 2007). One intriguing question is the impact of UVB on NFκB in suprabasal keratinocytes where NFκB is localized in the nucleus mediating expression of anti-apoptotic genes. How NFκB transactivation would be altered in suprabasal keratinocytes is unknown.

The mechanism by which UVB activates NFκB remains controversial. Potential parallel pathways of interaction with NFκB following UVB exposure include: 1) activation of src tyrosine kinases by ROS (Devary et al., 1992); 2) activation of EGF receptor by metalloproteinases (Singh et al., 2009); ligand-independent activation of receptor tyrosine kinases by ROS (Herrlich and Bohmer, 2000); and ligand-dependent IGF-1 receptor activation (Lewis and Spandau, 2007). The present studies suggest that the TGFβ-1 pathway, through activation of Smads may also contribute to the mechanism by which NFκB responds to UVB.

How NFκB and Smad3 interact at the level of transcription in the context of UVB exposure is a question that future studies should address using methods described in Chapter 2. In published studies, there are a few examples of protein-protein interactions that occur at the level of transcription following UVB. For example, following UVB exposure, AP-1 cooperates with NFκB through a physical interaction between bZIP and Rel homology domains to enhance transactivation (Stein et al., 1993). Another mechanism involving interaction of transcription factors has been shown in the sequential UVB-induced activation of NFκB, Egr-1, and Gadd45, which either causes keratinocytes to apoptose or induces the expression of TGFβ-1, which, in turn, inhibits cellular growth (Thyss et al., 2005). Clearly, crosstalk between NFκB and other pathways facilitates decision making within the cell, particularly under conditions of injury or

177

stress. Taken together, it is likely that TGFβ-1 is one such pathway that modulates or tunes the response to UVB through modulation of NFκB-dependent transcription.

VI Literature Cited

Abeyama K, Eng W, Jester JV, Vink AA, Edelbaum D, Cockerell CJ, Bergstresser PR, Takashima A (2000) A role for NF-kappaB-dependent gene transactivation in sunburn. J Clin Invest 105:1751-1759.

Afaq F, Adhami VM, Ahmad N, Mukhtar H (2003) Inhibition of ultraviolet B-mediated activation of nuclear factor kappaB in normal human epidermal keratinocytes by green tea Constituent (-)-epigallocatechin-3-gallate. Oncogene %20;22:1035-1044.

Afaq F, Malik A, Syed D, Maes D, Matsui MS, Mukhtar H (2005) Pomegranate fruit extract modulates UV-B-mediated phosphorylation of mitogen-activated protein kinases and activation of nuclear factor kappa B in normal human epidermal keratinocytes paragraph sign. Photochem Photobiol 81:38-45.

Barr RM, Walker SL, Tsang W, Harrison GI, Ettehadi P, Greaves MW, Young AR (1999) Suppressed alloantigen presentation, increased TNF-alpha, IL-1, IL-1Ra, IL-10, and modulation of TNF-R in UV-irradiated human skin. J Invest Dermatol 112:692-698.

Bashir MM, Sharma MR, Werth VP (2009) UVB and proinflammatory cytokines synergistically activate TNF-alpha production in keratinocytes through enhanced gene transcription. J Invest Dermatol 129:994-1001.

Bazzoni F, Kruys V, Shakhov A, Jongeneel CV, Beutler B (1994) Analysis of tumor necrosis factor promoter responses to ultraviolet light. J Clin Invest 93:56-62.

Bitzer M, von GG, Liang D, Dominguez-Rosales A, Beg AA, Rojkind M, Bottinger EP (2000) A mechanism of suppression of TGF-beta/SMAD signaling by NF-kappa B/RelA. Genes Dev 14:187-197.

Boukamp P, Petrussevska RT, Breitkreutz D, Hornung J, Markham A, Fusenig NE (1988) Normal keratinization in a spontaneously immortalized aneuploid human keratinocyte cell line. J Cell Biol 106:761-771.

178

Brink N, Szamel M, Young AR, Wittern KP, Bergemann J (2000) Comparative quantification of IL-1beta, IL-10, IL-10r, TNFalpha and IL-7 mRNA levels in UV-irradiated human skin in vivo. Inflamm Res 49:290-296.

Buscher M, Rahmsdorf HJ, Litfin M, Karin M, Herrlich P (1988) Activation of the c-fos gene by UV and phorbol ester: different signal transduction pathways converge to the same enhancer element. Oncogene 3:301-311.

Caamano JH, Perez P, Lira SA, Bravo R (1996) Constitutive expression of Bc1-3 in thymocytes increases the DNA binding of NF-kappaB1 (p50) homodimers in vivo. Mol Cell Biol 16:1342- 1348.

Campbell KJ, Chapman NR, Perkins ND (2001) UV stimulation induces nuclear factor kappaB (NF-kappaB) DNA-binding activity but not transcriptional activation. Biochem Soc Trans 29:688-691.

Chaturvedi V, Bacon P, Bodner B, Nickoloff BJ (2004) Proliferating cultured human keratinocytes are more susceptible to apoptosis compared with mouse keratinocytes. J Invest Dermatol 123:1200-1203.

Clingen PH, Berneburg M, Petit-Frere C, Woollons A, Lowe JE, Arlett CF, Green MH (2001) Contrasting effects of an ultraviolet B and an ultraviolet A tanning lamp on interleukin-6, tumour necrosis factor-alpha and intercellular adhesion molecule-1 expression. Br J Dermatol 145:54-62.

Cooper KD, Duraiswamy N, Hammerberg C, Allen E, Kimbrough-Green C, Dillon W, Thomas D (1993) Neutrophils, differentiated macrophages, and monocyte/macrophage antigen presenting cells infiltrate murine epidermis after UV injury. J Invest Dermatol 101:155-163.

Cooper S, Ranger-Moore J, Bowden TG (2005b) Differential inhibition of UVB-induced AP-1 and NF-kappaB transactivation by components of the jun bZIP domain. Mol Carcinog 43:108- 116.

Cooper S, Ranger-Moore J, Bowden TG (2005a) Differential inhibition of UVB-induced AP-1 and NF-kappaB transactivation by components of the jun bZIP domain. Mol Carcinog 43:108- 116.

Corsini E, Bruccoleri A, Marinovich M, Galli CL (1995) In vitro mechanism(s) of ultraviolet- induced tumor necrosis factor-alpha release in a human keratinocyte cell line. Photodermatol Photoimmunol Photomed 11:112-118.

179

Davis JN, Kucuk O, Djuric Z, Sarkar FH (2001) Soy isoflavone supplementation in healthy men prevents NF-kappa B activation by TNF-alpha in blood lymphocytes. Free Radic Biol Med 30:1293-1302.

Devary Y, Gottlieb RA, Smeal T, Karin M (1992) The mammalian ultraviolet response is triggered by activation of Src tyrosine kinases. Cell 71:1081-1091.

Dlugosz AA, Glick AB, Tennenbaum T, Weinberg WC, Yuspa SH (1995) Isolation and utilization of epidermal keratinocytes for oncogene research. Methods Enzymol 254:3-20.:3-20.

El-Abaseri TB, Hansen LA (2007) EGFR Activation and Ultraviolet Light-Induced Skin Carcinogenesis. J Biomed Biotechnol 2007:97939.

Enk CD, Jacob-Hirsch J, Gal H, Verbovetski I, Amariglio N, Mevorach D, Ingber A, Givol D, Rechavi G, Hochberg M (2006) The UVB-induced gene expression profile of human epidermis in vivo is different from that of cultured keratinocytes. Oncogene 25:2601-2614.

Gambichler T, Tomi NS, Skrygan M, Altmeyer P, Kreuter A (2006) Alterations of TGF- beta/Smad mRNA expression in atopic dermatitis following narrow-band ultraviolet B phototherapy: results of a pilot study. J Dermatol Sci 44:56-58.

Glick AB, Lee MM, Darwiche N, Kulkarni AB, Karlsson S, Yuspa SH (1994) Targeted deletion of the TGF-beta 1 gene causes rapid progression to squamous cell carcinoma. Genes Dev 8:2429-2440.

Grau AM, Datta PK, Zi J, Halder SK, Beauchamp RD (2006) Role of Smad proteins in the regulation of NF-kappaB by TGF-beta in colon cancer cells. Cell Signal 18:1041-1050.

Han KH, Choi HR, Won CH, Chung JH, Cho KH, Eun HC, Kim KH (2005) Alteration of the TGF-beta/SMAD pathway in intrinsically and UV-induced skin aging. Mech Ageing Dev 126:560-567.

Hawk JL, Murphy GM, Holden CA (1988) The presence of neutrophils in human cutaneous ultraviolet-B inflammation. Br J Dermatol 118:27-30.

Hennings H, Holbrook K, Steinert P, Yuspa S (1980a) Growth and differentiation of mouse epidermal cells in culture: effects of extracellular calcium. Curr Probl Dermatol 10:3-25.

Hennings H, Michael D, Cheng C, Steinert P, Holbrook K, Yuspa SH (1980b) Calcium regulation of growth and differentiation of mouse epidermal cells in culture. Cell 19:245-254.

Herrlich P, Bohmer FD (2000) Redox regulation of signal transduction in mammalian cells. Biochem Pharmacol 59:35-41.

180

Hill HZ, Hill GJ, Cieszka K, Plonka PM, Mitchell DL, Meyenhofer MF, Xin P, Boissy RE (1997) Comparative action spectrum for ultraviolet light killing of mouse melanocytes from different genetic coat color backgrounds. Photochem Photobiol 65:983-989.

Hou S, Guan H, Ricciardi RP (2003) Phosphorylation of serine 337 of NF-kappaB p50 is critical for DNA binding. J Biol Chem 278:45994-45998.

Ito CY, Adey N, Bautch VL, Baldwin AS, Jr. (1995) Structure and evolution of the human IKBA gene. Genomics 29:490-495.

Kibitel J, Hejmadi V, Alas L, O'Connor A, Sutherland BM, Yarosh D (1998) UV-DNA damage in mouse and human cells induces the expression of tumor necrosis factor alpha. Photochem Photobiol 67:541-546.

Komatsu J, Koyama H, Maeda N, Aratani Y (2006) Earlier onset of neutrophil-mediated inflammation in the ultraviolet-exposed skin of mice deficient in myeloperoxidase and NADPH oxidase. Inflamm Res 55:200-206.

Kuhn C, Hurwitz SA, Kumar MG, Cotton J, Spandau DF (1999) Activation of the insulin-like growth factor-1 receptor promotes the survival of human keratinocytes following ultraviolet B irradiation. Int J Cancer 80:431-438.

Lee HS, Kooshesh F, Sauder DN, Kondo S (1997) Modulation of TGF-beta 1 production from human keratinocytes by UVB. Exp Dermatol 6:105-110.

Legrand-Poels S, Schoonbroodt S, Matroule JY, Piette J (1998) Nf-kappa B: an important transcription factor in photobiology. J Photochem Photobiol B 45:1-8.

Lehman TA, Modali R, Boukamp P, Stanek J, Bennett WP, Welsh JA, Metcalf RA, Stampfer MR, Fusenig N, Rogan EM, . (1993) p53 mutations in human immortalized epithelial cell lines. Carcinogenesis 14:833-839.

Leverkus M, Yaar M, Eller MS, Tang EH, Gilchrest BA (1998) Post-transcriptional regulation of UV induced TNF-alpha expression. J Invest Dermatol 110:353-357.

Lewis DA, Hengeltraub SF, Gao FC, Leivant MA, Spandau DF (2006) Aberrant NF-kappaB activity in HaCaT cells alters their response to UVB signaling. J Invest Dermatol 126:1885- 1892.

181

Lewis DA, Spandau DF (2007) UVB activation of NF-kappaB in normal human keratinocytes occurs via a unique mechanism. Arch Dermatol Res 299:93-101.

Lewis DA, Spandau DF (2008) UVB-induced activation of NF-kappaB is regulated by the IGF- 1R and dependent on p38 MAPK. J Invest Dermatol 128:1022-1029.

Li CC, Dai RM, Chen E, Longo DL (1994) Phosphorylation of NF-KB1-p50 is involved in NF- kappa B activation and stable DNA binding. J Biol Chem 269:30089-30092.

Lippens S, Denecker G, Ovaere P, Vandenabeele P, Declercq W (2005) Death penalty for keratinocytes: apoptosis versus cornification. Cell Death Differ 12 Suppl 2:1497-508.:1497- 1508.

Madrid LV, Wang CY, Guttridge DC, Schottelius AJ, Baldwin AS, Jr., Mayo MW (2000) Akt suppresses apoptosis by stimulating the transactivation potential of the RelA/p65 subunit of NF- kappaB. Mol Cell Biol 20:1626-1638.

Madson JG, Hansen LA (2007) Multiple mechanisms of Erbb2 action after ultraviolet irradiation of the skin. Mol Carcinog 46:624-628.

Madson JG, Lynch DT, Tinkum KL, Putta SK, Hansen LA (2006) Erbb2 regulates inflammation and proliferation in the skin after ultraviolet irradiation. Am J Pathol 169:1402-1414.

Metz M, Lammel V, Gibbs BF, Maurer M (2006) Inflammatory murine skin responses to UV-B light are partially dependent on endothelin-1 and mast cells. Am J Pathol 169:815-822.

O'Connor A, Nishigori C, Yarosh D, Alas L, Kibitel J, Burley L, Cox P, Bucana C, Ullrich S, Kripke M (1996) DNA double strand breaks in epidermal cells cause immune suppression in vivo and cytokine production in vitro. J Immunol 157:271-278.

Perez P, Page A, Jorcano JL (2000) Role of phosphorylated p50-NF-kappaB in the ultraviolet response of mouse skin. Mol Carcinog 27:272-279.

Petrocelli T, Poon R, Drucker DJ, Slingerland JM, Rosen CF (1996) UVB radiation induces p21Cip1/WAF1 and mediates G1 and S phase checkpoints. Oncogene 12:1387-1396.

182

Piguet PF, Grau GE, Hauser C, Vassalli P (1991) Tumor necrosis factor is a critical mediator in hapten induced irritant and contact hypersensitivity reactions. J Exp Med 173:673-679.

Quan T, He T, Kang S, Voorhees JJ, Fisher GJ (2002a) Connective tissue growth factor: expression in human skin in vivo and inhibition by ultraviolet irradiation. J Invest Dermatol 118:402-408.

Quan T, He T, Kang S, Voorhees JJ, Fisher GJ (2002b) Ultraviolet irradiation alters transforming growth factor beta/smad pathway in human skin in vivo. J Invest Dermatol 119:499-506.

Rijken F, Bruijnzeel PL (2009) The pathogenesis of photoaging: the role of neutrophils and neutrophil-derived enzymes. J Investig Dermatol Symp Proc 14:67-72.

Rijken F, Kiekens RC, van den WE, Lee PL, van WH, Bruijnzeel PL (2006) Pathophysiology of photoaging of human skin: focus on neutrophils. Photochem Photobiol Sci 5:184-189.

Satterwhite TS, Chong AK, Luo J, Pham H, Costa M, Longaker MT, Wyss-Coray T, Chang J (2007) In vitro analysis of transforming growth factor-beta1 inhibition in novel transgenic SBE- luciferase mice. Ann Plast Surg 59:207-213.

Schwarz T, Schwarz A (2009) DNA repair and cytokine responses. J Investig Dermatol Symp Proc 14:63-66.

Scordi IA, Vincek V (2000) Timecourse study of UVB-induced cytokine induction in whole mouse skin. Photodermatol Photoimmunol Photomed 16:67-73.

Sha WC, Liou HC, Tuomanen EI, Baltimore D (1995) Targeted disruption of the p50 subunit of NF-kappa B leads to multifocal defects in immune responses. Cell 80:321-330.

Sharma MR, Werth B, Werth VP (2011) Animal models of acute photodamage: comparisons of anatomic, cellular and molecular responses in C57BL/6J, SKH1 and Balb/c mice. Photochem Photobiol 87:690-698.

183

Skov L, Hansen H, Allen M, Villadsen L, Norval M, Barker JN, Simon J, Baadsgaard O (1998) Contrasting effects of ultraviolet A1 and ultraviolet B exposure on the induction of tumour necrosis factor-alpha in human skin. Br J Dermatol 138:216-220.

Stein B, Baldwin AS, Jr., Ballard DW, Greene WC, Angel P, Herrlich P (1993) Cross-coupling of the NF-kappa B p65 and Fos/Jun transcription factors produces potentiated biological function. EMBO J 12:3879-3891.

Strickland I, Rhodes LE, Flanagan BF, Friedmann PS (1997a) TNF-alpha and IL-8 are upregulated in the epidermis of normal human skin after UVB exposure: correlation with neutrophil accumulation and E-selectin expression. J Invest Dermatol 108:763-768.

Strickland I, Rhodes LE, Flanagan BF, Friedmann PS (1997b) TNF-alpha and IL-8 are upregulated in the epidermis of normal human skin after UVB exposure: correlation with neutrophil accumulation and E-selectin expression. J Invest Dermatol 108:763-768.

Sun SC (2011) Non-canonical NF-kappaB signaling pathway. Cell Res 21:71-85.

Szoltysek K, Pietranek K, Kalinowska-Herok M, Pietrowska M, Kimmel M, Widlak P (2008) TNFalpha-induced activation of NFkappaB protects against UV-induced apoptosis specifically in p53-proficient cells. Acta Biochim Pol 55:741-748.

Takashima A, Bergstresser PR (1996) Impact of UVB radiation on the epidermal cytokine network. Photochem Photobiol 63:397-400.

Thyss R, Virolle V, Imbert V, Peyron JF, Aberdam D, Virolle T (2005) NF-kappaB/Egr- 1/Gadd45 are sequentially activated upon UVB irradiation to mediate epidermal cell death. EMBO J 24:128-137.

Tobin D, van HM, Toftgard R (1998) UVB-induced association of tumor necrosis factor (TNF) receptor 1/TNF receptor-associated factor-2 mediates activation of Rel proteins. Proc Natl Acad Sci U S A %20;95:565-569. van RF, van Erp PE, de Jongh GJ, Boezeman JB, van de Kerkhof PC, Schalkwijk J (1994) Cell kinetic characterization of growth arrest in cultured human keratinocytes. J Cell Sci 107 ( Pt 8):2219-2228.

Veldhoen M, Stockinger B (2006) TGFbeta1, a "Jack of all trades": the link with proinflammatory IL-17-producing T cells. Trends Immunol 27:358-361.

184

Wang H, Kochevar IE (2005) Involvement of UVB-induced reactive oxygen species in TGF- beta biosynthesis and activation in keratinocytes. Free Radic Biol Med 38:890-897.

Yarosh D, Both D, Kibitel J, Anderson C, Elmets C, Brash D, Brown D (2000) Regulation of TNFalpha production and release in human and mouse keratinocytes and mouse skin after UV-B irradiation. Photodermatol Photoimmunol Photomed 16:263-270.

Yuspa SH, Hawley-Nelson P, Koehler B, Stanley JR (1980) A survey of transformation markers in differentiating epidermal cell lines in culture. Cancer Res 40:4694-4703.

Zawel L, Dai JL, Buckhaults P, Zhou S, Kinzler KW, Vogelstein B, Kern SE (1998) Human Smad3 and Smad4 are sequence-specific transcription activators. Mol Cell 1:611-617.

185

Chapter 4

Discussion

I Global Discussion and Implications

Collectively, these studies have implications for understanding: 1) the role of the epithelium in the onset of inflammation; 2) the role of cytokines like TGFβ-1 as modulators of NFκB-mediated responsiveness to ultraviolet radiation; and 3) the role of TGFβ-1-induced TNFα in the progression of cancer.

A. Crosstalk in inflammation: TGFβ-1 and NFκB

Epithelial cells line and cover internal organs, cavities and the body surface; but more recently, they have emerged as important mediators of inflammation (Swamy et al., 2010), a role once assigned largely to cells of the immune system. As a protective barrier, skin is charged with responding to an array of environmental stimuli, often simultaneously, using a highly integrated signaling network. Genetic studies are revealing the importance of individual signaling pathways within this network, which when compromised, leads to disrupted or altered homeostasis in the epithelium and other parenchymal cells. Hence, the alteration of a signaling pathway in the epithelium can have profound consequences to the tissue, and those effects can become systemic.

Skin targeted transgenic models reveal that altering a single signaling pathway, such as TGFβ-1 or Ha-ras can lead to hyperplastic (Liu et al., 2001), inflamed skin (Han et al., 2010). This phenotype is most recognizable during the course of tumorigenesis or the chronic inflammatory disease psoriasis, both of which are well-established diseases of the epithelium which exhibit both inflammation and hyperplasia. How hyperplastic skin leads to infiltration of inflammatory cells is not entirely clear. Cellular proliferation in the epidermis, however, has been shown to express factors, such as S100A8 and A9, which act as chemokines to attract myeloid cells and lymphocytes (Ghavami et al., 2009). Inflammation can also result from environmental and pathological stimuli can cause endoplasmic reticular stress, which triggers an ‘unfolded protein response’ (UPR). This is best characterized in intestinal epithelium where UPR elicits infiltration of inflammatory cells (Kaser et al., 2008). The intersection between epithelial cells and the immune system has recently been dubbed the ‘epimmunome’, defined as the set of epithelial factors that instruct the immune cells and, therefore, drive an epithelial- mediated immune response (Swamy et al., 2010) . The epimmunome and the pathways that are composed of those critical factors are not well-elucidated.

Increasingly it is becoming clear that immunomodulation by epithelial cells exists along a continuum. Whereas mild stress to epithelial cells signals a proinflammatory Th2 response

186

leading to skin conditions such as atopic dermatitis, more chronic inflammation requires a shift to Th1 or Th17 response (Swamy et al., 2010). The transcription factor that is involved across this spectrum is NFκB. Skin-specific ablation studies of the NFκB signaling pathway reveal a surprising role for NFκB during inflammation. Whereas over-expression of NFκB leads to an increase in inflammatory cytokines in a variety of cell types (Beg et al., 1995;Lee et al., 2000;Cai et al., 2004), ablation of NFκB or components of the NFκB pathway are anti-inflammatory (Acharyya et al., 2007;Arkan et al., 2005). In epithelial cells, however, targeted genetic alterations of the NFκB signaling pathway tells a different story. In these non-immune cell types, most notably the epidermis, inhibition of NFκB results in the spontaneous onset of inflammation. Although targeted inhibition of IκKα disrupts terminal differentiation, it appears dispensable in the NFκB signaling pathway. Mice with a skin targeted IκKβ ablation, however, develop a severe inflammatory disease characterized by increased cytokine expression, infiltration of inflammatory cells, and hyperplasia (Pasparakis et al., 2002). What is most remarkable about this model is the reversal of the inflammatory phenotype when the IκKβ mouse is crossed with a mouse deficient in the TNFα receptor type I (TNFRI). Alternatively, elimination of macrophages—a source of TNFα—alleviates the inflammatory phenotype in IκKβ knockout mice. This model suggests that the NFκB signaling pathway in keratinocytes is important for mediating and dampening inflammation. Similar findings have been shown in mice with a skin targeted NEMO ablation (Nenci et al., 2006) or IκBα over-expression in skin (van Hogerlinden M. et al., 2004). These mice crossed with a TNFRI knockout mouse show resolution of inflammation as well. Studies in the skin-targeted IκBα over-expressing mouse expand what has been observed in IκK knockout mice. Sustained inhibition of NFκB by IκBα over-expression in skin induces the expression of chemokines including monocyte chemotactic proteins 1,2, and 3 (MCP-1,-2,-3), which in turn attract TNFα-secreting macrophages (Ulvmar et al., 2009). Taken together, these models demonstrate that intact NFκB signaling in keratinocytes is essential for maintaining tissue homeostasis at the interface of keratinocytes and the immune system (Figure 1).

187

FIGURE 4-1

Intact NFκB signaling in keratinocytes is essential for maintaining skin immune homeostasis (Pasparakis, 2009)

Without this balance, keratinocytes become complicit in the pathogenesis of chronic inflammation, which can lead to inflammatory diseases of skin and squamous cell carcinoma.

The finding that TNFα mediates inflammation in the absence of intact NFκB signaling is intriguing in light of the role TNFα has in inflammatory skin disorders in humans. Among them is psoriasis, a hyperproliferative skin disorder characterized by persistent scaling, acanthosis, and leukocyte infilatration. The exceptionally high expression of TNFα in psoratic lesions is also pathognomonic of psoriasis, which is often treated with entanercept, a decoy receptor that binds and inactivates TNFα (Danilenko, 2008). One of the more intriguing models of psoriasis to emerge is a skin-targeted latent TGFβ-1 over-expressing mouse that has increased levels of TNFα in the skin and a phenotype very closely resembling psoriasis (Han et al., 2010). Expression of genes such as the S100s and TNFα in doxycycline inducible K5rTA x tetOTGFβ-1 mouse model are, in fact, among those observed in Han’s skin-targeted TGFβ-1 over-expressing mouse. Han’s model, in particular, supports clinical observations that suggest a role for TGFβ-1 in the pathogenesis of psoriasis. These include increased TGFβ-1 in skin and serum, which correlate with severity of the disease (Han et al., 2010). Whether TGFβ-1 is involved in the etiology of psoriasis or is a consequence of the disease process is presently unknown. The role of TGFβ-1 in chronic inflammation and inflammatory diseases in the skin remains an intriguing line of inquiry.

In the present studies described in Chapter 2, the finding that TGFβ-1 mediates the expression of TNFα in a Smad3- and NFκB-dependent manner is interesting in light of published reports implicating TGFβ-1 in inflammatory skin diseases like psoriasis. What has not been addressed in the skin targeted TGFβ-1 over-expression model is the role of NFκB signaling

188

in keratinocytes and whether TGFβ-1-induced inflammation is partially mediated by NFκB. This raises the question: if TGFβ-1 mediates NFκB binding to DNA and transactivation of gene expression as demonstrated in Chapter 2, what role does NFκB signaling play in inflammation resulting from keratinocyte-derived TGFβ-1? One approach to test the hypothesis that NFκB mediates the inflammatory effects of TGFβ-1 over-expression, one approach would be to cross the TGFβ-1 over-expressing mouse with a mouse lacking NFκB, which does not itself have an inflammatory phenotype. The p50 knockout mouse, which shows no skin phenotype, may be one such reasonable choice. If this cross results in abrogation of inflammation, this would provide evidence for a role for the NFκB pathway in TGFβ-1-mediated inflammation observed in Han’s model as well as in psoriasis.

B. NFκB as an amplifier rather than inducer of the ultraviolet radiation (UVR) response in the epidermis

In addition to perpetuating inflammation, the role of NFκB-mediated cytokine signaling pathways, such as TGFβ-1, may also bear on ultraviolet radiation (UVB) responsiveness, but in unanticipated ways. The rationale for studies described in Chapter 3 stemmed from the observation in Chapter 2 that TGFβ-1-mediated NFκB transactivation. One common assumption, which may have proven erroneous in the present studies, is that ultraviolet radiation is an inducer of NFκB. Indeed, as described in Chapter 1, NFκB activation is among several UV-activated pathways reported in the literature including JNK (Cooper, 1996) and ligand independent EGF pathway activation (El-Abaseri and Hansen, 2007). The activation of NFκB, a stress-induced transcription factor in many cellular contexts including skin, however, is tightly regulated. Controlled regulation of NFκB may be required to avoid an “all or nothing” stress response undermining other critical pathways such as vitamin D synthesis, which, in turn, is important for maintaining immune surveillance and protective against some cancers (Hart et al., 2011).

Surprisingly, little is known about the precise mechanism of UVB activation of NFκB and this represents an underserved area of UV and cancer research. Current mechanisms of UV- induced activation of NFκB can be characterized into three categories: 1) lack of activation of IκK (Li and Karin, 1998); 2) activation of casein kinase 2 (CK2) via the p38/MAPK pathway, which degrades IκB (Bender et al., 1998;Kato, Jr. et al., 2003); and 3) stress induced translational inhibition of IκB resulting in NFκB activation (Jiang et al., 2003). A vast majority of these studies have been obtained using UVC, a wavelength ranging from 100-280 nm, which is absorbed by ozone and does not reach the earth’s surface. Furthermore, most published studies in the field of UVB responsiveness have been performed in cells that are not typically exposed to sunlight including HeLa cells (Devary et al., 1993;Li and Karin, 1998;Kato, Jr. et al., 2003), an immortalized cell line derived from cervical carcinoma, or HaCaT cells (Adhami et al., 2003;Kitazawa et al., 2002;Tanaka et al., 2005;Sesto et al., 2002;Li et al., 2002;Lewis et al.,

189

2006), a transformed cell line with defects in both NFκB and p53 signaling. Indeed, neither cell line reflects the cell biology of normal primary keratinocytes.

Research performed in cell types exposed to a wavelength of UV, such as UVC, is less physiologically relevant than studies performed on keratinocytes. UV studies in HeLa cells, for example are prevalent in the literature, but fail to consider highly specialized responses to solar radiation that are unique to keratinocyes. However, a study of mouse embryo fibroblasts exposed to UVC, in spite of its questionable biological relevance, may be potentially informative. This study in fibroblasts modeled the degradation of IκB in vitro and predicted an unexpected role for UVC as an amplifier rather than inducer of NFκB signaling (O'Dea et al., 2008). This model predicted two pools of IκB—an unbound, rapidly degraded pool and a pool bound to NFκB--and posited that the free pool, in particular, exists to compensate for shifts in cellular homeostasis that lead to ribotoxic stress. Ribotoxic stress targets protein translation, decreasing protein synthesis in the cell. Decreased translation is particularly vexing to proteins like IκB, which require high steady state protein synthesis to keep NFκB sequestered and tightly regulated (Jiang et al., 2003;Deng et al., 2004). The existence of two pools of IκB is one way the cell ensures homeostasis as it encounters stimuli that challenge cellular homeostasis. O’Dea and Hoffmann concluded that UVC, one such example of an environmental stimuli capable of shifting homeostasis, may not significantly activate NFκB. Instead, UVC exposure may result in ribotoxic stress-associated blockade of free IκB synthesis and degradation of the existing pool of free IκB (Figure 2). Indeed, failure to demonstrate UVB activation of NFκB in studies presented in Chapter 3 is consistent with this model.

FIGURE 4-2

Two pools of IκB are degradated at different rates, ensuring homeostasis in the face of diverse stimuli (O’Dea and Hoffmann, 2008)

In pathological contexts that demonstrate an inflammatory state, such as in cancer, dermatologic diseases, or chronic UVB exposure, O’Dea and Hoffman predict that UVB will more robustly activate NFκB, and thus act as an amplifier of NFκB signaling in the context of

190 other NFκB inducers such as cytokines. Thus cellular homeostasis may play an important role in whether (and to what extent) UVB activates NFκB. Indeed, several published reports in fibroblasts seem to support the model. For example, dermal fibroblasts have been shown to synergistically induce TNFα expression when simultaneously exposed to both UVB and IL-1α, compared to UVB alone (Fujisawa et al., 1997;Werth and Zhang, 1999;Kondo et al., 1994;Bashir et al., 2009;Witt et al., 2011). The focus of the present studies was on the role of endogenous TGFβ-1 signaling in UVB-induced NFκB transactivation and did not address the outcome of NFκB transactivation in the presence of both UVB and exogenous TGFβ-1. However, an example of synergistic increase in Smad transactivation was observed in UVB-treated keratinocytes or fibroblasts pretreated with TGFβ-1 and then irradiated with UVB (Chapter 3, Figure 9). These results suggest the possibility that UVB could act as an amplifier of NFκB in the presence of exogenous TGFβ-1 and increase transactivation. Future studies should test whether exogenous TGFβ-1 treatment also results in synergistic NFκB transactivation. The mechanism for cytokine-mediated UVB-induced activation of NFκB is not clear; however, the implications of UVB as an amplifer rather than inducer of NFκB is intriguing from a therapeutic standpoint.

Although the NFκB pathway inhibitor parthenolide has been explored in clinical studies as a therapy for the alleviation of sunburn, there are no reports indicating the use of NFκB inhibitors as sunscreens. Parethenolide is a sesquiterpene lactone inihibitor of IκK phosphorylation and the active constituent of Feverfew (Tanacetum parthenium), a member of the sunflower family (Kwok et al., 2001). Dermal application of parthenolide has been found to sensitize skin; therefore, studies have been limited to use of parthenolide-depleted extract of Feverfew (PD-Feverfew) (Hausen and Osmundsen, 1983). Although Feverfew diminishes erythema and reduces proinflammatory cytokine release following UVB exposure (Martin et al., 2008), it does so by scavenging free radicals (Burns and Martinon, 2004;Rasmussen et al., 2010) rather than inhibiting NFκB directly. Thus, inhibition of the NFκB pathway as a sunscreen or as a treatment for UVB exposure has not been investigated directly.

As a therapeutic target, NFκB, much like TGFβ-1 inhibitors (Markell et al., 2011;Mordasky et al., 2010), may have serious drawbacks in skin where both over-activation (Rebholz et al., 2007;van Hogerlinden M. et al., 2004;Page et al., 2010) and inhibition of ((Nenci et al., 2006;Pasparakis et al., 2006;Pasparakis et al., 2002) of NFκB result in disrupted cellular homeostasis leading to chronic inflammation. The studies of O’Dea and Hoffmann suggest that UVB does not directly activate NFκB, but amplifies it in the presence of other cytokines. Increased cytokine production during UVB exposure occurs as a result of DNA damage (Walker and Young, 2007) or through several pathways that activate NFκB indirectly (Cooper, 1996;Adler et al., 1996;Madson and Hansen, 2007). The possibility of cytokine inducing NFκB in response to UVB points to an alternative therapeutic strategy for preventing or treating UVB exposed skin. As O’Dea’s model suggests, if UVB amplifies NFκB in the presence of cytokines, perhaps the therapeutic inhibition of critical cytokine pathways upregulated by UVB (eg IL-6,

191

IL-1α) will prevent the amplification of the NFκB signal and the untoward effects observed in skin in response to UVB, including increased cytokine expression, erythema, and inflammation. Over time, repeated exposures to UVB lead to UV-carcinogenesis.

As published studies and studies described in Chapter 3 suggest, the role of NFκB in UVB responsiveness is important and yet not entirely understood. Cytokines, like TGFβ-1, are likely to prove extremely important in mechanisms of UVB responsiveness, particularly as the role of NFκB in UVB-exposed keratinocytes is clarified.

C. TNFα as endogenous tumor promoter

The Smad3-dependent induction of TNFα by both TGFβ-1 and UVB demonstrated in both Chapter 2 and 3 has important implications for cancer promotion that have not been previously explored in the literature. Considered an endogeneous tumor promoter, cytokines such as TNFα and IL-1 appear to play a critical role during early stages of tumorigenous (Murakawa et al., 2006), although little effect is observed in later stages of cancer progression (Moore et al., 1999). In fact, mice lacking TNFα are resistant to two stage carcinogenesis (Moore et al., 1999;Suganuma et al., 1999) and both TNFαRI and TNFαRII are involved in tumor promotion with TNFαR1 knockout mice demonstrating greater resistance to tumor fromation (Arnott et al., 2004). Further, virtually no evidence of inflammatory cell infiltration is observed in TNFαR1 null mice following UVB exposure (Starcher, 2000). In mice lacking TNFα, MMP-9 and integrin αvβ6 expression is decreased, suggesting that TNFα is also important in migration of keratinocytes (Scott et al., 2004). Therefore, it stands to reason that TGFβ-1-induced TNFα may play a novel role during tumor promotion, thus expanding the number of ways TGFβ-1 influences cancer progression.

The link between TGFβ-1 and increased expression of TNFα during tumor promotion has not yet been explored to any extent in the scientific literature. Recently, however, polymorphisms identified for both TGFβ-1 and TNFα have been reported as possible risk factors for increased breast cancer incidence (Guo et al., 2011). This finding, along with evidence presented in Chapters 2 and 3 in the present studies, suggests that a link exists between these cytokines and that the role of TGFβ-1 and TNFα is possibly interdependent in tumor promotion. This finding may have implications for therapeutic intervention of cancers that have similar cytokine profiles to that observed in skin and warrant further consideration.

II Literature Cited

Acharyya S, Villalta SA, Bakkar N, Bupha-Intr T, Janssen PM, Carathers M, Li ZW, Beg AA, Ghosh S, Sahenk Z, Weinstein M, Gardner KL, Rafael-Fortney JA, Karin M, Tidball JG, Baldwin AS, Guttridge DC (2007) Interplay of IKK/NF-kappaB signaling in macrophages and

192

myofibers promotes muscle degeneration in Duchenne muscular dystrophy. J Clin Invest 117:889-901.

Adhami VM, Afaq F, Ahmad N (2003) Suppression of ultraviolet B exposure-mediated activation of NF-kappaB in normal human keratinocytes by resveratrol. Neoplasia 5:74-82.

Adler V, Polotskaya A, Kim J, Dolan L, Davis R, Pincus M, Ronai Z (1996) Dose rate and mode of exposure are key factors in JNK activation by UV irradiation. Carcinogenesis 17:2073-2076.

Arkan MC, Hevener AL, Greten FR, Maeda S, Li ZW, Long JM, Wynshaw-Boris A, Poli G, Olefsky J, Karin M (2005) IKK-beta links inflammation to obesity-induced insulin resistance. Nat Med 11:191-198.

Arnott CH, Scott KA, Moore RJ, Robinson SC, Thompson RG, Balkwill FR (2004) Expression of both TNF-alpha receptor subtypes is essential for optimal skin tumour development. Oncogene 23:1902-1910.

Beg AA, Sha WC, Bronson RT, Baltimore D (1995) Constitutive NF-kappa B activation, enhanced granulopoiesis, and neonatal lethality in I kappa B alpha-deficient mice. Genes Dev 9:2736-2746.

Bender K, Gottlicher M, Whiteside S, Rahmsdorf HJ, Herrlich P (1998) Sequential DNA damage-independent and -dependent activation of NF-kappaB by UV. EMBO J 17:5170-5181.

Burns KA, Martinon F (2004) Inflammatory diseases: is ubiquitinated NEMO at the hub? Curr Biol 14:R1040-R1042.

Cai D, Frantz JD, Tawa NE, Jr., Melendez PA, Oh BC, Lidov HG, Hasselgren PO, Frontera WR, Lee J, Glass DJ, Shoelson SE (2004) IKKbeta/NF-kappaB activation causes severe muscle wasting in mice. Cell 119:285-298.

Cooper KD (1996) Cell-mediated immunosuppressive mechanisms induced by UV radiation. Photochem Photobiol 63:400-406.

Danilenko DM (2008) Review paper: preclinical models of psoriasis. Vet Pathol 45:563-575.

Deng J, Lu PD, Zhang Y, Scheuner D, Kaufman RJ, Sonenberg N, Harding HP, Ron D (2004) Translational repression mediates activation of nuclear factor kappa B by phosphorylated translation initiation factor 2. Mol Cell Biol 24:10161-10168.

Devary Y, Rosette C, DiDonato JA, Karin M (1993) NF-kappa B activation by ultraviolet light not dependent on a nuclear signal. Science 261:1442-1445.

193

El-Abaseri TB, Hansen LA (2007) EGFR Activation and Ultraviolet Light-Induced Skin Carcinogenesis. J Biomed Biotechnol 2007:97939.

Fujisawa H, Wang B, Kondo S, Shivji GM, Sauder DN (1997) Costimulation with ultraviolet B and interleukin-1 alpha dramatically increase tumor necrosis factor-alpha production in human dermal fibroblasts. J Interferon Cytokine Res 17:307-313.

Ghavami S, Chitayat S, Hashemi M, Eshraghi M, Chazin WJ, Halayko AJ, Kerkhoff C (2009) S100A8/A9: a Janus-faced molecule in cancer therapy and tumorgenesis. Eur J Pharmacol 625:73-83.

Guo J, Meng H, Pei J, Zhu M (2011) Association between the TNF-alpha-238G>A and TGF- beta1 L10P Polymorphisms and Breast Cancer Risk: A Meta-Analysis. Breast Care (Basel) 6:126-129.

Han G, Williams CA, Salter K, Garl PJ, Li AG, Wang XJ (2010) A role for TGFbeta signaling in the pathogenesis of psoriasis. J Invest Dermatol 130:371-377.

Hart PH, Gorman S, Finlay-Jones JJ (2011) Modulation of the immune system by UV radiation: more than just the effects of vitamin D? Nat Rev Immunol 11:584-596.

Hausen BM, Osmundsen PE (1983) Contact allergy to parthenolide in Tanacetum parthenium (L.) Schulz-Bip. (feverfew, Asteraceae) and cross-reactions to related sesquiterpene lactone containing Compositae species. Acta Derm Venereol 63:308-314.

Jiang HY, Wek SA, McGrath BC, Scheuner D, Kaufman RJ, Cavener DR, Wek RC (2003) Phosphorylation of the alpha subunit of eukaryotic initiation factor 2 is required for activation of NF-kappaB in response to diverse cellular stresses. Mol Cell Biol 23:5651-5663.

Kaser A, Lee AH, Franke A, Glickman JN, Zeissig S, Tilg H, Nieuwenhuis EE, Higgins DE, Schreiber S, Glimcher LH, Blumberg RS (2008) XBP1 links ER stress to intestinal inflammation and confers genetic risk for human inflammatory bowel disease. Cell 134:743-756.

Kato T, Jr., Delhase M, Hoffmann A, Karin M (2003) CK2 Is a C-Terminal IkappaB Kinase Responsible for NF-kappaB Activation during the UV Response. Mol Cell 12:829-839.

Kitazawa M, Nakano T, Chuujou H, Shiojiri E, Iwasaki K, Sakamoto K (2002) Intracellular redox regulation by a cystine derivative suppresses UV-induced NF-kappa B activation. FEBS Lett 526:106-110.

Kondo S, Sauder DN, Kono T, Galley KA, McKenzie RC (1994) Differential modulation of interleukin-1 alpha (IL-1 alpha) and interleukin-1 beta (IL-1 beta) in human epidermal keratinocytes by UVB. Exp Dermatol 3:29-39.

Kwok BH, Koh B, Ndubuisi MI, Elofsson M, Crews CM (2001) The anti-inflammatory natural product parthenolide from the medicinal herb Feverfew directly binds to and inhibits IkappaB kinase. Chem Biol 8:759-766.

194

Lee EG, Boone DL, Chai S, Libby SL, Chien M, Lodolce JP, Ma A (2000) Failure to regulate TNF-induced NF-kappaB and cell death responses in A20-deficient mice. Science 289:2350- 2354.

Lewis DA, Hengeltraub SF, Gao FC, Leivant MA, Spandau DF (2006) Aberrant NF-kappaB activity in HaCaT cells alters their response to UVB signaling. J Invest Dermatol 126:1885- 1892.

Li N, Karin M (1998) Ionizing radiation and short wavelength UV activate NF-kappaB through two distinct mechanisms. Proc Natl Acad Sci U S A 95:13012-13017.

Li X, Massa PE, Hanidu A, Peet GW, Aro P, Savitt A, Mische S, Li J, Marcu KB (2002) IKKalpha, IKKbeta, and NEMO/IKKgamma are each required for the NF-kappa B-mediated inflammatory response program. J Biol Chem 277:45129-45140.

Madson JG, Hansen LA (2007) Multiple mechanisms of Erbb2 action after ultraviolet irradiation of the skin. Mol Carcinog 46:624-628.

Martin K, Sur R, Liebel F, Tierney N, Lyte P, Garay M, Oddos T, Anthonavage M, Shapiro S, Southall M (2008) Parthenolide-depleted Feverfew (Tanacetum parthenium) protects skin from UV irradiation and external aggression. Arch Dermatol Res 300:69-80.

Moore RJ, Owens DM, Stamp G, Arnott C, Burke F, East N, Holdsworth H, Turner L, Rollins B, Pasparakis M, Kollias G, Balkwill F (1999) Mice deficient in tumor necrosis factor-alpha are resistant to skin carcinogenesis. Nat Med 5:828-831.

Murakawa M, Yamaoka K, Tanaka Y, Fukuda Y (2006) Involvement of tumor necrosis factor (TNF)-alpha in phorbol ester 12-O-tetradecanoylphorbol-13-acetate (TPA)-induced skin edema in mice. Biochem Pharmacol 71:1331-1336.

195

O'Dea EL, Kearns JD, Hoffmann A (2008) UV as an amplifier rather than inducer of NF-kappaB activity. Mol Cell 30:632-641.

Pasparakis M, Luedde T, Schmidt-Supprian M (2006) Dissection of the NF-kappaB signalling cascade in transgenic and knockout mice. Cell Death Differ 13:861-872.

Rasmussen C, Gratz K, Liebel F, Southall M, Garay M, Bhattacharyya S, Simon N, Vander ZM, Van WK, Pirnstill J, Pirnstill S, Comer A, len-Hoffmann BL (2010) The StrataTest(R) human skin model, a consistent in vitro alternative for toxicological testing. Toxicol In Vitro 24:2021- 2029.

Scott KA, Arnott CH, Robinson SC, Moore RJ, Thompson RG, Marshall JF, Balkwill FR (2004) TNF-alpha regulates epithelial expression of MMP-9 and integrin alphavbeta6 during tumour promotion. A role for TNF-alpha in keratinocyte migration? Oncogene 23:6954-6966.

Sesto A, Navarro M, Burslem F, Jorcano JL (2002) Analysis of the ultraviolet B response in primary human keratinocytes using oligonucleotide microarrays. Proc Natl Acad Sci U S A 99:2965-2970.

Starcher B (2000) Role for tumour necrosis factor-alpha receptors in ultraviolet-induced skin tumours. Br J Dermatol 142:1140-1147.

Suganuma M, Okabe S, Marino MW, Sakai A, Sueoka E, Fujiki H (1999) Essential role of tumor necrosis factor alpha (TNF-alpha) in tumor promotion as revealed by TNF-alpha-deficient mice. Cancer Res 59:4516-4518.

Swamy M, Jamora C, Havran W, Hayday A (2010) Epithelial decision makers: in search of the 'epimmunome'. Nat Immunol 11:656-665.

Tanaka H, Fujita N, Tsuruo T (2005) 3-Phosphoinositide-dependent protein kinase-1-mediated IkappaB kinase beta (IkkB) phosphorylation activates NF-kappaB signaling. J Biol Chem 280:40965-40973.

196

Ulvmar MH, Sur I, Memet S, Toftgard R (2009) Timed NF-kappaB inhibition in skin reveals dual independent effects on development of HED/EDA and chronic inflammation. J Invest Dermatol 129:2584-2593. van Hogerlinden M., Rozell BL, Toftgard R, Sundberg JP (2004) Characterization of the progressive skin disease and inflammatory cell infiltrate in mice with inhibited NF-kappaB signaling. J Invest Dermatol 123:101-108.

Walker SL, Young AR (2007) An action spectrum (290-320 nm) for TNFalpha protein in human skin in vivo suggests that basal-layer epidermal DNA is the chromophore. Proc Natl Acad Sci U S A 104:19051-19054.

Werth VP, Zhang W (1999) Wavelength-specific synergy between ultraviolet radiation and interleukin-1 alpha in the regulation of matrix-related genes: mechanistic role for tumor necrosis factor-alpha. J Invest Dermatol 113:196-201.

Witt J, Barisic S, Sawodny O, Ederer M, Kulms D, Sauter T (2011) Modeling time delay in the NFkappaB signaling pathway following low dose IL-1 stimulation. EURASIP J Bioinform Syst Biol 2011:3.

197

VITA Kelly A. Hogan

EDUCATION The Pennsylvania State University, University Park, Pennsylvania Department of Veterinary & Biomedical Sciences/ Center for Molecular Toxicology & Carcinogenesis Ph.D. Integrative Biosciences, Molecular Toxicology Option (2011) Dissertation: Modulation of NFĸB transactivation by transforming growth factor-beta 1(TGF-β1) in skin: implications for responsiveness to ultraviolet radiation (UVB)

Marine Biological Laboratory (MBL), Woods Hole, Massachusetts Frontiers in Reproduction: Molecular and Cellular Concepts and Applications (2009)

FELLOWSHIPS/GRANTS/AWARDS AAAS/American Physiological Society Science and Engineering Mass Media Fellowship with the Milwaukee Journal Sentinel, Milwaukee, Wisconsin (2011)

Burroughs Wellcome Fund Fellowship to attend Frontiers in Reproductive course, Marine Biological Laboratory, Woods Hole, Massachusetts (2009)

Sigma Xi Grants-in-Aid of Research for “Identifying a role for TGF-β1 in induction of the NFĸB pathway by ultraviolet radiation (UVR) in primary keratinocytes” ( 2007)

Sahakian Family Fund For Agricultural Research Student Travel Award, Penn State University, University Park, PA (2007)

Fred Gellert Family Foundation Travel Award to attend UCSF/CHE Summit on Environmental Challenges to Reproductive Health & Fertility, San Francisco, CA (2007)

Huck Institute of the Life Sciences Graduate Fellowship (2004-2006)

PUBLICATIONS Pérez-Lorenzo R., Markell L.M., Hogan K.A., Yuspa S.H., Glick A.B. (2010) Transforming growth factor beta 1 enhances tumor promotion in mouse skin carcinogenesis. Carcinogenesis 31:1116.

Sivaprasad U., Fleming J., Verma P.S., Hogan K.A., Desury, G., Cohick W.S. (2004) Stimulation of insulin-like growth factor-3 synthesis by IGF-1 and transforming growth factor-alpha is mediated by both phosphatidylinositol-3 kinase and mitogen-activated protein kinase pathways in mammary epithelial cells. Endocrinology 145:4213.

SELECTED ABSTRACTS Hogan K.A., Blazanin N., and Glick A.B. (2009) TGF- β1 induction of MMP-9 occurs through NFкB and Smad 3 dependent mechanisms. Twelfth Annual Frontiers in Reproduction (FIR) Symposium, June 11-13. Marine Biological Laboratory, Woods Hole, MA. Presentation.

Hogan K.A. and Glick A.B. (2007) TGF-β1 induces Smad3-dependent NFĸB activation of primary mouse keratinocytes. In: American Association for Cancer Research Annual Meeting: Proceedings; Apr 14-18; Los Angeles, CA. Philadelphia (PA): AACR; 2007. Abstract nr 2419. Presentation.

Hogan K.A., Sivaprasad U., Desury G., Cohick W.S. (2004) IGF-I and TGF-α activate different upstream signaling molecules in bovine mammary epithelial cells. Federation of Animal Science Societies. St.Louis, MO. Poster.