DOCSLIB.ORG

Mechanism of Interaction Between Ocular and Nasal Neurogenic Inflammation in Allergic Rhinoconjunctivitis

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Mechanism of Interaction Between Ocular and Nasal Neurogenic Inflammation in Allergic Rhinoconjunctivitis Int Ophthalmol (2019) 39:2283–2294 https://doi.org/10.1007/s10792-018-01066-5 (0123456789().,-volV)( 0123456789().,-volV) ORIGINAL PAPER Mechanism of interaction between ocular and nasal neurogenic inflammation in allergic rhinoconjunctivitis Xiao-Wei Gao . Xiao-Min Zhang . Hai-Yan Liu . Shan-Shan Wang . Hua-Jiang Dong Received: 9 December 2017 / Accepted: 29 December 2018 / Published online: 3 January 2019 Ó Springer Nature B.V. 2019 Abstract substance P (SP), vasoactive intestinal peptide (VIP), Purpose The mechanisms of naso-ocular interaction and nerve growth factor (NGF) were detected. in allergic rhinoconjunctivitis are not well understood. Results The levels of SP, VIP, and NGF were Neurogenic inflammation affects both eyes and nose increased in both nasal mucosa and conjunctivae 1 h via the same neurogenic factors. The purpose of this and 24 h after OVA administration (p \ 0.05). Higher study was to investigate the effects of neurogenic levels of SP, VIP, and NGF expression were observed inflammation on conjunctival inflammation following in the nasal mucosa and conjunctivae 24 h after OVA nasal allergen provocation. administration (p \ 0.05). Following damage of the Methods Sensitized rats were exposed to ovalbumin nasal sensory nerves by capsaicin, the protein and (OVA) via the nose. Parts of the nasal mucosa and mRNA levels of SP, VIP, and NGF were reduced. conjunctivae were sliced and used for hematoxylin– Conclusion In conclusion, the increased levels of eosin staining, immunohistochemical analysis, west- VIP, SP, and NGF might be responsible for the ocular ern blotting, and real-time polymerase chain reaction. reaction following nasal challenge with allergen in The slides were observed under a light microscope, rats. and the acquired images were analyzed. The levels of Keywords Allergic rhinoconjunctivitis Á Conjunctiva Á Nerve growth factor Á Substance P Á Vasoactive intestinal peptide X.-W. Gao Á X.-M. Zhang (&) Tianjin Medical University Eye Institute and Tianjin Medical University School of Optometry and Ophthalmology, Tianjin Medical University Eye Hospital, Tianjin 300384, China Introduction e-mail: [email protected] The allergic conjunctivitis commonly accompanies X.-W. Gao Á H.-Y. Liu Á S.-S. Wang allergic rhinitis (AR); consequently, the World Department of Otolaryngology-Head and Neck Surgery, Second Hospital of Tianjin Medical University, Allergy Organization proposed that the disorder be Tianjin 300211, China appropriately termed allergic rhinoconjunctivitis (ARC) [1]. ARC is characterized by type I H.-J. Dong immunoglobulin E (IgE)-mediated hypersensitivity State Key Laboratory of Precision Measurement Technology and Instruments, Tianjin University, reaction to environmental allergens. It is a common Tianjin 300072, China allergic condition, affecting 10–40% of the general 123 2284 Int Ophthalmol (2019) 39:2283–2294 population [2, 3]. Nevertheless, due to the high related peptide (CGRP), neurokinin A (NKA), vasoac- prevalence and the influence on patients’ quality of tive intestinal peptide (VIP), and neuropeptide Y life, it possesses clinical and socioeconomic rele- (NPY). Of these, SP, CGRP, and NKA are sensory vance. Since ocular allergy is closely linked to AR, neuropeptides, released from the sensory nerve fibers demonstrating similarities in epidemiology, patho- of the C category; VIP is a neuropeptide released from physiology, and treatment, the pathophysiologic the nasal mucosa and the postganglionic parasympa- mechanisms thought to be involved in the generation thetic fibers of the conjunctivae [15]; NPY is released of ocular symptoms with nasal challenge deserve from sympathetic fibers and has no effect on the special attention. secretion of mucous glands [16, 17]. Nerve growth Ocular symptoms in patients with ARC are thought factor (NGF), a neurotrophin that regulates neuronal to have three possible underlying mechanisms. Most development, enhances the production of neuropep- evidently, direct exposure of the conjunctivae to tides and is associated with ocular and nasal neuro- allergens leads to topical IgE-mediated mast cell genic inflammation [15, 18, 19]. There are no studies activation, which parallels the nasal immune reaction. on the role of neuropeptides, except SP [17, 20, 21], Another possible mechanism is: various types of cells and the naso-ocular interaction in ARC. or factors released from nasal mucosa during allergic The aim of this study was to illustrate the mech- reactions reach the conjunctivae through the blood anism of interaction of ocular and nasal neurogenic vessels, lymphatic system, and nasolacrimal duct, inflammation in ARC. Therefore, we investigated the causing ocular symptoms. Finally, neurogenic inflam- expression of SP, VIP, and NGF in nasal mucosa and mation may contribute to the generation of conjunc- conjunctivae at different stages following nasal aller- tivitis in AR, as several clinical and experimental gic challenge in a rat model of ARC. Further, we observations point in the direction of a naso-ocular examined the effects of topical capsaicin on the reflex. The naso-ocular reflex has been theorized based mechanisms of the neuropeptides and neurotrophin on several studies [4–9]. released following the allergic challenge. Neurogenic inflammation is the process by which inflammatory mediators, including inflammatory neu- ropeptides and neurotrophins, are released from Method afferent nerve terminals in a target tissue and trigger inflammation with vasodilatation, increased vascular Animals permeability, and hypersensitivity [10, 11]. The nasal mucosa and conjunctivae have a common embryonic Sixty healthy male Sprague–Dawley rats (300–350 g, origin and innervations (sensory nerves, and sympa- 10–12 weeks of age) were obtained from Beijing Hua thetic and parasympathetic fibers). Parasympathetic Fukang Biological Polytron Technologies Inc. (Bei- nerves richly innervate the eyes, entering them after jing, China) and bred in the laboratory of Institute of traveling in conjunction with the parasympathetic Biomedical Engineering, Chinese Academy of Med- input to the nasal cavity. Parasympathetic innervations ical Sciences and Peking Union Medical College. All governing the tear film and nasal secretion intersect at animals were allowed to acclimate for 1 week before the pterygopalatine ganglion. Several studies have experimentation. The rats were housed at 19–25 °C, concluded that ocular symptoms following nasal with 40–60% humidity and 12-h light/dark cycle challenge occur secondary to the release of acetyl- (lights on at 7 am), and had free access to food and choline (ACh) from the parasympathetic nerve end- water. All experiments were conducted during the ings [12–14], called cholinergically mediated central light phase of the light/dark cycle. All procedures were reflex. approved by the Institutional Animal Care and Use In addition to ACh, there are other neurogenic Committee of Tianjin Medical University and con- messengers that complete the signal transmission ducted in accordance with the National Institutes of inside the neurogenic system. These neurotransmitters Health Guide for the Care and Use of Laboratory are neuropeptides and neurotrophins. Neuropeptides Animals. associated with ocular and nasal neurogenic inflam- mation include substance P (SP), calcitonin gene- 123 Int Ophthalmol (2019) 39:2283–2294 2285 Rat model of ARC of the primers used were as follows: Tac1 forward 50TGGCGGTCTTTTTTCTCGTT30,reverse50GCAT The basic sensitization was performed with intraperi- TGCCTCCTTGATTTGG30; Vip forward 50ACGCCA toneal (i.p.) injection of 0.8 mL allergen suspension AACTTACAAAGA30,reverse50GGAGTAGATAGA containing 0.3 mg ovalbumin (OVA; Grade V; Sigma, GCCCCA30; Ngf forward 50CGGTCTTCCCGCCCTA 0 0 St. Louis, MO, USA) and 30 mg Al(OH)3 gel (Xi’an GCCTG3 ,reverse5ATTTGCACGCCGCTCCTTT Heart Biological Technology Co., Ltd., Xian Shi, GC30; Gapdh forward 50CGTATCGGACGCCTGG Shaanxi, China) in 40 rats: a total of 7 times, once TT30,reverse50GTGCCGTTGAACTTGCCG30.The every 48 h. Further, 100 lL 2% OVA suspension levels of Tac1, Vip, Ngf,andGapdh expression were drops (1 mg 50 lL-1 nostril-1) were administered detected by RT-PCR, using the SYBR Green and SYBR into nasal cavities of the rats bilaterally using a Premix Ex Taq (code: DRR420A, TaKaRa Bio Inc.). micropipette for endonasal (e.n.) challenge: a total of 7 times, once every 24 h. Twenty sensitized rats were Western blotting administered 1 mM of capsaicin (N-vanillyl- nonanamide; Sigma) e.n. on day 10 [20]. All the rats The remaining conjunctival tissues of the left eye were were conscious and fixed appropriately during the stored in liquid nitrogen for subsequent assays. Total procedures to prevent them from rubbing the solution proteins were extracted from the homogenate of the from nose to eyes. frozen tissues, and the concentrations of proteins were measured using a bicinchoninic acid protein assay kit Study design (Sigma and Abcam, Cambridge, UK). The proteins were separated using 10% sodium dodecyl sulfate– Animals were randomly allocated into 3 groups: (1) polyacrylamide gel electrophoresis and then electro- the non-capsaicin group (NC, n = 20) consisted of rats transferred onto polyvinylidene difluoride mem- that were sensitized and intranasally challenged via branes. After blocking with 5% skim milk powder in administration of OVA and were administered saline phosphate-buffered saline, the membranes were e.n. instead of capsaicin on day 10; (2) the capsaicin probed with rabbit anti-SP polyclonal antibody (Bio- group (C,
Load more

Recommended publications
  • Altered Inflammatory Mediators in Fibromyalgia
    Cur gy: ren lo t o R t e a s e m a u r c e h h García et al., Rheumatology (Sunnyvale) 2017, 7:2 R Rheumatology: Current Research DOI: 10.4172/2161-1149.1000215 ISSN: 2161-1149 Review Article Open Access Altered Inflammatory Mediators in Fibromyalgia Juan José García1*, Julián Carvajal-Gil2, Aurora Herrero-Olea2 and Rafael Gómez-Galán2 1Department of Physiology, University Centre of Mérida, University of Extremadura, Mérida, Spain 2Department of Nursing, University Centre of Mérida, University of Extremadura, Mérida, Spain *Corresponding author: Dr. Juan José García, Department of Physiology, University Centre of Mérida, University of Extremadura, Mérida, Spain,Tel: 00 34 924289300, Ext: 86118; E-mail: [email protected] Received date: February 07, 2017; Accepted date: April 08, 2017; Published date: April 15, 2017 Copyright: ©2017 García JJ, et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. Abstract Fibromyalgia (FM) is a syndrome characterized by widespread chronic pain, tenderness, stiffness, fatigue, and sleep and mood disturbances. Current evidences suggest that inflammatory mediators may have an important role in the pathogenesis of fibromyalgia. Every day new evidences emerging of the role of the immune system and the inflammatory process in the pathophysiology of this disease. Thus, the aim of this work has been review that altered inductors, inflammatory mediators and effectors have been reported in fibromyalgia, and its relationship to disease’s symptoms. If in fibromyalgia underlies widespread disruption of most characteristic components on the inflammatory ´s process (endogenous inductors, mediators and effectors) is logical to think that fibromyalgia is producing a sustained inflammatory response in time, unregulated, responsible for the disease´s symptoms.
    [Show full text]
  • The Migraine Attack As a Homeostatic, Neuroprotective Response to Brain Oxidative Stress: Preliminary Evidence for a Theory
    ISSN 0017-8748 Headache doi: 10.1111/head.13214 VC 2017 American Headache Society Published by Wiley Periodicals, Inc. Views and Perspectives The Migraine Attack as a Homeostatic, Neuroprotective Response to Brain Oxidative Stress: Preliminary Evidence for a Theory Jonathan M. Borkum, PhD Background.—Previous research has suggested that migraineurs show higher levels of oxidative stress (lipid peroxides) between migraine attacks and that migraine triggers may further increase brain oxidative stress. Oxidative stress is trans- duced into a neural signal by the TRPA1 ion channel on meningeal pain receptors, eliciting neurogenic inflammation, a key event in migraine. Thus, migraines may be a response to brain oxidative stress. Results.—In this article, a number of migraine components are considered: cortical spreading depression, platelet acti- vation, plasma protein extravasation, endothelial nitric oxide synthesis, and the release of serotonin, substance P, calcitonin gene-related peptide, and brain-derived neurotrophic factor. Evidence is presented from in vitro research and animal and human studies of ischemia suggesting that each component has neuroprotective functions, decreasing oxidant production, upregulating antioxidant enzymes, stimulating neurogenesis, preventing apoptosis, facilitating mitochondrial biogenesis, and/or releasing growth factors in the brain. Feedback loops between these components are described. Limitations and challenges to the model are discussed. Conclusions.—The theory is presented that migraines are an integrated
    [Show full text]
  • Sustained Sensitizing Effects of Tumor Necrosis Factor Alpha on Sensory Nerves in Lung and Airways Ruei-Lung Lin University of Kentucky, [email protected]
    University of Kentucky UKnowledge Physiology Faculty Publications Physiology 12-2017 Sustained Sensitizing Effects of Tumor Necrosis Factor Alpha on Sensory Nerves in Lung and Airways Ruei-Lung Lin University of Kentucky, [email protected] Qihai Gu Mercer University Mehdi Khosravi University of Kentucky, [email protected] Lu-Yuan Lee University of Kentucky, [email protected] Right click to open a feedback form in a new tab to let us know how this document benefits oy u. Follow this and additional works at: https://uknowledge.uky.edu/physiology_facpub Part of the Pharmacology Commons, Physiology Commons, Pulmonology Commons, and the Therapeutics Commons Repository Citation Lin, Ruei-Lung; Gu, Qihai; Khosravi, Mehdi; and Lee, Lu-Yuan, "Sustained Sensitizing Effects of Tumor Necrosis Factor Alpha on Sensory Nerves in Lung and Airways" (2017). Physiology Faculty Publications. 139. https://uknowledge.uky.edu/physiology_facpub/139 This Article is brought to you for free and open access by the Physiology at UKnowledge. It has been accepted for inclusion in Physiology Faculty Publications by an authorized administrator of UKnowledge. For more information, please contact [email protected]. Sustained Sensitizing Effects of Tumor Necrosis Factor Alpha on Sensory Nerves in Lung and Airways Notes/Citation Information Published in Pulmonary Pharmacology & Therapeutics, v. 47, p. 29-37. © 2017 Elsevier Ltd. All rights reserved. This manuscript version is made available under the CC‐BY‐NC‐ND 4.0 license https://creativecommons.org/licenses/by-nc-nd/4.0/. The document available for download is the author's post-peer-review final draft of the ra ticle. Digital Object Identifier (DOI) https://doi.org/10.1016/j.pupt.2017.06.001 This article is available at UKnowledge: https://uknowledge.uky.edu/physiology_facpub/139 HHS Public Access Author manuscript Author ManuscriptAuthor Manuscript Author Pulm Pharmacol Manuscript Author Ther.
    [Show full text]
  • Migraine: Current Concepts and Emerging Therapies
    Vascular Pharmacology 43 (2005) 176 – 187 www.elsevier.com/locate/vph Migraine: Current concepts and emerging therapies D.K. Arulmozhi a,b,*, A. Veeranjaneyulu a, S.L. Bodhankar b aNew Chemical Entity Research, Lupin Research Park, Village Nande, Taluk Mulshi, Pune 411 042, Maharashtra, India bDepartment of Pharmacology, Bharati Vidyapeeth, Poona College of Pharmacy, Pune 411 038, Maharashtra, India Received 23 April 2005; received in revised form 17 June 2005; accepted 11 July 2005 Abstract Migraine is a recurrent incapacitating neurovascular disorder characterized by attacks of debilitating pain associated with photophobia, phonophobia, nausea and vomiting. Migraine affects a substantial fraction of world population and is a major cause of disability in the work place. Though the pathophysiology of migraine is still unclear three major theories proposed with regard to the mechanisms of migraine are vascular (due to cerebral vasodilatation), neurological (abnormal neurological firing which causes the spreading depression and migraine) and neurogenic dural inflammation (release of inflammatory neuropeptides). The modern understanding of the pathogenesis of migraine is based on the concept that it is a neurovascular disorder. The drugs used in the treatment of migraine either abolish the acute migraine headache or aim its prevention. The last decade has witnessed the advent of Sumatriptan and the Ftriptan_ class of 5-HT1B/1D receptor agonists which have well established efficacy in treating migraine. Currently prophylactic treatments for migraine include calcium channel blockers, 5-HT2 receptor antagonists, beta adrenoceptor blockers and g-amino butyric acid (GABA) agonists. Unfortunately, many of these treatments are non specific and not always effective. Despite such progress, in view of the complexity of the etiology of migraine, it still remains undiagnosed and available therapies are underused.
    [Show full text]
  • Infection-Associated Mechanisms of Neuro-Inflammation and Neuro
    International Journal of Molecular Sciences Review Infection-Associated Mechanisms of Neuro-Inflammation and Neuro-Immune Crosstalk in Chronic Respiratory Diseases Belinda Camp, Sabine Stegemann-Koniszewski *,† and Jens Schreiber † Experimental Pneumonology, Department of Pneumonology, University Hospital Magdeburg, Health Campus Immunology, Infectiology and Inflammation (GC-I3), Otto-von-Guericke University Magdeburg, 39120 Magdeburg, Germany; [email protected] (B.C.); [email protected] (J.S.) * Correspondence: [email protected] † These authors contributed equally to this work. Abstract: Chronic obstructive airway diseases are characterized by airflow obstruction and airflow limitation as well as chronic airway inflammation. Especially bronchial asthma and chronic obstruc- tive pulmonary disease (COPD) cause considerable morbidity and mortality worldwide, can be difficult to treat, and ultimately lack cures. While there are substantial knowledge gaps with respect to disease pathophysiology, our awareness of the role of neurological and neuro-immunological processes in the development of symptoms, the progression, and the outcome of these chronic obstructive respiratory diseases, is growing. Likewise, the role of pathogenic and colonizing mi- croorganisms of the respiratory tract in the development and manifestation of asthma and COPD is increasingly appreciated. However, their role remains poorly understood with respect to the underly- ing mechanisms. Common bacteria and viruses causing respiratory infections and exacerbations of chronic obstructive respiratory diseases have also been implicated to affect the local neuro-immune Citation: Camp, B.; crosstalk. In this review, we provide an overview of previously described neuro-immune interactions Stegemann-Koniszewski, S.; in asthma, COPD, and respiratory infections that support the hypothesis of a neuro-immunological Schreiber, J.
    [Show full text]
  • A Comprehensive Review on Biomarkers Associated with Painful Temporomandibular Disorders ✉ ✉ Mayank Shrivastava1, Ricardo Battaglino2 and Liang Ye2
    International Journal of Oral Science www.nature.com/ijos REVIEW ARTICLE OPEN A comprehensive review on biomarkers associated with painful temporomandibular disorders ✉ ✉ Mayank Shrivastava1, Ricardo Battaglino2 and Liang Ye2 Pain of the orofacial region is the primary complaint for which patients seek treatment. Of all the orofacial pain conditions, one condition that possess a significant global health problem is temporomandibular disorder (TMD). Patients with TMD typically frequently complaints of pain as a symptom. TMD can occur due to complex interplay between peripheral and central sensitization, endogenous modulatory pathways, and cortical processing. For diagnosis of TMD pain a descriptive history, clinical assessment, and imaging is needed. However, due to the complex nature of pain an additional step is needed to render a definitive TMD diagnosis. In this review we explicate the role of different biomarkers involved in painful TMD. In painful TMD conditions, the role of biomarkers is still elusive. We believe that the identification of biomarkers associated with painful TMD may stimulate researchers and clinician to understand the mechanism underlying the pathogenesis of TMD and help them in developing newer methods for the diagnosis and management of TMD. Therefore, to understand the potential relationship of biomarkers, and painful TMD we categorize the biomarkers as molecular biomarkers, neuroimaging biomarkers and sensory biomarkers. In addition, we will briefly discuss pain genetics and the role of potential microRNA (miRNA) involved in TMD pain. International Journal of Oral Science (2021) 13:23; https://doi.org/10.1038/s41368-021-00129-1 1234567890();,: INTRODUCTION persistence of pain beyond the normal time of healing, while for The orofacial region consists of heterogeneous hard and soft clinical practicability a duration exceeding 3 months and for tissues that make diagnosing and treating pain conditions a research purposes, a duration of 6 months is used to denote the challenging task.
    [Show full text]
  • Editorials Neurogenic Inflammation in Human Airways
    Thorax 1995;50:217-219 217 Thorax: first published as 10.1136/thx.50.3.217 on 1 March 1995. Downloaded from THORAX Editorials Neurogenic inflammation in human airways: is it important? Numerous peptides have been demonstrated in airway which is present in both upper and lower human nerves and endocrine cells.' Among the best studied are airways. substance P and neurokinin A which are peptides contained A considerable amount of research has been carried within sensory airway nerves. Both are members of the out on the effects of exogenously administered sensory tachykinin peptide family. The tachykinins are potent vaso- neuropeptides on the upper and lower airways. Studies on dilators and contractors of smooth muscle which are co- human lower airways have focused on changes in airway localised with calcitonin gene-related peptide, a sensory calibre. 2 Inhalation ofsubstance P and neurokinin A causes neuropeptide with important vasodilator properties.2 In dose-dependent bronchoconstriction, neurokinin A being studies on rodent airways substance P and neurokinin A more potent than substance P and asthmatic subjects being have been implicated as neurotransmitters which mediate more responsive than normal subjects.2' 28 The contractile the excitatory part of the non-adrenergic non-cholinergic effect of substance P and neurokinin A is reduced in (NANC) nervous system. These non-cholinergic excitatory asthmatic patients pretreated with disodium cromoglycate nerves can be activated by mechanical and chemical stimuli or nedocromil sodium, suggesting
    [Show full text]
  • ACTIVIN IS CRITICAL for the DEVELOPMENT of PAIN HYPERSENSITIVITY AFTER INFLAMMATION by PIN XU Submitted in Partial Fulfillment
    ACTIVIN IS CRITICAL FOR THE DEVELOPMENT OF PAIN HYPERSENSITIVITY AFTER INFLAMMATION by PIN XU Submitted in partial fulfillment of the requirements For the degree of Doctor of Philosophy Thesis Adviser: Dr. Alison K. Hall Department of Neurosciences CASE WESTERN RESERVE UNIVERSITY August, 2007 CASE WESTERN RESERVE UNIVERSITY SCHOOL OF GRADUATE STUDIES We hereby approve the dissertation of ____Pin Xu______________________________________________ candidate for the Ph.D. degree *. (signed)__ Gary Landreth______________________________ ___ (chair of the committee) ___Alison Hall____________________________________ ___Jerry Silver___________ ___________ _____ ___ ___Susann Brady-kalnay____________________________ ________________________________________________ ________________________________________________ (date) ____June 5, 2007___________________ *We also certify that written approval has been obtained for any proprietary material contained therein. ii DEDICATION This thesis is dedicated to my parents, Hongfa Xu and Ruiyun Pan, and to my husband Chen Liu. iii TABLE OF CONTENTS Page Title Page……………………..…………………………………………………….….…I Typed ETD Sign-off Sheet…………………………………………………….................II Dedication……………………………………………………………………………..…III Table of Contents………………………………………………………..……..……..….IV List of Tables……………………………………………………………………………VII List of Figures…………………………………………………………………….....…VIII Acknowledgements………………………………………………………………………X Abstract…………………………………………………………………………...……...XI Chapter I: General Introduction……………………………………………………………………...1 Chapter
    [Show full text]
  • Chronic Urticaria Is Usually Associated with Fibromyalgia Syndrome
    Acta Derm Venereol 2009; 89: 389–392 CLINICAL REPORT Chronic Urticaria is Usually Associated with Fibromyalgia Syndrome Claudio TORRESANI, Salvatore BELLAFIORE and Giuseppe DE PANFILIS Section of Dermatology, Department of Surgical Sciences, University of Parma, Parma, Italy Although the pathophysiology of chronic urticaria is not participate in skin inflammation (2). In fact, after their fully understood, it is possible that dysfunctioning of pe- release, neuropeptides act on target skin cells, resulting in ripheral cutaneous nerve fibres may be involved. It has erythema, oedema, hyperthermia and pruritus, indicating also been suggested that fibromyalgia syndrome, a multi- that a communication network exists between cutaneous symptomatic chronic pain condition, may be associated sensory nerves and immune skin cells during cutaneous with alterations and dysfunctioning of peripheral cuta- inflammation (reviewed in (3)). In particular, a neuroim- neous nerve fibres. The aim of this study was to determine mune network between cutaneous sensory nerves and whether patients with chronic urticaria are also affected target effector skin cells has been suggested to link dys- by fibromyalgia syndrome. A total of 126 patients with functions of peripheral nervous system and pathogenic chronic urticaria were investigated for fibromyalgia syn- events in allergic inflammatory skin diseases (4). drome. An unexpectedly high proportion (over 70%) had Fibromyalgia syndrome (FMS) is a chronic, genera- fibromyalgia syndrome. The corresponding proportion lized pain condition with characteristic tender points on for 50 control dermatological patients was 16%, which is physical examination, often accompanied by a number higher than previously published data for the Italian ge- of associated symptoms, such as sleep disturbance, neral population (2.2%).
    [Show full text]
  • Role of Inflammation in the Pathogenesis and Treatment of Fibromyalgia
    Rheumatology International (2019) 39:781–791 Rheumatology https://doi.org/10.1007/s00296-019-04251-6 INTERNATIONAL REVIEW Role of inflammation in the pathogenesis and treatment of fibromyalgia Ilke Coskun Benlidayi1 Received: 28 December 2018 / Accepted: 8 February 2019 / Published online: 13 February 2019 © Springer-Verlag GmbH Germany, part of Springer Nature 2019 Abstract Fibromyalgia is a multifaceted disease. The clinical picture of fibromyalgia covers numerous comorbidities. Each comorbid- ity stands as a distinct condition. However, common pathophysiologic factors are occupied in their background. Along with the genetic, environmental and neuro-hormonal factors, inflammation has been supposed to have role in the pathogenesis of fibromyalgia. The aim of the present article was to review the current literature regarding the potential role of inflammation in the pathogenesis and treatment of fibromyalgia. A literature search was conducted through PubMed/MEDLINE and Web of Science databases using relevant keywords. Recent evidence on this highly studied topic indicates that fibromyalgia has an immunological background. Cytokines/chemokines, lipid mediators, oxidative stress and several plasma-derived factors underlie the inflammatory state in fibromyalgia. There are potential new therapeutic options targeting inflammatory pathways in fibromyalgia patients. In conclusion, there is evidence to support the inflammation-driven pathways in the pathogenesis of fibromyalgia. However, further research is required to fully understand the network of inflammation and its possible role in diagnosis and/or treatment of fibromyalgia. Keywords Cytokines · Fibromyalgia · Inflammation · Inflammatory markers · Neurogenic inflammation · Treatment Introduction look [1–4]. Since, not only chronic pain, but also fatigue, psychological comorbidities and sleep disturbances might Fibromyalgia is a chronic rheumatic condition characterized contribute to functional limitation, absence from work and by widespread pain and various comorbidities.
    [Show full text]
  • Current Status and Future Directions of Botulinum Neurotoxins for Targeting Pain Processing
    Toxins 2015, 7, 4519-4563; doi:10.3390/toxins7114519 OPEN ACCESS toxins ISSN 2072-6651 www.mdpi.com/journal/toxins Review Current Status and Future Directions of Botulinum Neurotoxins for Targeting Pain Processing Sabine Pellett 1, Tony L. Yaksh 2 and Roshni Ramachandran 2,* 1 Department of Bacteriology, University of Wisconsin, 6340 Microbial Sciences Building, 1550 Linden Dr., Madison, WI 53706, USA; E-Mail: [email protected] 2 Department of Anesthesiology 0818, University of California, 214 Dickinson St., San Diego, CA 92103, USA; E-Mail: [email protected] * Author to whom correspondence should be addressed; E-Mail: [email protected]; Tel.: +1-619-543-3597. Academic Editor: Bahman Jabbari Received: 31 July 2015 / Accepted: 19 October 2015 / Published: 4 November 2015 Abstract: Current evidence suggests that botulinum neurotoxins (BoNTs) A1 and B1, given locally into peripheral tissues such as skin, muscles, and joints, alter nociceptive processing otherwise initiated by inflammation or nerve injury in animal models and humans. Recent data indicate that such locally delivered BoNTs exert not only local action on sensory afferent terminals but undergo transport to central afferent cell bodies (dorsal root ganglia) and spinal dorsal horn terminals, where they cleave SNAREs and block transmitter release. Increasing evidence supports the possibility of a trans-synaptic movement to alter postsynaptic function in neuronal and possibly non-neuronal (glial) cells. The vast majority of these studies have been conducted on BoNT/A1 and BoNT/B1, the only two pharmaceutically developed variants. However, now over 40 different subtypes of botulinum neurotoxins (BoNTs) have been identified. By combining our existing and rapidly growing understanding of BoNT/A1 and /B1 in altering nociceptive processing with explorations of the specific characteristics of the various toxins from this family, we may be able to discover or design novel, effective, and long-lasting pain therapeutics.
    [Show full text]
  • TNF-Α and Neuropathic Pain
    Leung and Cahill Journal of Neuroinflammation 2010, 7:27 JOURNAL OF http://www.jneuroinflammation.com/content/7/1/27 NEUROINFLAMMATION REVIEW Open Access TNF-αReview and neuropathic pain - a review Lawrence Leung*1,2,3 and Catherine M Cahill1,4,5 Abstract Tumor necrosis factor alpha (TNF-α) was discovered more than a century ago, and its known roles have extended from within the immune system to include a neuro-inflammatory domain in the nervous system. Neuropathic pain is a recognized type of pathological pain where nociceptive responses persist beyond the resolution of damage to the nerve or its surrounding tissue. Very often, neuropathic pain is disproportionately enhanced in intensity (hyperalgesia) or altered in modality (hyperpathia or allodynia) in relation to the stimuli. At time of this writing, there is as yet no common consensus about the etiology of neuropathic pain - possible mechanisms can be categorized into peripheral sensitization and central sensitization of the nervous system in response to the nociceptive stimuli. Animal models of neuropathic pain based on various types of nerve injuries (peripheral versus spinal nerve, ligation versus chronic constrictive injury) have persistently implicated a pivotal role for TNF-α at both peripheral and central levels of sensitization. Despite a lack of success in clinical trials of anti-TNF-α therapy in alleviating the sciatic type of neuropathic pain, the intricate link of TNF-α with other neuro-inflammatory signaling systems (e.g., chemokines and p38 MAPK) has indeed inspired a systems approach perspective for future drug development in treating neuropathic pain. Introduction stimuli (allodynia). It is a pathological type of pain that Despite intense research over the last 30 years, debate is persists despite resolution of the inciting damage to the still ongoing regarding the nature of neuropathic pain, nerve and the surrounding tissues.
    [Show full text]