© 2017 Nature America, Inc., part of Springer Nature. All rights reserved. or or D.-E.Z. ( de Recherche Servier, Croissy-sur-Seine, France. 5 3 1 STAT2 STAT1,and IFNAR2-associated phosphorylate turn JAK1 in respectively JAK1, and TYK2 kinases, sine tyro Janus family associated of their activation the induces IFNAR2 for crucial is interventions. and human for health therapeutic system IFN the of fine-tuning accurate that indicate interferonopathies as known disorders syndrome, systemic sclerosis, rheumatoid arthritis, and the rare geneticSjogren’s erythematosus, lupus systemic with people in pathogenesis to contributes signaling IFN dysregulated or production IFN excess effects and chronic side acute severe cause therapies and immunotherapy ventional chemotherapies, targeted anticancer treatment, radiotherapy,con including therapies, anticancer successful for required are cells recently, cancer it has and been revealed that disorders, autonomous autoimmune IFN responses in infections, cancer viral treat to development cancer and infections against responses immune for essential are IFNs that demonstrated have models mouse and diseases genetic human from other regulators that affect cell proliferation and survival. Many studies block growth and of survival pathogens, and transcription factors and ulate innate and adaptive immune responses, enzymes that specifically Proteins encoded by ISGs include cytokines and chemokines that mod and cancer via expression of over 300 genes IFN-stimulated (ISGs) network the coordinating regulatory host’s against defense pathogens complex highly a as emerged has signaling (IFN) interferon I Type novel membrane-distal both report in with detrimental Type Jacob Piehler Stephan Wilmes Kei-ichiro Arimoto suppression of type I interferon signaling STAT2 is an essential adaptor in USP18-mediated nature structural & molecular biology molecular & structural nature Received 8 August 2016; accepted 13 January 2017; published online 6 February 2017; Hybrigenics, Hybrigenics, impasse Reille, Paris, France. Division of Biological Sciences, University of California San Diego, La Jolla, California, USA. Moores UCSD Cancer Center, University of California San Diego, La Jolla, California, USA.

The binding of type I IFNs to the receptor subunits IFNAR1 and and IFNAR1 subunits receptor the to IFNs I type of binding The alterations

medical I human

strategies

interferons that [email protected]

STAT2

effects and

interventions. in 2

for gene & Dong-Er Zhang

mouse STAT2-binding

(IFNs) is 2 3

4 on treatment ,

, , Jun-Bao Fan , 4 6 also . Therefore, IFNs have successfully been used used been successfully have IFNs Therefore, .

. . However, it is also known IFN that high-dose expression.

1 human ,

). 8 cells.

are , , Sara Löchte a

previously

The

multifunctional

We of health.

JAK–STAT

IFN-signaling-related site.

STAT2 found 6 1 Department Department of Pathology, University of California San Diego, La Jolla, California, USA. , , Jürgen J Heinisch 9

This , A 1 unrecognized, 1 8 , 0

These These authors contributed equally to this work. should Correspondence be addressed to J.P. ( 3 . Together, these findings findings these Together, .

tight

2 that , is 6 , 1

8 mechanistic

1

, , Samuel A Stoner a signaling . Activated TYK2 and and TYK2 Activated .

well-known

cytokines STAT2 regulatory advance online publication online advance 7 , 8 . Furthermore, . Furthermore,

recruits pathway

crucial

human coupling that

network

essential 5 . Most . 2

, , Zhi Li regulate

USP component

transmits 1

, diseases. 2 - - - 1 .

of , , Christoph Burkart

1 therefore

8 and

effector USP18-inhibitory effects may have therapeutic potential. therapeutic have may effects USP18-inhibitory and that modulating on responses immune has a effect USP18 broad demonstrated in mouse and human models been have responses immune IFN-mediated in USP18 of functions cells, ISG15 regulates directly USP18 stability manner IFN-affinity-dependent plex in a com signaling downstream and dimerization receptor binding, ligand decreases thereby prob USP18 is kinases. Janus by the mediated ably stabilization this because complexes, signaling of lization stabi cytosolic the with interfere may USP18 IFNAR2, binding for activity enzymatic its of independent an effect of I type signaling, regulation interferon negative and exerts by treatment IFN stimulated is strongly However, expression USP18 removes a ubiquitin-like modifier, ISG15, from conjugated proteins model mouse leukemia-fusion-protein a in expression gene of analysis an in fied identi we have which previously USP18, protease ubiquitin-specific plasticity signaling to contribute to regulators intracellular and negative positive multiple by signaling IFN of modulation tiotemporal spa and dynamics dimerization receptor of interplay intricate An IFNs strongly depend on the cellular and physiological context physiological and cellular the on depend strongly IFNs promoters their in ment ele response IFN-stimulated an with genes of expression promotes ISGF3 3 (ISGF3). factor gene IFN-stimulated complex ternary IRF9 STAT1–STAT2– DNA-binding of the in formation resulting thereby

to 4

immune , , Ming Yan

the specific

do

the 2

of Department Department of Biology, University of Osnabrück, Osnabrück, Germany. i:10.1038/nsmb.337

4 type

Institut Institut Pasteur, Cytokine Signaling Unit, Inserm, Paris, France.

controls IFN the and

responses

positive

USP

I extracellular negative-feedback 18

IFN 1 , 1 , , Sandra Pellegrini 9

1 , plays an intriguing role. USP18 is an enzyme that that is an enzyme USP18 role. an intriguing , plays IFN

8-mediated receptor

effector 1

and signaling, , , Yue Zhang 8 12

cellular , signal 1

3 subunit . Signaling patterns elicited by type I type by elicited patterns Signaling .

of

negative-feedback

1

type which

, functions 1 to

5 functions and by endocytosis by and 1

7 the 3 IFNAR2 . Among these regulators, the the regulators, these Among .

21– , , Sayuri Miyauchi I 2 4 7

1

IFN Present Present address: Institut , , Frédéric Colland

in . By competing with JAK1 JAK1 with competing By . 2 nucleus, 3

. Interestingly, in human human in Interestingly, . 25– turn

of 2 signaling. 4

3

but . . Furthermore, critical

2 via STAT2 , , thus that suggesting

[email protected] may

s e l c i t r a

also its thus

control

constitutive interfere

may

can Here, resulting 1 6 are likely likely are

provide

have 1 in ) ,

we

5

, 7

, 1 2

4 0  ------. .

© 2017 Nature America, Inc., part of Springer Nature. All rights reserved. 2fTGH, MDA-MB-231, 2fTGH, and KT-1 the interaction we cells, confirmed of lifetime tion ( FRAP STAT2 by micropatterned to bound USP18 of intracellular of Monitoring kinetics exchange the STAT2 to ( fused not was that domain membrane trans a with cotransfected was USP18 when or bait STAT2 as with significant contrast was when observed only mEGFP was coexpressed the and trast patterned between nonpatterned regions in the Nocells. by the as con quantified micropatterns, within strong colocalization revealed USP18 mEGFP-tagged with construct this of Coexpression HaloTag (HaloTag-mTagBFP-TMD-STAT2) was used as bait ( a with STAT2transmembrane domain (TMD) as of well as mTagBFPextracellular protein and fusion A cells. U5A IFNAR2-deficient in of STAT2 interaction USP18 and IFNAR2-independent the examine to micropatterning We cell IFNAR2. with used proteins next of both s; ( after photobleaching recovery (FRAP) and revealed similar rate constants fluorescence for STAT2 by analyzed was dynamics Interaction ( IFNAR2 with interacted constitutively with micropatterned IFNAR2 confirmed that both STAT2 and USP18 together USP18 STAT2 and of to Colocalization relevance. respect functional with data coimmunoprecipitation complements nicely cell the within protein target a to binding librium ( HaloTag used was the via membrane plasma the in proteins bait of zation immobili controlled spatially for approach micropatterning cell a purified biochemically between STAT2 ( USP18 and binding direct revealed analysis ( STAT2 and USP18 expressed exogenously between interaction showed Coimmunoprecipitation ( assay two-hybrid yeast targeted a in detected was USP18 STAT2 and of interaction direct STAT2.Likewise, encoding clones independent 11 Weidentified proteins. bait as active (C64A) mutant its site and USP18 full-length human wild-type using by screen two-hybrid yeast a pathway,conducted we signaling IFN the in tion IFNAR2 with interaction its (refs. on relies ISG15- its but of activity independent is deconjugating signaling IFN in USP18 of role The USP RESULTS human in treating disease. of signaling IFN modulation systemic for or the should potential expand regulation local negative-feedback STAT2 in of requirement unrecognized previously this Elucidating USP18 interferes with receptor dimerization and JAK phosphorylation. USP18 and thus mediates its recruitment to IFNAR2. In turn, anchored ated inhibition of JAK–STAT STAT2 signaling. with interacts directly key of STAT2 effector IFN signaling, is for essential the USP18-medi approaches. We protein with biochemical a being found beyond that, protein interaction assays and single-molecule imaging in combination real-time in micropatterning live-cell of use through USP18, by tion Here, we investigated in detail the role of STAT2 in IFNAR desensitiza unique in its selective involvement in type I and type III IFN signaling. cytokines diverse by activated are STAT which proteins, tional cross-talk between these proteins. Among the seven mammalian ment of STAT2 by (ref. USP18 is affected protein micropatterning assays, we have recently observed that recruit s e l c i t r a  coimmunoprecipitation STAT2through and USP18 endogenous of τ STAT2 Supplementary Fig. 1e Supplementary To STAT2the quantify between interaction and USP18 in live cells, live-cell in IFNAR2 with interactions effector quantifying While 1 8 21 of 79

interacts , 3 5 Supplementary Fig. 1a Fig. Supplementary . o dniy rtis ht a rglt UP8 func USP18 regulate may that proteins identify To ). ± 28 s, mean τ = 53 53 =

with Fig. 1 Fig.

± STAT2 28 s (8 cells analyzed). Furthermore, using using Furthermore, analyzed). cells (8 s 28 ), thus suggesting simultaneous interaction interaction simultaneous ), thus suggesting ± c error of fit) and USP18 ( ). Fig. 1 Fig. ). This technique quantifies equi quantifies technique This ). Fig. 1 Fig. b ). Furthermore, a pulldown pulldown a Furthermore, ). Supplementary Fig. 1b Fig. Supplementary 3 d 3 ) yielded a mean interac mean a yielded ) ), thus suggesting a func ), thus suggesting Fig. 1 Fig. τ USP18 in situ in d 3 4 of 103 ; box plot). plot). box ; , STAT2 , is advance online publication online advance and thus thus and Fig. 1 Fig. Fig. 1 ± – 33 d d a 3 ). ). ). ). ). 3 ------

analyses demonstrate the mechanistic requirement for STAT2 in in signaling. STAT2 interferon of for inhibition USP18-mediated requirement mechanistic the demonstrate analyses tion STAT2 role of biological STAT2essential transduc of signal in IFN-responsive reintroduction after only ( observed was ISGs these of 2b Fig. STAT2( of absence the in expression of induction 2 ( U2A We did, however, identify two genes ( in shown genes STAT2 (representative of absence the in treatment IFN by induced not were 23) of (21 tested without or with exogenous of reintroduction Stat2. As the vectors, majority expected, of genes expression Usp18 or control with duced in genes IFN-inducible 23 of expression the negative USP18-dependent regulation of IFN we signaling, examined STATof upstream phosphorylation. occurs which inhibition, USP18-mediated for required STAT2 is that port expressed USP18 on JAK1 phosphorylation. These results further sup but not a control shRNA, the abolished negative of effect exogenously bone-marrow cells ( IFN ( expression Stat2 down knock to (shRNA) RNA hairpin short Stat2 phosphorylation. To confirm this finding, we also selected an effective indicating that STAT2 is critical for USP18-mediated inhibition of JAK1 mouse embryonic fibroblasts (MEFs) derived from from derived (MEFs) fibroblasts embryonic mouse phorylation ( cells in 2fTGH than STAT1 IFN-induced was much in weaker U6A cells phosphorylation Notably, inhibition. USP18-mediated for STAT2 that required ing is phosphorylation in STAT2-deficient U6A cells ( viously of upstream pre as IRF9, that reported IFN signaling USP18 inhibits IFN after missing. phosphorylation were pathway signaling STAT1 decreased clearly expression In USP18 and 2fTGH U2A cells, the of components important STAT1 IFN after was not observed of phosphorylation (U5A), IFNAR2 and JAK1 (U4A), (U1A), TYK2 ( MIP-USP18 or control ( ( U1A cells: lines 2fTGH cell fibrosarcoma U-series human following from the derived used we signaling, IFN I type of desensitization USP18-mediated in STAT2 of role the examine To STAT2 USP18. STAT2 binds that lished directly ( assays phosphorylation in Stat2-transduced in Stat2-transduced phosphorylation in JAK1 phosphorylation affect not did USP18 expressed Exogenously JAK1 phosphorylation. upstream of could be detected STAT1 we examined phosphorylation, signaling. IFN I type on USP18 of effect negative the with USP18, STAT2interacting cally plays role effect a in critical mediating inhibitory strong a had ( USP18 ectopic context this in but duction strongly increased IFN ( STAT1 phosphorylation induced ( mice Fig. 2 Fig. Fig. 2 Fig. STAT2 Supplementary Fig. 2a Fig. Supplementary To further examine the mechanistic requirement for STAT2 in in STAT2 for requirement mechanistic the examine further To To investigate whether the inhibitory effect of STAT2 of USP18 plus effect inhibitory the whether Toinvestigate β 3 9 -induced JAK1 phosphorylation in in phosphorylation JAK1 -induced . Furthermore, both of our biochemical and gene-expression gene-expression and biochemical our of both Furthermore, . Stat2 h

j IRF9 2 is ). Neither control shRNA nor Stat2-specific shRNA affected affected shRNA Stat2-specific nor shRNA control Neither ). −/− ). Importantly, USP18-mediated inhibition of expression expression of inhibition USP18-mediated Importantly, ). Fig. 1 Fig. , lanes 5–8). These results indicate that, in addition to physi addition in that, indicate results These 5–8). , lanes 1

. Interestingly, expression of USP18 did not affect STAT1 affect not did USP18 of expression Interestingly, . required ) 36 − 3 −/−  8 , − 3 e . To further verify the critical role of STAT2, we used used STAT2,we of role critical the verify Tofurther . ). In these cells, ectopic Usp18 did not inhibit IFN inhibit not did Usp18 ectopic cells, these In ). 7 ). Together, these different approaches clearly estab clearly approaches different these Together, ). , 4 ( U4A ), . These cells were stably transduced with the MIP MIP the with transduced stably were cells These .

for Fig. Fig. 2 nature structural & molecular biology molecular & structural nature Fig. 2 Fig.

inhibition k JAK1 , Stat2 i. 2a Fig. b ). ). In contrast, expression of a Stat2 shRNA, g α ). These observations fully support the the support fully observations These ). ), because STAT2 ), because STAT1 supports phos treatment ( treatment − β −/−  -stimulated -stimulated STAT1 phosphorylation, −

– MEFs but clearly diminished JAK1 MEFs but diminished clearly , 5 ( U5A ), of α e Fig. 2 Fig. ). As expected, in cells lacking lacking cells in expected, As ).

treatment ( treatment Irf9 type Stat2 and h

Fig. 2a Fig. I , lanes 1–4). STAT2 trans 1–4). lanes , −

Usp18 Supplementary Fig. 2a Fig. Supplementary IFN  IFNAR2 − Cxcl9 MEFs ( MEFs Stat2 Fig. Fig. 2

Fig. 2b Fig. signaling , − c ) ) that showed weak  ), thus indicating indicating thus ), − primary mouse mouse primary − Supplementary Supplementary −/− Stat2 f Fig. 2  ), ), thus suggest − MEFs trans MEFs , ), and U6A U6A and ), d ,

e by -knockout -knockout TYK2 i ), because ), because ), thereby

USP −/− 1 β 8 ). ). ), ), ------

© 2017 Nature America, Inc., part of Springer Nature. All rights reserved. ( fluorescence recovery of USP18 recruited to STAT2,micropatterned and fit monoexponential of the recovery curve of (representative 8 cells analyzed). analyzed (obtained from two independent experiments) is shown below each group. *** the range interquartile (whiskers). Points, individual cells for which measurements were performed; x, first and 99th percentiles. The number of cells and with mEGFP and HaloTag-mTagBFP-TMD-STAT2. Box plots show median (line), mean (open squares), first and third quartiles (box limits) and 1.5× intensities inside and outside the patterns. As negative controls (blue boxes), U5A cells were transfected with mEGFP-USP18 and HaloTag-mTagBFP-TMD left, quantitative analysis of the recruitment of mEGFP-USP18 to STAT2,micropatterned as determined on the basis of the contrast of the fluorescence normalized (norm.) intensity profiles of both channels within the yellow region of interest depicted in the merged image. A.u., arbitrary units. Bottom whose outline is shown with dashed lines, in the blue channel (TMD-STAT2) and green channel (USP18); scale bars, 10 domain transmembrane (TMD) and mTagBFPextracellular and HaloTag. Top middle, images representative of a transfected cell (out of 36 cells analyzed) Top left, cartoon schematic of experimental setup. U5A cells were transfected with mEGFP-USP18 and with the STAT2 region intracellular fused to a directly associates with USP18. Numbers on the left show molecular weight (kDa). ( plasmids encoding GFP, GFP-USP18, and STAT2-FLAG. Numbers on the left show molecular weight (kDa). ( ( growth control; –histidine, in addition to –leucine, –tryptophan, to select for BD, interaction). fusion; DNA-binding-domain AD, fusion. activation-domain pJ69-4a/pJ69-4 Figure 1 ( domains transactivation C-terminal and dimerization, (SH2) 2 homology Src (LD), linker (DB), DNA-binding (CC), coil coiled- (NTD), N-terminal into divided be STAT2 can Structurally, of STAT2 nature structural & molecular biology molecular & structural nature molecular weight (kDa). Uncropped blot images are shown in (1,000 U/ml) for 24 h were with immunoprecipitated IgG or anti-STAT2 and with immunoblotted anti-STAT2 or anti-USP18. Numbers on the left show e b ) ) Immunoblot showing interaction of endogenous USP18 and STAT2 in 2fTGH, MDA-MB-231, and KT-1 cells. Lysates from cells treated with IFN ) ) Immunoblot (IB) analysis of whole cell lysates (WCL) and (IP) anti-FLAG immunoprecipitates derived from 293T cells 24 h after with cotransfection

IFN

coiled-coil signaling

c b a USP18 USP18 interacts with STAT2. ( IB: FLAG IP: FLAG IP: FLAG USP18 USP18 IB: GF IB: GF WC Vector STAT2-FLAG BD GFP-USP18 α L carrying two-hybrid plasmids were spotted onto selective medium (control (ctrl), –leucine, –tryptophan, for plasmid maintenance and

P P by

130 130 and GF 26 34 43 55 72 95 43 43

26 34 43 55 26 34 43 55 USP STAT2 STAT2 Vector P AD

DNA-binding + + + –

GST 1 8 + + – GST-STAT2 + – Ctrl GST pulldown Input: USP18 IB: GST STAT2 GFP USP18 USP18 (GFP) (GFP) (FLAG a –His ) ) Yeast two-hybrid analysis of the direct interaction between USP18 and STAT2. Overnight cultures of strains (FLAG)

domains ) d

Contrast (inside/outside pattern) and advance online publication online advance Prey Bait 0 1 2 3 4 5 6 7 TMD-STAT2

inhibition TMD-STAT2 Supplementary Data Supplementary Set 1 USP18 n Fig. 3 Fig. =36 Linker TMD STAT2 a

). In ). e TMD-STAT2 130 *** 43 mEGF USP18 mTagBFP n =10 HaloTa assays on a set of STAT2-deletion mutants ( mutants STAT2-deletion of set a on assays coimmunoprecipitation performed we applications, therapeutic tial poten for signaling IFN of inhibition STAT2of USP18-mediated in structure DB appropriate the for required is LD the DB, because the in LD the study, included we this mEGFP Cytosol *** WCL P g 2fTG d ) Immobilization ) of Immobilization STAT2 to probe for direct interaction with USP18. IgG USP18 H P . USP18 < 0.001 by test. two-sample Kolmogorov–Smirnov Bottom right, n TM

Anti-STAT2 =21

D

WCL MDA-MB-231 Relative intensity (a.u.) 2 3 4 5 6 7 8 1 2 0 IgG Relative intensity (a.u.) 0.0 0.2 0.4 0.6 0.8 1.0 USP18 TMD-STAT2 Anti-STAT2 4 Distance c ) ) GST pulldown assay showing that the STAT2 0 6 WCL Merge KT-1 1 8

IgG ( µ 50 4 m) 0 1 0 Anti-STAT2 mechanism the understand To . µ m. m. Top right, graph showing 1 2 Time (s) 100 USP18 STAT2 4 150 Fig. 3 Fig. s e l c i t r a a 200 ). FLAG-tagged FLAG-tagged ). 250 α

 - © 2017 Nature America, Inc., part of Springer Nature. All rights reserved. trol, full length STAT2, or deletion mutantsfeedback ofregulation STAT2 of IFN in signaling,U6A cells.we expressedUSP18 an empty-vector con USP18. with interaction STAT2 its of to domains DB contribute and CC the both that suggest USP18. analyses these a Thus, USP18. with to of coprecipitation loss led STAT2 with of domains DB associate and CC to both of deletion able However, were STAT2 DB-only-deleted or STAT2 ( ( deletion-mutant USP18 either of immunoprecipitation of STAT2 interacted with significantly USP18 ( However,with USP18. the protein with only the CC and DB domains STAT2 of coprecipitate not region did C-terminal the and NTD The domains). transactivation and SH2 the containing 573–861, aa and domains; DB and CC the containing 139–572, aa NTD; of the 1–136 STAT2 Myc-tagged (STAT2-Myc) with or either of three fragments of STAT2 coexpressed (amino acids was (aa) (FLAG-USP18) USP18 s e l c i t r a  STAT2-expressing in STAT1phosphorylation decreased expression for for 30 min before cell lysates were collected and analyzed with the indicated antibodies. Uncropped images are shown in Two days after double drug selection (with puromycin and cells blasticidin), were either left untreated (−) or were treated (+) with mouse IFN (BM) cells infected with pCX4-bsr control (−) or pCX4-bsr-Usp18 (+), in either the presence or absence of control or Stat2 shRNA (ShStat2-3) expression. control (ShCtrl) or one of five shRNA Stat2-targeting (ShStat2) after lentiviruses, 5 d of puromycin selection. ( and analyzed by with immunoblotting the indicated antibodies. ( C-terminally FLAG-tagged Stat2 cDNA. Cells were treated with either mouse IFN IFN indicated antibodies. P-, phospho-. ( of different indicated cells expressing MIP or MIP-USP18, treated with IFN Figure 2

To examine the role of the STAT2-USP18 interaction in negative- in STAT2-USP18 interaction the of role the To examine α i e Usp18 a USP1 130 130 130 USP18 . . ( IF 130 55 43 55 34 90 90 43 IF 55 34 43 90 90 IFN N h N β

, i α 8 STAT2 is required for inhibition USP18-mediated of type I IFN signaling. Numbers on the left show molecular weight (kDa). ( α ) ) Immunoblots from U5A – – – – – – – ( + + + – IFNAR2 + + – 2fTGH – Stat2 + – + – + + –/ –/ – + + ) – MEF – – α USP1 STAT STAT p-STAT1 Fig. 3 Fig. STAT STAT – p-STAT1 USP1 α -tubuli s -FLAG + Stat2 -tubuli Stat2 1 2 8 1 2 8 n d n + − g ) revealed that the CC-only-deleted CC-only-deleted the that revealed )  ) Immunoblot analysis of STAT1 phosphorylation in 2fTGH and U6A cells in the presence or absence of (1,000 U/ml) + − MEFs infected with MIP control (−) or MIP-Usp18 (+) in retroviruses, either the presence or absence of rescue with f USP1 130 IFN 55 34 43 90 90 α USP1 JAK1 p-JAK b USP18 130 -tubuli 55 34 43 90 90 IFN α 8 8 1 – – α U6A i. 3 Fig. n – – U1A + + – ( Fig. Fig. 3 STAT2 130 j + + – 55 + – ( c TYK2 ) or wild-type or or wild-type or ) + – –/ b + – ) ). ). Furthermore, ShCtrl –/ – + ) STAT1 STAT2 USP1 α p-STAT1 -tubulin j ) ) Immunoblot showing validation of Stat2 knockdown. Ba/F3 cells were infected with advance online publication online advance STAT1 STAT2 USP18 α ShStat2-1 p-STAT1 -tubulin 8

ShStat2-2 g IFN 130 - 55 90 90 α

α (1,000 U/ml) for 15 min. The cell lysates were with immunoblotted the c USP18 130

ShStat2-3 55 34 43 90 90 IFN coimmunoprecipitation coimmunoprecipitation assays with conducted cell lysates containing ( USP18 of regions selected of with STAT2 and IFNAR2. We for expression six constructs generated interaction its for are required of USP18 regions which there Wefore assessed STAT2. and IFNAR2 both with interacts report USP18 above, previous our of basis the On The and IFNAR2 in cell these lines ( not affect the levels cell-surface of the IFN-receptor subunits IFNAR1 Importantly, expression of USP18 and different STAT2 constructs did domains of STAT2 for is of crucial the effect USP18 on IFN signaling. suggesting that the interaction of these two proteins via the CC and DB tion, it did not support the inhibitory function of USP18 ( IFN promoted still domains DB and the DB domain ( detected in the presence of STAT2 lacking the CC domain ( ( cells U6A β – –

(500 U/ml) for 15 min ( 2fTGH α

N- ShStat2-4 U6A – – U2A

and + + – + 2fTGH ( IRF9 Fig. 4 Fig.

ShStat2-4 + – C-terminal + U6A –/ α STAT2 – + ) -tubulin Fig. 4 α STAT1 STAT2 p-STAT1 a -tubulin ). Furthermore, the negative effect of USP18 was was USP18 of effect negative the Furthermore, ).

α USP18 STAT1 STAT2 p-STAT1 -tubulin nature structural & molecular biology molecular & structural nature c ). In contrast, although STAT2 lacking both CC

h regions ) ) or 30 min ( Usp18 k 130 130 IFN 43 43 Usp18 h k 130 ) ) Immunoblot of IFN 55 34 43 90 90 β Supplementary Figs. 3a Figs. Supplementary Fig. 4 β

– – – – d USP18 of 130 – 90 90 55 34 43 IFN

+ – USP ShCtrl + – α i α e ), ), before cell lysates were collected Supplementary Data Supplementary Set 1 -induced STAT1 -induced phosphoryla ). – 2 – – U4A Stat2 1 Usp18 1 + – + and the results presented presented results the and 8 + + + + –

bind ( –/ Usp18 JAK1 – –/–

+ – MEFs + – BM – – –/

-FLAG ShStat2 STAT2 Stat2 – + + ) a − –  + – − f bone-marrow ) ) Immunoblots + α USP18 STAT1 STAT2 p-STAT1 -tubulin + β

+ Fig. 4 and (500 U/ml) and and * α STAT1 STAT2 p-STAT1 Fig. 4 Usp18 -tubulin

JAK β USP18 p-JAK1 IFNAR2 -actin d . 4a ), thus 1 b ). In ). ) ) or - -

© 2017 Nature America, Inc., part of Springer Nature. All rights reserved. antibodies. ( antibodies. IFN or with without (+) retrovirus; (−) or MIP-USP18 ( 4 Figure deleted 303–312 aa ( with phosphorylation USP18 of (USP18 mutant a Consequently, STAT2 with ( interacted USP18 of 303–312 interaction ( aa 243–312 of USP18 are two important regions for the STAT2-USP18 of 313–372 aa and USP18 with interacted STAT2,113–242 thereby that suggesting aa and 51–112 aa not but 243–312, aa and 1–242, aa 51–242, aa 1–112, STAT2, aa Myc-tagged and USP18 FLAG-tagged in left the on Numbers chain. light LC, chain; heavy HC, bands. nonspecific indicate Asterisks mutants. deletion STAT2-FLAGindicated the or either and GFP-USP18 encoding plasmids with cotransfection h after 24 cells 293T from derived IP ( mutants. deletion indicated STAT2-Myc the or (WT) full-length the either and FLAG-USP18 encoding ( indicated. is − binding) or (+ USP18 with interact to mutant deletion a given of ability study. The this in used mutants deletion and STAT2 the of structure domain 3 Figure nature structural & molecular biology molecular & structural nature and IFNAR2 after infection of U6A cells with the indicated constructs. constructs. indicated the with cells U6A of infection after IFNAR2 and ( (kDa). weight molecular show left the on Numbers antibodies. indicated the with analyzed ( Myc a NH a ) Immunoblot analyses of U6A cells stably transduced with control (−) or C-terminally Myc-tagged STAT2 (STAT2-Myc), infected with MIP control control STAT2MIP with (STAT2-Myc),Myc-tagged infected C-terminally or (−) control with transduced stably cells U6A of analyses ) Immunoblot 2 - 1 NTD NTD NTD NTD NTD NTD NTD NTD NTD NTD NTD NTD b d USP18 a USP18 ), STAT2), 138 IFN IFN

∆ 130 130 The coiled-coil (CC) and DNA binding (DB) domains of STAT2 are important for USP18-mediated inhibition of type I IFN signaling. signaling. I IFN type of inhibition USP18-mediated for STAT2of domains important are (DB) binding DNA and (CC) coiled-coil The ( USP18. with interaction the STAT2in of domains involved are (DB) DNA-binding and (CC) coiled-coil the Both 55 34 55 90 90 90 CC CC CC CC CC CC CC 55 34 43 90 90 0–1) a ual t sprs IFN suppress to unable was 303–312) α α 230 b Supplementary Fig. 3b – b d , – ∆ – DB DB DB DB DB DB DB c ) Immunoblot analysis of U6A cells stably transduced to express full-length STAT2 STAT2 (STAT2-Myc) full-length mutants STAT2-deletion or express to transduced stably cells U6A of analysis ) Immunoblot – + – DB-Myc ( DB-Myc STAT2 ) Immunoblot analysis of whole cell lysates (WCL) and anti-FLAG IP derived from 293T cells 24 h after cotransfection with plasmids plasmids with cotransfection h after 24 cells 293T from derived IP anti-FLAG and (WCL) lysates cell whole of analysis ) Immunoblot -Myc + + 572 – Supplementary Fig. 3d Fig. Supplementary SH2 SH2 SH2 SH2 SH2 SH2 SH2 SH2 SH2 – – + 667 + + TAD TAD TAD TAD TAD ∆ c – – CC/DB-Myc ), or STAT2or ), – – 851 STAT2 STAT2 + -Myc + -COOH – – Binding to + + USP1 + + + + + + + + + + + + – – – – 8 ∆ ). Further analysis revealed that aa α USP18 STAT2 (Myc) STAT1 p-STAT1 α USP18 STAT1 STAT2 p-STAT1 -tubulin CC/DB-Myc ( CC/DB-Myc -tubulin IB: FLAG IP: FLAG IB: Myc WCL IB: Myc IP: FLAG b STAT2- ). USP1 FLAG- Supplementary Fig. 3c Fig. Supplementary 130 130 Myc 95 43 17 26 34 43 55 72 95 17 26 34 43 55 72 8 e b USP18

α

d WT

Count IFN – (1,000 U/ml) treatment for 15 min. Cell lysates were collected and analyzed with the indicated indicated the with analyzed and collected were lysates Cell min. 15 for treatment U/ml) (1,000 advance online publication online advance ), with or without IFN without or with ), 130 α 20 40 60

55 34 90 90 90 WT 0 + + + + idcd STAT1 -induced α 1–138 10 139–572 0 572–851 + – – STAT2 10 -Myc * * * 1 FLAG-USP18 1–138 573–851 139–572 WT LC 139–572 WT + – HC + IFNAR1 PE- 10 2 A + – ∆ – ). ). STAT2 CC-Myc

10 α STAT2- c (1,000 U/ml) treatment for 15 min. Cell lysates were collected and and collected were lysates Cell min. 15 for treatment U/ml) (1,000 USP1 3 + – FLAG- did did not show such a negative effect ( of STAT1.JAK1 and USP18 of phosphorylation inhibition of IFN addition USP18 mutant noninteracting the or USP18 type 243–312 of USP18 coimmunoprecipitated with the intracellular domain 1–112, aa 1–242, and aa 313–372, but not aa 51–242, aa 113–242, and aa STAT2of loss its with interaction. ment 130 13 + Myc 43 17 26 34 43 55 72 95 17 26 34 43 55 72 95 0 We also established human KT-1 cell lines stably expressing wild- expressing stably lines KT-1 cell human Weestablished also Regarding the USP18-IFNAR2 interaction, peptides comprising aa USP18-IFNAR2Regarding peptides the interaction, 8 10 – + + 4 α USP18 STAT2 (Myc) STAT1 p-STAT1 1–66 + -tubulin

+ + + + + + + + + + + 1–57 Count 7 1–230 10 15 200

2 50 1–138 0 0 0 1–667 10 e ∆ ) Histograms showing the surface expression of IFNAR1 IFNAR1 of expression surface the showing ) Histograms 1–572 0 CC ∆

b CC α ∆ – 1–667 CC , cells expressing wild-type USP18-showed a strong USP18-showed wild-type , expressing cells 10 d c

USP18 ∆ 1–667 DB show molecular weight (kDa). weight molecular show

1 ∆

IFN ∆ CC/DBDB 130 ∆

55 34 90 90 90 CC/DB IFNAR2 F α d ITC-A 10 ) Immunoblot analysis of WCL and anti-FLAG anti-FLAG and WCL of analysis ) Immunoblot 2 IB: FLAG IP: FLAG IB: Myc WCL IB: Myc IP: FLAG LC HC – + – STAT2 -Myc + 10 3 – d STAT2- USP1 FLAG 130 + GFP- 17 26 34 43 55 72 95 55 55 10 Supplementary Supplementary Fig. 3e 8 4 – ∆ – STAT2 DB-Myc + – + + + U6A STAT2 U6A STAT2 U6A STAT2,MIP-USP18 U6A STAT2,MIP U6A MIP-USP18 U6A MIP U6A LgG a 1–667 ) Schematic drawing drawing ) Schematic –

+ + 1–572 +

+ 1–230

+ + 1–138 1–667

α USP18 STAT2 (Myc) STAT1 p-STAT1 ∆ ∆ ∆ CC

-tubulin 1–572 + + CC/DB, MIP-USP18 CC/DB, MI

∆ s e l c i t r a CC

∆ ∆ 1–667 CC 303–312. After After 303–312. + + ∆ DB 1–667 ∆ ∆ CC/DBDB P + + + ∆ ), in agree

∆ CC/DB 303–312 303–312

IB: FLAG IP: FLAG IB: GF WC IB: GF IP: FLAG LC HC ∆ CC- L

P P  - © 2017 Nature America, Inc., part of Springer Nature. All rights reserved. The importance of STAT2 in USP18 recruitment was also verified by of STAT2 verified The importance was also recruitment in USP18 was enhanced up to ten-fold after expression of STAT2 ( STAT2 of interaction expression after USP18-IFNAR2 ten-fold to up the enhanced was cells, U6A STAT2. by STAT2-deficient affected In was IFNAR2 and USP18 between interaction interacts (refs. IFNAR2 with independently acts USP18 that inter STAT2constitutively STAT2. and itself Because IFNAR2 with established results These STAT2 for critical USP18 binding to STAT2.are 303–312) aa and 51–112 (aa regions adjacent the and IFNAR2, and aa 317–371) of USP18 play important roles in the interaction with 36–51 (aa regions C-terminal and WeN- the that conclude therefore aa 303–312 of USP18 are important for the USP18-STAT2 interaction. are critical for the USP18-IFNAR2 interaction and that aa 51–112 and Together, these findings indicate IFN that aa after 36–51 and aa phosphorylation 313–371 of USP18 expression of aa 36–372, but not aa 51–372, of USP18 inhibited STAT1 aa 36–51 of USP18 ( interaction. Further analysis narrowed the first interaction domain to aa 1–51 and aa 313–372 of USP18 are important for the IFNAR2-USP18(ICD) of IFNAR2 ( *** group. each below shown are experiments) independent two (from analyzed cells of Numbers percentiles. 99th and first the x denotes and points, individual as plotted are outliers (whiskers); T, In respectively. TagRFP-or mEGFP cytosolic with transfected were cells HeLa controls, negative As cells. HeLa in (R2375) HaloTag-IFNAR2 truncated C-terminally or HaloTag-IFNAR2 STAT2-TagRFP-T with immobilized to coexpressed mEGFP-USP18 of recruitment of Quantification USP18. recruiting for necessary is ( quantified. was cells U6A in expressed IFNAR2 length full micropatterned to control) (negative mEGFP cytosolic and STAT2of control) binding (positive constitutive comparison, For patterns. the outside and inside intensities fluorescence the of 10 bars, Scale experiments. independent two from cells 17 of representative is image each lines; dashed by shown are +STAT2). outlines TagRFP-T (USP18 Cell STAT2- and mEGFP-USP18 −STAT2) HaloTag-mTagBFP-IFNAR2, (USP18 with or mEGFP-USP18 and HaloTag-mTagBFP-IFNAR2 with transfected cells U6A of images green-channel Right, setup. experimental the of schematics cartoon Left, cells. U6A STAT2-deficient in IFNAR2 micropatterned to ( experiments. 3 independent from s.e.m. and mean shows graph Bar 4). (lane binding maximum the to normalized USP18, total to USP18 IFNAR2-bound of ratio the as shown IFNAR2, to USP18 of binding the of quantification Bottom, (kDa). weight molecular show left the on Numbers construct. STAT2-Mycof expression amounts increasing and FLAG-IFNAR2 USP18, encoding plasmids with cotransfection after 5 Figure s e l c i t r a 

recruits

µ STAT2 recruits USP18 to IFNAR2. ( IFNAR2. to STAT2 USP18 recruits M. ( M. IB: IFNAR2(FLAG) IP: IFNAR2(FLAG) IB: STAT2(Myc) WC IB: STAT2(Myc) IP: IFNAR2(FLAG) IB: USP18 WC IB: USP18 IP: IFNAR2(FLAG) a L L c ) Quantification of the recruitment of USP18 to immobilized IFNAR2 (R2) into micropatterns in U6A cells, on the basis of the contrast contrast the of basis the on cells, U6A in micropatterns into (R2) IFNAR2 immobilized to USP18 of recruitment the of ) Quantification

USP c and and IFNAR2-FLAG Supplementary Supplementary Fig. 4b Supplementary Supplementary Fig. 4c STAT2-My 1 Relative USP18 binding to IFNAR2 8 d USP18 0.2 0.4 0.6 0.8 1.0 1.2 1.4

, box plots show median (line), mean (open squares), first and third quartiles (box limits), and 1.5× the interquartile range range interquartile the 1.5× and limits), (box quartiles third and first squares), (open mean (line), median show plots , box to 0 130 130 130 70 90 34 43 34 43 33

IFNAR2 c α 4 3 2 1 , U6A + + + – 41 ramn ( treatment 1 , + + ( – 4 3 2 STAT 2 ), we further examined whether whether examined further we ), + + 2 –/– 4 + ) IFNAR2 (FLAG) STAT2 (Myc) STAT2 (Myc) USP18 USP18 a ). ). These results suggest that upeetr Fg 4e Fig. Supplementary , P ) Top, immunoblot analysis of whole cell lysates (WCL) and anti-FLAG IP derived from U6A cells 24 h 24 cells U6A from derived IP anti-FLAG and (WCL) lysates cell whole of analysis ) Top, immunoblot d < 0.001 by two-sample Kolmogorov–Smirnov test; NS, not significant. not NS, test; Kolmogorov–Smirnov two-sample by < 0.001 ). ). In line with this result, c Contrast (inside/outside pattern) Prey Bait 0 1 2 3 4 5 6 7 8 9 b STAT2 n =20 R2 advance online publication online advance Fig. 5 Fig. –STAT2 USP18 n STAT2 =17 R2 IFNAR2 a HaloTag USP18 ). ). ). ). *** -

*** +STAT2 USP18 n recruitment recruitment of USP18 to IFNAR2 and is for critical the negative effect established that the interaction of USP18 and STAT2 is responsible for results These STAT2 USP18. for and site interaction minimal the as ( tions muta and deletions further of micropatterning cell by IFNAR2 to ( decreased strongly 5c Fig. was Supplementary 375 position at truncated 418–444 aa (ref.least at include to suggested been has which IFNAR2, of STAT2 presence in the of STAT2-bindingthe deletion site on after system. A comparable loss in USP18 binding to IFNAR2 was observed USP18 to micropatterned IFNAR2 was detectable in this experimental binding of USP18 was weakened, such that no significant of STAT2, In of to recruitmentabsence IFNAR2. USP18 the recruitment effective of role the results These critical of highlight STAT2STAT2. of concentration in the coexpression ectopic after observed was binding USP18 ( IFNAR2 of to bound micropatterned binding USP18 substantial to cient yield suffi STAT2 was of level expression endogenous the cells, HeLa In contrast after complementation with STAT2 was ( observed in increase strong a cells, U6A in detectable was IFNAR2 micro patterned to USP18 of binding no whereas micropatterning: live-cell =17 R2 NS USP18 –STAT 4 1 Supplementary Fig. 5d Fig. Supplementary *** ). The recruitment of STAT2 and USP18 to IFNAR2 C-terminally mEGFP n R2 = Supplementary Fig. 5c Fig. Supplementary 9 2 d d ) The C-terminal STAT2-interacting region of IFNAR2 IFNAR2 of region STAT2-interacting C-terminal ) The

Contrast (inside/outside pattern) Prey Bait 10 nature structural & molecular biology molecular & structural nature 0 2 4 6 8 ). Mapping the STAT2 and USP18 binding binding USP18 and STAT2 the Mapping ). USP18 n =35 R2 U SP18 +STAT2 STAT2 n – =35 R2 f *** ) confirmed aa 418–444 of IFNAR2 IFNAR2 of 418–444 aa confirmed ) ). However, substantially increased increased However,). substantially b ) Recruitment of USP18 and STAT2 and USP18 of ) Recruitment R2 USP18 n =34 ∆ *** *** 375 R2 STAT2 n =34 ∆ NS *** 375 mEGFP n =22 R2 NS TagRFP n =22 R2 i. 5 Fig. Fig. Fig. 5b d and and , c ). ). - - -

© 2017 Nature America, Inc., part of Springer Nature. All rights reserved. labeled with DY647 ( IFN of binding the To quantified we end, this performed. were cells U6A in assays binding ligand formation, ternary-complex interaction is important for the effect of USP18 on ligand binding and affinity binding ligand in loss the explaining thereby complex, IFN–IFNAR1–IFNAR2 ternary the of assembly the with interferes USP18 that revealed have assays subsequent stimulation to cells IFN IFN-primed of responsiveness the decreasing receptor, thus cell-surface their to IFNs I type of affinity binding the regulates negatively USP18 human that reported recently have We IFN STAT2-USP STAT1 activation. IFN–induced I type of upstream is which ( JAK1 phosphorylation I IFN–induced on type of USP18 Student’s *** experiments. 3 independent from s.e.m. and mean STAT2of shows absence Graph the in USP18. and ( IFN without or with retrovirus, (+) MIP-USP18 or (−) STAT2MIP with (STAT2 mutant Myc-tagged infected and Y690F Y690F) C-terminally or (−) control ( experiments. 3 independent from s.e.m. and means STAT2of shows Graph USP18. and absence the in cells U6A of (MFI) intensity fluorescence mean the to normalized are Data constructs. indicated the express to transduced were Cells ( test. Kolmogorov–Smirnov two-sample by *** group. each below shown are experiments) 2 independent (from condition each for analyzed cells of numbers The percentiles. 99th and first the x denotes and points, individual as plotted are outliers (whiskers); range interquartile the 1.5× and limits), (box quartiles third and first squares), (open mean (line), median show plots Box quantified. was mEGFP with transfected cells U6A of surface of localization assay. the in a As control, used also were STAT2the to domains DB and CC or domain CC corresponding ( 10 bars, Scale frames. consecutive 100 from localizations single-molecule of superimpositions are images The left). (bottom both or right), (top STAT2-TagRFP-T USP18-mEGFP expressing left), cells (top U6A of surface the at 6 Figure nature structural & molecular biology molecular & structural nature This ligand with requires both interaction simultaneous IFNAR1 and e b d a IFN ) Relative amounts of FITC-labeled IFN FITC-labeled of amounts ) Relative 130 ) Comparison of the density of of density the of ) Comparison USP18 +STAT2 +STAT2 35 34 43 90 90 α

α receptor (1,000 U/ml) treatment for 15 min. Cell lysates were analyzed with the indicated antibodies. Numbers on the left show molecular weight (kDa). (kDa). weight molecular show left the on Numbers antibodies. indicated the with analyzed were lysates Cell min. 15 for treatment U/ml) (1,000 –

– STAT2-USP18 interaction regulates ternary-complex assembly of the type I IFN receptor. ( receptor. I IFN type the of assembly ternary-complex regulates STAT2-USP18 interaction t -test. ( -test. + 1 – U6A 8 – –

+ interaction f ) Model of USP18-STAT2 regulation of the IFN response. IFN the of USP18-STAT2of ) Model regulation ( + 22 STAT2 , 2 STAT2 Y690F DY647 3 . Quantitative single-molecule dimerization dimerization single-molecule Quantitative . – –/ +USP18 USP1 IFNAR1 + – ) STAT2 8 IFN 2 – 2 . To explore whether the STAT2-USP18 the whether Toexplore .

+ regulates IF α DY647 + N 2 M148A) at the single-molecule level. α USP18 STAT1 STAT2 p-STAT1 IFNAR2 -tubulin IFN α α

c bound to the U6A cell surface, as examined by flow cytometry. Data are normalized to the MFI of U6A cells cells U6A of MFI the to normalized are Data cytometry. flow by examined as surface, cell U6A the to bound assembly 2 M148A bound to cell-surface IFNAR in U6A cells expressing STAT2, USP18, or both proteins. Constructs Constructs STAT2, proteins. both or expressing USP18, cells U6A in IFNAR cell-surface to bound 2 M148A ) Relative amount of FITC-labeled IFN FITC-labeled of amount ) Relative e USP18 Relative IFN binding b Localizations/ m2

0.5 1.0 1.5 µ

0.00 0.01 0.02 0.03 0.04 0.05 0.06 0 advance online publication online advance of

+ – the mEGF n – =18 U6A

type α Fig. 2i Fig. U P 2 M148A M148A 2 ( STAT2 NS

STAT2 Y690F n I =16 SP18 –

*** *** – –/ – k ) ), ), *** + * +STAT2 µ USP18 n =18 m. Images are representative of 13–18 cells analyzed for each condition. condition. each for analyzed cells 13–18 of representative are Images m. NS expressing USP18 ( USP18 expressing cells U6A in detected was receptor cell-surface the to bound M148A of ternary-complex formation at the plasma membrane. plasma at the formation ternary-complex of of both STAT2 and USP18 is required for inhibition USP18-mediated presence the that confirm results These assembly. IFNAR in inhibiting interaction STAT2-USP18 the of relevance the confirming thus formation, of ternary-complex regulation negative USP18-mediated For both CC-DB and CC fragments of STAT2, we observed substantial binding. on ligand effect no had STAT2, USP18, without transfected effective desensitization by USP18. Complementation with transiently of number the decreased STAT2 of significantly coexpression by plementation of STAT2. absence in the com by USP18 By contrast, regulation tive cells U5A IFNAR2-deficient or cells HeLa in performed experiments previous formation ternary-complex probes indirectly thus and receptor cell-surface the to binding for IFNAR2 ** α STAT *** NS * bound to the U6A cell surface, as examined by flow cytometry. flow by examined as surface, cell U6A the to bound USP18+ f n =18 *** 2 IFNAR CC/DB

2 d 2 ) Immunoblot analysis of U6A cells stably transduced with with transduced stably cells U6A of analysis ) Immunoblot *** DY647 , no substantial difference in the amount of of amount the in difference substantial no , TYK2 STAT2 USP18+ n 1 =15 P IFN CC IFN < 0.001; ** < 0.001; JAK1 a Fig. 6a Fig. STAT n ) Binding of of ) Binding IFNAR α =16 2 M148A on the cell surface, as expected for for expected as surface, cell the on M148A 2

2 STAT2 P 2 < 0.001., NS, not significant by two-tailed two-tailed by significant not NS, < 0.001., , b P ). This result suggests impaired nega impaired suggests result This ). c <0.01; * <0.01;

Relative IFN binding USP18 DY647 0.2 0.4 0.6 0.8 1.0 1.2 1.4 0 22 IFN , DY647 4 3 P . In contrast to findings from from findings to contrast In . + – <0.05; NS, not significant significant not NS, <0.05; α – 2 M148A to the IFNAR IFNAR the to 2 M148A IFN NS α U6A 2 M148A on the the on 2 M148A + – STAT2 ( s e l c i t r a -Myc STAT2 *** –/ DY647 – ) ∆ CC/DB-Myc + – USP18 STAT2 IFN

α  2 - - © 2017 Nature America, Inc., part of Springer Nature. All rights reserved. phosphorylation of STAT1 in STAT2 Y690F-expressing U6A cells cells U6A Y690F-expressing STAT2 in STAT1 of phosphorylation ( tion the STAT2-USP18Because was not by interaction affected this muta IFN enhance not did cells U6A in mutant Y690F STAT2 the of expression Accordingly, STAT1phosphorylation STAT2-mediated for also but regulation ISG and formation ISGF3 for only not critical STAT2 is in Y690 of Phosphorylation binding. ligand-receptor IFN I type for important is USP18 STAT2 of and interaction that notion the supporting thus STAT2 STAT2 not but full-length of presence the ( ability domains (STAT2 DB and CC the both STAT2lacking STAT2, and USP18, expressed we ectopically In cells, U6A interaction. IFN-receptor the for testing Fig. 6c similar biological activity to that of nonlabeled IFN deficient U5A cells ( but not did cells to bind to 2fTGH IFNAR2- binding tion-dependent IFN FITC-labeled cytometry. flow by IFNAR IFN (FITC)-labeled isothiocyanate ity of fluorescein ** experiments. IFN with * experiments. 3 independent from s.e.m. and mean as shown are Data (right). quantified was experiments p-STAT1of STAT1 ratio total The to 3 independent from IFN treatment, peptide after TAThours Five peptide. ** lines. cell stable generated independently with performed experiments, 3 independent from s.e.m. and mean are Data cytometry. flow by analyzed then IFN with treated were MIP-STAT2(3A) or 3A (−) CC/DB control MIP either with transduced ( experiments. 2 independent from s.d. and mean are Data qRT–PCR. by analyzed was GBP1 of expression and h, 12 for U/ml) (1,000 ( (kDa). weight molecular show left the on Numbers system. Odyssey a LI-COR with STAT1 quantified was IFN with treatment After (3A). K415A-Myc STAT2R409A mutant L227A STAT2the or CC/DB either and CC/DB-Myc STAT1-FLAG, FLAG-USP18 encoding plasmids with 7 Figure s e l c i t r a  IFN with stimulated THP-1 P Furthermore, we analyzed the effective cell-surface binding affin binding cell-surface effective the analyzed we Furthermore, -Myc STAT2 CC/DB FLAG-USP18 STAT1-FLAG d a KT-1 < 0.01 by two-tailed Student’s Student’s two-tailed by < 0.01 upeetr Fg 6d Fig. Supplementary ). ). These results demonstrate that FITC-labeled IFN

Fig. Fig. α 100 100 Inhibiting negative-feedback regulation of USP18 by targeting its interaction with STAT2. with ( interaction its targeting by USP18 of regulation negative-feedback Inhibiting (1,000 U/ml) for 48 h, and annexin V–positive cells were then analyzed by flow cytometry. Data are mean and s.e.m. from 3 independent 3 independent from s.e.m. and mean are Data cytometry. flow by analyzed then were cells V–positive annexin and h, 48 for U/ml) (1,000 40 55 0 3 P ). USP18 decreased IFN decreased USP18 ). 15 P < 0.05 by two-tailed Student’s Student’s two-tailed by < 0.05 + + – – – – TAT

< 0.01 by two-tailed Student’s Student’s two-tailed by < 0.01 0.01 ∆ α 30 CC/DB) and CC/DB) USP18-binding lacking consequently (1,000 U/ml) for 15 min, cell lysates were collected and analyzed with the indicated antibodies. The ratio of p-STAT1of ratio total The to antibodies. indicated the with analyzed and collected were lysates cell min, 15 for U/ml) (1,000 –

Supplementary Supplementary Fig. 6a 6.54 α α 60 ( + + -induced STAT1 phosphorylation ( phosphorylation STAT1 -induced 2.91 IFN Fig. 6 Fig. α 3 + + + 1 0 5.49 USP18 302-313 d ), USP18 expression still decreased decreased still expression USP18 ), + + ). Importantly, expression of USP18 USP18 of expression Importantly, ). A 3 5 4.53 t TAT test. ( test. Myc STAT1 USP18 p-STAT1 /STAT1 p-STAT1 6 0 α binding to U6A cells only in in only cells U6A to binding d 0 ) THP-1 and KT-1 cells were treated with transactivator of transcription protein (TAT) or USP18 aa 302–313 (TAT) 302–313 aa protein USP18 or transcription of transactivator with treated KT-1 were and cells ) THP-1 (min, IFN ). ). FITC-labeled IFN t STAT1 STAT1 p-STAT1 p-STAT1 test. ( test. t test. -Myc STAT2 CC/DB FLAG-USP18 α α showed concentra showed α) (1,000 U/ml) was added for the indicated times, and cells were analyzed by immunoblotting. immunoblotting. by analyzed were cells and times, indicated the for added was U/ml) (1,000 ∆ α e b CC/DB ( CC/DB ( ) TAT- or USP18 aa 302–313 TAT-peptide-treated THP-1 and KT-1 cells were incubated ) TAT- incubated KT-1 were and TAT-peptide-treated cells THP-1 302–313 aa USP18 or α Supplementary Supplementary 0 1 2 3 4 5 6 7 8 Relative expression of GBP1 to cell-surface to cell-surface 10 15 20 0 5 α 1 0 is suitable advance online publication online advance – – – Fig. 6 Fig. Fig. 6 Fig. THP-1 3 5 – α had d c + + 4 – IFN 6 0 * 4 ). ). ), ), IFN - - - .

α + + α 0 treatment(min) * of STAT2 is essential for activation of ISG transcription of USP18, thus resulting STAT1 in increased phosphorylation. ( and the STAT2 CC/DB fragment were in coexpressed HEK 293T cells STAT1,To end, USP18. this of USP18, presence the in responses ing signal IFN maintain consequently and interaction USP18-STAT2 a comprisingpeptide the STAT2 CC and DB domains could block the gated by the expression of USP18. Therefore,abro effectively are responses we these but next cells, examinedmalignant against and whether infection pathogen during responses immune crucial IFNsmodulate IFN-dependent Disruption dissociation JAK1 in resulting probably and of ( IFNAR2 domain membrane-proximal the with of USP18 interaction an additional STAT2 allowing thus the DB domains, and CC with interaction its via IFNAR2 to recruited is USP18 that gest sug data Our and signaling. assembly I receptor IFN on type USP18 of effect inhibitory the STAT2 mediates and USP18 between action ( cells U6A the of level IFN decreased also Fig. 7 3A The The CC domain of STAT2 and IRF9, with the DB domain interacts 1 2 3 4 5 6 7 8 0 a c

). ). As expected, STAT2 CC/DB counteracted the negative effect Annexin V positive (%) 1 0 10 20 30 40 50 0 Fig. 6 Fig. α

of (1,000 U/ml) for 48 h, and annexin V–positive cells were were cells V–positive annexin and h, 48 for U/ml) (1,000 3 5 – – * KT-1

the

3A response e 6 0 * ). Together, these results establish that the inter the that establish results these Together, ).

STAT2-USP a nature structural & molecular biology molecular & structural nature IFN ** ) Immunoblot analysis of 293T cells cotransfected cotransfected cells 293T of analysis ) Immunoblot 0 * 3A α b ) Cells described in in described ) Cells TAT TAT 302-313 USP18 α USP18 302-313TAT USP18 302-313TAT binding to binding STAT2 Y690F-expressing 1 e 8

interaction

Annexin V positive (%) Annexin V positive (%) TAT 10 20 30 40 50 TAT 10 20 30 40 50 0 2 a 0 1 were treated with IFN with treated were . + –

enhances + – THP-1 + – – c ) THP-1 cells cells ) THP-1 + – 45 KT-1 + + – IFN , 4 ** 6 . . Although α + –

IFN ** Fig. 6 Fig. α + – α f

- - - - )

© 2017 Nature America, Inc., part of Springer Nature. All rights reserved. STAT2 in type I IFN signaling has been further corroborated by the the by corroborated further been has signaling IFN I STAT2type in STAT1regulates phosphorylation of ISGs for induction the responsible complex ISGF3 the of component integral an is only not that signaling IFN STAT2-USP18 the interaction. by negative-feedback inhibition signal of mechanism specific the stages later at response prolonged stage a early an at signaling IFN I type enhanced to leads of USP18 inhibition In contrast, signaling. IFN II type but also is and on later treatment IFN undetectable I type after phase early the in expressed is it bition the of IFN only enhances because response, transiently SOCS1 of STAT1 translocation nuclear by to binding JAKs and phosphorylation tyrosine inhibit IFN SOCS3 the and SOCS1 prolongs response. slightly only CID755673 inhibitor PKD the but (ref. IFNAR1 via feedback negative exerts PKD2 response: IFN the enhance to inhibitors by targeted been have regulators negative role role of negative regulators in I type is IFN signaling emerging critical A contexts. disease of variety manipulate a in responses therapeutically immunological to and understanding improve to tive be impera will network this governing determinants lar and cellular network a signaling tuned finely regulatory responses immune adaptive and innate of processes different of variety a in involved are IFNs TypeI DISCUSSION responses. IFN I type enhancing for target drug useful a be This finding suggests that the STAT2-USP18 interaction interface may USP18-mediated inhibition of type I IFN signaling can be suppressed. USP18-STAT2 the interaction, with by interfering that, demonstrate ( peptide apoptosis in THP-1 and KT-1 cells treated with the USP18 aa 302–313 GBP-1 enhanced we and results, expression these increased observed ( prolonged and enhanced was control, the with compared peptide, this with treated cells KT-1 and THP-1 the STAT2 CC/DB domains. STAT1IFN-induced in phosphorylation as effect have a similar might 302–313 aa USP18 comprising peptide STAT2 ( with and ( 3A STAT2CC/DB of addition after enhanced significantly was effect this and THP-1, line cell myeloid human the in apoptosis cer lines cell IFN Both of transcription on such as ( USP18 and GBP1 ISGs, IFIT1 of effect the blocked partially CC/DB, ( phosphorylation STAT1 on effect inhibitory USP18 ability the the disrupt retained to 3A CC/DB STAT2 However, IRF9. to bind ability the to lack to and cytosolic primarily be to expected therefore translocation nuclear in important be to 7a Fig. ( IRF9 STAT2with of CC/DB interaction decreased substantially mutation point L227A single The substitutions. K415A and R409A, L227A, bearing STAT2 3A) CC/DB (designated mutant downstream biological functions, we generated a STAT2 CC/DB triple ISRE promoter regions after nuclear translocation. To investigate these to binding the in and complex ISGF3 the of STAT2 formation wild-type the in with compete also may it interaction, negative-feedback of expression STAT2 the STAT2-USP18disrupts successfully CC/DB nature structural & molecular biology molecular & structural nature Fig. 7 Fig. STAT2 is well known as a unique effector of type I and type III III type and I type of effector unique a as known well is STAT2 for interaction USP18 region the critical the we identified Because Supplementary Fig. 7c Fig. Supplementary a ). Furthermore, residues R409 and K415 have been reported reported been have K415 and R409 residues Furthermore, ). , right lane). In addition, STAT2 CC/DB 3A, but not STAT2 not but 3A, STAT2 CC/DB addition, In lane). right , Fig. 7 Fig. α and IFN 4 8 Supplementary Fig. 3c Fig. Supplementary . . Here, we found that IFN e and and β are known to promote can apoptosis in several Supplementary Fig. 7d Fig. Supplementary 5 3 . Additionally, SOCS1 affects not only type I type only not affects SOCS1 Additionally, . ). Fig. 7 Fig. 38 49 , 5 , 5 7 b ), we also examined whether a whether examined also we ), 0 . The biological importance of importance biological The . 27 and , which are coordinated by by coordinated are which , α Fig. 7 Fig. , 5 or IFN 4 4 . Therefore, we explored explored we Therefore, . 7 1 Supplementary Fig. 7b Fig. Supplementary . STAT2 CC/DB 3A was was 3A CC/DB STAT2 . . . Unraveling the molecu ). Together, our results results Together,our ). 55 d

). In agreement with with agreement In ). , β 5 6 advance online publication online advance treatment induced induced treatment but also positively but positively also 5 2 2 Supplementary Supplementary . . However, inhi 1 and produces produces and 1 5 Fig. 7 Fig. ; ; these 5 1 ), ), ). ). c - - - -

ISGF3 complex. We assume that recruitment of USP18 to IFNAR2 IFNAR2 to USP18 of recruitment that We assume complex. ISGF3 the of activation the and rate turnover STAT-phosphorylation the by decreasing process STATthe regulate negatively phosphorylation also may USP18 IFNAR2, and STAT2 between interaction the ing (ref. USP18 by strengthened is tion interac STAT2-IFNAR2 the that for observation site previous a with line binding in synergistic, constitutive is IFNAR2 to USP18 STAT2and of Binding STAT2. membrane-distal its via to USP18 IFNAR2 recruiting adaptor an as acts mechanism STAT2 that unknown demonstrated an IFN–IFNAR1–IFNAR2 through the complex, to IFNAR1 ternary of recruitment the with receptor the by USP18. feedback STAT2 by induced levels negative may enhance IFN signaling further increased the that USP18-mediated suggest moreover and in signaling IFN STAT2of inhibition of role key the establish observations as well as JAK1 phosphorylation only when STAT2 was present. dimerization These receptor and binding IFN decreased USP18 signaling. IFN on effect inhibitory its STAT2 exerting for requires USP18 that evidence first the knowledge, our to is, what provides study present infection to viral and are compromised vulnerable immune become which mice, and humans of STAT2-deficient study and has no inhibitory effect on type III IFN signaling in U6A cells cells U6A in signaling IFN III type on effect inhibitory no has and show our laboratory that USP18 binds III type IFN receptor IL-28RA type III IFN signaling can be Indeed, expected. preliminary data from STAT2 and USP18 by in regulation negative of mechanism similar a type III IFN signaling currently are which modulators, PPI emerging small-molecule of USP18 by use feedback by negative manipulate to strategies novel Thus, available. become they when proteins purified using analysis tural struc a including function, USP18 on effect USP18 inhibitory and 302–313 aa CC/DB STAT2 the unravel to required be will studies involved or that there is room for improving Further inhibitors. these strong, it was not complete, thus indicating either that other factors are was Notably,effect responses. inhibitory this although IFN-triggered enhanced significantly peptides Both interface. STAT2interaction results revealed that our the USP18 Notably, 302–313 peptide disrupted the USP18- phosphorylation. STAT1 increased consequently and of STAT2the USP18 on function the effect had an CC/DB inhibitory only containing that a construct we demonstrated Indeed, functions. STAT2 synergy, the linking binding and moreover tightly and USP18 explaining thereby IFNAR2, for with STAT2 critical interaction also are domains and STATInterestingly, these binding phosphorylation. I IFN of type on basis the as determined I signaling, IFN of type tion regula negative-feedback and for USP18 with USP18-mediated tion ( region membrane-proximal the in directly and region membrane-distal the STAT2in via IFNAR2 with interacts simultaneously USP18 Together,that suggest our data IFNAR2. with interact directly of USP18 regions C-terminal and N- results previous with ment with the acts N- as regions of well In as USP18. the C-terminal agree (refs. USP18 of functions inhibitory main the are probably roles two these membrane; plasma the at activation signal and formation ternary-complex effectively decreasing thus binding, JAK1 with competes interaction this that shown previously Wehave IFNAR2. of site membrane-proximal a with USP18 of interaction weak otherwise the STAT2 promotes via To fulfill its inhibitory function, USP18 must be recruited to to recruited be must USP18 function, inhibitory its fulfill To Importantly, USP18 has a negative role not only in type I but also in the CC and DB Both of domains STAT2 for the interac are critical

5 9 , may be possible. be may , 2 1 . Previously, we have reported that USP18 interferes interferes USP18 that reported have we Previously, . 6 0 , , and this role also involves STAT2. Therefore, 21– 2 1 , our experiments confirmed that the the that confirmed experiments our , 2 3 ). Here, we found that STAT2 that inter found we Here, ). Fig. 6 Fig. 3 3 f ). Hence, through stabiliz through Hence, ). ). s e l c i t r a 39 , 5 8 . . However, the 2 2 . Here, we we Here, .  ------

© 2017 Nature America, Inc., part of Springer Nature. All rights reserved. 14. 13. 12. 11. 10. 9. 8. 7. 6. 5. 4. 3. 2. 1. reprints/index.ht at online available is information permissions and Reprints The authors declare no competing interests.financial the manuscript. the project, experiments, designed analyzed data, experimental and wrote performed experiments or provided information;critical J.P. and D.-E.Z. conceived the manuscript; C.B., Y.Z., S.M., J.-B.F., S.W., J.J.H., Z.L., M.Y., S.P., and F.C. K.A., S.L., and S.A.S. designed, performed, and analyzed experiments, and wrote to D.-E.Z. and SFB 944 from the DFG to J.P. and J.J.H. microscopy. This study was supported by NIH andR01HL091549 R01CA177305 G. Hikade for technical support, and R. Kurre for advice on fluorescence and anti–human IFNAR1 antibody, the staff of Hybrigenics for their contribution, DNA construct, D. Baker (Biogen Idec) for supplying recombinant human IFN vectors, S. Kotenko (Rutgers New Jersey Medical forSchool) the pcDEF-hIFNAR2 mTag-BFP construct, T. Akagi (KAN Research Institute) for providing pCX4-series USP18 constructs, V. Verkhusha Einstein (Albert College of Medicine) for the for WEHI-3B cells, S. Urbe (University of forLiverpool) GFP-fusion STAT2 and School of Medicine) for KT-1 cells, R. Xiang (The Scripps Research Institute) (Cleveland Clinic) for sharing cell lines, U-series S. Fujita (Ehime University MEFs, D. Cheresh (Moores UCSD Cancer Center) for MDA-MB-231, G. Stark We thank A. Garcia-Sastre (Icahn School of Medicine at Mount Sinai) for version of the pape Note: Any Supplementary Information and Source Data files are available in the pape the the in available are references, and codes accession statements of including Methods, and data availability any associated M settings. therapeutic in responses IFN III type and I type diminish or enhance to ability the yield fore for the USP18-STAT2 modulators controlling may there interaction of Design expression. gene ISGF3-based of control efficient warrant of STAT2linkage functional the tight tion, to and has USP18 evolved in presented studies peptide tional func current our Although data). unpublished D.-E.Z., and (K.-I.A. s e l c i t r a 1 C AU A 0 ck O

ethods

T MPE a BxlDzie AH, ai MR & tr, .. ope mdlto o cell of modulation Complex G.R. Stark, & M.R. Rani, A.H., Boxel-Dezaire, van signalling. type-II-interferon-mediated and type-I- of Mechanisms L.C. Platanias, STAT1-of Formation G.R. Stark, & Jr. J.E. Darnell, S., Qureshi, S., Leung, X., Li, Uzé, G., Lutfalla, G. & Mogensen, K.E. Alpha and beta interferons and their receptor disorders. autoimmune and Interferons O. Meyer, syndrome. Aicardi-Goutières Y.J. Crow, C. hepatitis chronic in interferon alpha of effects Side G. Dusheiko, update. clinical a Interferon-alpha: P.T. Rieger, A. Sistigu, E.C. Borden, interferons I Type G. Kroemer, & M.J. Smyth, O., Kepp, L., Galluzzi, L., Zitvogel, responses. interferon I type of Regulation L.T. Donlin, & L.B. Ivashkiv, a genes: Interferon-stimulated C.M. Rice, & M.D. Chevillotte, W.M., Schneider, responses. interferon I type tuning Fine B.R. Williams, & P.J. Hertzog, (2006). Iinterferons. type to in response signaling type-specific Immunol. Rev. Nat. interferon-alpha. by transcription gene IRF-1 of activation the in role their STAT2and heterodimers relations. and friends their and (2009). (2013). (1997). S112–S121 (Suppl.1), (1995). chemotherapy. of efficacy the to biomedicine. immunity. anticancer in Immunol. defenses. host of web complex Rev. Factor Growth H no O T wled R R C r I NG . ONT

14 et al. et FI m g , 36–49 (2014). 36–49 , Nat. Rev. Drug Discov. Drug Rev. Nat. t al. et N me r l RIBU . . Cancer cell-autonomous contribution of type I interferon signaling interferon I type of contribution cell-autonomous Cancer A J. Biol. Chem. Biol. J. N nt

24 nefrn a ae 0 ps, urn ad uue mat on impact future and current past, 50: age at Interferons CIAL CIAL I 5 T , 375–386 (2005). 375–386 , s , 217–225 (2013). 217–225 , I ON Nat. Rev. Immunol. Rev. Nat. NT S ERES

Annu. Rev. Immunol. Rev. Annu. J. Interferon Cytokine Res. Cytokine Interferon J. 271 Nat. Med. Nat.

, 5790–5794 (1996). 5790–5794 , 6 T , 975–990 (2007). 975–990 , S Figure Figure ad. ln Neurol. Clin. Handb.

20

15 , 1301–1309 (2014). 1301–1309 , , 405–414 (2015). 405–414 , Joint Bone Spine Bone Joint 7 still lack lack still acr Pract. Cancer

32 , 513–545 (2014). 513–545 , Immunity http://www.nature.c

15 online , 3–26 (1995). 3–26 ,

113 in vivo in

Hepatology 1629–1635 , 25 76 version of version 3 advance online publication online advance 356–365 , 361–372 , , 464–473 , Stat2

valida a. Rev. Nat. Cytokine online − β om/ /−

26

- - -

32. 27. 26. 25. 24. 23. 22. 21. 20. 19. 18. 17. 16. 15. 45. 44. 43. 42. 41. 40. 39. 38. 37. 36. 35. 34. 33. 31. 30. 29. 28.

i, H.Y. Yim, Kim, K.I. Kim, K.J. Ritchie, M.E. Meuwissen, Zhang, X. V. François-Newton, Wilmes,S. Malakhova, O.A. UBP43 D.E. Zhang, & K.J. Ritchie, K.I., Kim, O.A., Malakhova, M.P.,Malakhov, H. Schwer, L.Q. Liu, I type in plasticity functional for basis molecular The J. Piehler, & G. Schreiber, Marchetti, M. Porritt, R.A. & Hertzog, P.J. Dynamic control of type I IFN signalling by an integrated Martinez-Moczygemba, M., Gutch, M.J., French, D.L. & Reich, N.C. Distinct STATDistinct N.C. Reich, & D.L. French, M.J., Gutch, M., Martinez-Moczygemba, T. Improta, aspects functional and structural New G. Schreiber, & L.C. Roisman, J., Piehler, Li, X., Leung, S., Kerr, I.M. & Stark, G.R. Functional subdomains of STAT2 required V.P.Nguyen, domain linker The Jr. J.E. Darnell, & J.J. Zhang, R.L., Haspel, Z., Wen, E., Yang, S. Hambleton, STAT2of Role G.R. Stark, & Jr. J.E. Darnell, I.M., Kerr, S.A., Qureshi, S., Leung, M.R. Rani, selectable a of Use G.R. Stark, & I.M. Kerr, non- M., Shearer, J., and John, S., Pellegrini, enzymatic dissecting uncut: ISG15 K.P. Knobeloch, & L. Ketscher, impact. biological and control transcriptional Stats: Jr. J.E. Darnell, & D.E. Levy, Löchte, S., Waichman, S., Beutel, O., You, C. & Piehler, J. Live cell micropatterning L. Ketscher, T. Goldmann, Honke, N. N. Honke, interferon beta (IFN-beta) compared with IFN-alpha. with compared (IFN-beta) beta interferon Biol. Cell. Mol. pathway.signaling the in mutations obtain to interferon alpha by regulated marker vivo. in USP18 of functions enzymatic Biol. Cell Mol. Rev. Nat. 207 membrane. plasma the at complexes signaling of dynamics the reveals mice. (2016). Usp18-knockout in osteoclastogenesis (2015). 1577–1582 resistance. viral and conjugation ISG15 enhances brain. mouse the of (2013). e1003650 175 Salmonella typhimurium infection. viral syndrome. (2016). pseudo-TORCH severe to leading auto-inflammation. and interferon One inactivates PLoS specifically and interferons III type and I type signaling. interferon I type of activity. isopeptidase ISG15 its of (2002). 9976–9981 proteins. conjugated from ISG15 removes specifically (USP18) (Usp18). UBP43 murine cell of homologue a protease, hematopoietic in functions mice, differentiation. AML1-ETO-expressing protein fusion signaling. interferon receptors. IFN of endocytosis dependent (IFNs) is differentially controlled through lipid microdomain association and clathrin- regulators. negative of network (1997). interferon- ISGF3. the factor of transcription subunit alpha-stimulated p48 the with STAT2 of interaction promotes structure Stat91 of independently phosphorylated protein. is protein Stat113 but protein, Stat91 interface. binding the (2000). of analysis mutational comprehensive by revealed interaction interferon-receptor I type the of signaling. Biol. for and receptor interferon alpha the with preassociation for signaling. interferon-alpha for required (1999). 5106–5112 transcription. interferon-driven gamma for required is Stat1 of USA Sci. Acad. Natl. Proc. pathway. signaling interferon (1995). alpha the in (1996). 22884 diabetes. autoimmune in tolerance immunological of break to virus. cytopathic a of control (2011). the for essential is , 847–854 (2005). 847–854 , , 407–418 (2014). 407–418 ,

17 , 2048–2056 (1997). 2048–2056 , Proc. Natl. Acad. Sci. USA Sci. Acad. Natl. Proc. et al. et et al.

et al. et et al. 6 t al. et et al. et et al. et et al. et , e22200 (2011). e22200 , t al. et t al. et et al. et et al. et t al. et et al. t al. et Human intracellular ISG15 prevents interferon- A novel ubiquitin-specific protease, UBP43, cloned from leukemia from cloned UBP43, protease, ubiquitin-specific novel A et al. et

Nat. Med. Nat. Enhanced antibacterial potential in UBP43-deficient mice against mice UBP43-deficient in potential antibacterial Enhanced Usp18 driven enforced viral replication in dendritic cells contributes Mol. Cell. Biol. Cell. Mol. 9 Receptor dimerization dynamics as a regulatory valve for plasticity for valve regulatory a as dynamics dimerization Receptor et al. Characterization of beta-R1, a gene that is selectively induced by induced selectively is that gene a beta-R1, of Characterization Cloning and characterization of a novel human ubiquitin-specific human novel a of characterization and Cloning lvtd epne o ye IN nacs RANKL-mediated enhances IFN I type to response Elevated , 4605–4612 (1989). 4605–4612 , et al. et rncito fco IG- frain eurs phosphorylated requires formation ISGF-3 factor Transcription nocd ia rpiain ciae aatv imnt and immunity adaptive activates replication viral Enforced Role of ISG15 protease UBP43 (USP18) in innate immunity to immunity innate in (USP18) UBP43 protease ISG15 of Role Stat2 binding to the interferon-alpha receptor 2 subunit is not is subunit 2 receptor interferon-alpha the to binding Stat2 Stat-mediated signaling induced by type I and type II interferons eetv iatvto o UP8 sppiae activity isopeptidase USP18 of inactivation Selective S1 lc i mcola ass etutv interferonopathy destructive causes microglia in lack USP18

STAT2 deficiency and susceptibility to viral illness in humans. in illness STAT2 viral to susceptibility and deficiency EMBO J. EMBO TrendsImmunol. t al. et UBP43 is a novel regulator of interferon signaling independent nature structural & molecular biology molecular & structural nature Human USP18 deficiency underlies type 1 interferonopathy 1 type underlies deficiency USP18 Human infection by up-regulating type I IFN signaling. Nature

3 S1-ae ngtv febc cnrl s nue by induced is control feedback negative USP18-based 10 , 651–662 (2002). 651–662 ,

110 , 1374–1378 (2004). 1374–1378 ,

J. Cell Biol. Cell J. 34

19 517 TrendsImmunol. , 3053–3058 (2013). 3053–3058 , , 1612–1629 (2015). 1612–1629 , , 3029–3038 (1999). 3029–3038 , EMBO J. EMBO , 89–93 (2015). 89–93 ,

91

36 , 4776–4780 (1994). 4776–4780 , J. Biol. Chem. Biol. J. Cytokine . il Chem. Biol. J. , 139–149 (2015). 139–149 , Mol. Biol. Cell Biol. Mol.

209

25 . il Chem. Biol. J. o. el Biol. Cell. Mol. , 579–593 (2015). 579–593 , , 2358–2367 (2006). 2358–2367 ,

. x. Med. Exp. J.

. Immunol. J. 76 36 Proc. Natl. Acad. Sci. USA Sci. Acad. Natl. Proc. , 569–571 (2015). 569–571 , Genomics , 150–160 (2015). 150–160 , J. Biol. Chem. Biol. J.

a. Immunol. Nat. 277

17

, 9713–9721 (2002). 9713–9721 , , 2896–2909 (2006). 2896–2909 , 275

α

272

65 / J. Biol. Chem. Biol. J. Mol. Cell. Biol. Cell. Mol. β

196 213 over-amplification 40425–40433 , , 44–52 (2000). 44–52 , 15 LS Pathog. PLoS 20070–20076 , 3887–3895 ,

1312–1317 , 1163–1174 , 271

α J. Immunol. J. Cell Biol. Cell J. 13 response. o. Cell. Mol. , 22878– , 51–57 , n vivo in

112 277

19

9 , , , ,

© 2017 Nature America, Inc., part of Springer Nature. All rights reserved. 53. 52. 51. 50. 49. 48. 47. 46. nature structural & molecular biology molecular & structural nature

Sarasin-Filipowicz, M. Sarasin-Filipowicz, Yoshimura, A., Naka, T. & Kubo, M. SOCS proteins, cytokine signalling and immune protein of S.Y.phosphorylation TyrosineFuchs, D.P.& Baker, J., Qian, H., Zheng, H.M. Chen, functions Immunomodulatory E. Raz, & M. David, J., Lee, J.M., González-Navajas, Chawla-Sarkar, M., Leaman, D.W. & Borden, E.C. Preferential induction of apoptosis is element structural Arginine/lysine-rich I. Julkunen, & L. Kinnunen, K., Melen, DNA-binding conserved the of relevance Functional E.N. Fish, & M.M. Brierley, Cell. Biol. Cell. USP18/UBP43. of induction through liver mouse the in JAK-STAT signaling regulation. Chem. Biol. J. receptor. interferon Type1 the of elimination ligand-inducible mediates D2 kinase transformation. cellular of prevention interferons. I type of lines. cell melanoma in induction TRAIL/Apo2L with correlation IFN-alpha2: with compared (IFN)-beta interferon by STATs. of import (2001). 16447–16455 nuclear interferon-induced in involved STAT2.of domain

29 Nat. Rev. Immunol. Rev. Nat. t al. et , 4841–4851 (2009). 4841–4851 ,

286 rtcl oe o cntttv tp I nefrn inln i the in signaling interferon I type constitutive for role Critical J. Biol. Chem. Biol. J. , 35733–35741 (2011). 35733–35741 , Nat. Rev. Immunol. Rev. Nat. et al. et Alpha interferon induces long-lasting refractoriness of refractoriness long-lasting induces interferon Alpha

7

, 454–465 (2007). 454–465 , 280 Clin. Cancer Res. Cancer Clin. Cancer Sci. Cancer , 13029–13036 (2005). 13029–13036 ,

12 , 125–135 (2012). 125–135 ,

100

7 , 1821–1831 (2001). 1821–1831 , , 449–456 (2009). 449–456 , advance online publication online advance . il Chem. Biol. J.

276 Mol. ,

60. 59. 58. 57. 56. 55. 54.

Burkart, C. Burkart, London, N., Raveh, B. & Schueler-Furman, O. Druggable protein-protein interactions: mice. knockout Stat2 in response Immune Schindler,C. & by E. Cha, S., Li, C., Park, regulation Transcriptional C.M. Horvath, & R. Mandhana, N., Au-Yeung, GAS- of Identification E.N. Fish, & I. Jurisica, K.L., Marchington, M.M., Brierley, S.V.Kotenko, W. Zou, EMBO Mol. Med. Mol. EMBO IFN- to hypersensitivity by driven environment segments. hot to (2013). spots hot from Immunity pathway. JAK-STAT interferon (2013). the in STAT2 and STAT1 ISGF3-independent. but dependent interferon-sensitive target genes whose transcription is STAT2-dependent (Usp18) Ubp43 complex. receptor in cytokine genes related immune-response (2007). macrophages. of deficient expression the

et al. et

13 et al. et , 795–804 (2000). 795–804 , Microarray analysis reveals that Type I interferon strongly increases strongly interferon I Type that reveals analysis Microarray et al. et Usp18 deficient mammary epithelial cells create an antitumour an create cells epithelial mammary deficient Usp18

5 IFN- , 1035–1050 (2013). 1035–1050 , λ FEBS J. FEBS s mediate antiviral protection through a distinct class II class distinct a through protection antiviral mediate s ice. ipy. e. Commun. Res. Biophys. Biochem. Nat. Immunol. Nat.

273 , 1569–1581 (2006). 1569–1581 , ur Oi. hm Biol. Chem. Opin. Curr.

4 , 69–77 (2003). 69–77 , λ and elevated secretion of Cxcl10. of secretion elevated and s e l c i t r a JAK-STAT

356 17

193–199 , 952–959 , 2 e23931 , 11

© 2017 Nature America, Inc., part of Springer Nature. All rights reserved. tors pCL-10A1 for human cells or Ecopac for mouse cells. Viraltorsforcells.pCL-10A1mouseforhumanEcopacwere orparticles cells cells were cotransfected with plasmids encoding viral vectors and packaging vec with PEI (polyethylenimine) Transfection and lentivirus or retrovirus infection. approved by the UCSD Institutional Animal Care and Use Committee. tested for mycoplasma. All the procedures for wereroutinelycellsconditional U-series SCFand andHeLamedium. IL3 and (ref. from cells Bone-marrow Xiang). R. by previously provided (kindly supplemented with 15% medium FBS and 5% conditional RPMI1640 medium from in WEHI-3B cells grown were cells Ba/F3 FBS. 10% and streptomycin, S. Fujita) were grown in RPMI mediumby previouslyprovidedsupplemented (kindly cells KT-1(ATCC)and THP-1with FBS. 10% glutamine,and penicillin/ weregrown DMEMin supplemented withglutamine, penicillin/streptomycin, by provided(kindlyStark)U6A)and cellsU5A,byG. U4A, U2A, (2fTGH,U1A, previously provided (kindly D. Cheresh), MDA-MB-231 (ATCC), HeLa (ATCC), culture bone-marrowand Cell primary fromcells the construct pDisplay-HaloTag-mTagBFP-IFNAR2. mTagBFP, HaloTag and IFNAR2 were inserted ferredinto by restrictionpDisplay-HaloTag with EcoRI and NotI into pSems-26m. toThe genesgenerate encoding constructs including the Ig N-terminalsequencesthesignal were intoinserted pDisplay (Invitrogen). The IFNAR2 or IFNAR2 length full encoding genes the by followed human STAT2 was cloned into pDisplay (Invitrogen). V. Verkhusha from (obtained BFP (as described in ref. sequence AS (Clontech). An artificial transmembrane domain (TMD) with the extracellular was obtained through A206K mutation within the EGFP sequence of pEGFP-N1MonomericEGFP cells. mammalian expressionin for (Covalys) pSEMS-26m UrbéSylvie from gift (kind constructs cloned into the pCAG and pEBG vectors. also Kotenko.HumanwasIFNAR2 S. by provided kindly was vector pcDEF3 the in IFNAR2human vector.encoding retroviral PlasmidpCX4-bsr the into cloned was Usp18Mouse vectors. MIP and pEGFP-C1, FLAG, 3× pCMV7.1 0000081542) and control were purchased from Dharmacon. vector. shRNA plasmids (pLKO.1 vectors) for mouse Stat2 (TRCN0000081538- (6p-1) vector. Mouse Stat2 was cloned into the pcDNA3.1the MSCV-IRES-Purovector. Human STAT2 clonedwas also into(MIP) pCAGthe and GST retroviral Plasmid construction. plasmid maintenance and incubated for 10 d. mids with the indicated coding sequences were spotted onto selectiveers of mediumovernight for cultures from strains pJ69-4a/pJ69-4 the constructs, Saccharomyces these with cerevisiae analyses two-hybrid For request. upon available are plasmids these of sequencesproteins. Completeactivation-domainfusion trol), pJJH1721 (pGAD-STAT2) and pJJH1720 (pGAD-USP18) for expressioncon (vector pGAD424A of(pGBD-STAT2)and (pGBD-USP18); pJJH1719 and domains:(vectorpGBD-C1control), DNA-binding-domain fusionspJJH1722 hybrid vectors were created, which contained Gal4 DNA-binding and activation Yeast two-hybrid assay. proteins were isolated. described humanofa placental cDNA (complexitylibrary of10 screens two-hybrid yeast in bait as used and pBTM116 from derived plasmid DNA-binding-domain LexA the into cloned were form) C64A-mutated and Yeast two-hybrid screen. ONLINE nature structural & molecular biology molecular & structural nature collected 48 h after transfection and filtered with an 0.45- For cloning of pSEMS-HaloTag-IFNAR2, the gene encoding the HaloTag the encoding gene pSEMS-HaloTag-IFNAR2, the of cloning For Monomeric GFP, human STAT2-mEGFP, and human mEGFP-USP18 fusion pcDNA3.1, the into cloned were cDNAs mutant its and USP18 Human 6 6 ) mice weremice )grown RPMI1640medium in supplemented FBS 20%with 6 1

METHODS . A total of 11 independent clones displaying similarity to STAT2to similarity displaying clones independent 11 of total A . ALAALAALAALAALAALAALA Stat2 −  6 − 4 MEF (kindly provided by A. Garcia-Sastre), and U-series ) extracellularly fused to a HaloTag (Promega) and mTag Human STAT2 and its mutant cDNAs were cloned into To confirm specific interactions, the following yeast two- strains pJ69-4a and pJ69-4 cDNA encoding full-length human USP18 (wild-type κ signal sequence from the pDisplay vector were trans 6 7 . For the retrovirus or lentivirus production, 293T 6 5 sqecs n itaellry ue to fused intracellularly and sequences ) 6 3 ) were cloned into the plasmid vector plasmid the intocloned were ) Usp18 KSSRL (with ALA7 underlined) α were used Transfection was conducted α − Usp18 carrying two-hybrid plas  6 − colonies),previously as mice experiments were µ m sterile filter. For the −  − 6 mice. 2 . Three microlit ∆ 375 without 375 HEK293T Usp18 −  − ------

was purchased from SuSoS AG. HaloTag-O2-amine ligand (HTL) was purchasedlysinegraft-modified withmethoxy-PEG (MW, 2,000g/mol) (PLL-PEG-OMe) PEG3000-COOH, MW of PEG, 3,000 g/mol) was from Rapp Polymere. Poly- was purchased from Sigma-Aldrich. Homobifunctional dicarboxy-PEGSystem (COOH- Diagnostix. Poly- was obtained, as determined by UV/vis spectroscopy. and conjugated with DY 647 as previously described mutant IFN previouslyas described in produced was assays single-molecule and ing Recombinant IFN human IFN antibody was as previously described 10359-H08H). Validation information is available from the vendors. 3F10),Anti-USP18 anti-IFNAR1 (Biogen Idec, AA3), and anti-IFNAR2 F1804),FITC anti-Myc(Sino (SantaBiological, (Sigma, Cruz, sc-40), anti-FLAG anti-hemagglutinin T9026), (HA; (Sigma, Roche anti-tubulin 12CA5 or A11122), Invitrogen,GFP, 9172), anti-STAT2 (Santa Cruz, sc-22816), anti–green fluorescent protein (anti- Signaling, STAT1 (Cell anti- 9167), Signaling, phospho-STAT1 Cell (Tyr701; anti- 3332), Signaling, (Cell anti-JAK1 3331), Signaling, Cell (Tyr1022/1023; Reagents and antibodies. (Beckman Coulter)) in the presence of polybrene (8 retrovirus or lentivirus infection, spin infection (2,000 Soluble fractions were precleared with Protein G–Sepharose at 4 °C for 15 min. studybuffersthiscontained in proteinase andphosphatase inhibitors (Roche). assays. The cell lysates were centrifuged (15,000 r.p.m.) at 4 °C for 5 min. 150 AllmM lysisNaCl, 1 mM EDTA and 0.5% Nonidet P-40 for coimmunoprecipitationTris-HCl, mMcontaining 8.0,bindingbuffer 25 pH in lysed were assays,cells sodium deoxycholate. To analyze immune complexes for coimmunoprecipitation150 mM NaCl, 1 mM EDTA, 1 mM DTT, 0.1% SDS, 1% Nonidet P-40 and 0.5% at 100 °C. Cells were lysed in RIPA buffer composed of 25 mM Tris-HCl, pH 8.0, 2% SDS, 2-mercaptethanol, 10% glycerol, and 1% bromophenol blue) for 5 min detail Immunoblotting. TTCATCCTGAAGCT TCTTTTAGTAGTTGCTCCTGTT GCCAGAGTCCCCAGTC CCTGTTTCGGGATGTC CCCTGGAAGTACTGG TGGATCGTGCCTCG CATCTCGTTTGGCT TTCGTGACTTG Biosystems) and CFX96 thermal cycler (Bio-Rad). were subjected to qRT–PCR with a KAPA SYBR FAST universal qPCR kit (Kapa transcribed with qScript (Quanta Biosciences), and the resulting cDNAFisher Scientific). templatesFor qRT–PCR analyses, equal amounts of RNA were reverse- RNA isolation and qRT–PCR analysis. as previously described mer (PLL-PEG derivatives, PLL-PEG-HTL and PLL-PEG-RGD) was carried out ethyl-carbodiimide hydrochloride (EDC) were purchased from Sigma-Aldrich. N from Promega. Dimethylformamide (DMF), , N The RGD peptide Ac-CGRGDS-COOHpeptidecustomsynthesizedCoringRGDwasby The IFN human Recombinant RT- RT- RT- RT- RT- RT- RT- RT- The primer sequences were as follows: Synthesis of functionalized poly- ′ diorplabdiie DC, and (DIC), -diisopropylcarbodiimide 7 0 Igtp GBP1 Cxcl9 Ifit1 Gbp1 IFIT1 Irf9 Isg15 . All samples were denatured in 1× sample buffer (50 mM Tris-HCl, pH 6.8, -Fw, GCCTTTGCCCCATCCCCATCTC; RT-GCCTTTGCCCCATCCCCATCTC;-Fw, -Fw; CGCCTCATCAGCCCGTGGTCTAA; RT- -Fw; TGGCGACCTGGGGCAACTGTG; -Fw; RT- -Fw, GACTAACTCCATGACGGTG;-Fw,RT- α α -Fw,GGAGGCCATTGAGGTCTTCAT; RT- -Fw, TCCTTTTGGGCATCATCTTCC; RT- -Fw, CCAGTTGCTGAAAGAGCAAGAGA; RT- -Fw,AAGGCAGGCTGTCCGCTTA;RT- 2-M148A fused to an N-terminal ybbR tag were produced in , mouse IFN α Immunoblotting was performed as previously described in previouslydescribed asImmunoblotting performed was 2 and the mutant IFN 6 4 l 9 3 -lysine (PLL) hydrobromide (MW, 15,000–30,000 g/mol) . . For. site-specific fluorescent labeling, IFN Commercial antibodies used were: anti-phospho-JAK1 β , and human IFN β was provided from Biogen Idec. Recombinant Idec. Biogen from provided was l -lysine-graft-(polyethylene glycol) copoly 6 0 RNA was extracted with TRIzol (Thermo . α 2-M148A used in cell micropattern N λ N were purchased from Peprotech. -ethyldiisopropylamine (DIPEA), -(3-dimethylaminopropyl)- Escherichia coliEscherichia 6 8 µ . A degree of labeling >90% g g/ml) was performed. IFIT1 , 3 h, 30 °C; Allegra X12R Isg15 doi: Cxcl9 Ifit1 Gbp1 Irf9 Igtp -Rev, AACTGGTC -Rev, 10.1038/nsmb.3378 -Rev,TCCTGTCC -Rev, CCCCTGG -Rev, GBP1 -Rev,TGGGCTG -Rev, TTTGTAG -Rev, TGCCATT -Rev,CAAAGG and purified purified and -Rev, TCCC α 2 and2 the E. coli N l ′ - - - -

© 2017 Nature America, Inc., part of Springer Nature. All rights reserved. the bait proteins was calculated as ROIs by using the ‘Measure’ function in ImageJ. The fluorescence contrast C of fluorescence intensities of the bait and prey proteins obtained from rectangular terned proteins inside versus outside the pattern was calculated from the average adjustmentbrightnessofcontrast and fluorescence levels.Thecontrast patof as well rotation,as and cropping,comprises processingImage scaling, (NIH). Data analysis. cycle time of 1–5 s with a 1-mW 488-nm or 561-nm laser excitation. for 5 s with a laser power of 7.5 mW, and this was followed by acquisition with a tion. A circular area with a diameter of 8 with a numerical aperture of 1.49 (UAPON 150×/1.49, Olympus) for TIR excita formed at 37 °C in an incubation chamber (Olympus) with a 150× TIRF objective Olympus Xcellence rt Version 1.2. software acquisition the with performed was acquisition Data cross-talk. tral spec avoid to used were Chroma) 685/40, HC BrightLine and AHF; 600/30, EmitterHQAHF;520/35, BrightLineHC AHF; 438/24,(BrightLine filters HC dichroic beamsplitters (480 dcxr, 565 dcxr, and 640 dcxr, Chroma) and emission ticolorexperiments,QuadView a (QV2, Photometrics) equipped suitablewith mul For 446/523/500/677). HC (BrightLine filter quad-band-pass a through detected was fluorescence the and AHF), R405/488/561/635, (HC-BS mirror aperturenumerical of 1.45 a (UAPON with 60×/1.45, Olympus) objective was used for 150× TIRF excitation. a or Olympus) 60×/1.49, (UAPON 1.49 of aperturenumerical a withobjective 60× A mW). (140 nm 640 and mW) (150 from Hamamatsu) back- as a well as MITICO), lasers cell^TIRF at illuminated electron-multiplied405 (Olympus (EM) CCD cameranm (C9100-13, 512 × 512 condenser pixel(100 mW), TIRF 488 four-line nm (150 a mW), with 561 nm (TIRFM) was performed with an inverted microscope (Olympus imaging. IX81) equipped Fluorescence cently labeled interferon coupled to ATTO655 ( micropatternedIFNAR, cells were incubated in the presence of 10 nM fluores streptomycincontainingandmedium with penicillin h (PAA). Foroflabeling After 24–36 h, cells were plated on chemically modified cover glasses for 15–20 were transfected via calcium phosphate precipitation, as previously described dishes to a density of approximately 50% confluence. One day after seeding, cells essentialaminoacids.For transfection, werecells platedculturecell 60-mm in MEM supplemented with 10% FCS (MEM/FCS), 1% HEPES buffer and 1% non then rinsed in Milli-Q water and dried under N 1min theto uncoated backfill area and to allow cell adhesion. The surface was 0.002 mg/ml PLL-g-PEG-RGD and 0.1 mg/ml PLL-PEG-MeO in PBS buffer for ofmixture a coverslideswithincubated werestamps,the the removalof After patterns. HTL generate to min 10 for coverslides glass the onto placed were transfer,stamps PLL-g-PEG-HTL For min. 10 for buffer PBS in g-PEG-HTL plasma cleaner for 10 min, and the stamp was then inked with 0.5 mg/ml PLL- custom-designed beam mask (NB Technologies). 10 of ing 5 of width a with lines of array master,an containing silicon The overnight. °C 80 at master silicon a to applied and ratio 10:1 a in Chemicals) agent curing (Dow with mixed elastomer (Sylgard basic Dow Chemicals) 184, from generated were stamps (PDMS) Poly(dimethylsiloxane) printing. tact micropatterning. Cell tification, signals were detected with a LI-COR Odyssey system. images for immunoblots are shown in performed two to four times, and representative blots are presented. Uncropped were immunoprecipitated with anti-FLAG M2-agarose (Sigma). All assays were being washed three times, were eluted by boiling for 5 bodies.min. ImmunocomplexesFLAG-tagged wereproteins adsorbed to the protein G–Sepharose and, after Precleared cell lysates were immunoprecipitated for 1–4 h with the indicated anti doi: Fluorescence recovery after photobleaching (FRAP) experiments were per wereexperiments photobleaching (FRAP)after Fluorescencerecovery The excitation beam was reflected into the objective by a quad-band dichroic CO 5% and °C 37 at cultivated were micropatterning,cells cellular For a in cleaned were microscopy fluorescence for coverslides glass Standard 10.1038/nsmb.3378 µ m and a depth of 3 3 of depth a and m Image analysis and image processing were performed with ImageJ Micropatterned were fabricated surfaces by microcon Total internal reflection fluorescence microscopy microscopy fluorescence reflection internal Total C bait µ = m, was generated by photolithography with a photolithography with by generated was m, I I bait I I Supplementary Data Set 1 bait , , in µ , m was bleached by 405-nm excitation − in − bait bg 2 AT655 . ou t IFN α 2). . For the quan µ m, a spac a m, 2 in 7 1 ------.

over time. FRAP curves were obtained with the following equation: area but outside the patterned area were chosen to obtainbleached areaintensity of thevalues pattern per andpixel a rectangular or circular ROI within the bleached individual points. (opensquares), and whiskers (1.5×interquartile range). Outliers are plotted as mean (line), median limits), (box quartiles third and first the of distribution mean pixel intensities from selected areas inside and outside the pattern, as: contrast of the prey proteins, teins and the maximal enrichment that can be achieved by the prey proteins. fromThe an ROI outside the cells. pattern, and pattern, where optical optical filters. and lasers standard FACSCanto BD with a instrument on measured was MFI FITC-IFN of concentration saturating a with incubated were lines cell indicated the experiments, For affinity binding experiments. affinity binding for used was instructions. ~4.1 of (F/P) manufacturer’s ratio molar optimal the an with conjugate A per 82-00-01), (KPL, Kit FITC-Labeling CYT-205) was labeled with fluorescein isothiocyanate (FITC) with a SureLINK IFN FITC labeling and binding affinity assay. tracking algorithm (MTT) individual IFN twice,and a representative blot is presented. Localization and quantification of RGD,previouslywithfunctionalized as described coverslips were coated with a poly- adsorbeddye specifically moleculesduring single-molecule experiments, glass photobleachingminimizeviologen) to (Roche Applied Science), 5% (w/v) glucose, 1 oxygenscavenger (0.5 mg ml with complemented medium with out carried were experiments binding All previously. described as imaging, TIRF through min 10 of timeincubation an nM 2 ofpresence the in performed werements Single-molecule ligand binding assay. fitted with a simple monoexponential function malized to the original intensity. The recovery of the fluorescence intensity was was assigned as a reference, and the sequential intensities in this area were nor ments.Forrectangular a purpose,not-bleached thisROIa in patterned region was implemented to correct background photobleaching during FRAP experi pattern as ( the outsiderecovery the ofsubtraction the byobtained waspattern the inside was determined as ( cells was consistent both inside and outside the pattern, and its effect on FRAP intensityliving Freeall in subtractedvalues. cytoplasmicbydiffusionwas and For analysis of FRAP experiments, a rectangular region of interest within the For quantitative analysis, data were visualized in box plots indicating the data Because The offset intensityoffsetThe ( I bait,in I bait,out F C I ROI,inside denotes the mean pixel intensities from selected areas inside the inside areas selected fromintensities pixel mean the denotes bg prey α denotes the mean pixel intensities from selected areas outside the denotes the background intensity from the glass surface obtained f 2 M148A molecules were determined by using the multiple target = varies in proportion to ( F F – RO ROI,outside F i I offset F , nature structural & molecular biology molecular & structural nature nsid offset     7 6 ( C ) – (     , as previously described C F o e C −1 ) was determinedwasfrom) anROI outside cellof the ( prey – re C prey F − bait glucose oxidase (Sigma), 0.04 mg ml p f re F prey F ) ( , F offset F , was obtained from the background-corrected p f ROI,outside l reflects the relative enrichment of the bait pro = ) ( re , re -lysine-graft-(polyethylene glycol) copolymer ffs F , f bleach I I re re corr et I I ). Thus the unbiased fluorescence recovery prey − f bleach prey ) 7 Single-molecule ligand binding experi − F 4 − C = offset . To. backgroundnonminimizefrom , F ou , ( bait – F in − C offset F C RO b t − F bait prey µ − , offset offset − C F M ascorbic acid and 1 Recombinant IFN 72 o I offset prey bg , , DY647 7 ). A normalization factor of utside g 3 7 ) was corrected to: . 5     . The assay was performedassay was The . ) 2     2 IFN . − F α offset 2 M148A and after and M148A 2 ) α α 2b, and FITC FITC and 2b, 2b (ProSpec, µ −1 M methyl catalase - - - - -

© 2017 Nature America, Inc., part of Springer Nature. All rights reserved. 61. available from corresponding authors upon reasonable request. Supplementary Data Set 1 Data availability. A software.MATLAB in calculated were samples two of values contrast the for statistically analyzed with two-sample Kolmogorov–Smirnov tests. The were values, contrast the by determined as micropatterningexperiments, cell different bait and prey proteins in the single-molecule ligand binding assay and between interactions the in Changes significant. statistically be to considered with two-tailed Student’s analyses. Statistical MIP-STAT2 CC/DB 3A) or peptide (TATmeans or USP18 of aa the302–313 percentagesTAT)-treated of cells. apoptoticFACSCanto withcells standard from lasers threeand optical independently filters.the Themanufacturer’s results infectedin the paperprotocol. are(MIP the Cells orwere analyzed through V-APCflow cytometry and 7-AAD on with a BD an annexin V apoptosis detection kit (BD), according Apoptosisassay.to in 2% FBS medium. or USP18 aa 302–313–linker (YELFAVIAHVGMGGGS)–TAT (Eton Peptides.Bioscience) is available on the manufacturers’ websites. antibody secondary (Invitrogen A10543). Validation of commercial antibodies Biological, 10359-H08H). For the detection of IFNAR1, we used anti-mouse PE incubated with mouse anti-IFNAR1 (ref. analysis. expression Receptor nature structural & molecular biology molecular & structural nature P

oln, F. Colland, Genome Res. Genome value <0.05 was considered to be statistically significant. THP-1 or KT-1 cells were treated with 10 mM TAT (GRKKRRQRRRPQ) t al. et

14 Apoptosis measuredwas basisthestainingonof withannexin Source data for all immunoblots in this study are available in , 1324–1332 (2004). 1324–1332 , ucinl rtois apn o a ua sgaig pathway. signaling human a of mapping proteomics Functional When applicable, statistical significance was determined determined was significance statistical applicable,When t tests in statcel2 software (OMS). A . Other data supporting our findings in the study are Infected U6A cell lines were trypsinized and trypsinized were lines cell U6A Infected 7 7) or IFNAR2-FITC antibodies (Sino P value <0.05 was P values

74. 73. 72. 71. 70. 69. 68. 67. 66. 65. 64. 63. 62. 77. 76. 75.

Vogelsang,J. fitting. and proper binding: of analysis FRAP McNally,J.G. & B.L. Sprague, binding of Analysis J.G. McNally, & D.A. Stavreva, R.L., Pego, B.L., Sprague, B. Muster, K. Arimoto, Wedeking, T. S. Waichman, O. Boussif, K.J. Ritchie, O.M. Subach, of organization Spatial J. Piehler, & D. Paterok, O., Beutel, F.,Roder,O., Birkholz, S. Urbé, designed strain host a and libraries Genomic E.A. Craig, & P.,J. Halladay,James, Goldman, L.A. tracing multiple-target Dynamic D. Marguet, & H. Rigneault, N., Bertaux, A., Sergé, poly- RGD-grafted J.A. Hubbell, & J. Vörös, S., VandeVondele, blinking of fluorescent dyes. fluorescent of blinking Biol. Cell (2004). reactions by fluorescence recovery after photobleaching. cells. life in distribution patchy and dimerization receptor activation. factor growth epidermal -independent and dependent cells. living of membrane plasma the in reaction. transfer enzymatic (1995). in culture and injury. cell Biol. Chem. 135 membranes. polymer-supported micropatterned in phases lipid 23 functions. microtubule-associated and centrosome- of regulator a as (1996). (1999). analysis. functional and localization epitope (2008). membranes. cell of cartography spatiotemporal probe to while adsorption protein non-specific block adhesion. cell promoting copolymers glycol) (polyethylene (2008). o hgl efcet w-yrd eeto inyeast. selection two-hybrid efficient highly for , 1095–1103 (2012). 1095–1103 , , 1189–1192 (2013). 1189–1192 ,

t al. et 15 Mol. Cell. Biol. Cell. Mol. Genes Dev. Genes t al. et

et al. et et al. et 15 , 84–91 (2005). 84–91 , et al. et al. et et al. et in vivo et al. et et al. Systematic survey of deubiquitinase localization identifies USP21 identifies localization deubiquitinase of survey Systematic t al. et , 1116–1124 (2008). 1116–1124 , eprtr can opee i dnmc iohnra ipa a display mitochondria dynamic in complexes chain Respiratory A versatile vector for gene and oligonucleotide transfer into cells into transfer oligonucleotide and gene for vector versatile A Plakophilin-2 promotes tumor development by enhancing ligand- enhancing by development tumor promotes Plakophilin-2 Spatiotemporally controlled reorganization of signaling complexes Dysregulation of protein modification by ISG15 results in brain in results ISG15 by modification protein of Dysregulation A reducing and oxidizing system minimizes photobleaching and photobleaching minimizes system oxidizing and reducing A Characterization of antihuman IFNAR-1 monoclonal antibodies: Conversion of red fluorescent protein into a bright blue probe. blue bright a into protein fluorescent red of Conversion : polyethylenimine. ucinl moiiain n ptenn o poen b an by proteins of patterning and immobilization Functional

16 Biotechnol. Bioeng. Biotechnol. , 2207–2212 (2002). 2207–2212 ,

34 Anal. Chem. Anal. , 3843–3854 (2014). 3843–3854 , ne. hm It En Engl. Edn Int. Chem. Angew. PLoS One PLoS Proc. Natl. Acad. Sci. USA

Small 82

5 , 1478–1485 (2010). 1478–1485 , , e11910 (2010). e11910 , J Interferon Cytokine Res. Cytokine Interferon J

82

11 , 784–790 (2003). 784–790 , , 5912–5918 (2015). 5912–5918 , Genetics Biophys. J. Nat. Methods Nat. doi: 10.1038/nsmb.3378

J. Am. Chem. Soc. Chem. Am. J.

144 47

92 86 5465–5469 , 1425–1436 , Mol. Biol. Cell Biol. Mol. L , 7297–7301 , 3473–3495

-lysine-graft- 5

19 , 687–694 , , 15–26 , Trends